SNP (Single Nucleotide Polymorphism) molecular marker related to length of fourth backboard of bee

Abstract

The invention relates to the technical field of bee breeding, in particular to an SNP (Single Nucleotide Polymorphism) molecular marker related to the fourth backboard length of bees. The SNP molecular marker comprises a nucleotide sequence as shown in SEQ ID NO.1, the 301th nucleotide sequence is mutated, and the mutation type is A or G. The SNP molecular marker has the advantages that the SNP molecular marker is high in molecular weight and high in molecular weight; the SNP molecular marker related to the fourth backboard length character of the bees is obtained through screening, the mutation type of the SNP molecular marker can reflect the fourth backboard length character of the bees, and the honey collecting capacity of the bees is indirectly reflected. Therefore, the SNP molecular marker can be used for improving bee varieties.

Description

Technical Field

[0001] The present invention relates to the technical field of bee breeding, and in particular to a SNP molecular marker associated with the length of the fourth dorsal plate of a bee. Background Art

[0002] Chinese honey bee ( Apis cerana The Chinese honey bee (Apis cerana cerana) is a relatively small bee, mostly dark brown with yellow-brown rings. It is a key member of the bee family. Apis cerana cerana ("Chinese honey bee") has a long history of survival and is closely connected to the natural environment and ecosystem.

[0003] Effective evaluation of the morphological traits of Chinese honeybees is a crucial tool for exploring, protecting, identifying, and utilizing bee species resources. It is also essential for evaluating bee species performance in beekeeping. The length of the fourth dorsal plate, located on the bee's abdomen, is a key morphological trait in honeybees. Its length, to a certain extent, reflects the size of the honey sac, the organ where bees store nectar. Larger sacs can hold more nectar. Therefore, the length of the fourth dorsal plate indirectly reflects the honey bee's nectar-collecting ability. Developing molecular markers related to this trait will facilitate the breeding of high-quality bee species. Summary of the Invention

[0004] In order to solve the problems existing in the prior art, the present invention provides a SNP molecular marker associated with the length of the fourth dorsal plate of honey bees.

[0005] In a first aspect, the present invention provides a SNP molecular marker associated with the length of the fourth dorsal plate of honey bees, wherein the SNP molecular marker comprises a nucleotide sequence as shown in SEQ ID NO.1, wherein the nucleotide sequence has a mutation at position 301, and the mutation type is A or G.

[0006] The nucleotide sequence shown in SEQ ID NO.1: .

[0007] In a second aspect, the present invention provides a KASP primer combination, comprising the following primers: F1: CCTCTCTCTCTCTCTGTGCTTCA, F2: CCTCTCTCTCTCTCTGTGCTTCG, R: TTTCGATTCGACGTTCGTAAAAC.

[0008] Furthermore, F1 and F2 in the KASP primer combination carry different fluorescent labels, including one or more of FAM, TET, HEX, ROX, Cy3, Cy5, Alexa Fluor, SYBR Green, DAPI, FITC or Texas Red.

[0009] For example, GAAGGTGACCAAGTTCATGCT (FAM) was linked to the 5' end of F1, and GAAGGTCGGAGTCAACGGATT (HEX) was linked to the 5' end of F2.

[0010] In a third aspect, the present invention provides a kit comprising the aforementioned SNP molecular marker or the aforementioned KASP primer combination.

[0011] In a fourth aspect, the present invention provides use of the aforementioned SNP molecular marker, or the aforementioned KASP primer combination, or the aforementioned kit in identifying the fourth dorsal plate length trait of honey bees.

[0012] The present invention further provides the use of the aforementioned SNP molecular marker, or the aforementioned KASP primer combination, or the aforementioned kit in any one or more of the following: (1) Cultivating genetically modified bee species, (2) Improve the honey-collecting ability of bees, (3) Improvement of honey bee germplasm resources.

[0013] Furthermore, the aforementioned applications include: The mutation type of the aforementioned SNP molecular marker of the bee to be tested is detected, and the fourth dorsal plate length trait of the bee to be tested is determined according to the detection result.

[0014] Furthermore, the detection method includes: gene sequencing, or PCR detection; the PCR detection adopts the aforementioned KASP primer combination, or the aforementioned kit for detection.

[0015] Furthermore, bees with a mutation type test result of A / G have a shorter fourth dorsal plate length than bees with a test result of G / G.

[0016] Furthermore, the bee is an oriental honey bee, preferably a cerana cerana cerana cerana.

[0017] The present invention has the following beneficial effects: The present invention, through genome-wide association analysis of Apis cerana cerana, has identified a single nucleotide polymorphism (SNP) molecular marker with mutation types A or G. This SNP molecular marker is associated with the length of the fourth dorsal scutellum of honeybees, which can reflect the honey bee's nectar-collecting ability. Therefore, the SNP molecular marker provided by the present invention can be used to breed honeybee varieties with different fourth dorsal scutellum lengths, thereby improving honeybee varieties. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] In order to more clearly illustrate the technical solutions in the present invention or the prior art, a brief introduction is given below to the drawings required for use in the embodiments or the description of the prior art. Obviously, the drawings described below are some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0019] Figure 1 This is a comparison chart of the fourth dorsal plate length trait of individuals with different genotypes at the Ch8_25373310 locus provided in Example 2 of the present invention. DETAILED DESCRIPTION

[0020] To make the objectives, technical solutions, and advantages of the present invention more clear, the technical solutions of the present invention will be clearly and completely described below in conjunction with the accompanying drawings. Obviously, the embodiments described are only some of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative efforts shall fall within the scope of protection of the present invention.

[0021] Unless otherwise specified, the experimental methods involved in the following examples are all conventional methods in the art. For example, reference can be made to experimental manuals in the art, or the conditions recommended by the manufacturer's instructions.

[0022] Unless otherwise specified, the experimental materials and reagents involved in the following examples can be obtained from commercial sources.

[0023] Example 1 The present invention provides a SNP site, which is as follows: 1. The present invention measured the length of the fourth dorsal plate based on samples from 110 colonies of Apis cerana cerana. Genomic DNA was extracted from the thorax tissue of the dissected worker bees, and a library was constructed using the Truseq Nano DNA HT Kit (Illumina, USA). The DNA was randomly fragmented into 350 bp fragments. DNA libraries were obtained through end-repair, PloyA tailing, sequencing adapter addition, amplification, and purification. Insert size was quality-checked using an Agilent 2100, and the effective concentration of the library was accurately quantified using qPCR. Once the quality met the standards, DNA library construction was completed.

[0024] 2. Genome Sequencing, Alignment, and SNP Identification: After successful sample library construction, genome sequencing was performed on the Illumina HiseqPE150 platform (Illumina, USA). Low-quality reads were removed during sequencing to ensure quality [quality control criteria: reads containing more than 10% unknown nucleotides, reads containing adapter sequences, and reads with low-quality (phred quality < 5) bases exceeding 50% of the sequence length]. Finally, high-quality paired-end clean reads of at least 4.5G were generated for each honey bee sample, with Q20 and Q30 values ​​exceeding 90% and 85%, respectively.

[0025] 3. High-quality paired-end clean reads were aligned to the reference genome, Apis cerana (Genbank accession number: PRJNA738447), using BWA 0.7.8 software. Alignment results were deduplicated using SAMTOOLS 1.15 software. The average alignment rate for the population samples was maintained at over 95%, and the average sequencing depth across the genome was over 20X.

[0026] 4. A Bayesian model in SAMTOOLS 1.15 software was used to detect cluster SNPs. High-quality SNPs were screened based on quality control criteria (removing SNPs with a sequencing error rate >1% (Q20 quality control), removing SNPs with a base spacing of <5 between adjacent SNPs, and removing SNPs with a coverage depth exceeding 1 / 3 to 5 times the average). Detected SNPs were annotated using ANNOVAR 20130520 software to identify exons, introns, alternative splice sites, upstream and downstream regions, and intergenic regions, and to distinguish between synonymous and nonsynonymous SNPs.

[0027] 5. Genome-wide association analysis: Genome-wide association studies (GWAS) were conducted using mrMLM 1.3 software to clarify the association between the fourth dorsal plate length trait and SNPs. The SNP quality control standard was MAF>5%, and the multilocus random mixed linear model was selected as the model.

[0028] 6. The following SNP sites associated with the length of the fourth back plate were obtained Table 1 SNPs associated with the length of the fourth dorsal plate

[0029] Among these SNP sites, experimental verification shows that Chr8_25373310 is closely related to the length of the fourth dorsal plate of honey bees. It is located at position 25373310 on chromosome 8 of honey bees, and the mutation type is A or G, that is, there are three genotypes: AA, AG and GG.

[0030] Example 2 1. The present invention selected 107 Chinese honey bee samples to carry out verification work to verify the relationship between the SNP site and the length of the fourth dorsal plate of the honey bee involved in Example 1. Specifically, sequencing was performed on these 107 Chinese honey bees, and the fourth dorsal plate length of the 107 honey bees was measured using a microscopic measurement system to obtain the fourth dorsal plate length data and SNP data of the 107 honey bees; the honey bees were grouped according to the genotype type at the SNP site, and the fourth dorsal plate length data of different groups were analyzed for significance of difference using SPSS 16.0 software to compare whether there were differences in the fourth dorsal plate length among different genotypes.

[0031] The results are shown in Tables 1, 2 and Figure 1 As shown, Figure 1 It can be seen that 43 Chinese bees showed A / A genotype, 47 Chinese bees showed A / G genotype, and 17 Chinese bees showed G / G genotype. Through LSD and Duncan data analysis (Table 1 and Table 2), the G / G genotype (genotype 1) and the A / G genotype (genotype 2) showed significant differences ( P <0.05), the length of the fourth dorsal plate of the A / G genotype Chinese honey bee was significantly shorter than that of the G / G genotype Chinese honey bee.

[0032] Table 1 Comparison of the length of the fourth dorsal plate in individuals with different genotypes at Chr8_25373310 locus in the Chinese honey bee

[0033] * express P <0.05, the difference is significant.

[0034] Table 2 Comparison of the length of the fourth dorsal plate in individuals with different genotypes at Ch8_25373310 locus in the Chinese honey bee

[0035] 2. The present invention further develops a KASP primer combination for the SNP molecular marker, as follows: F1: GAAGGTGACCAAGTTCATGCTCCTCTCTCTCTCTGTGCTTCA, F2: GAAGGTCGGAGTCAACGGATTCCTCTCTCTCTCTCTGTGCTTCG, R: TTTCGATTCGACGTTCGTAAAAC.

[0036] Among them, F1 carries FAM and F2 carries HEX. In actual situations, the KASP primer combination can be used to detect the sample to be tested. At the same time, the detection can be carried out using existing fluorescence equipment in the existing technology. The detection results of the FAM and HEX fluorescence channels can be used to determine whether the genotype of the sample to be tested is G / G (HEX fluorescence signal exceeds the threshold), A / G (both FAM and HEX fluorescence signals exceed the threshold), or A / A (FAM fluorescence signal exceeds the threshold).

[0037] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or make equivalent replacements for some of the technical features therein. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the various embodiments of the present invention.

Claims

1. A SNP molecular marker associated with the length of the fourth dorsal plate of honey bees, characterized in that: The SNP molecular marker includes a nucleotide sequence as shown in SEQ ID NO. 1, wherein the nucleotide sequence has a mutation at position 301, and the mutation type is A or G.

2. A KASP primer combination, characterized in that: The KASP primer combination includes the following primers: F1: CCTCTCTCTCTCTCTGTGCTTCA, F2: CCTCTCTCTCTCTCTGTGCTTCG, R: TTTCGATTCGACGTTCGTAAAAC.

3. A kit, characterized in that The kit comprises the SNP molecular marker according to claim 1 or the KASP primer combination according to claim 2.

4. Use of the SNP molecular marker according to claim 1, or the KASP primer combination according to claim 2, or the kit according to claim 3 in identifying the fourth dorsal plate length trait of honey bees.

5. Use of the SNP molecular marker according to claim 1, or the KASP primer combination according to claim 2, or the kit according to claim 3 in any one or more of the following: (1) Cultivate genetically modified bee varieties, (2) Improve the honey-collecting ability of bees, (3) Improvement of honey bee germplasm resources.

6. The use according to claim 4, characterized in that The applications include: Detect the mutation type of the SNP molecular marker of the bee to be tested according to claim 1, and determine the fourth dorsal plate length trait of the bee to be tested based on the detection result.

7. The use according to claim 6, characterized in that The detection method includes: gene sequencing, or PCR detection; the PCR detection adopts the KASP primer combination described in claim 2, or the kit described in claim 3 for detection.

8. The use according to claim 6 or 7, characterized in that Bees with the mutation type test result of A / G have a shorter fourth dorsal plate length than bees with the test result of G / G.

9. The use according to any one of claims 4 to 8, characterized in that The honey bee is an oriental honey bee, preferably a cerana ....

Images