Small interfering RNA targeting CFB and application thereof

Abstract

The present disclosure relates to isolated oligonucleotides comprising duplex regions targeting human CFB mRNA, and delivery systems, kits, and compositions comprising the same, and methods of using the same for inhibiting or down-regulating CFB gene expression.

Description

Related applications

[0001] This application claims priority to and the benefit of U.S. Provisional Application No. 63 / 433,735, filed December 19, 2022, the contents of which are incorporated herein by reference in their entirety. References to electronic sequence listings

[0002] The contents of the electronic sequence listing (SANB_018_001WO_SeqList_ST26.xml; size: 454,399 bytes; and creation date: December 15, 2023) are incorporated herein by reference in its entirety. background

[0003] The complement system is part of the innate immune system and is composed of more than one soluble protein present in the serum as an inactive precursor. When activated, these complement components form an amplification cascade that leads to the production of biologically active effector compounds. This cascade plays a central role in maintaining cell integrity and tissue homeostasis by removing damaged or dead cells, immune complexes, and cell debris. It also plays a role in immunomodulation, metabolism, inflammation, and host defense against pathogens. The complement system has three activation pathways, all of which revolve around the proteolytic cleavage of C3, a central component that serves as a convergence point for downstream effector functions. During cleavage, the active subunit Bb of complement factor B combines with the complement factor 3b component of C3 to form the alternative pathway C3 or C5 convertase. The central role of complement factor B (CFB) in the alternative complement cascade function makes it an ideal target for therapeutic regulation of complement.

[0004] Defects or loss-of-function mutations in common complement components can lead to dysregulation of normal complement system function and potentially overproduction of complement components. Excessive production and / or dysregulation are associated with an increasing number of diseases, such as, but not limited to, type 2 diabetes, cardiovascular, neurological, hematological, ocular, renal, and autoimmune diseases and / or disorders, and infections. Therefore, there is a need for therapies for subjects suffering from diseases, disorders, and symptoms associated with elevated levels of complement CFB expression. The present disclosure provides compositions targeting CFB and methods for reducing CFB expression for treating subjects suffering from complement-related diseases, disorders, or symptoms. Overview

[0005] The present disclosure provides isolated oligonucleotides comprising a sense strand and an antisense strand, wherein: the sense strand comprises a nucleotide sequence substantially identical to a region of 19-25 nucleotides comprised between any one of the following nucleotide positions from the 5' end of the human CFB mRNA sequence according to SEQ ID NO: 1: a) 493 to 534; b) 991 to 1054; c) 1384 to 1500; d) 1606 to 1686; e) 1821 to 1881; f) 2116 to 2307; and g) 2382 to 2468, and the antisense strand is substantially complementary to the sense strand such that the sense strand and antisense strand together form a double-stranded region.

[0006] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a nucleotide sequence that is at least 70%, at least 80%, at least 90%, at least 95%, or at least 99% identical to a region of 19-25 nucleotides contained between any one of the following nucleotide positions from the 5' end of the human CFB mRNA sequence according to SEQ ID NO: 1: a) 493 to 534; b) 991 to 1054; c) 1384 to 1500; d) 1606 to 1686; e) 1821 to 1881; f) 2116 to 2307; and g) 2382 to 2468.

[0007] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a nucleotide sequence identical to a region of 19-25 nucleotides contained between any one of the following nucleotide positions from the 5' end of the human CFB mRNA sequence according to SEQ ID NO: 1: a) 493 to 534; b) 991 to 1054; c) 1384 to 1500; d) 1606 to 1686; e) 1821 to 1881; f) 2116 to 2307; and g) 2382 to 2468.

[0008] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a nucleotide sequence substantially identical to a region selected from between any one of the following nucleotide positions from the 5' end of the human CFB mRNA sequence according to SEQ ID NO: 1: a) 503 to 523 and b) 2190 to 2210.

[0009] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a nucleotide sequence that is at least 70%, at least 80%, at least 90%, at least 95%, or at least 99% identical to a region selected from any one of the following nucleotide positions from the 5' end of the human CFB mRNA sequence according to SEQ ID NO: 1: a) 503 to 523 and b) 2190 to 2210.

[0010] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a nucleotide sequence identical to a region selected from between any one of the following nucleotide positions from the 5' end of the human CFB mRNA sequence according to SEQ ID NO: 1: a) 503 to 523 and b) 2190 to 2210.

[0011] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a nucleotide sequence substantially identical to a region selected from between any one of the following nucleotide positions from the 5' end of the human CFB mRNA sequence according to SEQ ID NO: 1: a) 493 to 534; b) 991 to 1054; c) 1384 to 1500; d) 1666 to 1686; e) 1821 to 1881; f) 2116 to 2136; g) 2232 to 2307, and h) 2394 to 2468.

[0012] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a nucleotide sequence that is at least 70%, at least 80%, at least 90%, at least 95%, or at least 99% identical to a region selected from any one of the following nucleotide positions from the 5' end of the human CFB mRNA sequence according to SEQ ID NO: 1: a) 493 to 534; b) 991 to 1054; c) 1384 to 1500; d) 1666 to 1686; e) 1821 to 1881; f) 2116 to 2136; g) 2232 to 2307, and h) 2394 to 2468.

[0013] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a nucleotide sequence identical to a region selected from any one of the following nucleotide positions from the 5' end of the human CFB mRNA sequence according to SEQ ID NO: 1: a) 493 to 534; b) 991 to 1054; c) 1384 to 1500; d) 1666 to 1686; e) 1821 to 1881; f) 2116 to 2136; g) 2232 to 2307, and h) 2394 to 2468.

[0014] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a nucleotide sequence substantially identical to a region selected from between any one of the following nucleotide positions from the 5' end of the human CFB mRNA sequence according to SEQ ID NO: 1: a) 995 to 1019; b) 1606 to 1626; c) 1860 to 1880; and d) 2382 to 2402.

[0015] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a nucleotide sequence that is at least 70%, at least 80%, at least 90%, at least 95%, or at least 99% identical to a region selected from any one of the following nucleotide positions from the 5' end of the human CFB mRNA sequence according to SEQ ID NO: 1: a) 995 to 1019; b) 1606 to 1626; c) 1860 to 1880; and d) 2382 to 2402.

[0016] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a nucleotide sequence identical to a region selected from between any one of the following nucleotide positions from the 5' end of the human CFB mRNA sequence according to SEQ ID NO: 1: a) 995 to 1019; b) 1606 to 1626; c) 1860 to 1880; and d) 2382 to 2402.

[0017] In some embodiments of the isolated oligonucleotide of the present disclosure, the isolated oligonucleotide is capable of inducing degradation of CFB mRNA.

[0018] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand is a single-stranded RNA molecule. In some embodiments of the isolated oligonucleotides of the present disclosure, the antisense strand is a single-stranded RNA molecule. In some embodiments of the isolated oligonucleotides of the present disclosure, both the sense strand and the antisense strand are single-stranded RNA molecules.

[0019] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand of the single-stranded RNA molecule comprises a 3' overhang. In some embodiments, the sense strand of the single-stranded RNA molecule comprises a 3' overhang comprising at least one nucleotide. In some embodiments, the sense strand of the single-stranded RNA molecule comprises a 3' overhang comprising two nucleotides.

[0020] In some embodiments of the isolated oligonucleotides of the present disclosure, the single-stranded RNA molecule of the antisense strand comprises a 3' overhang. In some embodiments, the 3' overhang of the single-stranded RNA molecule of the antisense strand comprises at least one nucleotide. In some embodiments, the 3' overhang of the single-stranded RNA molecule of the antisense strand comprises two nucleotides.

[0021] In some embodiments of the isolated oligonucleotides of the present disclosure, the 3' overhang comprises any of thymidine-thymidine (dTdT), adenine-adenine (AA), cytosine-cytosine (CC), guanine-guanine (GG), or uracil-uracil (UU).

[0022] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises an RNA sequence of at least 20 nucleotides in length. In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises an RNA sequence of 20 nucleotides in length.

[0023] In some embodiments of the isolated oligonucleotides of the present disclosure, the antisense strand comprises an RNA sequence of at least 22 nucleotides in length. In some embodiments of the isolated oligonucleotides of the present disclosure, the antisense strand comprises an RNA sequence of 22 nucleotides in length.

[0024] In some embodiments of the isolated oligonucleotides of the present disclosure, the double-stranded region is between 19 and 21 nucleotides in length. In some embodiments of the present disclosure, the double-stranded region is 20 nucleotides in length.

[0025] In some embodiments of the isolated oligonucleotides of the present disclosure, the double-stranded region comprises an antisense strand and a sense strand according to any of the antisense strand and sense strand sequence pairs in Table 1, as described herein.

[0026] In some embodiments of the isolated oligonucleotides of the present disclosure, the antisense strand comprises a nucleotide sequence according to any one of: SEQ ID NOs: 2-35.

[0027] In some embodiments of the isolated oligonucleotide of the present disclosure, the sense strand comprises a nucleotide sequence according to any one of: SEQ ID NOs: 36-69.

[0028] In some embodiments of the isolated oligonucleotides of the present disclosure, the antisense strand comprises a nucleotide sequence according to any one of SEQ ID NOs: 2-35; and the sense strand comprises a nucleotide sequence according to any one of SEQ ID NOs: 36-69, wherein the antisense and sense strand sequences have sufficient complementarity to allow formation of a double-stranded region between the antisense and sense strands.

[0029] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a nucleotide sequence identical to a region selected from any one of the following nucleotide positions from the 5' end of the human CFB mRNA sequence according to SEQ ID NO: 1: a) 493 to 534; b) 991 to 1054; c) 1384 to 1500; d) 1606 to 1686; e) 1821 to 1881; f) 2116 to 2307; and g) 2382 to 2468, and the antisense strand is substantially complementary to the sense strand such that the sense and antisense strands together form a double-stranded region, and the isolated oligonucleotide attenuates expression of CFB mRNA by at least 50% at a dose of 0.1 nM. (e.g., 50% to 55%, 55% to 60%, 60% to 65%, 65% to 70%, 70% to 75%, 75% to 80%, 80% to 85%, 85% to 90%, 90% to 95%, or 95% to 99%, 99% to 100%).

[0030] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a nucleotide sequence identical to a region selected from any one of the following nucleotide positions from the 5' end of the human CFB mRNA sequence according to SEQ ID NO: 1: a) 493 to 534; b) 991 to 1054; c) 1384 to 1500; d) 1606 to 1686; e) 1821 to 1881; f) 2116 to 2307; and g) 2382 to 2468, and the antisense strand is substantially complementary to the sense strand such that the sense and antisense strands together form a double-stranded region, and the isolated oligonucleotide attenuates expression of CFB mRNA by at least 50% at a dose of 0.02 nM. (e.g., 50% to 55%, 55% to 60%, 60% to 65%, 65% to 70%, 70% to 75%, 75% to 80%, 80% to 85%, 85% to 90%, 90% to 95%, or 95% to 99%, 99% to 100%).

[0031] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a nucleotide sequence identical to a region selected from any one of the following nucleotide positions from the 5' end of the human CFB mRNA sequence according to SEQ ID NO: 1: a) 493 to 534; b) 991 to 1054; c) 1384 to 1500; d) 1606 to 1686; e) 1821 to 1881; f) 2116 to 2307, and g) 2382 to 2468, and the antisense strand is substantially complementary to the sense strand such that the sense and antisense strands together form a double-stranded region, and the isolated oligonucleotide attenuates expression of CFB mRNA by 20% to 50% (e.g., 20% to 25%, 25% to 30%, 30% to 35%, 35% to 40%, 40% to 45%, or 45% to 50%) at a dose of 0.02 nM.

[0032] The present disclosure also provides isolated oligonucleotides comprising a sense strand and an antisense strand, wherein the sense strand comprises a nucleotide sequence substantially identical to a region of 19-25 nucleotides comprised between any one of the following nucleotide positions from the 5' end of the CFB mRNA sequence according to SEQ ID NO: 1: a) 5 to 38; b) 340 to 606; c) 776 to 828; d) 939 to 1227; e) 1305 to 1606; f) 1667 to 1746; g) 1815 to 2313; and h) 2378 to 2417, and the antisense strand is substantially complementary to the sense strand such that the sense strand and antisense strand together form a double-stranded region.

[0033] In some embodiments of the isolated oligonucleotide comprising a sense strand and an antisense strand, the sense strand comprises a nucleotide sequence substantially identical to a region of 19-25 nucleotides selected from any one of the following nucleotide positions from the 5' end of the CFB mRNA sequence according to SEQ ID NO: 1: a) 5 to 38; b) 340 to 606; c) 776 to 828; d) 939 to 1227; e) 1305 to 1606; f) 1667 to 1746; g) 1815 to 2313; and h) 2378 to 2417, and the antisense strand is substantially complementary to the sense strand such that the sense strand and antisense strand together form a double-stranded region, and the isolated oligonucleotide attenuates expression of CFB mRNA by 20% to 50% at a dose of 0.1 nM.

[0034] In some embodiments of the isolated oligonucleotide comprising a sense strand and an antisense strand, the sense strand comprises a nucleotide sequence substantially identical to a region of 19-25 nucleotides comprised between any one of the following nucleotide positions from the 5' end of the CFB mRNA sequence according to SEQ ID NO: 1: a) 5 to 38; b) 340 to 606; c) 776 to 828; d) 939 to 1227; e) 1305 to 1606; f) 1667 to 1746; g) 1815 to 2313; and h) 2378 to 2417, and the antisense strand is substantially complementary to the sense strand such that the sense strand and antisense strand together form a double-stranded region, and the isolated oligonucleotide attenuates expression of CFB mRNA by at least 50% at a dose of 0.1 nM.

[0035] In some embodiments of the isolated oligonucleotide comprising a sense strand and an antisense strand, the sense strand comprises a nucleotide sequence substantially identical to a region of 19-25 nucleotides selected from any one of the following nucleotide positions from the 5' end of the CFB mRNA sequence according to SEQ ID NO: 1: a) 5 to 38; b) 340 to 606; c) 776 to 828; d) 939 to 1227; e) 1305 to 1606; f) 1667 to 1746; g) 1815 to 2313; and h) 2378 to 2417, and the antisense strand is substantially complementary to the sense strand such that the sense and antisense strands together form a double-stranded region, and the isolated oligonucleotide attenuates expression of CFB mRNA by 20% to 50% at a dose of 0.02 nM.

[0036] In some embodiments of the isolated oligonucleotide comprising a sense strand and an antisense strand, the sense strand comprises a nucleotide sequence substantially identical to a region of 19-25 nucleotides selected from any one of the following nucleotide positions from the 5' end of the CFB mRNA sequence according to SEQ ID NO: 1: a) 5 to 38; b) 340 to 606; c) 776 to 828; d) 939 to 1227; e) 1305 to 1606; f) 1667 to 1746; g) 1815 to 2313; and h) 2378 to 2417, and the antisense strand is substantially complementary to the sense strand such that the sense strand and antisense strand together form a double-stranded region, and the isolated oligonucleotide attenuates expression of CFB mRNA by at least 50% at a dose of 0.02 nM.

[0037] The present disclosure also provides isolated oligonucleotides comprising a sense strand and an antisense strand, wherein the sense strand or the antisense strand or both comprise one or more modified nucleotides. In some embodiments, the antisense strand comprises a monomethyl protected phosphate mimic (5'-MeEP). In some embodiments, in the sense strand or the antisense strand or both, an end or internal nucleotide is connected to a targeting ligand. In some embodiments, the targeting ligand comprises at least one GalNAc G1b moiety.

[0038] In some embodiments of the isolated oligonucleotide comprising a sense strand and an antisense strand, the antisense strand comprises nucleotides modified with a 2'-F modification and nucleotides modified with a 2'-O-methyl modification according to the following formula: 3'(M)0(F)0(M)6(F)1(M)1(F)1(M)3(F)1(M)2(F)1(M)1(F)1(M)1(F)2(M)1 5'.

[0039] In some embodiments of the isolated oligonucleotide comprising a sense strand and an antisense strand, the sense strand comprises nucleotides modified with a 2'-F modification and nucleotides modified with a 2'-O-methyl modification according to the following formula: 5'(M)0(F)0(M)5(F)1(M)1(F)4(M)9 3'.

[0040] In some embodiments of the isolated oligonucleotide comprising a sense strand and an antisense strand, the antisense strand comprises any of the following: i) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 370 (5' [MeEPmUs][fGs][fU][mC][fA][mU][fA][mA][mA][fA][mU][mC][fA][mG][fG][mA][mA][mU][mUs][mCs][mC] 3'); ii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 371 (5' [MeEPmUs][fUs][fA][mA][fA][mA][fU][mU][mC][fA][mG][mG][mA][fA][mU][fU][mC][mC][mU][mGs][mCs][mU] 3'); iii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 372 (5' [MeEPmUs][fUs][fA][mA][fA][mA][fU][mU][mC][mC][mU][mGs][mCs][mU] 3'); iv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 373 (5' [MeEPmUs][fAs][fA][mU][fU][mC][fA][mG][mG][fA][mA][mU][mU][fC][mC][fU][mG][mC][mU][mUs][mCs][mU] 3'); v) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 374 (5'[MeEPmUs][fAs][fA][mC][fA][mC][fA][mU][mG][fU][mU][mG][mC][fU][mC][fA][mU][mU][mG][mUs][mCs][mU] 3'); vi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 375 (5'[MeEPmUs][fGs][fU][mG][fU][mA][fA][mC][mC][fG][mU][mC][mA][fU][mA][fG][mC][mA][mG][mUs][mGs][mG] 3'); vii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 376 the antisense strand of the nucleic acid sequence (5'[MeEPmUs][fAs][fU][mA][fG][mC][fA][mG][mU][fG][mG][mA][mA][fA][mG][fA][mG][mA][mU][mCs][mUs][mC] 3');viii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 377 (5' [mUs][fGs][fU][mC][fA][mU][fA][mA][mA][fA][mU][mU][mC][fA][mG][fG][mA][mA][mU][mUs][mCs][mC] 3'); ix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 378 (5' [mUs][fUs][fA][mA][fA][mA][fU][mU][mC][fA][mG][mG][mA][fA][mU][fU][mC][mC][mU][mGs][mCs][mU] 3'); or x) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 379 (5' [mUs][fUs][fA][mA][fA][mA][fU][mU][mC][mC][mU][mGs][mCs][mU] 3'). [mUs][fGs][fG][mA][fA][mA][fG][mA][mG][fA][mU][mC][mU][fC][mA][fU][mC][mA][mC][mUs][mCs][mA]3'), wherein "m" is a 2'-O-methyl modified nucleotide, "f" is a 2'-F modified nucleotide, "s" is a phosphorothioate internucleotide linkage, and "MeEP" is a monomethyl protected phosphate mimetic.;

[0041] In some embodiments of the isolated oligonucleotide comprising a sense strand and an antisense strand, the sense strand comprises any of the following: i) the sense strand of the nucleic acid sequence according to SEQ ID NO: 381 (5' [mAs][mAs][mU][mU][mC][fC][mU][fG][fA][fA][fU][mU][mU][mU][mA][mU][mG][mAs][mCs][mA][G1b][G1b][G1b] 3'); ii) the sense strand of the nucleic acid sequence according to SEQ ID NO: 382 (5' [mCs][mAs][mG][mG][mA][fA][mU][fU][fC][fC][fU][mG][mA][mA][mU][mU][mU][mUs][mAs][mA][G1b][G1b][G1b] 3'); iii) the sense strand of the nucleic acid sequence according to SEQ ID NO: 383 (5' [mCs][mAs][mG][mG][mA][fA][mU][fU][fC][fU][mG][mA][mA][mU][mU][mUs][mAs][mA][G1b][G1b][G1b] 3'); 1b][G1b][G1b] 3'); iv) the sense strand of the nucleic acid sequence according to SEQ ID NO: 384 (5' [mAs][mAs][mG][mC][mA][fG][mG][fA][fA][fU][fU][mC][mU][mC][mU][mU][mU][mCs][mCs][mA][G1b][G1b][G1b] 3'); v) the sense strand of the nucleic acid sequence according to SEQ ID NO: 385 (5' [mAs][mAs][mG][mC][mA][fG][mG][fA][fA][fU][fU][mC][mC][mU][mG][mA][mA][mUs][mUs][mA][G1b][G1b][G1b] 3'); vi) the sense strand of the nucleic acid sequence according to SEQ ID NO:386 (5' [mAs][mCs][mA][mA][mU][fG][mA][fG][fC][fA][fA][mC][mA][mU][mG][mU][mG][mUs][mUs][mA][G1b][G1b][G1b] 3'); vi) the sense strand of the nucleic acid sequence according to SEQ ID NO:386 (5' [mAs][mCs][mU][mG][mC][fU][mA][fU][fG][fA][fC][mG][mG][mU][mU][mA][mC][mAs][mCs][mA][G1b][G1b][G1b] 3');or vii) the sense strand of the nucleic acid sequence according to SEQ ID NO:387 (5' [mGs][mAs][mU][mC][mU][fC][mU][fU][fU][fC][fC][mA][mC][mU][mG][mC][mU][mAs][mUs][mA][G1b][G1b][G1b] 3'), wherein "m" is a 2'-O-methyl modified nucleotide, "f" is a 2'-F modified nucleotide, "s" is a phosphorothioate internucleotide linkage, and "G1b" is a GalNac G1b moiety;

[0042] In some embodiments of the isolated oligonucleotide comprising a sense strand and an antisense strand, the double-stranded region comprises any of the following: i) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 370 (5' [MeEPmUs][fGs][fU][mC][fA][mU][fA][mA][mA][fA][mU][mU][mC][fA][mG][fG][mA][mA][mU][mUs][mCs][mC] 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 381 (5' [mAs][mAs][mU][mU][mC][fC][mU][fG][fA][fA][fU][mU][mU][mU][mA][mU][mG][mAs][mCs][mA][G1b][G1b][G1b] 3'); ii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 371 (5' [MeEPmUs][fGs][fU][mC][fA][mU][fA][mA][mA][mU][mU][mC][fA][mG][fG][mA][mA][mU][mUs][mCs][mC] 3'); 3'); iii) the antisense strand of the nucleic acid sequence of [MeEPmUs][fUs][fA][mA][fA][mA][fU][mU][mC][fA][mG][mG][mA][fA][mU][fU][mC][mC][mU][mGs][mCs][mU] 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 382 (5' [mCs][mAs][mG][mG][mA][fA][mU][fU][fC][fC][fU][mG][mA][mA][mU][mU][mU][mUs][mAs][mA][G1b][G1b][G1b] 3'); the antisense strand of the nucleic acid sequence according to SEQ ID NO: 383 (5' [mAs][mGs][mU][mG][mA][fU][mG][fA][fG][fA][fU][mC][mU][mC][mU][mU][mCs][mA][G1b][G1b][G1b] 3');iv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 373 (5' [MeEPmUs][fAs][fA][mU][fU][mC][fA][mG][mG][fA][mA][mU][mU][fC][mC][fU][mG][mC][mU][mUs][mCs][mU] 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 384 (5' [mAs][mAs][mG][mC][mA][fG][mG][fA][fA][fU][fU][mC][mC][mU][mG][mA][mA][mUs][mUs][mA][G1b][G1b][G1b] 3'); v) the sense strand of the nucleic acid sequence according to SEQ ID NO: 374 (5' [MeEPmUs][fAs][fA][mU][fU][mC][fU][mG][mC][mU][mUs][mCs][mU] 3'); vi) an antisense strand of the nucleic acid sequence of [MeEPmUs][fAs][fA][mC][fA][mC][fA][mU][mG][fU][mU][mG][mC][fU][mC][fA][mU][mU][mG][mUs][mCs][mU] 3'), and a sense strand of the nucleic acid sequence according to SEQ ID NO: 385 (5' [mAs][mCs][mA][mA][mU][fG][mA][fG][fC][fA][fA][mC][mA][mU][mG][mU][mG][mUs][mUs][mA][G1b][G1b][G1b] 3'); vi) an antisense strand of the nucleic acid sequence according to SEQ ID NO: 375 (5' [mAs][mCs][mA][mA][mU][fG][mA][fG][fC][fA][fA][mC][mA][mU][mG][mU][mG][mUs][mUs][mA][G1b][G1b][G1b] 3'); the antisense strand of the nucleic acid sequence of SEQ ID NO: 386 (5' [mAs][mCs][mU][mG][mC][fU][mA][fU][fG][fA][fC][mG][mG][mU][mU][mA][mC][mAs][mCs][mA][G1b][G1b][G1b] 3');vii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 376 (5' [MeEPmUs][fAs][fU][mA][fG][mC][fA][mG][mU][fG][mG][mA][mA][fA][mG][fA][mG][mA][mU][mCs][mUs][mC] 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 387 (5' [mGs][mAs][mU][mC][mU][fC][mU][fU][fU][fC][fC][mA][mC][mU][mG][mC][mU][mAs][mUs][mA][G1b][G1b][G1b] 3'); viii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 377 (5' [MeEPmUs][fAs][fU][mA][fG][mC][mU][fG][mG][mA][mU][mCs][mUs][mC] 3'). ix) an antisense strand of the nucleic acid sequence of SEQ ID NO: 381 (5' [mAs][mAs][mU][mU][mC][fC][mU][fG][fA][fA][fU][mU][mU][mA][mU][mG][mAs][mCs][mA][G1b][G1b][G1b] 3'); ix) an antisense strand of the nucleic acid sequence of SEQ ID NO: 378 (5' [mUs][fGs][fU][mC][fA][mU][fA][mA][mA][mU][mU][mC][fA][mG][fG][mA][mA][mU][mUs][mCs][mC] 3'); and ix) a sense strand of the nucleic acid sequence of SEQ ID NO: 381 (5' [mAs][mAs][mU][mU][mC][fC][mU][fG][fA][fA][fU][mU][mU][mU][mA][mU][mG][mAs][mCs][mA][G1b][G1b][G1b] 3'). the antisense strand of the nucleic acid sequence according to SEQ ID NO: 382 (5' [mCs][mAs][mG][mG][mA][fA][mU][fU][fC][fC][fU][mG][mA][mA][mU][mU][mU][mUs][mAs][mA][G1b][G1b][G1b] 3');or x) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 379 (5' [mUs][fGs][fG][mA][fA][mA][fG][mA][mG][fA][mU][mC][mU][fC][mA][fU][mC][mA][mC][mUs][mCs][mA] 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 383 (5' [mAs][mGs][mU][mG][mA][fU][mG][fA][fG][fA][fU][mC][mU][mC][mU][mU][mCs][mA][G1b][G1b][G1b] 3');

[0043] The present disclosure also provides vectors encoding the isolated oligonucleotides disclosed herein.

[0044] The present disclosure also provides a delivery system comprising the isolated oligonucleotide or vector disclosed herein.

[0045] The present disclosure also provides pharmaceutical compositions comprising an isolated oligonucleotide disclosed herein, a vector or delivery system, and a pharmaceutically acceptable carrier, diluent, or excipient.

[0046] The present disclosure also provides kits comprising the isolated oligonucleotide, vector, delivery system, or pharmaceutical composition disclosed herein.

[0047] The present disclosure also provides a method of inhibiting or downregulating the expression or level of CFB in a subject in need thereof, wherein the method comprises administering to the subject an effective amount of at least one isolated oligonucleotide, vector, delivery system, or pharmaceutical composition disclosed herein.

[0048] The present disclosure also provides a method of treating or preventing a disease or disorder associated with abnormal or increased expression or activity of CFB, or a disease or disorder in which CFB plays a role, in a subject in need thereof, wherein the method comprises administering to the subject an effective amount of at least one isolated oligonucleotide, vector, delivery system, or pharmaceutical composition disclosed herein. BRIEF DESCRIPTION OF THE DRAWINGS

[0049] Figure 1 Graph showing the efficacy of the siRNA compounds listed in Table 2 in silencing human CFB in cultured Huh-7 cells. Compounds were transfected into cells at a concentration of 0.02 nM. Data are presented as the % of human CFB mRNA remaining relative to mock transfection when normalized to Gapdh mRNA levels (mean, + / - SEM). Each bar represents a single compound tested.

[0050] Figure 2 Graph showing the efficacy of the siRNA compounds listed in Table 2 in silencing human CFB in cultured Huh-7 cells. Compounds were transfected into cells at a concentration of 0.1 nM. Data are presented as the % of human CFB mRNA remaining relative to mock transfection when normalized to Gapdh mRNA levels (mean, + / - SEM). Each bar represents a single compound tested.

[0051] Figure 3 is a graph showing the in vivo efficacy of a subset of the compounds listed in Table 2 in mouse HDI livers at day 4 following dosing at 1 mg / kg. Data are presented as % of human CFB mRNA remaining relative to PBS when normalized to NeoR mRNA levels (mean, + / - SEM).

[0052] Figure 4 Graph showing in vivo dose response in mouse HDI livers at day 4 following dosing at 0.25 mg / kg, 0.5 mg / kg, or 1 mg / kg for a subset of the compounds listed in Table 2. Data are presented as % of human CFB mRNA remaining relative to PBS when normalized to NeoR mRNA levels (mean, + / - SEM).

[0053] Figure 5A-5B The table shows the compounds listed in Table 3 after a single subcutaneous (sc) dose of 3 mg / kg in cynomolgus monkeys ( Macaca fascicularis ) in vivo efficacy evaluation. The remaining cynomolgus monkey CFB mRNA ( Figure 5A ) and the remaining serum CFB protein ( Figure 5B ). Data were normalized to pre-dose mRNA or protein levels for each animal. Details

[0054] The present disclosure provides isolated oligonucleotides (oligonucleotides / oligonucleotide(s)), preferably small interfering RNA (siRNA), that form double-stranded regions and can reduce complement CFB mRNA expression, thereby reducing the expression of CFB protein in target cells. The oligonucleotides disclosed herein can have therapeutic applications in regulating CFB expression for the treatment of diseases involving complement component-related diseases, such as, but not limited to, paroxysmal nocturnal hemoglobinuria (PNH), rheumatoid arthritis, ischemia-reperfusion injury, multiple sclerosis (MS), Guillain-Barré syndrome, systemic lupus erythematosus, C3 glomerulonephritis, atypical hemolytic uremic syndrome (aHUS), myasthenia gravis (MG), neuromyelitis optica spectrum disorder (NMOSD), dense deposit disease (DDD), age-related macular degeneration (AMD), IgA nephropathy, multifocal motor neuropathy (MMN), organ transplantation, and neurodegenerative diseases.

[0055] In some aspects, the present invention provides compositions and methods for treating a subject having a disorder that would benefit from reduction of complement CFB expression. In some aspects, the methods disclosed herein prevent at least one symptom in a subject having a disease or disorder that would benefit from reduction of complement CFB expression.

[0056] The present disclosure has identified specific regions within CFB mRNA that provide targets for binding of double-stranded oligonucleotides (eg, siRNA), resulting in decreased expression levels of CFB mRNA.

[0057] The complement factor B (CFB) mRNA sequence described herein is the mRNA sequence encoded by the CFB gene according to GenBank accession number NM_001710.6:

[0058] The present disclosure provides isolated oligonucleotides comprising a sense strand and an antisense strand, wherein the sense strand comprises a nucleotide sequence substantially identical to a region of 19-25 nucleotides comprised between any one of the following nucleotide positions from the 5' end of the human CFB mRNA sequence according to SEQ ID NO: 1: a) 493 to 534; b) 991 to 1054; c) 1384 to 1500; d) 1606 to 1686; e) 1821 to 1881; f) 2116 to 2307; and g) 2382 to 2468, and the antisense strand is substantially complementary to the sense strand such that the sense strand and antisense strand together form a double-stranded region.

[0059] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a nucleotide sequence that is at least 70%, at least 80%, at least 90%, at least 95%, or at least 99% identical to a region of 19-25 nucleotides contained between any one of the following nucleotide positions from the 5' end of the human CFB mRNA sequence according to SEQ ID NO: 1: a) 493 to 534; b) 991 to 1054; c) 1384 to 1500; d) 1606 to 1686; e) 1821 to 1881; f) 2116 to 2307; and g) 2382 to 2468.

[0060] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a nucleotide sequence identical to a region of 19-25 nucleotides contained between any one of the following nucleotide positions from the 5' end of the human CFB mRNA sequence according to SEQ ID NO: 1: a) 493 to 534; b) 991 to 1054; c) 1384 to 1500; d) 1606 to 1686; e) 1821 to 1881; f) 2116 to 2307; and g) 2382 to 2468.

[0061] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a nucleotide sequence substantially identical to a region selected from between any one of the following nucleotide positions from the 5' end of the human CFB mRNA sequence according to SEQ ID NO: 1: a) 503 to 523 and b) 2190 to 2210.

[0062] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a nucleotide sequence that is at least 70%, at least 80%, at least 90%, at least 95%, or at least 99% identical to a region selected from any one of the following nucleotide positions from the 5' end of the human CFB mRNA sequence according to SEQ ID NO: 1: a) 503 to 523 and b) 2190 to 2210.

[0063] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a nucleotide sequence identical to a region selected from between any one of the following nucleotide positions from the 5' end of the human CFB mRNA sequence according to SEQ ID NO: 1: a) 503 to 523 and b) 2190 to 2210.

[0064] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a nucleotide sequence substantially identical to a region selected from between any one of the following nucleotide positions from the 5' end of the human CFB mRNA sequence according to SEQ ID NO: 1: a) 493 to 534; b) 991 to 1054; c) 1384 to 1500; d) 1666 to 1686; e) 1821 to 1881; f) 2116 to 2136; g) 2232 to 2307, and h) 2394 to 2468.

[0065] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a sequence that is at least 70%, at least 80%, at least 90%, at least 95%, or at least 99% identical to a region selected from any one of the following nucleotide positions from the 5' end of the human CFB mRNA sequence according to SEQ ID NO: 1: a) 493 to 534; b) 991 to 1054; c) 1384 to 1500; d) 1666 to 1686; e) 1821 to 1881; f) 2116 to 2136; g) 2232 to 2307, and h) 2394 to 2468.

[0066] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a sequence identical to a region selected from any one of the following nucleotide positions from the 5' end of the human CFB mRNA sequence according to SEQ ID NO: 1: a) 493 to 534; b) 991 to 1054; c) 1384 to 1500; d) 1666 to 1686; e) 1821 to 1881; f) 2116 to 2136; g) 2232 to 2307, and h) 2394 to 2468.

[0067] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a sequence substantially identical to a region selected from between any one of the following nucleotide positions from the 5' end of the human CFB mRNA sequence according to SEQ ID NO: 1: a) 995 to 1019; b) 1606 to 1626; c) 1860 to 1880; and d) 2382 to 2402.

[0068] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a sequence that is at least 70%, at least 80%, at least 90%, at least 95%, or at least 99% identical to a region selected from any one of the following nucleotide positions from the 5' end of the human CFB mRNA sequence according to SEQ ID NO: 1: a) 995 to 1019; b) 1606 to 1626; c) 1860 to 1880; and d) 2382 to 2402.

[0069] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a sequence identical to a region selected from between any one of the following nucleotide positions from the 5' end of the human CFB mRNA sequence according to SEQ ID NO: 1: a) 995 to 1019; b) 1606 to 1626; c) 1860 to 1880; and d) 2382 to 2402.

[0070] The CFB mRNA sequence according to SEQ ID NO: 1 as described herein is any heterologous mRNA sequence having sufficient identity to CFB according to accession number NM_001710.6 as described herein to allow binding to the antisense strand of the oligonucleotides of the present disclosure.

[0071] In some embodiments of the isolated oligonucleotide of the present disclosure, the isolated oligonucleotide is capable of inducing degradation of CFB mRNA.

[0072] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand is a single-stranded RNA molecule. In some embodiments of the isolated oligonucleotides of the present disclosure, the antisense strand is a single-stranded RNA molecule. In some embodiments of the isolated oligonucleotides of the present disclosure, both the sense strand and the antisense strand are single-stranded RNA molecules.

[0073] In some embodiments, the isolated oligonucleotides of the present disclosure are small interfering RNAs (siRNAs). Thus, the present disclosure provides siRNAs, wherein the siRNA comprises a sense region and an antisense region complementary to the sense region, which together form an RNA duplex, and wherein the sense region comprises a sequence that is at least 70% to 100% identical to a CFB mRNA sequence. definition

[0074] "RNAi" or "RNA interference" refers to the process of sequence-specific post-transcriptional gene silencing mediated by double-stranded RNA (dsRNA). Duplex RNA siRNA (small interfering RNA), miRNA (microRNA), shRNA (short hairpin RNA), ddRNA (DNA-directed RNA, DNA-directed RNA), piRNA (Piwi interacting RNA) or rasiRNA (repeat associated siRNA) and modified forms thereof can mediate RNA interference. These dsRNA molecules can be commercially available, or can be designed and prepared based on known sequence information. The antisense strand of these molecules can include RNA, DNA, PNA or a combination thereof. These DNA / RNA chimera polynucleotides include, but are not limited to, double-stranded polynucleotides composed of DNA and RNA that inhibit the expression of a target gene. These dsRNA molecules can also include one or more modified nucleotides as described herein that can be incorporated into any chain.

[0075] In the RNAi gene silencing or knockdown process, a dsRNA comprising a first (antisense) strand complementary to a portion of a target gene and a second (sense) strand fully or partially complementary to the first antisense strand is introduced into an organism. After introduction into the organism, the target gene-specific dsRNA is processed into relatively small fragments (siRNA) and can subsequently become distributed throughout the organism, reducing the messenger RNA of the target gene, resulting in a phenotype that may be close to that caused by a complete or partial deletion of the target gene.

[0076] Some dsRNAs in cells can undergo the action of the Dicer enzyme (ribonuclease III enzyme). Dicer can process dsRNA into shorter dsRNA fragments, i.e., siRNAs. RNAi also involves a nuclease endonuclease complex called the RNA-induced silencing complex (RISC). After being cleaved by Dicer, the siRNA enters the RISC complex and guides the cleavage of a single-stranded RNA target having a sequence complementary to the antisense strand of the siRNA duplex. The other strand of the siRNA is the passenger strand. The cleavage of the target RNA occurs in the middle of the region complementary to the antisense strand of the siRNA duplex. Therefore, siRNA can downregulate or knock down gene expression by mediating RNA interference in a sequence-specific manner.

[0077] As used herein, "target gene" or "target sequence" refers to a gene or gene sequence whose corresponding RNA is targeted for degradation via the RNAi pathway using dsRNA or siRNA as described herein. To target a gene, for example, using an siRNA to target a gene, the siRNA comprises an antisense region that is complementary or substantially complementary to at least a portion of the target gene or sequence and a sense strand that is complementary to the antisense strand. Upon introduction into a cell, the siRNA directs the RISC complex to cleave RNA containing the target sequence, thereby degrading the RNA.

[0078] As used herein, "oligonucleotide," "nucleic acid," "nucleotide sequence," and "polynucleotide" are used interchangeably and encompass both RNA and DNA, including cDNA, genomic DNA, mRNA, synthetic (e.g., chemically synthesized) DNA or RNA, and chimeras of RNA and DNA. The terms polynucleotide, nucleotide sequence, or nucleic acid refer to a chain of nucleotides, regardless of the length of the chain. Nucleic acids can be double-stranded or single-stranded. Wherein single-stranded nucleic acids can be sense strands or antisense strands. Nucleic acids can be synthesized using oligonucleotide analogs or derivatives (e.g., inosine or phosphorothioate nucleotides). Such oligonucleotides can be used, for example, to prepare nucleic acids with altered base pairing abilities or increased resistance to nucleases. The present disclosure also provides nucleic acids that are complements (which can be complete complements or partial complements) of the nucleic acids, nucleotide sequences, or polynucleotides of the present disclosure. When synthesizing dsRNA, less common bases such as inosine, 5-methylcytosine, 6-methyladenine, hypoxanthine, and other bases can also be used for antisense, dsRNA, and ribozyme pairing. Other modifications can also be made, such as modifications to the phosphodiester backbone or 2'-fluoro, 2'-hydroxy, or 2'O-methyl in the ribose group of the RNA.

[0079] The term "isolated" can refer to a nucleic acid, nucleotide sequence, or polypeptide that is substantially free of cellular material, viral material, and / or culture medium (when produced by recombinant DNA techniques), or chemical precursors or other chemical substances (when chemically synthesized). Additionally, an "isolated fragment" is a fragment of a nucleic acid, nucleotide sequence, or polypeptide that does not naturally occur as a fragment and would not be found in nature. "Isolated" does not mean that the preparation is technically pure (homogeneous), but rather that it is sufficiently pure to provide the polypeptide or nucleic acid in a form useful for its intended purpose.

[0080] The terms "region" or "fragment" are used interchangeably and apply to oligonucleotides.

[0081] As described herein, a CFB mRNA sequence will be understood to mean a nucleotide sequence that is reduced in length relative to a reference nucleic acid or nucleotide sequence of the CFB mRNA sequence and that comprises, consists essentially of, and / or consists of contiguous nucleotides that are identical or nearly identical (e.g., 60%, 70%, 80%, 90%, 92%, 95%, 98%, or 99% identical) to the reference nucleic acid or nucleotide sequence. Where appropriate, such a nucleic acid fragment according to the present disclosure may be included in a larger polynucleotide of which it is a component. In some embodiments, such a fragment may comprise, consist essentially of, and / or consist of an oligonucleotide having a length of at least about 8, 10, 12, 15, 20, 25, 30, 35, 40, 45, 50, 75, 100, 150, 200, or more contiguous nucleotides of a nucleic acid or nucleotide sequence according to the present disclosure.

[0082] As used herein, "complementary" polynucleotides are those that are capable of base pairing according to the standard Watson-Crick complementarity rules. Specifically, purines will base pair with pyrimidines to form combinations of guanine and cytosine (G:C) pairing and adenine and thymine (A:T) pairing (in the case of DNA) or adenine and uracil (A:U) pairing (in the case of RNA). For example, the sequence "AGT" binds to the complementary sequence "TCA". It should be understood that even if two polynucleotides are not completely complementary to each other, they can hybridize to each other if they each have at least one region that is substantially complementary to the other.

[0083] As used herein, the term "substantially complementary" is at least 90% (e.g., 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%) complementary to the sense strand, i.e., substantially identical to the nucleotide sequence within the region defined in SEQ ID NO: 1. As used herein, the term "substantially complementary" means that two nucleic acid sequences are complementary at at least about 90%, 95% or 99% of their nucleotides.

[0084] In some embodiments, two nucleic acid sequences can be complementary at least 90%, 95%, 96%, 97%, 98%, 99% or more of their nucleotides. In some embodiments, two nucleic acid sequences can be complementary at least 90%, 95%, 96%, 97%, 98%, 99% or more of their nucleotides. In some embodiments, two nucleic acid sequences can be complementary at least 90% to 95%, complementary at least 70% to 100%, complementary at least 95% and 96%, complementary at least 90% and 100%, complementary at least 96% to 97%, complementary at least 60% to 80%, complementary at least 97% and 98%, complementary at least 70% and 90%, complementary at least 98% and 99%, complementary at least 80% and 100%, or complementary at least 99% and 100%.

[0085] The term "substantially complementary" can also mean that the two nucleic acid sequences of the sense strand and the antisense strand have sufficient complementarity to allow the sense strand and the antisense strand to bind to form a double-stranded region consisting of between 19 and 25 nucleotides in length. The term "substantially complementary" can also mean that the two nucleic acid sequences can hybridize under high stringency conditions, and such conditions are well known in the art.

[0086] As used herein, the terms "substantially identical" or "sufficient identity" are used interchangeably herein to refer to a sequence that is at least 70%, at least 80%, at least 90%, at least 95%, or at least 99% (e.g., between 70% and 80%, 85% and 90%, or 90% and 95%, or 95% and 99%, or 99% and 100%) identical to the nucleotide sequence within the region defined in SEQ ID NO: 1.

[0087] As used herein, the term "identity" means that sequences are compared to each other as follows. In order to determine the percent identity of two nucleic acid sequences, the sequences can first be aligned relative to each other so that the comparison of these sequences can be made possible subsequently. For this reason, for example, a room can be inserted into the sequence of the first nucleic acid sequence, and the corresponding positions of nucleotides and the second nucleic acid sequence can be compared. If the position in the first nucleic acid sequence is occupied by the same nucleotide as the position in the second sequence, the two sequences are identical at this position. The percent identity between the two sequences is a function of the number of the same positions divided by the number of all positions compared in the sequence under investigation.

[0088] For aligned segments of a test and reference sequence, "percent identity" or "% identity," as used interchangeably herein, is the percentage of identical components shared by the two aligned sequences divided by the total number of components in the segment of the reference sequence (i.e., the entire reference sequence or a smaller defined portion of the reference sequence).

[0089] The percent identity of two sequences can be determined by means of a mathematical algorithm. A preferred but non-limiting example of a mathematical algorithm that can be used for the comparison of two sequences is the algorithm of Karlin et al. (1993), PNAS USA, 90:5873-5877. Such an algorithm is integrated into the NBLAST program, which can be used to identify sequences with the desired identity to the sequences of the present disclosure. In order to obtain a gapped alignment, as described herein, a "Gapped BLAST" program can be used, as described in Altschul et al. (1997), Nucleic Acids Res, 25:3389-3402. If BLAST and Gapped BLAST programs are used, the preset parameters of a specific program (e.g., NBLAST) can be used. Sequences can be further aligned using version 9 of the GAP (global alignment program) from the "Genetic Computing Group" using a preset (BLOSUM62) matrix (values ​​-4 to +11) with a gap open penalty of -12 (for the first zero in a gap) and a gap extension penalty of -4 (for each additional consecutive zero in a gap). After alignment, percent identity is calculated by expressing the identity number as the percentage content of the nucleic acid in the claimed sequence. If necessary, the methods described for determining percent identity between two nucleic acid sequences can also be applied to the encoded amino acid sequences accordingly.

[0090] Useful methods for determining sequence identity are also disclosed in Guide to Huge Computers (Martin J. Bishop, ed., Academic Press, San Diego (1994)), and in Carillo, H. and Lipton, D., (Applied Math 48:1073 (1988)). More specifically, preferred computer programs for determining sequence identity include, but are not limited to, the Basic Local Alignment Search Tool (BLAST) program, which is publicly available from the National Center for Biotechnology Information (NCBI) at the U.S. National Library of Medicine, National Institutes of Health, Bethesda, Md. 20894; see BLAST Manual, Altschul et al., NCBI, NLM, NIH; (Altschul et al., J. Mol. Biol. 215:403-410 (1990)); BLAST programs, version 2.0 or later, allow for the introduction of gaps (deletions and insertions) in the alignment; for peptide sequences, BLASTX can be used to determine sequence identity; and, for polynucleotide sequences, BLASTN can be used to determine sequence identity. The percent identity can be 70% identity or greater, e.g., at least 70% identity, at least 75% identity, at least 80% identity, at least 85% identity, at least 90% identity, at least 95% identity, at least 98% identity, at least 99% identity, or 100% identity.

[0091] As used herein, "heterologous" refers to a nucleic acid sequence that is derived from another species or from the same species or organism but modified from its original form or the form primarily expressed in the cell. Thus, a nucleotide sequence derived from an organism or species different from the cell into which the nucleotide sequence is introduced is heterologous with respect to that cell and the progeny of that cell. Additionally, heterologous nucleotide sequences include nucleotide sequences derived from and inserted into the same native original cell type, but which exist in a non-native state, e.g., a different copy number, and / or under the control of regulatory sequences different from those found in nature.

[0092] Double-stranded RNA targeting human complement factor B (CFB) The present disclosure provides isolated oligonucleotides comprising a double-stranded RNA (dsRNA) duplex region targeting a CFB mRNA sequence for degradation. The double-stranded RNA molecules of the present disclosure can be in the form of any type of RNA interference molecule known in the art. In some embodiments, the double-stranded RNA molecule is a small interfering RNA (siRNA). In other embodiments, the double-stranded RNA molecule is a short hairpin RNA (shRNA) molecule. In other embodiments, the double-stranded RNA molecule is a Dicer substrate that is processed in cells to produce siRNA. In other embodiments, the double-stranded RNA molecule is a part of a microRNA precursor molecule.

[0093] In some embodiments, the dsRNA is a small interfering RNA (siRNA) that targets CFB mRNA sequences for degradation. In some embodiments, the siRNA targeting CFB is packaged in a delivery system (e.g., nanoparticles) described herein.

[0094] The isolated oligonucleotides of the present disclosure that target CFB for degradation may comprise a sense strand that is at least 70% identical to any fragment of CFB mRNA (e.g., the CFB mRNA of SEQ ID NO: 1). In some embodiments, the sense strand comprises or consists essentially of a sequence that is at least 70%, at least 80%, at least 90%, at least 95%, or 100% identical to any fragment of SEQ ID NO: 1. siRNAs that target CFB for degradation may comprise an antisense strand that is at least 70% identical to a sequence complementary to any fragment of CFB mRNA (e.g., the CFB mRNA of SEQ ID NO: 1). In some embodiments, the antisense strand comprises or consists essentially of a sequence that is at least 70%, at least 80%, at least 90%, at least 95%, or 100% identical to a sequence complementary to any fragment of SEQ ID NO: 1. In some embodiments, the sense and antisense regions are complementary and base-paired to form an RNA duplex structure. The segment of CFB mRNA that has a percent identity with the sense region of the siRNA and is complementary to the antisense region of the siRNA can be the protein coding sequence of the mRNA, the untranslated region (UTR) of the mRNA (5'UTR or 3'UTR), or both.

[0095] In some embodiments, the isolated oligonucleotide of the present disclosure comprises a sense region and an antisense region that is complementary to the sense region, which together form an RNA duplex, and the sense region comprises a sequence that is at least 70% identical to a CFB mRNA sequence. In some embodiments, the sense region is identical to the CFB mRNA sequence.

[0096] As used herein, the term "sense strand" or "sense region" refers to a nucleotide sequence of an siRNA molecule that is partially or completely complementary to at least a portion of the corresponding antisense strand or antisense region of an siRNA molecule. The sense strand of an isolated oligonucleotide of the present disclosure can include a nucleic acid sequence having a certain percentage of identity with a target nucleic acid sequence, such as a CFB mRNA sequence. In some cases, the sense region can have 100% identity, i.e., complete identity or homology, to the target nucleic acid sequence. In other cases, one or more mismatches can exist between the sense region and the target nucleic acid sequence. For example, there can be 1, 2, 3, 4, 5, 6, or 7 mismatches between the sense region and the target nucleic acid sequence.

[0097] As used herein, the term "antisense strand" or "antisense region" refers to a nucleotide sequence in an isolated oligonucleotide of the present disclosure that is partially or completely complementary to at least a portion of a target nucleic acid sequence. The antisense strand of an isolated oligonucleotide of a molecule of the present disclosure may include a nucleic acid sequence that is complementary to at least a portion of the corresponding sense strand of the isolated oligonucleotide.

[0098] In some embodiments, the sense region comprises a sequence that is at least 70% identical, at least 75% identical, at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 97% identical, at least 99% identical, or 100% identical to the sequence of SEQ ID NO: 1, or a region of SEQ ID NO: 1, as disclosed herein. In some embodiments, the sense region consists essentially of a sequence that is at least 70% identical, at least 75% identical, at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 97% identical, at least 99% identical, or 100% identical to the sequence of SEQ ID NO: 1, or a region of SEQ ID NO: 1, as disclosed herein. In some embodiments, the sense region comprises a sequence that is identical to the sequence of SEQ ID NO: 1, or a region of SEQ ID NO: 1, as disclosed herein. In some embodiments, the sense region consists essentially of a sequence that is identical to the sequence of SEQ ID NO: 1, or a region of SEQ ID NO: 1, as disclosed herein.

[0099] In some embodiments, the sense region of the isolated oligonucleotide targeting CFB of the present disclosure has one or more mismatches between the sequence of the isolated oligonucleotide and the CFB sequence. For example, the sequence of the sense region can have 1, 2, 3, 4, or 5 mismatches between the sequence of the sense region of the isolated oligonucleotide and the CFB sequence. In some embodiments, the CFB sequence is a CFB 3' untranslated region sequence (3' UTR). Without wishing to be bound by theory, it is believed that siRNAs targeting the 3' UTR have increased mismatch tolerance when compared to mismatches in isolated oligonucleotides targeting the coding region of a gene. In addition, isolated oligonucleotide RNAs can tolerate mismatches outside the seed region. As used herein, the "seed region" of an isolated oligonucleotide refers to base pairs 2-8 of the antisense region of the isolated oligonucleotide, i.e., the strand of the isolated oligonucleotide that is complementary to and hybridizes with the target mRNA.

[0100] In some embodiments, the antisense region comprises a sequence that is at least 70% identical, at least 75% identical, at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 97% identical, at least 99% identical, or 100% identical to a sequence that is complementary to SEQ ID NO: 1 or a region of SEQ ID NO: 1 as disclosed herein. In some embodiments, the antisense region consists essentially of a sequence that is at least 70% identical, at least 75% identical, at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 97% identical, at least 99% identical, or 100% identical to a sequence that is complementary to SEQ ID NO: 1 or a region of SEQ ID NO: 1. In some embodiments, the antisense region comprises a sequence that is identical to a sequence that is complementary to SEQ ID NO: 1 or a region of SEQ ID NO: 1. In some embodiments, the sense region consists essentially of a sequence that is complementary to SEQ ID NO: 1 or a region of SEQ ID NO: 1.

[0101] The antisense region of the isolated oligonucleotide targeting CFB of the present disclosure is complementary to the sense region. In some embodiments, the sense region and the antisense region are fully complementary (no mismatches). In some embodiments, the antisense region is partially complementary to the sense region, that is, there are 1, 2, 3, 4, or 5 mismatches between the sense region and the antisense region.

[0102] Typically, the isolated oligonucleotides of the present disclosure comprise RNA duplexes of about 16 to about 25 nucleotides in length. In some embodiments, the RNA duplexes are between about 17 and about 24 nucleotides in length, between about 18 and about 23 nucleotides in length, or between about 19 and about 22 nucleotides in length. In some embodiments, the RNA duplexes are 19 nucleotides in length. In some embodiments, the RNA duplexes are 20 nucleotides in length.

[0103] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand is a single-stranded RNA molecule. In some embodiments of the isolated oligonucleotides of the present disclosure, the antisense strand is a single-stranded RNA molecule. In some embodiments, both the sense strand and the antisense strand are single-stranded RNA molecules. In some embodiments, the isolated oligonucleotides of the present disclosure are siRNAs targeting CFB, comprising two different single-stranded RNAs, the first comprising a sense region and the second comprising an antisense region, which hybridize to form an RNA duplex.

[0104] In some embodiments, the oligonucleotide of the separation of the present disclosure can have one or more overhangs from the duplex region. In some embodiments, the overhang (it is the single-stranded region of non-base pairing) length can be from 1 to 8 nucleotides or longer. In some embodiments, the overhang can be a 3' overhang, wherein the 3' end of the chain has the single-stranded region from 1 to 8 nucleotides. In some embodiments, the overhang can be a 5' overhang, wherein the 5' end of the chain has the single-stranded region from 1 to 8 nucleotides. In some embodiments, the overhang of the oligonucleotide of separation is the same length. In some embodiments, the overhang of the oligonucleotide of separation is different lengths.

[0105] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand of the single-stranded RNA molecule comprises a 3' overhang. In some embodiments, the sense strand of the single-stranded RNA molecule comprises a 3' overhang. In some embodiments, the sense strand of the single-stranded RNA molecule comprises a 3' overhang of at least one nucleotide. In some embodiments, the sense strand of the single-stranded RNA molecule comprises a 3' overhang of two nucleotides.

[0106] In some embodiments of the isolated oligonucleotides of the present disclosure, the single-stranded RNA molecule of the antisense strand comprises a 3' overhang. In some embodiments, the 3' overhang of the single-stranded RNA molecule of the antisense strand comprises at least one nucleotide. In some embodiments, the 3' overhang of the single-stranded RNA molecule of the antisense strand comprises two nucleotides.

[0107] In some embodiments of the isolated oligonucleotides of the present disclosure, both ends of the isolated oligonucleotide have overhangs, e.g., a 3' dinucleotide overhang at each end. In some embodiments, the overhangs at the 5' end and the 3' end are different lengths. In some embodiments, the overhangs at the 5' end and the 3' end are the same length.

[0108] In some embodiments of the isolated oligonucleotides of the present disclosure, the overhangs may comprise one or more deoxyribonucleotides, one or more ribonucleotides, or a combination of deoxyribonucleotides and ribonucleotides. In some embodiments, one or two overhang nucleotides of the siRNA may be 2'-deoxyribonucleotides.

[0109] In some embodiments of the isolated oligonucleotides of the present disclosure, the first single-stranded RNA molecule comprises a first 3' overhang. In some embodiments, the second single-stranded RNA molecule comprises a second 3' overhang. In some embodiments, the first 3' overhang and the second 3' overhang comprise dinucleotides.

[0110] In some embodiments of the isolated oligonucleotides of the present disclosure, the 3' overhang comprises any one of thymidine-thymidine (dTdT), adenine-adenine (AA), cytosine-cytosine (CC), guanine-guanine (GG), or uracil-uracil (UU). In some embodiments of the isolated oligonucleotides of the present disclosure, the 3' overhang comprises thymidine-thymidine (dTdT) or uracil-uracil (UU) overhang. In some embodiments, the 3' overhang comprises uracil-uracil (UU) overhang. Without wishing to be bound by theory, it is believed that the 3' overhang (such as a dinucleotide overhang) enhances siRNA-mediated mRNA degradation by enhancing siRNA-RISC complex formation and / or enhancing the rate at which the target mRNA is cleaved by the siRNA-RISC complex.

[0111] In some embodiments, the isolated oligonucleotides of the present disclosure can have one or more blunt ends, wherein the duplex region end does not have an overhang, and the chain is base-paired with the duplex region end. In some embodiments, the isolated oligonucleotides of the present disclosure can have one or more blunt ends, or can have one or more overhangs, or can have a combination of blunt ends and overhangs. For example, the 5' end of the siRNA can be blunt, and the 3' end of the same isolated oligonucleotide can include an overhang, or vice versa.

[0112] In some embodiments, the isolated oligonucleotides of the present disclosure have blunt ends at both ends.

[0113] In some embodiments of the isolated oligonucleotides of the present disclosure, the double-stranded region comprises an antisense strand and a sense strand according to any of the antisense strand and sense strand sequence pairs in Table 1, as described below.

[0114] complement system The complement system is a key component of the innate immune system and comprises a group of proteins that are normally inactive. These proteins are organized into three activation pathways: the classical pathway, the lectin pathway, and the alternative pathway.

[0115] Molecules from microorganisms, antibodies, or cellular components can activate these pathways, leading to the formation of protease complexes called C3 convertase and C5 convertase. The first enzymatically activated cascade, called the classical pathway, is a calcium / magnesium-dependent cascade that is typically activated by the formation of an antigen-antibody complex. It can also be activated in an antibody-independent manner by binding of C-reactive protein complexed with a ligand and by many pathogens, including Gram-negative bacteria.

[0116] As described in US Pat. No. 8,703,136, the classical pathway comprises several components, C1, C4, C2, C3, and C5 (listed in the order in which they appear in the pathway). The initiation of the classical pathway of the complement system occurs after the first complement component (C1) is bound and activated by both an immune activator and a non-immune activator. C1 comprises a calcium-dependent complex of components C1q, C1r, and C1s and is activated by the binding of the C1q component. C1q contains six identical subunits, and each subunit comprises three chains (A chain, B chain, and C chain). Each chain has a globular head region connected to a collagen-like tail. Binding and activation of C1q by the antigen-antibody complex occurs through the C1q head group region. Many non-antibody C1q activators, including proteins, lipids, and nucleic acids, bind and activate C1q through a unique site on the collagen-like stem region. The C1qrs complex then catalyzes the activation of complement components C4 and C2, forming the C4b2a complex, which functions as a C3 convertase.

[0117] The second enzymatically activated cascade, known as the alternative pathway, is a rapid, antibody-independent route for complement system activation and amplification. The alternative pathway is a magnesium-dependent cascade that is activated by the deposition and activation of C3 on certain susceptible surfaces (e.g., cell wall polysaccharides of yeast and bacteria and certain biopolymer materials). The alternative pathway includes several components, including C3, complement factor B (CFB), and factor D (listed in the order in which they appear in the pathway). Activation of the alternative pathway occurs when C3b (the proteolytically cleaved and active form of C3) binds to an activating surface agent, such as bacteria. CFB then binds to C3b and is cleaved by factor D to produce the active enzyme Bb. The resulting complement complex, C3bBb, is the alternative pathway C3 convertase. The enzyme C3b-Bb cleaves C3 to produce C3b, resulting in extensive deposition of the C3b-Bb complex on activated surfaces.

[0118] Thus, both the classical complement pathway and the alternative complement pathway produce the C3 convertase, which separates factor C3 into C3a and C3b. At this point, both C3 convertases also assemble into the C5 convertase (C4b2a3b and C3b3bBb). These complexes subsequently cleave complement component C5 into two components: the C5a polypeptide (9 kDa) and the C5b polypeptide (170 kDa). The C5a polypeptide binds to a 7-transmembrane G protein-coupled receptor, originally associated with leukocytes and now known to be expressed on a variety of tissues including hepatocytes and neurons. The C5a molecule is the major chemotactic component of the human complement system and can trigger a variety of biological responses, including leukocyte chemotaxis, smooth muscle contraction, activation of intracellular signal transduction pathways, neutrophil-endothelial adhesion, cytokine and lipid mediator release, and oxidant formation.

[0119] The larger C5b fragment sequentially binds to later components of the complement cascade, C6, C7, C8, and C9, to form the C5b-9 membrane attack complex ("MAC"). The lipophilic C5b-9 MAC can directly lyse red blood cells, and in larger amounts, it lyses white blood cells and damages tissues such as muscle, epithelium, and endothelial cells. In sublytic amounts, C5b-9 MAC can stimulate upregulation of adhesion molecules, increase in intracellular calcium, and cytokine release. Additionally, at sublytic concentrations, C5b-9 MAC can stimulate cells such as endothelial cells and platelets without causing cell lysis. The non-lytic effects of C5a and C5b-9 MAC are comparable and interchangeable.

[0120] The lectin pathway is initiated when pattern recognition molecules (MBL, CL-K1, and ficolins) bind to so-called pathogen-associated molecular patterns (PAMPs) (D-mannose, N-acetyl-D-glucosamine, or acetyl groups) on the surface of pathogens or to apoptotic or necrotic cells (Beltrame et al., 2015).

[0121] Despite its important role in the maintenance of health, the complement system has the potential to cause or promote disease.

[0122] Complement-targeting drugs are approved for routine clinical use in four diseases by the U.S. Food and Drug Administration (FDA) and the European Medicines Agency (EMA) (Garred et al., 2021). In 2007, the mAb eculizumab (Soliris), which blocks C5 cleavage, was shown to be highly effective in preventing hemolysis in paroxysmal nocturnal hemorrhage (PNH) (Brodsky et al., 2008; Parker, 2009), and this was subsequently followed by the treatment of atypical hemolytic uremic syndrome (aHUS) (Tschumi et al., 2011; Loirat et al., 2016). Recently, it has also been approved for the neurological diseases generalized myasthenia gravis (Dhillon, 2018) and neuromyelitis optica spectrum disorder (Selmaj and Selmaj, 2019).

[0123] Until recently, when ravulizumab (Ultomiris) and zilucoplan were introduced, eculizumab was the only complement inhibitor approved for routine use. Ravlizumab is a second-generation version of eculizumab; in other words, some minor amino acid modifications were made to the eculizumab molecule, significantly increasing its half-life, allowing treatment intervals to be increased from every 2 weeks to every 8 weeks. It shares the same C5 binding site as eculizumab (i.e., blocks C5 cleavage and thereby prevents the release of C5a and the formation of C5b-9) (Kulasekararaj et al., 2019; Lee et al., 2019; McKeage, 2019; Stern and Connell, 2019; Lee and Kulasekararaj, 2020).

[0124] Zilucoplan is a drug that is structurally distinct from the aforementioned antibodies but shares the same primary function. It is a synthetic macrocyclic peptide inhibitor for subcutaneous self-administration that shares much of the same function as eculizumab, blocking C5 cleavage (Beecher et al., 2019; Albazli et al., 2020; Howard et al., 2020). A phase 2, randomized, double-blind, placebo-controlled, multicenter clinical trial demonstrated that zilucoplan administration produced rapid, meaningful, and sustained improvements within 12 weeks in a broad population of patients with moderate to severe acetylcholine receptor antibody-positive generalized myasthenia gravis (Howard et al., 2020). A close analog of zilucoplan (RA101495), RA 101295, has been used in animal studies and has been shown to increase survival in baboon Escherichia coli sepsis (Keshari et al., 2017).

[0125] Thus, the isolated oligonucleotides disclosed in the present disclosure can be used to treat or prevent diseases or disorders associated with abnormal or increased expression or activity of CFB or diseases or disorders in which CFB plays a role. Exemplary isolated oligonucleotides of the present disclosure are described in Table 1.

[0126] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a sequence selected from any one of the groups of sense / passenger strand sequences listed in Table 1, Table 2, or Table 3. In some embodiments, the antisense strand comprises a sequence selected from any one of the groups of antisense / guide strand sequences listed in Table 1, Table 2, or Table 3. In some embodiments, the sense region and the antisense region comprise complementary sequences selected from the groups listed in Table 1, Table 2, and Table 3.

[0127] In some embodiments of the isolated oligonucleotides of the present disclosure, the antisense strand comprises a nucleotide sequence according to any one of: SEQ ID NOs: 2-35.

[0128] In some embodiments of the isolated oligonucleotide of the present disclosure, the sense strand comprises a nucleotide sequence according to any one of: SEQ ID NOs: 36-69.

[0129] In some embodiments of the isolated oligonucleotides of the present disclosure, the antisense strand comprises a nucleotide sequence according to any one of SEQ ID NOs: 2-35; and the sense strand comprises a nucleotide sequence according to any one of SEQ ID NOs: 36-69, wherein the antisense and sense strand sequences have sufficient complementarity to allow formation of a double-stranded region between the antisense and sense strands.

[0130] Sequence of the present disclosure The present disclosure provides isolated oligonucleotides comprising a sense strand and an antisense strand, wherein the sense strand comprises a nucleotide sequence substantially identical to a region selected from any one of the following nucleotide positions from the 5' end of the human CFB mRNA sequence according to SEQ ID NO: 1: a) 493 to 534; b) 991 to 1054; c) 1384 to 1500; d) 1606 to 1686; e) 1821 to 1881; f) 2116 to 2307; and g) 2382 to 2468, and the antisense strand is substantially complementary to the sense strand such that the sense strand and antisense strand together form a double-stranded region.

[0131] The present disclosure provides isolated oligonucleotides comprising a sense strand and an antisense strand, wherein the sense strand comprises a nucleotide sequence that is at least 70%, at least 80%, at least 90%, at least 95%, or at least 99% identical to a region of 19-25 nucleotides comprised between any one of the following nucleotide positions from the 5' end of the human CFB mRNA sequence according to SEQ ID NO: 1: a) 493 to 534; b) 991 to 1054; c) 1384 to 1500; d) 1606 to 1686; e) 1821 to 1881; f) 2116 to 2307, and g) 2382 to 2468.

[0132] The present disclosure provides isolated oligonucleotides comprising a sense strand and an antisense strand, wherein the sense strand comprises a nucleotide sequence identical to a region of 19-25 nucleotides comprised between any one of the following nucleotide positions from the 5' end of the human CFB mRNA sequence according to SEQ ID NO: 1: a) 493 to 534; b) 991 to 1054; c) 1384 to 1500; d) 1606 to 1686; e) 1821 to 1881; f) 2116 to 2307, and g) 2382 to 2468.

[0133] The present disclosure provides isolated oligonucleotides comprising a sense strand and an antisense strand, wherein the sense strand comprises a nucleotide sequence substantially identical to a region selected from between any one of the following nucleotide positions from the 5' end of the human CFB mRNA sequence according to SEQ ID NO: 1: a) 503 to 523 and b) 2190 to 2210.

[0134] The present disclosure provides isolated oligonucleotides comprising a sense strand and an antisense strand, wherein the sense strand comprises a nucleotide sequence that is at least 70%, at least 80%, at least 90%, at least 95%, or at least 99% identical to a region selected from any one of the following nucleotide positions from the 5' end of the human CFB mRNA sequence according to SEQ ID NO: 1: a) 503 to 523 and b) 2190 to 2210.

[0135] The present disclosure provides isolated oligonucleotides comprising a sense strand and an antisense strand, wherein the sense strand comprises a nucleotide sequence identical to a region selected from between any one of the following nucleotide positions from the 5' end of the human CFB mRNA sequence according to SEQ ID NO: 1: a) 503 to 523 and b) 2190 to 2210.

[0136] In some embodiments of the isolated oligonucleotides of the present disclosure, wherein the sense strand comprises a nucleotide sequence identical to a region selected from any one of the following nucleotide positions from the 5' end of the human CFB mRNA sequence according to SEQ ID NO: 1: a) 503 to 523 and b) 2190 to 2210, the double-stranded region comprises: i) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 5 (5' UAUAGCAGUGGAAAGAGAUCUC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 39 (5'GAUCUCUUUUCCACUGCUAUA 3'); or ii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 28 (5'UAAGUAUUGGGGUCAGCAUAGG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 62 (5'UAUGCUGACCCCAAUACUUA 3').

[0137] The present disclosure provides isolated oligonucleotides comprising a sense strand and an antisense strand, wherein the sense strand comprises a sequence substantially identical to a region selected from between any one of the following nucleotide positions from the 5' end of the human CFB mRNA sequence according to SEQ ID NO: 1: a) 493 to 534; b) 991 to 1054; c) 1384 to 1500; d) 1666 to 1686; e) 1821 to 1881; f) 2116 to 2136; g) 2232 to 2307, and h) 2394 to 2468.

[0138] The present disclosure provides isolated oligonucleotides comprising a sense strand and an antisense strand, wherein the sense strand comprises a sequence that is at least 70%, at least 80%, at least 90%, at least 95%, or at least 99% identical to a region selected from any one of the following nucleotide positions from the 5' end of the human CFB mRNA sequence according to SEQ ID NO: 1: a) 493 to 534; b) 991 to 1054; c) 1384 to 1500; d) 1666 to 1686; e) 1821 to 1881; f) 2116 to 2136; g) 2232 to 2307, and h) 2394 to 2468.

[0139] The present disclosure provides isolated oligonucleotides comprising a sense strand and an antisense strand, wherein the sense strand comprises a nucleotide sequence identical to a region selected from any one of the following nucleotide positions from the 5' end of the human CFB mRNA sequence according to SEQ ID NO: 1: a) 493 to 534; b) 991 to 1054; c) 1384 to 1500; d) 1666 to 1686; e) 1821 to 1881; f) 2116 to 2136; g) 2232 to 2307, and h) 2394 to 2468.

[0140] In some embodiments of the isolated oligonucleotides of the present disclosure, wherein the sense strand comprises a nucleotide sequence identical to a region selected from any one of the following nucleotide positions from the 5' end of the human CFB mRNA sequence according to SEQ ID NO: 1: a) 493 to 534; b) 991 to 1054; c) 1384 to 1500; d) 1666 to 1686; e) 1821 to 1881; f) 2116 to 2136; g) 2232 to 2307; and h) 2394 to 2468, the double-stranded region comprises: i) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 2 (5' UAAAGAGAUCUCAUCACUCACA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 36 (5' UGAGUGAUGAGAUCUCUUUA 3'); ii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 3 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 38 (5'AUGAGAUCUCUUUCCACUGA 3'); iv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 6 (5'UGUGUAACCGUCAUAGCAGUGG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 389 (5'ACUGCUAUGACGGUUACACA 3'); v) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 7 (5'UUUGACUAGACACUUUUUGGCU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 390 (5'ACUGCUAUGACGGUUACACA 3'). NO: 41 (5'CCAAAAAGUGUCUAGUCAAA 3'); vi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 9 (5'UAAUUAAGUUGACUAGACACUU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 43 (5'GUGUCUAGUCAACUUAAUUA 3'); vii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 11 (5'UAUAUCUUGGCUUCACACCAUA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 45 (5'UGGUGUGAAGCCAAGAUAUA 3');viii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 12 (5'UUAGACAUCCAGAUAAUCCUCC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 46 (5'AGGAUUAUCUGGAUGUCUAA 3'); ix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 13 (5'UAAGCAUUGAUGUUCACUUGGU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 47 (5'CAAGUGAACAUCAAUGCUUA 3'); x) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 14 (5'UAAAGCAUUGAUGUUCACUUGG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 48 (5'AAGUGAACAUCAAUGCUUUA 3'); xi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 15 (5'UAACACAUGUUGCUCAUUGUCU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 49 (5'ACAAUGAGCAACAUGUGUUA 3'); xii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 16 (5'UUUGACUUUGAACACAUGUUGC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 50 (5'AACAUGUGUUCAAAGUCAAA 3'); xiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 17 (5'UAUAUCCUUGACUUUGAACACA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 51 (5'UGUUCAAAGUCAAGGAUAUA 3'); xiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 19 (5'UAAGUACUCAGACACCACAGCC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 53 xv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 20 (5'UAUUCAGGAAUUCCUGCUUCUU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 54 (5'GAAGCAGGAAUUCCUGAAUA 3');xvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 21 (5'UAAUUCAGGAAUUCCUGCUUCU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 55 (5'AAGCAGGAAUUCCUGAAUUA 3'); xvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 22 (5'UUAAAAUUCAGGAAUUCCUGCU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 56 (5'CAGGAAUUCCUGAAUUUUAA 3'); xviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 23 (5'UAUAAAAUUCAGGAAUUCCUGC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 57 (5'AGGAAUUCCUGAAUUUUAUA 3'); xix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 24 (5'UGUCAUAAAAUUCAGGAAUUCC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 58 (5'AAUUCCUGAAUUUUAUGACA 3'); xx) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 26 (5'UUUAUUCUUGAGCUUGAUCAGG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 60 (5'UGAUCAAGCUCAAGAAUAAA 3'); xxi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 27 (5'UUUGACUUUGUCAUAGCCUGGG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 61 (5'CAGGCUAUGACAAAGUCAAA 3'); xxii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 29 (5'UUUCUCUUGUGAACUAUCAAGG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 63 xxiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 30 (5'UAAACGACUUCUCUUGUGAACU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 64 (5'UUCACAAGAGAAGUCGUUUA 3');xxiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 31 (5'UUUUUUGCAGACAUCCACUACU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 65 (5'UAGUGGAUGUCUGCAAAAAA 3'); xxv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 33 (5'UAACCCAAAUCCUCAUCUUGGA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 67 (5'CAAGAUGAGGAUUUGGGUUA 3'); xxvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 34 (5'UAAACCCAAAUCCUCAUCUUGG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 68 (5'AAGAUGAGGAUUUGGGUUUA 3'); or xxvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 35 (5'UCAGCUGUUUUAAUUCAAUCCC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 69 (5'GAUUGAAUUAAAACAGCUGA 3'). ;

[0141] The present disclosure provides isolated oligonucleotides comprising a sense strand and an antisense strand, wherein the sense strand comprises a sequence substantially identical to a region selected from between any one of the following nucleotide positions from the 5' end of the human CFB mRNA sequence according to SEQ ID NO: 1: a) 995 to 1019; b) 1606 to 1626; c) 1860 to 1880; and d) 2382 to 2402.

[0142] The present disclosure provides isolated oligonucleotides comprising a sense strand and an antisense strand, wherein the sense strand comprises a sequence that is at least 70%, at least 80%, at least 90%, at least 95%, or at least 99% identical to a region selected from any one of the following nucleotide positions from the 5' end of the human CFB mRNA sequence according to SEQ ID NO: 1: a) 995 to 1019; b) 1606 to 1626; c) 1860 to 1880; and d) 2382 to 2402.

[0143] The present disclosure provides isolated oligonucleotides comprising a sense strand and an antisense strand, wherein the sense strand comprises a nucleotide sequence identical to a region selected from between any one of the following nucleotide positions from the 5' end of the human CFB mRNA sequence according to SEQ ID NO: 1: a) 995 to 1019; b) 1606 to 1626; c) 1860 to 1880; and d) 2382 to 2402.

[0144] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a sequence identical to a region selected from any one of the following nucleotide positions from the 5' end of the CFB mRNA sequence according to SEQ ID NO: 1: a) 995 to 1019; b) 1606 to 1626; c) 1860 to 1880, and d) 2382 to 2402, and the double-stranded region includes: i) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 8 (5' UUAAGUUGACUAGACACUUUUU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 42 (5' AAAGUGUCUAGUCAACUUAA 3'); ii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 10 (5' UCAAUUAAGUUGACUAGACACU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 44 (5' UGUCUAGUCAACUUAAUUGA 3'); iii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 18 (5'UGAGAUCUUGGCCUGCCAUGGU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 52 (5'CAUGGCAGGCCAAGAUCUCA 3'); iv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 25 (5'UUAUUCUUGAGCUUGAUCAGGG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 59 (5'CUGAUCAAGCUCAAGAAUAA 3'); or v) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 32 (5'UCAUCUUGGAGUUUCUCCUUCA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 66 (5'AAGGAGAAACUCCAAGAUGA 3').

[0145] Knockdown of CFB by at least 50% at 0.1 nM In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a sequence identical to a region selected from any one of the following nucleotide positions from the 5' end of the human CFB mRNA sequence according to SEQ ID NO: 1: a) 493 to 534; b) 991 to 1054; c) 1384 to 1500; d) 1606 to 1686; e) 1821 to 1881; f) 2116 to 2307; and g) 2382 to 2468, and the antisense strand is substantially complementary to the sense strand such that the sense and antisense strands together form a double-stranded region, wherein the isolated oligonucleotide attenuates expression of CFB mRNA by at least 50% at a dose of 0.1 nM. (e.g., 50% to 55%, 55% to 60%, 60% to 65%, 65% to 70%, 70% to 75%, 75% to 80%, 80% to 85%, 85% to 90%, 90% to 95%, or 95% to 99%, 99% to 100%).

[0146] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a sequence identical to a region selected from the group consisting of: a) 493 to 534; b) 991 to 1054; c) 1384 to 1500; d) 1606 to 1686; e) 1821 to 1881; f) 2116 to 2307; and g) 2382 to 2468 of the human CFB mRNA sequence from the 5' end of SEQ ID NO: 1, and the antisense strand is substantially complementary to the sense strand such that the sense and antisense strands together form a double-stranded region, and the isolated oligonucleotide attenuates expression of CFB mRNA by at least 50% at a dose of 0.1 nM, wherein the double-stranded region includes: i) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 2 (5' UAAAGAGAUCUCAUCACUCA 3'), and i) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 36 (5' UAAAGAGAUCUCAUCACUCA 3'). 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 38 (5' AUGAGUGGAAAGAGAUCUCUUUA 3'); iv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 6 (5'UGUGUAACCGUCAUAGCAGUGG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 389 (5'ACUGCUAUGACGGUUACACA 3'); v) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 5'UGUGUGGAAAGAGAUCUCAUCA 3', and the sense strand of the nucleic acid sequence according to SEQ ID NO: 5'UGUGUGAUGAGAUCUCUUUA 3'; 7 (5'UUUGACUAGACACUUUUUGGCU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 41 (5'CCAAAAAGUGUCUAGUCAAA 3'); vi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 9 (5'UAAUUAAGUUGACUAGACACUU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 43 (5'GUGUCUAGUCAACUUAAUUA 3');vii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 11 (5'UAUAUCUUGGCUUCACACCAUA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 45 (5'UGGUGUGAAGCCAAGAUAUA 3'); viiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 12 (5'UUAGACAUCCAGAUAAUCCUCC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 46 (5'AGGAUUAUCUGGAUGUCUAA 3'); ix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 13 (5'UAAGCAUUGAUGUUCACUUGGU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 47 (5'CAAGUGAACAUCAAUGCUUA 3'); x) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 14 (5'UAAAGCAUUGAUGUUCACUUGG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 48 (5'AAGUGAACAUCAAUGCUUUA 3'); xi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 15 (5'UAACACAUGUUGCUCAUUGUCU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 49 (5'ACAAUGAGCAACAUGUGUUA 3'); xii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 16 (5'UUUGACUUUGAACACAUGUUGC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 50 (5'AACAUGUGUUCAAAGUCAAA 3'); xiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 17 (5'UAUAUCCUUGACUUUGAACACA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 51 (5'UGUUCAAAGUCAAGGAUAUA 3'); xiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 19 (5'UAAGUACUCAGACACCACAGCC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 53 (5'CUGUGGUGUCUGAGUACUUA 3');xv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 20 (5'UAUUCAGGAAUUCCUGCUUCUU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 54 (5'GAAGCAGGAAUUCCUGAAUA 3'); xvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 21 (5'UAAUUCAGGAAUUCCUGCUUCU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 55 (5'AAGCAGGAAUUCCUGAAUUA 3'); xvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 22 (5'UUAAAAUUCAGGAAUUCCUGCU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 56 (5'CAGGAAUUCCUGAAUUUUAA 3'); xviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 23 3'); xxi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 27 (5'UUUAUUCUUGAGCUUGAUCAGG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 28 (5'UUUAUUCUUGAGCUUGAUCAGG 3'); 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 61 (5'CAGGCUAUGACAAAGUCAAA 3'); xxii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 29 (5'UUUCUCUUGUGAACUAUCAAGG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 63 (5'UUGAUAGUUCACAAGAGAAA 3');xxiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 30 (5'UAAACGACUUCUCUUGUGAACU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 64 (5'UUCACAAGAGAAGUCGUUUA 3'); xxiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 31 (5'UUUUUUGCAGACAUCCACUACU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 65 (5'UAGUGGAUGUCUGCAAAAAA 3'); xxv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 33 (5'UAACCCAAAUCCUCAUCUUGGA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 67 (5'CAAGAUGAGGAUUUGGGUUA 3'); xxvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 34 3'); xxviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 8 (5'UUAAGUUGACUAGACACUUUUU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 42 (5'AAAGUGUCUAGUCAACUUAA 3'); xxix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 10 (5'UCAGCUGUUUUAAUUCAAUCCC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 11 (5'UCAGCUGUUUUAAUUCAAUCCC 3'); 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 44 (5'UGUCUAGUCAACUUAAUUGA 3'); xxx) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 18 (5'UGAGAUCUUGGCCUGCCAUGGU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 52 (5'CAUGGCAGGCCAAGAUCUCA 3');xxxi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 25 (5'UUAUUCUUGAGCUUGAUCAGGG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 59 (5'CUGAUCAAGCUCAAGAAUAA 3'); xxxii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 32 (5'UCAUCUUGGAGUUUCUCCUUCA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 66 (5'AAGGAGAAACUCCAAGAUGA 3'); xxxiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 5 (5'UAUAGCAGUGGAAAGAGAUCUC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 39 (5'GAUCUCUUUCCACUGCUAUA 3'); or xxxiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 28 (5'UAAGUAUUGGGGUCAGCAUAGG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 62 (5'UAUGCUGACCCCAAUACUUA 3'). ;

[0147] Knockdown of CFB by at least 50% at 0.02 nM In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a sequence identical to a region selected from any one of the following nucleotide positions from the 5' end of the human CFB mRNA sequence according to SEQ ID NO: 1: a) 493 to 534; b) 991 to 1054; c) 1384 to 1500; d) 1606 to 1686; e) 1821 to 1881; f) 2116 to 2307; and g) 2382 to 2468, and the antisense strand is substantially complementary to the sense strand such that the sense and antisense strands together form a double-stranded region, wherein the isolated oligonucleotide attenuates expression of CFB mRNA by at least 50% at a dose of 0.02 nM. (e.g., 50% to 55%, 55% to 60%, 60% to 65%, 65% to 70%, 70% to 75%, 75% to 80%, 80% to 85%, 85% to 90%, 90% to 95%, or 95% to 99%, 99% to 100%).

[0148] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a sequence identical to a region selected from the group consisting of: a) 493 to 534; b) 991 to 1054; c) 1384 to 1500; d) 1606 to 1686; e) 1821 to 1881; f) 2116 to 2307, and g) 2382 to 2468, from the 5' end of the human CFB mRNA sequence according to SEQ ID NO: 1, and the antisense strand is substantially complementary to the sense strand such that the sense and antisense strands together form a double-stranded region, and the isolated oligonucleotide attenuates expression of CFB mRNA by at least 50% at a dose of 0.02 nM, wherein the double-stranded region comprises: i) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 2 (5' UAAAGAGAUCUCAUCACUCA 3'), and i) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 36 (5' UAAAGAGAUCUCAUCACUCA 3'). 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 38 (5' AUGAGUGGAAAGAGAUCUCUUUA 3'); iv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 6 (5'UGUGUAACCGUCAUAGCAGUGG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 389 (5'ACUGCUAUGACGGUUACACA 3'); v) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 5'UGUGUGGAAAGAGAUCUCAUCA 3', and the sense strand of the nucleic acid sequence according to SEQ ID NO: 5'UGAGUGUGAUGAGAUCUCUUUA 3'; 9 (5'UAAUUAAGUUGACUAGACACUU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 43 (5'GUGUCUAGUCAACUUAAUUA 3'); vi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 12 (5'UUAGACAUCCAGAUAAUCCUCC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 46 (5'AGGAUUAUCUGGAUGUCUAA 3');vii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 13 (5'UAAGCAUUGAUGUUCACUUGGU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 47 (5'CAAGUGAACAUCAAUGCUUA 3'); viiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 14 (5'UAAAGCAUUGAUGUUCACUUGG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 48 (5'AAGUGAACAUCAAUGCUUUA 3'); ix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 22 (5'UUAAAAUUCAGGAAUUCCUGCU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 56 (5'CAGGAAUUCCUGAAUUUUAA 3'); x) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 23 (5'UAUAAAAUUCAGGAAUUCCUGC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 57 (5'AGGAAUUCCUGAAUUUUAUA 3'); xi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 24 (5'UGUCAUAAAAUUCAGGAAUUCC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 58 (5'AAUUCCUGAAUUUUAUGACA 3'); xii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 30 (5'UAAACGACUUCUCUUGUGAACU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 64 (5'UUCACAAGAGAAGUCGUUUA 3'); xiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 34 (5'UAAACCCAAAUCCUCUCAUCUUGG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 68 (5'AAGAUGAGGAUUUGGGUUUA 3'); xiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 35 (5'UCAGCUGUUUUAAUUCAAUCCC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 69 (5'GAUUGAAUUAAAACAGCUGA 3');xv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 5 (5'UAUAGCAGUGGAAAGAGAUCUC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 39 (5'GAUCUCUUUUCCACUGCUAUA 3'); or xvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 28 (5'UAAGUAUUGGGGUCAGCAUAGG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 62 (5'UAUGCUGACCCCAAUACUUA 3');

[0149] 0.02 nM knocks down CFB by 20% - 50% In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a nucleotide sequence substantially identical to a region of 19-25 nucleotides selected from any one of the following nucleotide positions from the 5' end of the human CFB mRNA sequence according to SEQ ID NO: 1: a) 493 to 534; b) 991 to 1054; c) 1384 to 1500; d) 1606 to 1686; e) 1821 to 1881; f) 2116 to 2307; and g) 2382 to 2468, and the antisense strand is substantially complementary to the sense strand such that the sense and antisense strands together form a double-stranded region, and the isolated oligonucleotide attenuates expression of CFB mRNA by 20% to 50% at a dose of 0.02 nM. (e.g., 20% to 25%, 25% to 30%, 30% to 35%, 35% to 40%, 40% to 45%, or 45% to 50%).

[0150] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a nucleotide sequence substantially identical to a region of 19-25 nucleotides selected from any one of the following nucleotide positions from the 5' end of the human CFB mRNA sequence according to SEQ ID NO: 1: a) 493 to 534; b) 991 to 1054; c) 1384 to 1500; d) 1606 to 1686; e) 1821 to 1881; f) 2116 to 2307; and g) 2382 to 2468, and the antisense strand is substantially complementary to the sense strand such that the sense and antisense strands together form a double-stranded region, and the isolated oligonucleotide attenuates expression of CFB mRNA by 20% to 50% at a dose of 0.02 nM, wherein the double-stranded region comprises: i) a nucleotide sequence according to SEQ ID NO: 8 (5' UUAAGUUGACUAGACACUUUUU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 42 (5'AAAGUGUCUAGUCAACUUAA 3'); ii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 10 (5'UCAAUUAAGUUGACUAGACACU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 44 (5'UGUCUAGUCAACUUAAUUGA 3'); iii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 18 (5'UGAGAUCUUGGCCUGCCAUGGU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 52 (5'CAUGGCAGGCCAAGAUCUCA 3'); iv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 25 (5'UUAUUCUUGAGCUUGAUCAGGG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 59 (5'CUGAUCAAGCUCAAGAAUAA 3'); v) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 32 (5'UCAUCUUGGAGUUUCUCCUUCA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 66 (5'AAGGAGAAACUCCAAGAUGA 3'); vi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 31 (5'UUUUUUGCAGACAUCCACUACU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 65 (5'UAGUGGAUGUCUGCAAAAAA 3');vii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 33 (5'UAACCCAAAUCCUCAUCUUGGA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 67 (5'CAAGAUGAGGAUUUGGGUUA 3'); viiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 26 (5'UUUAUUCUUGAGCUUGAUCAGG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 60 (5'UGAUCAAGCUCAAGAAUAAA 3'); ix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 27 (5'UUUGACUUUGUCAUAGCCUGGG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 61 (5'CAGGCUAUGACAAAGUCAAA 3'); x) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 29 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 50 (5'AACAUGUGUUCAAAGUCAAA 3'); xii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 16 (5'UUUGACUUUGAACACAUGUUGC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 51 (5'AACAUGUGUUCAAAGUCAAA 3'); xiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 17 (5'UAUAUCCUUGACUUUGAACACA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 51 (5'UGUUCAAAGUCAAGGAUAUA 3'); xiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 19 (5'UAAGUACUCAGACACCACAGCC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 53 (5'CUGUGGUGUCUGAGUACUUA 3');xv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 20 (5'UAUUCAGGAAUUCCUGCUUCUU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 54 (5'GAAGCAGGAAUUCCUGAAUA 3'); xvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 21 (5'UAAUUCAGGAAUUCCUGCUUCU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 55 (5'AAGCAGGAAUUCCUGAAUUA 3'); xvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 7 (5'UUUGACUAGACACUUUUUGGCU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 41 (5'CCAAAAAGUGUCUAGUCAAA 3'); or xviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 11 (5'UAUAUCUUGGCUUCACACCAUA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 45 (5'UGGUGUGAAGCCAAGAUAUA 3'). ;

[0151] The present disclosure provides isolated oligonucleotides comprising a sense strand and an antisense strand, wherein the sense strand comprises a nucleotide sequence substantially identical to a region of 19-25 nucleotides comprised between any one of the following nucleotide positions from the 5' end of the CFB mRNA sequence according to SEQ ID NO: 1: a) 5 to 38; b) 340 to 606; c) 776 to 828; d) 939 to 1227; e) 1305 to 1606; f) 1667 to 1746; g) 1815 to 2313; and h) 2378 to 2417, and the antisense strand is substantially complementary to the sense strand such that the sense strand and antisense strand together form a double-stranded region.

[0152] 0.1 nM knocks down CFB by 20% - 50% In some embodiments of the isolated oligonucleotide comprising a sense strand and an antisense strand, the sense strand comprises a nucleotide sequence substantially identical to a region of 19-25 nucleotides selected from any one of the following nucleotide positions from the 5' end of the CFB mRNA sequence according to SEQ ID NO: 1: a) 5 to 38; b) 340 to 606; c) 776 to 828; d) 939 to 1227; e) 1305 to 1606; f) 1667 to 1746; g) 1815 to 2313; and h) 2378 to 2417, and the antisense strand is substantially complementary to the sense strand such that the sense strand and antisense strand together form a double-stranded region, and the isolated oligonucleotide attenuates expression of CFB mRNA by 20% to 50% at a dose of 0.1 nM.

[0153] In some embodiments of the isolated oligonucleotide comprising a sense strand and an antisense strand, the sense strand comprises a nucleotide sequence substantially identical to a region of 19-25 nucleotides selected from any one of the following nucleotide positions from the 5' end of the CFB mRNA sequence according to SEQ ID NO: 1: a) 5 to 38; b) 340 to 606; c) 776 to 828; d) 939 to 1227; e) 1305 to 1606; f) 1667 to 1746; g) 1845 to 2313; and h) 2378 to 2417, and the antisense strand is substantially complementary to the sense strand such that the sense strand and antisense strand together form a double-stranded region, and the isolated oligonucleotide attenuates expression of CFB mRNA by 20% to 50% at a dose of 0.1 nM, wherein the double-stranded region comprises: i) a CFB mRNA sequence according to SEQ ID NO: 94 (5' UGACACUUUUUGGCUCCUGUGA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 204 (5'ACAGGAGCCAAAAAGUGUCA 3'); ii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 124 (5'UAUGUUGCUCAUUGUCUUUCUU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 234 (5'GAAAGACAAUGAGCAACAUA 3'); iii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 169 (5'UCUCUUGUGAACUAUCAAGGGG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 279 (5'CCUUGAUAGUUCACAAGAGA 3'); iv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 87 (5'UGUACAUGAAGGAGUCUUGGCA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 197 v) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 163 (5'UGUCAGCAUAGGGACUCACUCC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 273 (5'AGUGAGUCCCUAUGCUGACA 3'); vi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 104 (5'UCUUCAACUUGUGGUCUUCAUA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 214 (5'UGAAGACCACAAGUUGAAGA 3');vii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 121 (5'UCUCAUUGUCUUUCUUGGAAGC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 231 (5'UUCCAAGAAAGACAAUGAGA 3'); viiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 99 (5'UUUCUCAAUUAAGUUGACUAGA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 209 (5'UAGUCAACUUAAUUGAGAAA 3'); ix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 155 (5'UCUCUCUCACAGCUGCCUUUCU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 265 (5'AAAGGCAGCUGUGAGAGA 3'); x) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 144 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 186 (5'GCAGAGUGCAGAGCAAUCCA 3'); xiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 134 (5'UAACAAUGUGCUGCUGUCAG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 186 (5'UGGAUUGCUCUGCACUCUGCCU 3'); xiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 134 (5'UAACAAUGUGCUGCUGUCAG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 244 (5'CUGACAGCAGCACAUUGUUA 3'); xiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 158 (5'UAUUGAGCAUCUCUCUCACAGC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 268 (5'UGUGAGAGAGAUGCUCAAUA 3');xv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 153 (5'UCAUUCUUGAUGUAGACCUCCU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 263 (5'GAGGUCUACAUCAAGAAUGA 3'); xvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 73 (5'UGAAACUCCAGACCUAGACCUG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 183 (5'GGUCUAGGUCUGGAGUUUCA 3'); xvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 152 (5'UCUUGAUGUAGACCUCCUUCCG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 262 (5'GAAGGAGGUCUACAUCAAGA 3'); xviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 147 3'); xxi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 118 (5'UUUUCUUGGAAGCCAAAGCAUU 3'); 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 228 (5'UGCUUUGGCUUCCAAGAAAA 3'); xxii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 149 (5'UAAACAGAGCUUUGAUAUCCUG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 259 (5'GGAUAUCAAAGCUCUGUUUA 3');xxiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 95 (5'UGACUAGACACUUUUUGGCUCC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 205 (5'AGCCAAAAAGUGUCUAGUCA 3'); xxiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 142 (5'UUUCUUGAGCUUGAUCAGGGCA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 252 (5'CCCUGAUCAAGCUCAAGAAA 3'); xxv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 160 (5'UCAUAUUGAGCAUCUCUCUCAC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 270 (5'GAGAGAGAUGCUCAAUAUGA 3'); xxvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 164 (5'UUUCUUGAGCUUGAUCAGGGCA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 165 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 196 (5'UGUAUUGGGGUCAGCAUAGGGA 3'); xxvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 74 (5'UUGAAACUCCAGACCUAGACCU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 184 (5'GUCUAGGUCUGGAGUUUCAA 3'); xxviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 91 (5'UAUCCAUCUAGCACCAGGUAGA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 201 (5'UACCUGGUGCUAGAUGGAUA 3'); xxix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 167 (5'UGUGAACUAUCAAGGGGCCGCC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 277 (5'CGGCCCCUUGAUAGUUCACA 3'); xxx) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 175 (5'UUUGGAGUUUCUCCUUCAGCCA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 285 (5'GCUGAAGGAGAAACUCCAAA 3');xxxi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 72 (5'UAAACUCCAGACCUAGACCUGG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 182 (5'AGGUCUAGGUCUGGAGUUUA 3'); xxxii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 119 (5'UCUUUCUUGGAAGCCAAAGCAU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 229 (5'GCUUUGGCUUCCAAGAAAGA 3'); xxxiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 154 (5'UCUUUCUUAUCCCCAUUCUUGA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 264 (5'AAGAAUGGGGAUAAGAAAGA 3'); xxxiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 70 3'); xxxvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 116 (5'UCAAAGCAUUGAUGUUCACUUG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 226 (5'AGUGAACAUCAAUGCUUUGA 3'); xxxvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 84 (5'UGAGAGUGUAACCGUCAUAGCACC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 85 (5'UGAGAGUGUAACCGUCAUAGCACC 3'). 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 194 (5'CUAUGACGGUUACACUCUCA 3'); xxxviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 89 (5'UGUCGUACAUGAAGGAGUCUUG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 199 (5'AGACUCCUUCAUGUACGACA 3');xxxix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 83 (5'UGAGUGUAACCGUCAUAGCAGU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 193 (5'UGCUAUGACGGUUACACUCA 3'); xL) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 107 (5'UUAAUUGGGUCCCCGCCCAUGU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 217 (5'AUGGGCGGGGACCCAAUUAA 3'); xLi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 100 (5'UAUAACUUGCCACCUUCUCAAU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 210 (5'UGAGAAGGUGGCAAGUUAUA 3'); xLii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 157 3'); xLiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 105 (5'UGACUUCAACUUGUGGUCUUCA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 215 (5'AAGACCACAAGUUGAAGUCA 3'); xLv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 130 (5'UCAGGUUUUCCAUAUCCUUGAC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 240 (5'CAAGGAUAUGGAAAACCUGA 3'); xLvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 166 (5'UAACUAUCAAGGGGCCGCCAGA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 276 (5'UGGCGGCCCCUUGAUAGUUA 3');xLvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 131 (5'UCACAGAGACUCAGAGACUGGC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 241 (5'CAGUCUCUGAGUCUCUGUGA 3'); xLviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 127 (5'UCUUUGAACACAUGUUGCUCAU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 237 (5'GAGCAACAUGUGUUCAAAGA 3'); xLix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 111 (5'UAUCAAUGACAGUAAUUGGGUC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 221 (5'CCCAAUUACUGUCAUUGAUA 3'); L) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 93 (5'UCUUUUUGGCUCCUGUGAAGUU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 203 (5'CUUCACAGGAGCCAAAAAGA 3'); or (11) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 71 (5'UAACUCCAGACCUAGACCUGGU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 181 (5'CAGGUCUAGGUCUGGAGUUA 3');

[0154] Knockdown of CFB by at least 50% at 0.1 nM In some embodiments of the isolated oligonucleotide comprising a sense strand and an antisense strand, the sense strand comprises a nucleotide sequence substantially identical to a region of 19-25 nucleotides comprised between any one of the following nucleotide positions from the 5' end of the CFB mRNA sequence according to SEQ ID NO: 1: a) 5 to 38; b) 340 to 606; c) 776 to 828; d) 939 to 1227; e) 1305 to 1606; f) 1667 to 1746; g) 1815 to 2313; and h) 2378 to 2417, and the antisense strand is substantially complementary to the sense strand such that the sense strand and antisense strand together form a double-stranded region, and the isolated oligonucleotide attenuates expression of CFB mRNA by at least 50% at a dose of 0.1 nM.

[0155] In some embodiments of the isolated oligonucleotide comprising a sense strand and an antisense strand, the sense strand comprises a nucleotide sequence substantially identical to a region of 19-25 nucleotides selected from any one of the following nucleotide positions from the 5' end of the CFB mRNA sequence according to SEQ ID NO: 1: a) 5 to 38; b) 340 to 606; c) 776 to 828; d) 939 to 1227; e) 1305 to 1606; f) 1667 to 1746; g) 1845 to 2313; and h) 2378 to 2417, and the antisense strand is substantially complementary to the sense strand such that the sense strand and antisense strand together form a double-stranded region, and the isolated oligonucleotide attenuates expression of CFB mRNA by at least 50% at a dose of 0.1 nM, wherein the double-stranded region comprises: i) a CFB mRNA sequence according to SEQ ID NO: 171 (5' UAUGAAACGACUUCUCUUGUGA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 281 (5'ACAAGAGAAGUCGUUUCAUA 3'); ii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 165 (5'UAUCACCUCUGCAAGUAUUGGG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 275 (5'CAAUACUUGCAGAGGUGAUA 3'); iii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 129 (5'UUUUCCAUAUCCUUGACUUUGA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 239 (5'AAAGUCAAGGAUAUGGAAAA 3'); iv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 176 (5'UAUCUUGGAGUUUCUCCUUCAG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 3'); v) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 177 (5'UCUCAUCUUGGAGUUUCUCCUU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 287 (5'GGAGAAACUCCAAGAUGAGA 3'); vi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 138 (5'UCAUAAAAUUCAGGAAUUCCUG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 248 (5'GGAAUUCCUGAAUUUUAUGA 3');vii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 140 (5'UGUCAUAGUCAUAAAAUUCAGG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 250 (5'UGAAUUUUAUGACUAUGACA 3'); viiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 148 (5'UAACAGAGCUUUGAUAUCCUGU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 258 (5'AGGAUAUCAAAGCUCUGUUA 3'); ix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 150 (5'UCAAACAGAGCUUUGAUAUCCU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 260 (5'GAUAUCAAAGCUCUGUUUGA 3'); x) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 179 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 282 (5'GUAGUGGAUGUCUGCAAAAA 3'); xiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 88 (5'UCGUACAUGAAGGAGUCUUGGC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 198 (5'CAAGACUCCUUCAUGUACGA 3'); xiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 168 (5'UUUGUGAACUAUCAAGGGGCCG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 278 (5'GCCCCUUGAUAGUUCACAAA 3');xv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 81 (5'UGUGGAAAGAGAUCUCAUCACU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 191 (5'UGAUGAGAUCUCUUUCCACA 3'); xvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 159 (5'UAUAUUGAGCAUCUCUCUCACA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 269 (5'UGAGAGAGAUGCUCAAUAUA 3'); xvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 82 (5'UCAUAGCAGUGGAAAGAGAUCU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 192 (5'AUCUCUUUCCACUGCUAUGA 3'); xviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 97 3'); xxi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 126 (5'UUUUGCUUGUGGUAAUCGGUACC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 127 (5'AAGUGUCUAGUCAACUUAAA 3'); xiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 134 (5'UUUGCUUGUGGUAAUCGGUACC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 137 (5'UUUGCUUGUGGUAAUCGGUACC 3'); xx) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 123 (5'UGUUGCUCAUUGUCUUUCUUGG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 124 (5'AAGAAAGACAAUGAGCAACA 3'); xxi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 126 (5'UUUUGAACACAUGUUGCUCAUU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 236 (5'UGAGCAACAUGUGUUCAAA 3'); xxii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 162 (5'UGAGAUGUCCUUGACUUUGUCA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 272 (5'ACAAAGUCAAGGACAUCUCA 3');xxiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 79 (5'UCAUCACUCACAUUGUAGUAGG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 189 (5'UACUACAAUGUGAGUGAUGA 3'); xxiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 151 (5'UCAGACACAAACAGAGCUUUGA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 261 (5'AAAGCUCUGUUUGUGUCUGA 3'); xxv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 143 (5'UAUUCUUGAGCUUGAUCAGGGC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 253 (5'CCUGAUCAAGCUCAAGAAUA 3'); xxvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 117 3'); xxviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 122 (5'UUUGCUCAUUGUCUUUCUUGGA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 232 (5'CAAGAAAGACAAUGAGCAAA 3'); xxix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 110 (5'UCAAUGACAGUAAUUGGGUCCC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 111 (5'UCAAUGACAGUAAUUGGGUCCC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 220 (5'GACCCAAUUACUGUCAUUGA 3'); xxx) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 173 (5'UGUUUUUGCAGACAUCCACUAC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 283 (5'AGUGGAUGUCUGCAAAAACA 3');xxxi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 156 (5'UGAGCAUCUCUCUCACAGCUGC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 266 (5'AGCUGUGAGAGAGAUGCUCA 3'); xxxii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 141 (5'UCUUGAUCAGGGCAACGUCAUA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 251 (5'UGACGUUGCCCUGAUCAAGA 3'); xxxiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 135 (5'UCUUGAUUGAGUGUUCCUUGUC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 245 (5'CAAGGAACACUCAAUCAAGA 3'); xxxiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 170 3'); xxxvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 114 (5'UAUAGACAUCCAGAUAAUCCUC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 224 (5'GGAUUAUCUGGAUGUCUAUA 3'); xxxvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 139 (5'UCAUAGUCAUAAAAUUCAGGAA 3'); 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 249 (5'CCUGAAUUUUAUGACUAUGA 3'); xxxviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 125 (5'UCAUGUUGCUCAUUGUCUUUCU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 235 (5'AAAGACAAUGAGCAACAUGA 3');xxxix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 145 (5'UGAGACAAAUGGGCCUGAUAGU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 255 (5'UAUCAGGCCCAUUUGUCUCA 3'); xL) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 113 (5'UCUCAUCAAUGACAGUAAUUGG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 223 (5'AAUUACUGUCAUUGAUGAGA 3'); xLi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 120 (5'UGUCUUUCUUGGAAGCCAAAGC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 230 (5'UUUGGCUUCCAAGAAAGACA 3'); xLii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 75 3'); xLiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 108 (5'UAUGACAGUAAUUGGGUCCCCG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 218 (5'GGGACCCAAUUACUGUCAUA 3'); xLv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 128 (5'UGACUUUGAACACAUGUUGCUC 3'); 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 238 (5'GCAACAUGUGUUCAAAGUCA 3'); xLvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 161 (5'UCUUGACUUUGUCAUAGCCUGG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 271 (5'AGGCUAUGACAAAGUCAAGA 3');xLvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 85 (5'UUUGUCACAGAUCGCUGUCUGC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 195 (5'AGACAGCGAUCUGUGACAAA 3'); xLviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 137 (5'UGAAUUCCUGCUUCUUUUUUCC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 247 (5'AAAAAAGAAGCAGGAAUUCA 3'); xLix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 80 (5'UGAAAGAGAUCUCAUCACUCAC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 190 (5'GAGUGAUGAGAUCUCUUUCA 3'); L) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 115 3'); Lii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 146 (5'UAAGUGGUAGUUGGAGGAAGCC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 256 (5'CUUCCUCCAACUACCACUUA 3'); Liii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 78 (5'UAUCACUCACAUUGUAGGG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 79 (5'UAUCACUCACAUUGUAGGG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 188 (5'CUACUACAAUGUGAGUGAUA 3'); Liv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 103 (5'UUUCACACCAUAACUUGCCACC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 213 (5'UGGCAAGUUAUGGUGUGAAA 3');Lv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 102 (5'UCACCAUAACUUGCCACCUUCU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 212 (5'AAGGUGGCAAGUUAUGGUGA 3'); Lvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 109 (5'UAAUGACAGUAAUUGGGUCCCC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 219 (5'GGACCCAAUUACUGUCAUUA 3'); Lvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 86 (5'UCAUGAAGGAGUCUUGGCAGGA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 196 (5'CUGCCAAGACUCCUUCAUGA 3'); Lviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 106 (5'UCUCAUCAUGCUGUACACUGCC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 216 (5'CAGUGUACAGCAUGAUGAGA 3'); (ix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 98 (5'UCUCAAUUAAGUUGACUAGACA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 208 (5'UCUAGUCAACUUAAUUGAGA 3');

[0156] 0.02 nM knocks down CFB by 20% - 50% In some embodiments of the isolated oligonucleotide comprising a sense strand and an antisense strand, the sense strand comprises a nucleotide sequence substantially identical to a region of 19-25 nucleotides selected from any one of the following nucleotide positions from the 5' end of the CFB mRNA sequence according to SEQ ID NO: 1: a) 5 to 38; b) 340 to 606; c) 776 to 828; d) 939 to 1227; e) 1305 to 1606; f) 1667 to 1746; g) 1815 to 2313; and h) 2378 to 2417, and the antisense strand is substantially complementary to the sense strand such that the sense and antisense strands together form a double-stranded region, and the isolated oligonucleotide attenuates expression of CFB mRNA by 20% to 50% at a dose of 0.02 nM.

[0157] In some embodiments of the isolated oligonucleotide comprising a sense strand and an antisense strand, the sense strand comprises a nucleotide sequence substantially identical to a region of 19-25 nucleotides selected from any one of the following nucleotide positions from the 5' end of the CFB mRNA sequence according to SEQ ID NO: 1: a) 5 to 38; b) 340 to 606; c) 776 to 828; d) 939 to 1227; e) 1305 to 1606; f) 1667 to 1746; g) 1845 to 2313; and h) 2378 to 2417, and the antisense strand is substantially complementary to the sense strand such that the sense strand and antisense strand together form a double-stranded region, and the isolated oligonucleotide attenuates expression of CFB mRNA by 20% to 50% at a dose of 0.02 nM, wherein the double-stranded region comprises: i) a CFB mRNA sequence according to SEQ ID NO: 165 (5' UAUCACCUCUGCAAGUAUUGGG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 275 (5'CAAUACUUGCAGAGGUGAUA 3'); ii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 129 (5'UUUUCCAUAUCCUUGACUUUGA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 239 (5'AAAGUCAAGGAUAUGGAAAA 3'); iii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 176 (5'UAUCUUGGAGUUUCUCCUUCAG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 286 (5'GAAGGAGAAACUCCAAGAUA 3'); iv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 177 (5'UCUCAUCUUGGAGUUUCUCCUU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: v) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 138 (5'UCAUAAAAUUCAGGAAUUCCUG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 248 (5'GGAAUUCCUGAAUUUUAUGA 3'); vi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 140 (5'UGUCAUAGUCAUAAAAUUCAGG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 250 (5'UGAAUUUUAUGACUAUGACA 3');vii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 148 (5'UAACAGAGCUUUGAUAUCCUGU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 258 (5'AGGAUAUCAAAGCUCUGUUA 3'); viiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 150 (5'UCAAACAGAGCUUUGAUAUCCU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 260 (5'GAUAUCAAAGCUCUGUUUGA 3'); ix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 179 (5'UGAAAACCCAAAUCCUCAUCUU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 289 (5'GAUGAGGAUUUGGGUUUUCA 3'); x) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 90 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 198 (5'CAAGACUCCUUCAUGUACGA 3'); xiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 168 (5'UUUUUGCAGACAUCCACUACUC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 180 (5'UUUUUGCAGACAUCCACUACUC 3'); 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 278 (5'GCCCCUUGAUAGUUCACAAA 3'); xiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 81 (5'UGUGGAAAGAGAUCUCAUCACU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 191 (5'UGAUGAGAUCUCUUUCCACA 3');xv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 159 (5'UAUAUUGAGCAUCUCUCUCACA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 269 (5'UGAGAGAGAUGCUCAAUAUA 3'); xvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 82 (5'UCAUAGCAGUGGAAAGAGAUCU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 192 (5'AUCUCUUUCCACUGCUAUGA 3'); xvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 97 (5'UUUAAGUUGACUAGACACUUUU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 207 (5'AAGUGUCUAGUCAACUUAAA 3'); xviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 132 3'); xxi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 117 (5'UAAGCCAAAGCAUUGAUGUUCA 3'); 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 227 (5'AACAUCAAUGCUUUGGCUUA 3'); xxii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 122 (5'UUUGCUCAUUGUCUUUCUUGGA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 232 (5'CAAGAAAGACAAUGAGCAAA 3');xxiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 110 (5'UCAAUGACAGUAAUUGGGUCCC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 220 (5'GACCCAAUUACUGUCAUUGA 3'); xxxiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 135 (5'UCUUGAUUGAGUGUUCCUUGUC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 245 (5'CAAGGAACACUCAAUCAAGA 3'); xxv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 178 (5'UAAUCCUCAUCUUGGAGUUUCU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 288 (5'AAACUCCAAGAUGAGGAUUA 3'); xxvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 114 3'); xxviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 113 (5'UCUCAUCAAUGACAGUAAUUGG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 223 (5'AAUUACUGUCAUUGAUGAGA 3'); xix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 120 (5'UGUCUUUCUUGGAAGCCAAAGC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 230 (5'UUUGGCUUCCAAGAAAGACA 3'); xxx) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 75 (5'UGAUCUGCAGGUACGUGUCUGC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 185 (5'AGACACGUACCUGCAGAUCA 3');xxxi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 112 (5'UCAUCAAUGACAGUAAUUGGGU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 222 (5'CCAAUUACUGUCAUUGAUGA 3'); xxxii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 108 (5'UAUGACAGUAAUUGGGUCCCCG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 218 (5'GGGACCCAAUUACUGUCAUA 3'); xxxiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 115 (5'UCAUAGACAUCCAGAUAAUCCU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 225 (5'GAUUAUCUGGAUGUCUAUGA 3'); xxxiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 102 3'); xxxvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 106 (5'UCUCAUCAUGCUGUACACUGCC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 216 (5'CAGUGUACAGCAUGAUGAGA 3'); xxxvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 98 (5'UCUCAAUUAAGUUGACUAGACA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 208 (5'UCUAGUCAACUUAAUUGAGA 3'); xxxviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 124 (5'UAUGUUGCUCAUUGUCUUUCUU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 234 (5'GAAAGACAAUGAGCAACAUA 3');xxxix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 121 (5'UCUCAUUGUCUUUCUUGGAAGC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 231 (5'UUCCAAGAAAGACAAUGAGA 3'); or xL) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 107 (5'UUAAUUGGGUCCCCGCCCAUGU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 217 (5'AUGGGCGGGGACCCAAUUAA 3');

[0158] Knockdown of CFB by at least 50% at 0.02 nM In some embodiments of the isolated oligonucleotide comprising a sense strand and an antisense strand, the sense strand comprises a nucleotide sequence substantially identical to a region of 19-25 nucleotides selected from any one of the following nucleotide positions from the 5' end of the CFB mRNA sequence according to SEQ ID NO: 1: a) 5 to 38; b) 340 to 606; c) 776 to 828; d) 939 to 1227; e) 1305 to 1606; f) 1667 to 1746; g) 1815 to 2313; and h) 2378 to 2417, and the antisense strand is substantially complementary to the sense strand such that the sense strand and antisense strand together form a double-stranded region, and the isolated oligonucleotide attenuates expression of CFB mRNA by at least 50% at a dose of 0.02 nM.

[0159] In some embodiments of the isolated oligonucleotide comprising a sense strand and an antisense strand, the sense strand comprises a nucleotide sequence substantially identical to a region of 19-25 nucleotides selected from any one of the following nucleotide positions from the 5' end of the CFB mRNA sequence according to SEQ ID NO: 1: a) 5 to 38; b) 340 to 606; c) 776 to 828; d) 939 to 1227; e) 1305 to 1606; f) 1667 to 1746; g) 1815 to 2313, and h) 2378 to 2417, and the antisense strand is substantially complementary to the sense strand such that the sense strand and antisense strand together form a double-stranded region, and the isolated oligonucleotide attenuates expression of CFB mRNA by at least 50% at a dose of 0.02 nM, wherein the double-stranded region comprises the CFB mRNA sequence according to SEQ ID NO: 171 (5' UAUGAAACGACUUCUCUUGUGA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 281 (5'ACAAGAGAAGUCGUUUCAUA 3').

[0160] In vivo reduction of CFB expression In some embodiments of the isolated oligonucleotide comprising a sense strand and an antisense strand, the sense strand comprises a nucleotide sequence substantially identical to a region of 19-25 nucleotides comprised between any one of the following nucleotide positions from the 5' end of the CFB mRNA sequence according to SEQ ID NO: 1: a) 493 to 534; b) 995 to 1018; c) 1034 to 1054; d) 1384 to 1404; e) 1431 to 1500; f) 1606 to 1686; g) 1822 to 1849; h) 1860 to 1881; i) 2190 to 2210; j) 2239 to 2262; k) 2287 to 2307; l) 2382 to 2402; m) 2395 to 2415 and n) 2448 to 2468, and the antisense strand is substantially complementary to the sense strand, such that the sense strand and the antisense strand together form a double-stranded region, and the isolated oligonucleotide attenuates expression of CFB mRNA by at least 25% at a dose of 1 mg / kg.

[0161] In some embodiments of the isolated oligonucleotide comprising a sense strand and an antisense strand, the sense strand comprises a nucleotide sequence substantially identical to a region of 19-25 nucleotides comprised between any one of the following nucleotide positions from the 5' end of the CFB mRNA sequence according to SEQ ID NO: 1: a) 493 to 534; b) 995 to 1018; c) 1034 to 1054; d) 1384 to 1404; e) 1431 to 1500; f) 1606 to 1686; g) 1822 to 1849; h) 1860 to 1881; i) 2190 to 2210; j) 2239 to 2262; k) 2287 to 2307; l) 2382 to 2402; m) 3'); iii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 4 (5'UGGUGGAAAGAGAUCUCAUCA 3'); and iv) the sense strand of the nucleic acid sequence according to SEQ ID NO: 5'UGGAAAGAGAUCUCAUCA 3'. 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 38 (5'AUGAGAUCUCUUUUCCACUGA 3'); iv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 5 (5'UAUAGCAGUGGAAAGAGAUCUC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 39 (5'GAUCUCUUUCCACUGCUAUA 3'); v) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 6 (5'UGUGUAACCGUCAUAGCAGUGG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 391 (5'ACUGCUAUGACGGUUACACA 3');vi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 8 (5'UUAAGUUGACUAGACACUUUUU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 42 (5'AAAGUGUCUAGUCAACUUAA 3'); vii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 9 (5'UAAUUAAGUUGACUAGACACUU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 43 (5'GUGUCUAGUCAACUUAAUUA 3'); viii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 11 (5'UAUAUCUUGGCUUCACACCAUA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 45 (5'UGGUGUGAAGCCAAGAUAUA 3'); ix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 12 (5'UUAGACAUCCAGAUAAUCCUC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 46 (5'AGGAUUAUCUGGAUGUCUAA 3'); x) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 13 (5'UAAGCAUUGAUGUUCACUUGGU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 47 (5'CAAGUGAACAUCAAUGCUUA 3'); xi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 14 (5'UAAAGCAUUGAUGUUCACUUGG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 48 (5'AAGUGAACAUCAAUGCUUUA 3'); xii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 15 (5'UAACACAUGUUGCUCAUUGUCU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 49 xiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 16 (5'UUUGACUUUGAACACAUGUUGC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 50 (5'AACAUGUGUUCAAAGUCAAA 3');xiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 17 (5'UAUAUCCUUGACUUUGAACACA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 51 (5'UGUUCAAAGUCAAGGAUAUA 3'); xv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 18 (5'UGAGAUCUUGGCCUGCCAUGGU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 52 (5'CAUGGCAGGCCAAGAUCUCA 3'); xvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 19 (5'UAAGUACUCAGACACCACAGCC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 53 (5'CUGUGGUGUCUGAGUACUUA 3'); xvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 21 (5'UAAUUCAGGAAUUCCUGCUUCU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 55 (5'AAGCAGGAAUUCCUGAAUUA 3'); xviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 22 (5'UUAAAAUUCAGGAAUUCCUGCU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 56 (5'CAGGAAUUCCUGAAUUUUAA 3'); xix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 23 (5'UAUAAAAUUCAGGAAUUCCUGC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 57 (5'AGGAAUUCCUGAAUUUUAUA 3'); xx) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 24 (5'UGUCAUAAAAUUCAGGAAUUCC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 58 (5'AAUUCCUGAAUUUUAUGACA 3'); xxi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 25 (5'UUAUUCUUGAGCUUGAUCAGGG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 59 (5'CUGAUCAAGCUCAAGAAUAA 3');xxii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 26 (5'UUUAUUCUUGAGCUUGAUCAGG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 60 (5'UGAUCAAGCUCAAGAAUAAA 3'); xxiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 28 (5'UAAGUAUUGGGGUCAGCAUAGG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 62 (5'UAUGCUGACCCCAAUACUUA 3'); xxiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 30 (5'UAAACGACUUCUCUUGUGAACU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 64 (5'UUCACAAGAGAAGUCGUUUA 3'); xxv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 171 3'); xxvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 31 (5'UUUUUUGCAGACAUCCACUACU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 65 (5'UAGUGGAUGUCUGCAAAAAA 3'); xxvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 32 (5'UCAUCUUGGAGUUUCUCCUUCA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 66 (5'AAGGAGAAACUCCAAGAUGA 3'); xxviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 34 (5'UAAACCCAAAUCCUCAUCUUGG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 68 (5'AAGAUGAGGAUUUGGGUUUA 3'); or xxix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 35 (5'UCAGCUGUUUUAAUUCAAUCCC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 69 (5'GAUUGAAUUAAAACAGCUGA 3'). ;

[0162] In some embodiments of the isolated oligonucleotide comprising a sense strand and an antisense strand, the sense strand comprises a nucleotide sequence substantially identical to a region of 19-25 nucleotides comprised between any one of the following nucleotide positions from the 5' end of the CFB mRNA sequence according to SEQ ID NO: 1: a) 493 to 534; b) 995 to 1018; c) 1034 to 1054; d) 1384 to 1404; e) 1431 to 1500; f) 1606 to 1686; g) 1822 to 1849; h) 1860 to 1881; i) 2190 to 2210; j) 2239 to 2262; k) 2287 to 2307; l) 2382 to 2402; m) 3'); iii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 4 (5'UGGUGGAAAGAGAUCUCAUCA 3'); and iv) the sense strand of the nucleic acid sequence according to SEQ ID NO: 5'UGGAAAGAGAUCUCAUCA 3'. 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 38 (5'AUGAGAUCUCUUUUCCACUGA 3'); iv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 5 (5'UAUAGCAGUGGAAAGAGAUCUC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 39 (5'GAUCUCUUUCCACUGCUAUA 3'); v) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 6 (5'UGUGUAACCGUCAUAGCAGUGG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 391 (5'ACUGCUAUGACGGUUACACA 3');vi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 9 (5'UAAUUAAGUUGACUAGACACUU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 43 (5'GUGUCUAGUCAACUUAAUUA 3'); vii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 11 (5'UAUAUCUUGGCUUCACACCAUA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 45 (5'UGGUGUGAAGCCAAGAUAUA 3'); viii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 12 (5'UUAGACAUCCAGAUAAUCCUCC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 46 (5'AGGAUUAUCUGGAUGUCUAA 3'); ix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 13 (5'UAAGCAUUGAUGUUCACUUGGU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 47 (5'CAAGUGAACAUCAAUGCUUA 3'); x) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 14 (5'UAAAGCAUUGAUGUUCACUUGG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 48 (5'AAGUGAACAUCAAUGCUUUA 3'); xi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 15 (5'UAACACAUGUUGCUCAUUGUCU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 49 (5'ACAAUGAGCAACAUGUGUUA 3'); xii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 16 (5'UUUGACUUUGAACACAUGUUGC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 50 xiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 17 (5'UAUAUCCUUGACUUUGAACACA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 51 (5'UGUUCAAAGUCAAGGAUAUA 3');xiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 19 (5'UAAGUACUCAGACACCACAGCC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 53 (5'CUGUGGUGUCUGAGUACUUA 3'); xv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 21 (5'UAAUUCAGGAAUUCCUGCUUCU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 55 (5'AAGCAGGAAUUCCUGAAUUA 3'); xvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 22 (5'UUAAAAUUCAGGAAUUCCUGCU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 56 (5'CAGGAAUUCCUGAAUUUUAA 3'); xvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 23 (5'UAUAAAAUUCAGGAAUUCCUGC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 57 (5'AGGAAUUCCUGAAUUUUAUA 3'); xviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 24 (5'UGUCAUAAAAUUCAGGAAUUCC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 58 (5'AAUUCCUGAAUUUUAUGACA 3'); xix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 26 (5'UUUAUUCUUGAGCUUGAUCAGG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 60 (5'UGAUCAAGCUCAAGAAUAAA 3'); xx) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 28 (5'UAAGUAUUGGGGUCAGCAUAGG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 62 (5'UAUGCUGACCCCAAUACUUA 3'); xxi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 30 (5'UAAACGACUUCUCUUGUGAACU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 64 (5'UUCACAAGAGAAGUCGUUUA 3');xxii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 171 (5'UAUGAAACGACUUCUCUUGUGA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 281 (5'ACAAGAGAAGUCGUUUCAUA 3'); xxiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 31 (5'UUUUUUGCAGACAUCCACUACU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 65 (5'UAGUGGAUGUCUGCAAAAAA 3'); xxiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 34 (5'UAAACCCAAAUCCUCAUCUUGG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 68 (5'AAGAUGAGGAUUUGGGUUUA 3'); or xxv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 35 (5'UCAGCUGUUUUAAUUCAAUCCC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 69 (5'GAUUGAAUUAAAACAGCUGA 3'). ;

[0163] In some embodiments, the isolated oligonucleotides of the present disclosure may include a linker, sometimes referred to as a loop. siRNAs comprising a linker or loop are sometimes referred to as short hairpin RNAs (shRNAs). In some embodiments, both the sense and antisense regions of the siRNA are encoded by a single-stranded RNA. In these embodiments, the antisense and sense regions hybridize to form a duplex region. The sense and antisense regions are connected by a linker sequence to form a "hairpin" or "stem-loop" structure. The siRNA may have complementary sense and antisense regions at the opposite ends of the single-stranded molecule, such that the molecule can form a duplex region with complementary sequence portions, and the chains are connected by a linker at one end of the duplex region. The linker may be a nucleotide linker or a non-nucleotide linker or a combination thereof. The linker may interact with the first chain and optionally the second chain through covalent bonds or non-covalent interactions.

[0164] Any suitable nucleotide linker sequence is contemplated to be within the scope of the present disclosure. The siRNA of the present disclosure may include nucleotide, non-nucleotide, or mixed nucleotide / non-nucleotide linkers that connect the sense region of the nucleic acid to the antisense region of the nucleic acid. The nucleotide linker may be a linker of ≥2 nucleotides in length, for example, about 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16 nucleotides in length.

[0165] Examples of non-nucleotidic linkers include abasic nucleotides, polyethers, polyamines, polyamides, peptides, sugars, lipids, polyhydrocarbons or other polymerizing agents, for example polyethylene glycol, such as those having from 2 to 100 ethylene glycol units. Some examples are described in Seela et al., Nucleic Acids Research, 1987, Vol. 15, pp. 3113-3129; Cload et al., J. Am. Chem. Soc, 1991, Vol. 113, pp. 6324-6326; Jaeschke et al., Tetrahedron Lett., 1993, Vol. 34, pp. 301; Arnold et al., WO 1989 / 002439; Usman et al., WO 1995 / 006731; Dudycz et al., WO 1995 / 011910, and Ferentz et al., J. Am. Chem. Soc, 1991, Vol. 113, pp. 4000-4002.

[0166] Examples of nucleotide linker sequences include, but are not limited to, AUG, CCC, UUCG, CCACC, AAGCAA, CCACACC, and UUCAAGAGA.

[0167] In some embodiments, the isolated oligonucleotide of the present disclosure is an siRNA, which may be a dsRNA of a length suitable as a Dicer substrate, which may be processed to produce a RISC-active siRNA molecule. See, e.g., Rossi et al., US 2005 / 0244858.

[0168] Dicer substrate double-stranded RNA (dsRNA) can be of sufficient length to be processed by Dicer to produce an active siRNA, and can further include one or more of the following properties: (i) the Dicer substrate dsRNA can be asymmetric, e.g., having a 3' overhang on the antisense strand, (ii) the Dicer substrate dsRNA can have a modified 3' end on the sense strand to direct the orientation of Dicer binding and processing of the dsRNA into an active siRNA, e.g., incorporation of one or more DNA nucleotides, and (iii) the length of the first and second strands of the Dicer substrate dsRNA can range from 19 bp to 30 bp.

[0169] In some embodiments, the isolated oligonucleotides of the present disclosure comprise at least one modified nucleotide. In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand or the antisense strand or both comprise one or more modified nucleotides. In some embodiments, only the sense strand comprises one or more modified nucleotides. In some embodiments, only the antisense strand comprises one or more modified nucleotides. In some embodiments, both the sense strand and the antisense strand comprise one or more modified nucleotides. In some embodiments, the isolated oligonucleotides are partially chemically modified. In some embodiments, the isolated oligonucleotides are completely chemically modified.

[0170] In some embodiments, the isolated oligonucleotide comprises at least two modified nucleotides. In some embodiments, the isolated oligonucleotide comprises at least three modified nucleotides. In some embodiments, the isolated oligonucleotide comprises at least four modified nucleotides. In some embodiments, the isolated oligonucleotide comprises at least five modified nucleotides. In some embodiments, the isolated oligonucleotide comprises at least six modified nucleotides. In some embodiments, the isolated oligonucleotide comprises at least seven modified nucleotides. In some embodiments, the isolated oligonucleotide comprises at least eight modified nucleotides. In some embodiments, the isolated oligonucleotide comprises at least nine modified nucleotides. In some embodiments, the isolated oligonucleotide comprises at least ten modified nucleotides. In some embodiments, the isolated oligonucleotide comprises at least eleven modified nucleotides. In some embodiments, the isolated oligonucleotide comprises at least twelve modified nucleotides. In some embodiments, the isolated oligonucleotide comprises at least thirteen modified nucleotides. In some embodiments, the isolated oligonucleotide comprises at least fourteen modified nucleotides. In some embodiments, the isolated oligonucleotide comprises at least fifteen modified nucleotides. In some embodiments, the isolated oligonucleotide comprises at least sixteen modified nucleotides. In some embodiments, the oligonucleotide of separation comprises at least seventeen modified nucleotides. In some embodiments, the oligonucleotide of separation comprises at least eighteen modified nucleotides. In some embodiments, the oligonucleotide of separation comprises at least nineteen modified nucleotides. In some embodiments, the oligonucleotide of separation comprises at least twenty modified nucleotides. In some embodiments, the oligonucleotide of separation comprises more than twenty modified nucleotides. In some embodiments, the oligonucleotide of separation comprises between twenty and thirty modified nucleotides. In some embodiments, the oligonucleotide of separation comprises between thirty and forty modified nucleotides. In some embodiments, the oligonucleotide of separation comprises between forty and fifty modified nucleotides.

[0171] In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least one modified nucleotide. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least two modified nucleotides. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least three modified nucleotides. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least four modified nucleotides. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least five modified nucleotides. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least six modified nucleotides. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least seven modified nucleotides. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least eight modified nucleotides. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least nine modified nucleotides. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least ten modified nucleotides. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least eleven modified nucleotides. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least twelve modified nucleotides. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least thirteen modified nucleotides. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least fourteen modified nucleotides. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least fifteen modified nucleotides. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least sixteen modified nucleotides. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least seventeen modified nucleotides. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least eighteen modified nucleotides. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least nineteen modified nucleotides. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least twenty modified nucleotides.

[0172] In some embodiments, wherein the oligonucleotide of separation comprises more than one modified nucleotide, at least the first nucleotide comprises the first modification, and at least the second nucleotide comprises the second modification. In some embodiments, the first modification and the second modification are different. In some embodiments, at least the first nucleotide and at least the second nucleotide are positioned on the different chains of the oligonucleotide of separation. In some embodiments, at least the first nucleotide and at least the second nucleotide are positioned on the same chain of the oligonucleotide of separation.

[0173] In some embodiments of the isolated oligonucleotide, wherein the isolated oligonucleotide comprises more than one modified nucleotide, at least the first modified nucleotide comprises the first modification, and at least the second modified nucleotide comprises the second modification, and at least the third nucleotide comprises the third modification. In some embodiments, the isolated oligonucleotide comprises the first modification, the second modification, the third modification, and the fourth modification. In some embodiments, the isolated oligonucleotide comprises more than four modifications. In some embodiments, all modifications are on the sense strand. In some embodiments, all modifications are on the antisense strand. Any combination of the positions of the modifications between the sense strand and the antisense strand is envisioned within the isolated oligonucleotide of the present disclosure.

[0174] In some embodiments, the modified nucleotides are located continuously on the sense strand or the antisense strand, or both. In some embodiments, some but not all of the modified nucleotides are located continuously on the sense strand or the antisense strand, or both. In some embodiments, the modified nucleotides are located discontinuously on the sense strand or the antisense strand, or both.

[0175] It is envisioned within the present disclosure that isolated oligonucleotides may be modified in which any nucleotide on the sense or antisense strand may be modified. In some embodiments, any nucleotide on the antisense strand may be modified. In some embodiments, any nucleotide on the antisense strand may be modified.

[0176] In some embodiments, the isolated oligonucleotide of the present disclosure comprises at least one modified nucleotide.In some embodiments, the nucleotide of one or more modifications increases the stability or effectiveness or both of the isolated oligonucleotide.In some embodiments, the nucleotide of one or more modifications increases the stability of RNA duplexes and siRNA.

[0177] Modifications that increase RNA stability include, but are not limited to, locked nucleic acids. As used herein, the term "locked nucleic acid" or "LNA" includes, but is not limited to, modified RNA nucleotides in which the ribose moiety comprises a methylene bridge connecting the 2' oxygen and the 4' carbon. The methylene bridge locks the ribose in a 3'-endo conformation, also known as the northern conformation, a conformation found in A-type RNA duplexes. The term inaccessible RNA can be used interchangeably with LNA. LNAs with 2'-4' loop connections are described in International Patent Applications WO 99 / 14226, WO 00 / 56746, WO 00 / 56748, and WO 00 / 66604, the contents of which are incorporated herein by reference.

[0178] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand or the antisense strand or both comprise at least one nucleotide with a modified phosphate backbone. In some embodiments, the sense strand of the isolated oligonucleotide comprises at least one nucleotide with a modified phosphate backbone. In some embodiments, the antisense strand of the isolated oligonucleotide comprises at least one nucleotide with a modified phosphate backbone. In some embodiments, wherein the isolated oligonucleotides of the present disclosure comprise a modified phosphate backbone, the modified phosphate backbone comprises a modified phosphodiester bond. In some embodiments, the modified phosphodiester bond is modified by replacing one or more oxygen atoms with a moiety, wherein the moiety is bonded to a phosphorus atom in the phosphodiester bond with a carbon, nitrogen, or sulfur atom in the moiety, or by forming a 2'-5' bond. In some embodiments, the modified phosphodiester bond comprises a phosphorothioate, a phosphorodithioate, a methylphosphonate, a phosphoramidate diester, a methylsulfonylphosphoramidate, or a phosphonoacetate.

[0179] In some embodiments, the isolated oligonucleotides of the present disclosure comprise one or more nucleotides containing non-natural bases, locked nucleotides or abasic nucleotides. In some embodiments, the nucleotides of one or more modifications comprise nucleotides substituted with thiophosphate derivatives or acridines. In some embodiments, the isolated oligonucleotides of the present disclosure comprise phosphate mimics at the 5' end of the antisense strand, including but not limited to vinylphosphonate or other phosphate analogs. In some embodiments, the 5'-phosphate mimics are ethylphosphonate, vinylphosphonate or its analogs.

[0180] In some embodiments, the modified nucleotides include 5-fluorouracil, 5-bromouracil, 5-chlorouracil, 5-iodouracil, hypoxanthine, xanthine, 4-acetylcytosine, 5-(carboxyhydroxymethyl)uracil, 5-carboxymethylaminomethyl-2-thiouridine, 5-carboxymethylaminomethyluracil, dihydrouracil, β-D-galactosylqueosine, inosine, N6-isopentenyladenine, 1-methylguanine, 1-methylinosine, 2,2-dimethylguanine, 2-methyladenine, 2-methylguanine, 3-methylcytosine, 5-methylcytosine, N6-adenine, 7-methylguanine, uracil, 5-methyl-aminomethyluracil, 5-methoxyaminomethyl-2-thiouracil, β-D-mannosyl quercetin, 5'-methoxycarboxymethyluracil, 5-methoxyuracil, 2-methylthio-N-isopentenyl adenine, uracil-5-hydroxyacetic acid (v), wybutoxosine, pseudouracil, Q-side, 2-thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil, 5-methyluracil, uracil-5-hydroxyacetic acid methyl ester, uracil-5-hydroxyacetic acid (v), 5-methyl-2-thiouracil, 3-(3-amino-3-N-2-carboxypropyl)uracil, (acp3)w or 2,6-diaminopurine.

[0181] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand or the antisense strand or both comprise a terminal or internal nucleotide connected to one or more targeting ligands. In some embodiments, the terminal or internal nucleotide is directly connected to one or more targeting ligands. In some embodiments, the terminal or internal nucleotide is indirectly connected to one or more targeting ligands via a linker. In some embodiments, one or more targeting ligands directly or indirectly connected to the terminal or internal nucleotide may further comprise a PK modulator. In some embodiments, the PK modulator is a competitive modulator, a positive allosteric modulator, a negative allosteric modulator, or a neutral allosteric modulator. In some embodiments, the targeting ligand is selected from one or more of a carbohydrate, a peptide, a lipid, an antibody or a fragment thereof, an aptamer, an albumin, a fibrinogen, and folic acid.

[0182] Nucleotide modification Provided herein are isolated oligonucleotides comprising: (a) a sense strand comprising X1 nucleotides, wherein at least one nucleotide is modified with a first modification and each of the remaining nucleotides is independently modified with a second modification, and X1 is an integer selected from 13-36, wherein the first modification and the second modification are different; and (b) an antisense strand comprising X2 nucleotides, wherein at least one nucleotide is modified with a third modification and each of the remaining nucleotides is independently modified with a fourth modification, and X2 is an integer selected from 18-31, wherein the third modification and the fourth modification are different.

[0183] In some embodiments, the X1 nucleotides of the sense strand of the isolated oligonucleotide of the present disclosure is 18-21, and the X2 nucleotides of the antisense strand of the isolated oligonucleotide of the present disclosure is 20-23. In some embodiments, the X1 nucleotides of the sense strand of the isolated oligonucleotide of the present disclosure is 20 or 21, and the X2 nucleotides of the antisense strand of the isolated oligonucleotide of the present disclosure is 22 or 23. In some embodiments, the X2 nucleotides of the antisense strand of the isolated oligonucleotide of the present disclosure is equal to the X1 nucleotides of the sense strand of the isolated oligonucleotide of the present disclosure plus 2. In some embodiments, the X1 nucleotides of the sense strand of the isolated oligonucleotide of the present disclosure is 21, and the X2 nucleotides of the antisense strand of the isolated oligonucleotide of the present disclosure is 23. In some embodiments, the X1 nucleotides of the sense strand of the isolated oligonucleotide of the present disclosure is 20, and the X2 nucleotides of the antisense strand of the isolated oligonucleotide of the present disclosure is 22.

[0184] In some embodiments of the isolated oligonucleotides of the present disclosure, the isolated oligonucleotide comprises: (a) a sense strand comprising 20 nucleotides, wherein at least one nucleotide is modified with a first modification and each of the remaining nucleotides is independently modified with a second modification, wherein the first modification and the second modification are the same or different; and (b) an antisense strand comprising 22 nucleotides, wherein at least one nucleotide is modified with a third modification and each of the remaining nucleotides is independently modified with a fourth modification, wherein the third modification and the fourth modification are the same or different.

[0185] In some embodiments, the first modification is a modification selected from the group consisting of a 2'-F modification, a 2'-CN modification, a 2'-N3 modification, a 2'-deoxy modification, and equivalents thereof, and combinations thereof, at the 2'-position of the sugar moiety of at least one nucleotide. In some embodiments, the first modification is a 2'-F modification, a 2'-CN modification, a 2'-N3 modification, or a 2'-deoxy modification, or a stereoisomer thereof. In some embodiments, the first modification is a 2'-F modification, a 2'-CN modification, or a 2'-N3 modification, or a stereoisomer thereof. In some embodiments, the first modification is a 2'-F modification, a 2'-CN modification, or a 2'-N3 modification, or a stereoisomer thereof.

[0186] In some embodiments, the second modification is a modification selected from 2'-C1-C6 alkyl, 2'-OR modification, 2'-amino and morpholino substitution, and equivalents and combinations thereof at the 2'-position of the sugar portion of one or more remaining nucleotides, wherein R is a C1-C6 alkyl optionally substituted with a C1-C6 alkoxy, acetamide, phenyl, or a heteroaryl group comprising a 5-membered ring or a 6-membered ring and 1 or 2 heteroatoms selected from N, O, and S. In some embodiments, the second modification is a 2'-OR modification, or a morpholino substitution, or a combination thereof. In some embodiments, the second modification is a 2'-OR modification. In some embodiments, the second modification is a 2'-O-methyl modification or a 2'-methoxyethoxy modification. In some embodiments, the second modification is a 2'-O-methyl modification. In some embodiments, the second modification is a morpholino substitution.

[0187] In some embodiments, the first modification is a 2'-F modification or a stereoisomer thereof, and the second modification is a 2'-O-methyl modification or a 2'-methoxyethoxy modification. In some embodiments, the first modification is a 2'-F modification or a stereoisomer thereof, and the second modification is a 2'-O-methyl modification.

[0188] In some embodiments, the third modification is a modification at the 2'-position of the sugar portion of at least one nucleotide selected from the group consisting of a 2'-F modification, a 2'-CN modification, a 2'-N3 modification, a 2'-deoxy modification, and equivalents thereof, and combinations thereof. In some embodiments, the third modification is a 2'-F modification, a 2'-CN modification, a 2'-N3 modification, or a 2'-deoxy modification, or a stereoisomer thereof. In some embodiments, the third modification is a 2'-F modification, a 2'-CN modification, or a 2'-N3 modification, or a stereoisomer thereof. In some embodiments, the third modification is a 2'-F modification, a 2'-CN modification, or a 2'-N3 modification, or a stereoisomer thereof. In some embodiments, the third modification is a 2'-F modification or a stereoisomer thereof.

[0189] In some embodiments, the fourth modification is a modification at the 2'-position of the sugar portion of one or more remaining nucleotides selected from 2'-C1-C6 alkyl, 2'-OR modification, 2'-amino and morpholino substitutions, and equivalents and combinations thereof, wherein R is a C1-C6 alkyl optionally substituted with a C1-C6 alkoxy, acetamide, phenyl, or a heteroaryl group comprising a 5-membered ring or a 6-membered ring and 1 or 2 heteroatoms selected from N, O, and S. In some embodiments, the fourth modification is a 2'-OR modification, or a morpholino substitution, or a combination thereof. In some embodiments, the fourth modification is a 2'-OR modification. In some embodiments, the fourth modification is a 2'-O-methyl modification or a 2'-methoxyethoxy modification. In some embodiments, the fourth modification is a 2'-O-methyl modification. In some embodiments, the fourth modification is a morpholino substitution.

[0190] In some embodiments, the third modification is a 2'-F modification or a stereoisomer thereof, and the fourth modification is a 2'-O-methyl modification or a 2'-methoxyethoxy modification. In some embodiments, the third modification is a 2'-F modification or a stereoisomer thereof, and the fourth modification is a 2'-O-methyl modification.

[0191] sense strand In some embodiments of the isolated oligonucleotides of the present disclosure comprising a sense strand and an antisense strand, in the sense strand of the isolated oligonucleotides of the present disclosure, at least three nucleotides are modified with a first modification. In some embodiments, in the sense strand of the isolated oligonucleotides of the present disclosure, at least two of the at least three nucleotides modified with the first modification are positioned contiguously. In some embodiments, in the sense strand of the isolated oligonucleotides of the present disclosure, at least three of the at least three nucleotides modified with the first modification are positioned contiguously.

[0192] In some embodiments, in the sense strand of an isolated oligonucleotide of the present disclosure, at least four nucleotides in the sense strand are modified with a first modification. In some embodiments, in the sense strand of an isolated oligonucleotide of the present disclosure, at least three of the at least four nucleotides modified with the first modification are positioned contiguously. In some embodiments, in the sense strand of an isolated oligonucleotide of the present disclosure, at least four of the at least four nucleotides modified with the first modification are positioned contiguously.

[0193] In some embodiments, in the sense strand of an isolated oligonucleotide of the present disclosure, at least five nucleotides in the sense strand are modified with the first modification. In some embodiments, in the sense strand of an isolated oligonucleotide of the present disclosure, at least three of the at least five nucleotides modified with the first modification are positioned contiguously. In some embodiments, in the sense strand of an isolated oligonucleotide of the present disclosure, at least four of the at least five nucleotides modified with the first modification are positioned contiguously.

[0194] In some embodiments, in the sense strand of the isolated oligonucleotide of the present disclosure, the at least three nucleotides, at least four nucleotides, or at least five nucleotides modified with the first modification are located from position 10 to position 15 from the nucleotide that is complementary to the first nucleotide at the 5' end of the antisense strand.

[0195] In some embodiments, in the sense strand of the isolated oligonucleotide of the present disclosure, two of the at least three nucleotides modified with the first modification are located at positions selected from 10, 11, 12, and 13 from the nucleotide that is complementary to the first nucleotide at the 5' terminus of the antisense strand. In some embodiments, in the sense strand of the isolated oligonucleotide of the present disclosure, three of the at least three nucleotides modified with the first modification are located at positions selected from 10, 11, 12, and 13 from the nucleotide that is complementary to the first nucleotide at the 5' terminus of the antisense strand. In some embodiments, in the sense strand of the isolated oligonucleotide of the present disclosure, one of the at least three nucleotides modified with the first modification is located at position 11 from the nucleotide that is complementary to the first nucleotide at the 5' terminus of the antisense strand.

[0196] In some embodiments, in the sense strand of an isolated oligonucleotide of the present disclosure, three of the at least three nucleotides modified with the first modification are located at positions 11, 12, and 13 from the nucleotide that is complementary to the first nucleotide at the 5' terminus of the antisense strand. In some embodiments, in the sense strand of an isolated oligonucleotide of the present disclosure, three of the at least three nucleotides modified with the first modification are located at positions 12, 13, and 14 from the nucleotide that is complementary to the first nucleotide at the 5' terminus of the antisense strand. In some embodiments, in the sense strand of an isolated oligonucleotide of the present disclosure, three of the at least three nucleotides modified with the first modification are located at positions 10, 11, and 12 from the nucleotide that is complementary to the first nucleotide at the 5' terminus of the antisense strand.

[0197] In some embodiments, in the sense strand of an isolated oligonucleotide of the present disclosure, one of the at least four nucleotides modified with the first modification is located at position 10 from the nucleotide that is complementary to the first nucleotide at the 5' terminus of the antisense strand. In some embodiments, in the sense strand of an isolated oligonucleotide of the present disclosure, one of the at least four nucleotides modified with the first modification is located at position 11 from the nucleotide that is complementary to the first nucleotide at the 5' terminus of the antisense strand. In some embodiments, in the sense strand of an isolated oligonucleotide of the present disclosure, one of the at least four nucleotides modified with the first modification is located at position 12 from the nucleotide that is complementary to the first nucleotide at the 5' terminus of the antisense strand. In some embodiments, in the sense strand of an isolated oligonucleotide of the present disclosure, one of the at least four nucleotides modified with the first modification is located at position 13 from the nucleotide that is complementary to the first nucleotide at the 5' terminus of the antisense strand. In some embodiments, in the sense strand of an isolated oligonucleotide of the present disclosure, one of the at least four nucleotides modified with the first modification is located at position 14 from the nucleotide that is complementary to the first nucleotide at the 5' terminus of the antisense strand. In some embodiments, in the sense strand of the isolated oligonucleotide of the present disclosure, one of the at least four nucleotides modified with the first modification is located at position 15 from the nucleotide that is complementary to the first nucleotide at the 5' end of the antisense strand.

[0198] In some embodiments, in the sense strand of the isolated oligonucleotide of the present disclosure, the at least four nucleotides modified with the first modification are located at positions 10, 11, 12, and 13 from the nucleotide that is complementary to the first nucleotide at the 5' end of the antisense strand.

[0199] In some embodiments, in the sense strand of the isolated oligonucleotide of the present disclosure, the at least five nucleotides modified with the first modification are located at positions 10, 11, 12, 13, and 15 from the nucleotide that is complementary to the first nucleotide at the 5' end of the antisense strand.

[0200] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises five nucleotides modified with a first modification, wherein the five nucleotides modified with the first modification are located at positions 10, 11, 12, 13, and 15 of the nucleotide that is complementary to the first nucleotide at the 5' end of the antisense strand.

[0201] In some embodiments, in the sense strand of an isolated oligonucleotide of the present disclosure, the at least three nucleotides, at least four nucleotides, or at least five nucleotides modified with a first modification are not all positioned contiguously. In some embodiments, in the sense strand of an isolated oligonucleotide of the present disclosure, the at least three nucleotides, the at least four nucleotides, or the at least five nucleotides are modified with a 2'-F modification.

[0202] In some embodiments, the sense strand of an isolated oligonucleotide of the present disclosure comprises a nucleotide modified with a 2'-F modification ("F") and a nucleotide modified with a 2'-O-methyl modification ("M") according to the following formula: 5' (M) g (F) f (M) e (F) d (M) c (F) b (M) a 3', wherein M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and a, b, c, d, e, f and g are any one of 0-16, and wherein the sense strand is 5'(M)0(F)0(M)5(F)1(M)1(F)4(M)9 3'.

[0203] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand of the isolated oligonucleotide comprises a nucleotide modified with a 2'-F modification ("F") and a nucleotide modified with a 2'-O-methyl modification ("M") according to the following formula: 5' (M) g (F) f (M) e (F) d (M) c (F) b (M) a 3', wherein M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and a, b, c, d, e, f and g are any one of 0-16, and wherein the sense strand is 5'(M)0(F)0(M)5(F)1(M)1(F)4(M)9 3'.

[0204] In some embodiments of the isolated oligonucleotide of the present disclosure, wherein the sense strand of the isolated oligonucleotide comprises a nucleotide modified with a 2'-F modification ("F") and a nucleotide modified with a 2'-O-methyl modification ("M") according to the following formula: 5' (M) g (F) f (M) e (F) d (M) c (F) b (M) a3', wherein M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and a, b, c, d, e, f, and g are any of 0-16, and wherein the sense strand is 5'(M)0(F)0(M)5(F)1(M)1(F)4(M)9 3', the sense strand comprises the nucleotide sequence according to any one of SEQ ID NO: 37, 39, 49, 55, 56, 58, or 389.

[0205] In some embodiments of the isolated oligonucleotide of the present disclosure, wherein the sense strand of the isolated oligonucleotide comprises a nucleotide modified with a 2'-F modification ("F") and a nucleotide modified with a 2'-O-methyl modification ("M") according to the following formula: 5' (M) g (F) f (M) e (F) d (M) c (F) b (M) a 3', wherein M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and a, b, c, d, e, f, and g are any one of 0-16, and wherein the sense strand is 5'(M)0(F)0(M)5(F)1(M)1(F)4(M)9 3', the sense strand comprises the nucleotide sequence according to SEQ ID NO: 58.

[0206] In some embodiments of the isolated oligonucleotide of the present disclosure, wherein the sense strand of the isolated oligonucleotide comprises a nucleotide modified with a 2'-F modification ("F") and a nucleotide modified with a 2'-O-methyl modification ("M") according to the following formula: 5' (M) g (F) f (M) e (F) d (M) c (F) b (M) a 3', wherein M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and a, b, c, d, e, f, and g are any one of 0-16, and wherein the sense strand is 5'(M)0(F)0(M)5(F)1(M)1(F)4(M)9 3', and the sense strand comprises the nucleotide sequence according to SEQ ID NO: 58, and the antisense strand comprises the nucleotide sequence according to SEQ ID NO: 24.

[0207] In some embodiments of the isolated oligonucleotide of the present disclosure, wherein the sense strand of the isolated oligonucleotide comprises a nucleotide modified with a 2'-F modification ("F") and a nucleotide modified with a 2'-O-methyl modification ("M") according to the following formula: 5' (M) g (F) f (M) e (F) d (M) c (F) b (M) a 3', wherein M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and a, b, c, d, e, f, and g are any one of 0-16, and wherein the sense strand is 5'(M)0(F)0(M)5(F)1(M)1(F)4(M)9 3', the sense strand comprises the nucleotide sequence according to SEQ ID NO: 56.

[0208] In some embodiments of the isolated oligonucleotide of the present disclosure, wherein the sense strand of the isolated oligonucleotide comprises a nucleotide modified with a 2'-F modification ("F") and a nucleotide modified with a 2'-O-methyl modification ("M") according to the following formula: 5' (M) g (F) f (M) e (F) d (M) c (F) b (M) a 3', wherein M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and a, b, c, d, e, f, and g are any one of 0-16, and wherein the sense strand is 5'(M)0(F)0(M)5(F)1(M)1(F)4(M)9 3', and the sense strand comprises the nucleotide sequence according to SEQ ID NO: 56, and the antisense strand comprises the nucleotide sequence according to SEQ ID NO: 22.

[0209] In some embodiments of the isolated oligonucleotide of the present disclosure, wherein the sense strand of the isolated oligonucleotide comprises a nucleotide modified with a 2'-F modification ("F") and a nucleotide modified with a 2'-O-methyl modification ("M") according to the following formula: 5' (M) g (F) f (M) e (F) d (M) c (F) b (M) a3', wherein M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and a, b, c, d, e, f, and g are any one of 0-16, and wherein the sense strand is 5'(M)0(F)0(M)5(F)1(M)1(F)4(M)9 3', the sense strand comprises the nucleotide sequence according to SEQ ID NO: 37.

[0210] In some embodiments of the isolated oligonucleotide of the present disclosure, wherein the sense strand of the isolated oligonucleotide comprises a nucleotide modified with a 2'-F modification ("F") and a nucleotide modified with a 2'-O-methyl modification ("M") according to the following formula: 5' (M) g (F) f (M) e (F) d (M) c (F) b (M) a 3', wherein M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and a, b, c, d, e, f, and g are any one of 0-16, and wherein the sense strand is 5'(M)0(F)0(M)5(F)1(M)1(F)4(M)9 3', and the sense strand comprises the nucleotide sequence according to SEQ ID NO: 37, and the antisense strand comprises the nucleotide sequence according to SEQ ID NO: 3.

[0211] In some embodiments of the isolated oligonucleotide of the present disclosure, wherein the sense strand of the isolated oligonucleotide comprises a nucleotide modified with a 2'-F modification ("F") and a nucleotide modified with a 2'-O-methyl modification ("M") according to the following formula: 5' (M) g (F) f (M) e (F) d (M) c (F) b (M) a 3', wherein M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and a, b, c, d, e, f, and g are any one of 0-16, and wherein the sense strand is 5'(M)0(F)0(M)5(F)1(M)1(F)4(M)9 3', the sense strand comprises the nucleotide sequence according to SEQ ID NO: 55.

[0212] In some embodiments of the isolated oligonucleotide of the present disclosure, wherein the sense strand of the isolated oligonucleotide comprises a nucleotide modified with a 2'-F modification ("F") and a nucleotide modified with a 2'-O-methyl modification ("M") according to the following formula: 5' (M) g (F)f (M) e (F) d (M) c (F) b (M) a 3', wherein M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and a, b, c, d, e, f, and g are any one of 0-16, and wherein the sense strand is 5'(M)0(F)0(M)5(F)1(M)1(F)4(M)9 3', and the sense strand comprises the nucleotide sequence according to SEQ ID NO: 55, and the antisense strand comprises the nucleotide sequence according to SEQ ID NO: 21.

[0213] In some embodiments of the isolated oligonucleotide of the present disclosure, wherein the sense strand of the isolated oligonucleotide comprises a nucleotide modified with a 2'-F modification ("F") and a nucleotide modified with a 2'-O-methyl modification ("M") according to the following formula: 5' (M) g (F) f (M) e (F) d (M) c (F) b (M) a 3', wherein M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and a, b, c, d, e, f, and g are any one of 0-16, and wherein the sense strand is 5'(M)0(F)0(M)5(F)1(M)1(F)4(M)9 3', the sense strand comprises the nucleotide sequence according to SEQ ID NO: 49.

[0214] In some embodiments of the isolated oligonucleotide of the present disclosure, wherein the sense strand of the isolated oligonucleotide comprises a nucleotide modified with a 2'-F modification ("F") and a nucleotide modified with a 2'-O-methyl modification ("M") according to the following formula: 5' (M) g (F) f (M) e (F) d (M) c (F) b (M) a 3', wherein M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and a, b, c, d, e, f, and g are any one of 0-16, and wherein the sense strand is 5'(M)0(F)0(M)5(F)1(M)1(F)4(M)9 3', and the sense strand comprises the nucleotide sequence according to SEQ ID NO: 49, and the antisense strand comprises the nucleotide sequence according to SEQ ID NO: 15.

[0215] In some embodiments of the isolated oligonucleotide of the present disclosure, wherein the sense strand of the isolated oligonucleotide comprises a nucleotide modified with a 2'-F modification ("F") and a nucleotide modified with a 2'-O-methyl modification ("M") according to the following formula: 5' (M) g (F) f (M) e (F) d (M) c (F) b (M) a 3', wherein M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and a, b, c, d, e, f, and g are any one of 0-16, and wherein the sense strand is 5'(M)0(F)0(M)5(F)1(M)1(F)4(M)9 3', the sense strand comprises the nucleotide sequence according to SEQ ID NO: 389.

[0216] In some embodiments of the isolated oligonucleotide of the present disclosure, wherein the sense strand of the isolated oligonucleotide comprises a nucleotide modified with a 2'-F modification ("F") and a nucleotide modified with a 2'-O-methyl modification ("M") according to the following formula: 5' (M) g (F) f (M) e (F) d (M) c (F) b (M) a 3', wherein M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and a, b, c, d, e, f, and g are any one of 0-16, and wherein the sense strand is 5'(M)0(F)0(M)5(F)1(M)1(F)4(M)9 3', and the sense strand comprises the nucleotide sequence according to SEQ ID NO: 389, and the antisense strand comprises the nucleotide sequence according to SEQ ID NO: 6.

[0217] In some embodiments of the isolated oligonucleotide of the present disclosure, wherein the sense strand of the isolated oligonucleotide comprises a nucleotide modified with a 2'-F modification ("F") and a nucleotide modified with a 2'-O-methyl modification ("M") according to the following formula: 5' (M) g (F) f (M) e (F) d (M) c (F) b (M) a3', wherein M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and a, b, c, d, e, f, and g are any one of 0-16, and wherein the sense strand is 5'(M)0(F)0(M)5(F)1(M)1(F)4(M)9 3', the sense strand comprises the nucleotide sequence according to SEQ ID NO: 39.

[0218] In some embodiments of the isolated oligonucleotide of the present disclosure, wherein the sense strand of the isolated oligonucleotide comprises a nucleotide modified with a 2'-F modification ("F") and a nucleotide modified with a 2'-O-methyl modification ("M") according to the following formula: 5' (M) g (F) f (M) e (F) d (M) c (F) b (M) a 3', wherein M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and a, b, c, d, e, f, and g are any one of 0-16, and wherein the sense strand is 5'(M)0(F)0(M)5(F)1(M)1(F)4(M)9 3', and the sense strand comprises the nucleotide sequence according to SEQ ID NO: 39, and the antisense strand comprises the nucleotide sequence according to SEQ ID NO: 5.

[0219] In some embodiments of the isolated oligonucleotide of the present disclosure, wherein the sense strand comprises a nucleotide sequence identical to the region between nucleotide positions 1829 to 1849 from the 5' end of the CFB mRNA sequence according to SEQ ID NO: 1, the double-stranded region comprises the antisense strand of the nucleic acid sequence according to SEQ ID NO: 24 (5' UGUCAUAAAAUUCAGGAAUUCC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 58 (5' AAUUCCUGAAUUUUAUGACA 3').

[0220] In some embodiments of the isolated oligonucleotide of the present disclosure, wherein the sense strand comprises a nucleotide sequence identical to the region between nucleotide positions 1825 to 1845 from the 5' end of the CFB mRNA sequence according to SEQ ID NO: 1, the double-stranded region comprises the antisense strand of the nucleic acid sequence according to SEQ ID NO: 22 (5' UUAAAAUUCAGGAAUUCCUGCU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 56 (5' CAGGAAUUCCUGAAUUUUAA 3').

[0221] In some embodiments of the isolated oligonucleotide of the present disclosure, wherein the sense strand comprises a nucleotide sequence identical to the region between nucleotide positions 495 to 515 from the 5' end of the CFB mRNA sequence according to SEQ ID NO: 1, the double-stranded region comprises the antisense strand of the nucleic acid sequence according to SEQ ID NO: 3 (5' UGGAAAGAGAUCUCAUCACUCA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 37 (5' AGUGAUGAGAUCUCUUUCCA 3').

[0222] In some embodiments of the isolated oligonucleotides of the present disclosure, wherein the sense strand comprises a nucleotide sequence identical to the region between nucleotide positions 1822 to 1842 from the 5' end of the CFB mRNA sequence according to SEQ ID NO: 1, the double-stranded region comprises the antisense strand of the nucleic acid sequence according to SEQ ID NO: 21 (5' UAAUUCAGGAAUUCCUGCUUCU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 55 (5' AAGCAGGAAUUCCUGAAUUA 3').

[0223] In some embodiments of the isolated oligonucleotides of the present disclosure, wherein the sense strand comprises a nucleotide sequence identical to the region between nucleotide positions 1465 to 1485 from the 5' end of the CFB mRNA sequence according to SEQ ID NO: 1, the double-stranded region comprises the antisense strand of the nucleic acid sequence according to SEQ ID NO: 15 (5' UAACACAUGUUGCUCAUUGUCU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 49 (5' ACAAUGAGCAACAUGUGUUA 3').

[0224] In some embodiments of the isolated oligonucleotide of the present disclosure, wherein the sense strand comprises a nucleotide sequence identical to the region between nucleotide positions 514 to 534 from the 5' end of the CFB mRNA sequence according to SEQ ID NO: 1, the double-stranded region comprises the antisense strand of the nucleic acid sequence according to SEQ ID NO: 6 (5' UGUGUAACCGUCAUAGCAGUGG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 389 (5' ACUGCUAUGACGGUUACACA 3').

[0225] In some embodiments of the isolated oligonucleotide of the present disclosure, wherein the sense strand comprises a nucleotide sequence identical to the region between nucleotide positions 503 to 523 from the 5' end of the CFB mRNA sequence according to SEQ ID NO: 1, the double-stranded region comprises the antisense strand of the nucleic acid sequence according to SEQ ID NO: 5 (5' UAUAGCAGUGGAAAGAGAUCUC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 39 (5' GAUCUCUUUCCACUGCUAUA 3').

[0226] Antisense strand In some embodiments, in the antisense strand of an isolated oligonucleotide of the present disclosure, up to seven nucleotides are modified with the third modification.

[0227] In some embodiments, in the antisense strand of an isolated oligonucleotide of the present disclosure, up to four of the up to seven nucleotides modified with the third modification are located at position 2 to position 8 from the first nucleotide at the 5' terminus of the antisense strand. In some embodiments, in the antisense strand of an isolated oligonucleotide of the present disclosure, at least one of the up to seven nucleotides modified with the third modification is located at position 2 from the first nucleotide at the 5' terminus of the antisense strand.

[0228] In some embodiments, in the antisense strand of an isolated oligonucleotide of the present disclosure, at most two of the up to seven nucleotides modified with the third modification are positioned contiguously. In some embodiments, in the antisense strand of an isolated oligonucleotide of the present disclosure, at most two of the up to seven nucleotides modified with the third modification are located at positions 2 and 3 from the first nucleotide at the 5' end of the antisense strand.

[0229] In some embodiments, in the antisense strand of an isolated oligonucleotide of the present disclosure, at least one of the up to seven nucleotides modified with the third modification is located at position 14 from the first nucleotide at the 5' terminus of the antisense strand. In some embodiments, in the antisense strand of an isolated oligonucleotide of the present disclosure, two or three of the up to seven nucleotides modified with the third modification are located at positions selected from 2, 3, 5, and 6 from the first nucleotide at the 5' terminus of the antisense strand. In some embodiments, in the antisense strand of an isolated oligonucleotide of the present disclosure, three of the up to seven nucleotides modified with the third modification are located at positions selected from 2, 3, 5, and 6 from the first nucleotide at the 5' terminus of the antisense strand. In some embodiments, in the antisense strand of an isolated oligonucleotide of the present disclosure, two of the up to seven nucleotides modified with the third modification are located at positions 2 and 5 from the first nucleotide at the 5' terminus of the antisense strand. In some embodiments, in the antisense strand of an isolated oligonucleotide of the present disclosure, two of the up to seven nucleotides modified with the third modification are located at positions 2 and 3 from the first nucleotide at the 5' end of the antisense strand.

[0230] In some embodiments, in the antisense strand of an isolated oligonucleotide of the present disclosure, three of the up to seven nucleotides modified with the third modification are located at positions 2, 3, and 5 from the first nucleotide at the 5' end of the antisense strand.

[0231] In some embodiments, in the antisense strand of an isolated oligonucleotide of the present disclosure, one or two of the up to seven nucleotides modified with the third modification are located at positions selected from 14 and 16 from the first nucleotide at the 5' terminus of the antisense strand. In some embodiments, in the antisense strand of an isolated oligonucleotide of the present disclosure, two of the up to seven nucleotides modified with the third modification are located at positions 14 and 16 from the first nucleotide at the 5' terminus of the antisense strand. In some embodiments, in the antisense strand of an isolated oligonucleotide of the present disclosure, the up to seven nucleotides are modified with a 2'-F modification. In some embodiments, in the antisense strand of an isolated oligonucleotide of the present disclosure, one of the up to seven nucleotides modified with the third modification is located at position 14 from the first nucleotide at the 5' terminus of the antisense strand. In some embodiments, in the antisense strand of an isolated oligonucleotide of the present disclosure, two of the up to seven nucleotides modified with the third modification are located at positions 14 and 16 from the first nucleotide at the 5' terminus of the antisense strand.

[0232] In some embodiments of the isolated oligonucleotides of the present disclosure, wherein the antisense strand comprises up to seven nucleotides modified with the third modification, the up to seven nucleotides modified with the 2'-F modification. In some embodiments, in the antisense strand of the isolated oligonucleotides of the present disclosure, one of the up to seven nucleotides modified with the third modification is located at position 2 from the first nucleotide at the 5' end of the antisense strand. In some embodiments, in the antisense strand of the isolated oligonucleotides of the present disclosure, one of the up to seven nucleotides modified with the third modification is located at position 3 from the first nucleotide at the 5' end of the antisense strand. In some embodiments, in the antisense strand of the isolated oligonucleotides of the present disclosure, one of the up to seven nucleotides modified with the third modification is located at position 5 from the first nucleotide at the 5' end of the antisense strand. In some embodiments, in the antisense strand of the isolated oligonucleotides of the present disclosure, one of the up to seven nucleotides modified with the third modification is located at position 7 from the first nucleotide at the 5' end of the antisense strand. In some embodiments, in the antisense strand of an isolated oligonucleotide of the present disclosure, one of the up to seven nucleotides modified with the third modification is located at position 10 from the first nucleotide at the 5' terminus of the antisense strand. In some embodiments, in the antisense strand of an isolated oligonucleotide of the present disclosure, one of the up to seven nucleotides modified with the third modification is located at position 14 from the first nucleotide at the 5' terminus of the antisense strand. In some embodiments, in the antisense strand of an isolated oligonucleotide of the present disclosure, one of the up to seven nucleotides modified with the third modification is located at position 16 from the first nucleotide at the 5' terminus of the antisense strand. In some embodiments, in the antisense strand of an isolated oligonucleotide of the present disclosure, the up to seven nucleotides modified with the third modification are located at positions 2, 3, 5, 7, 10, 14, and 16 from the first nucleotide at the 5' terminus of the antisense strand.

[0233] In some embodiments, in the antisense strand of the isolated oligonucleotide of the present disclosure, the antisense strand comprises nucleotides modified with a 2'-F modification ("F") and nucleotides modified with a 2'-O-methyl modification ("M") according to the following formula: 3' (M) a (F) b (M) c (F) d (M) e (F) f (M) g (F) h (M) i (F) j (M) k (F) l (M) m (F) n (M)o 5', wherein M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and a, b, c, d, e, f, g, h, i, j, k, l, m, n and o are any of 0-16, wherein the antisense strand is any of the following: 3'(M)0(F)0(M)6(F)1(M)1(F)1(M)3(F)1(M)2(F)1(M)1(F)1(M)1(F)2(M)1 5'.

[0234] In some embodiments of the isolated oligonucleotide of the present disclosure, wherein the antisense strand of the isolated oligonucleotide comprises a nucleotide modified with a 2'-F modification ("F") and a nucleotide modified with a 2'-O-methyl modification ("M") according to the following formula: 3' (M) a (F) b (M) c (F) d (M) e (F) f (M) g (F) h (M) i (F) j (M) k (F) l (M) m (F) n (M) o 5', wherein M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and a, b, c, d, e, f, g, h, i, j, k, l, m, n and o are any of 0-16, wherein the antisense strand is any of the following: 3'(M)0(F)0(M)6(F)1(M)1(F)1(M)3(F)1(M)2(F)1(M)1(F)1(M)1(F)2(M)1 5', the antisense strand comprises the nucleotide sequence according to any one of SEQ ID NO: 3, 5, 6, 15, 21, 22 or 24.

[0235] In some embodiments of the isolated oligonucleotide of the present disclosure, wherein the antisense strand of the isolated oligonucleotide comprises a nucleotide modified with a 2'-F modification ("F") and a nucleotide modified with a 2'-O-methyl modification ("M") according to the following formula: 3' (M) a (F) b (M) c (F) d (M) e (F) f (M) g (F) h (M) i (F) j (M)k (F) l (M) m (F) n (M) o 5', wherein M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and a, b, c, d, e, f, g, h, i, j, k, l, m, n and o are any of 0-16, wherein the antisense strand is any of the following: 3'(M)0(F)0(M)6(F)1(M)1(F)1(M)3(F)1(M)2(F)1(M)1(F)1(M)1(F)2(M)1 5', and the antisense strand comprises the nucleotide sequence according to SEQ ID NO: 24.

[0236] In some embodiments of the isolated oligonucleotide of the present disclosure, wherein the antisense strand of the isolated oligonucleotide comprises a nucleotide modified with a 2'-F modification ("F") and a nucleotide modified with a 2'-O-methyl modification ("M") according to the following formula: 3' (M) a (F) b (M) c (F) d (M) e (F) f (M) g (F) h (M) i (F) j (M) k (F) l (M) m (F) n (M) o 5', wherein M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and a, b, c, d, e, f, g, h, i, j, k, l, m, n and o are any of 0-16, wherein the antisense strand is any of the following: 3'(M)0(F)0(M)6(F)1(M)1(F)1(M)3(F)1(M)2(F)1(M)1(F)1(M)1(F)2(M)1 5', and the antisense strand comprises the nucleotide sequence according to SEQ ID NO: 24, and the sense strand comprises the nucleotide sequence according to SEQ ID NO: 58.

[0237] In some embodiments of the isolated oligonucleotide of the present disclosure, wherein the antisense strand of the isolated oligonucleotide comprises a nucleotide modified with a 2'-F modification ("F") and a nucleotide modified with a 2'-O-methyl modification ("M") according to the following formula: 3' (M) a (F) b (M) c (F) d(M) e (F) f (M) g (F) h (M) i (F) j (M) k (F) l (M) m (F) n (M) o 5', wherein M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and a, b, c, d, e, f, g, h, i, j, k, l, m, n and o are any of 0-16, wherein the antisense strand is any of the following: 3'(M)0(F)0(M)6(F)1(M)1(F)1(M)3(F)1(M)2(F)1(M)1(F)1(M)1(F)2(M)1 5', and the antisense strand comprises the nucleotide sequence according to SEQ ID NO: 22.

[0238] In some embodiments of the isolated oligonucleotide of the present disclosure, wherein the antisense strand of the isolated oligonucleotide comprises a nucleotide modified with a 2'-F modification ("F") and a nucleotide modified with a 2'-O-methyl modification ("M") according to the following formula: 3' (M) a (F) b (M) c (F) d (M) e (F) f (M) g (F) h (M) i (F) j (M) k (F) l (M) m (F) n (M) o 5', wherein M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and a, b, c, d, e, f, g, h, i, j, k, l, m, n and o are any of 0-16, wherein the antisense strand is any of the following: 3'(M)0(F)0(M)6(F)1(M)1(F)1(M)3(F)1(M)2(F)1(M)1(F)1(M)1(F)2(M)1 5', and the antisense strand comprises the nucleotide sequence according to SEQ ID NO: 22, and the sense strand comprises the nucleotide sequence according to SEQ ID NO: 56.

[0239] In some embodiments of the isolated oligonucleotide of the present disclosure, wherein the antisense strand of the isolated oligonucleotide comprises a nucleotide modified with a 2'-F modification ("F") and a nucleotide modified with a 2'-O-methyl modification ("M") according to the following formula: 3' (M) a (F) b (M) c (F) d (M) e (F) f (M) g (F) h (M) i (F) j (M) k (F) l (M) m (F) n (M) o 5', wherein M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and a, b, c, d, e, f, g, h, i, j, k, l, m, n and o are any of 0-16, wherein the antisense strand is any of the following: 3'(M)0(F)0(M)6(F)1(M)1(F)1(M)3(F)1(M)2(F)1(M)1(F)1(M)1(F)2(M)1 5', and the antisense strand comprises the nucleotide sequence according to SEQ ID NO: 3.

[0240] In some embodiments of the isolated oligonucleotide of the present disclosure, wherein the antisense strand of the isolated oligonucleotide comprises a nucleotide modified with a 2'-F modification ("F") and a nucleotide modified with a 2'-O-methyl modification ("M") according to the following formula: 3' (M) a (F) b (M) c (F) d (M) e (F) f (M) g (F) h (M) i (F) j (M) k (F) l (M) m (F) n (M) o5', wherein M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and a, b, c, d, e, f, g, h, i, j, k, l, m, n and o are any of 0-16, wherein the antisense strand is any of the following: 3'(M)0(F)0(M)6(F)1(M)1(F)1(M)3(F)1(M)2(F)1(M)1(F)1(M)1(F)2(M)1 5', and the antisense strand comprises the nucleotide sequence according to SEQ ID NO: 3, and the sense strand comprises the nucleotide sequence according to SEQ ID NO: 37.

[0241] In some embodiments of the isolated oligonucleotide of the present disclosure, wherein the antisense strand of the isolated oligonucleotide comprises a nucleotide modified with a 2'-F modification ("F") and a nucleotide modified with a 2'-O-methyl modification ("M") according to the following formula: 3' (M) a (F) b (M) c (F) d (M) e (F) f (M) g (F) h (M) i (F) j (M) k (F) l (M) m (F) n (M) o 5', wherein M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and a, b, c, d, e, f, g, h, i, j, k, l, m, n and o are any of 0-16, wherein the antisense strand is any of the following: 3'(M)0(F)0(M)6(F)1(M)1(F)1(M)3(F)1(M)2(F)1(M)1(F)1(M)1(F)2(M)1 5', and the antisense strand comprises the nucleotide sequence according to SEQ ID NO: 21.

[0242] In some embodiments of the isolated oligonucleotide of the present disclosure, wherein the antisense strand of the isolated oligonucleotide comprises a nucleotide modified with a 2'-F modification ("F") and a nucleotide modified with a 2'-O-methyl modification ("M") according to the following formula: 3' (M) a (F) b (M) c (F) d (M) e (F) f (M) g (F) h (M)i (F) j (M) k (F) l (M) m (F) n (M) o 5', wherein M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and a, b, c, d, e, f, g, h, i, j, k, l, m, n and o are any of 0-16, wherein the antisense strand is any of the following: 3'(M)0(F)0(M)6(F)1(M)1(F)1(M)3(F)1(M)2(F)1(M)1(F)1(M)1(F)2(M)1 5', and the antisense strand comprises the nucleotide sequence according to SEQ ID NO: 21, and the sense strand comprises the nucleotide sequence according to SEQ ID NO: 55.

[0243] In some embodiments of the isolated oligonucleotide of the present disclosure, wherein the antisense strand of the isolated oligonucleotide comprises a nucleotide modified with a 2'-F modification ("F") and a nucleotide modified with a 2'-O-methyl modification ("M") according to the following formula: 3' (M) a (F) b (M) c (F) d (M) e (F) f (M) g (F) h (M) i (F) j (M) k (F) l (M) m (F) n (M) o 5', wherein M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and a, b, c, d, e, f, g, h, i, j, k, l, m, n and o are any of 0-16, wherein the antisense strand is any of the following: 3'(M)0(F)0(M)6(F)1(M)1(F)1(M)3(F)1(M)2(F)1(M)1(F)1(M)1(F)2(M)1 5', and the antisense strand comprises the nucleotide sequence according to SEQ ID NO: 15.

[0244] In some embodiments of the isolated oligonucleotide of the present disclosure, wherein the antisense strand of the isolated oligonucleotide comprises a nucleotide modified with a 2'-F modification ("F") and a nucleotide modified with a 2'-O-methyl modification ("M") according to the following formula: 3' (M) a (F) b(M) c (F) d (M) e (F) f (M) g (F) h (M) i (F) j (M) k (F) l (M) m (F) n (M) o 5', wherein M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and a, b, c, d, e, f, g, h, i, j, k, l, m, n and o are any of 0-16, wherein the antisense strand is any of the following: 3'(M)0(F)0(M)6(F)1(M)1(F)1(M)3(F)1(M)2(F)1(M)1(F)1(M)1(F)2(M)1 5', and the antisense strand comprises the nucleotide sequence according to SEQ ID NO: 15, and the sense strand comprises the nucleotide sequence according to SEQ ID NO: 49.

[0245] In some embodiments of the isolated oligonucleotide of the present disclosure, wherein the antisense strand of the isolated oligonucleotide comprises a nucleotide modified with a 2'-F modification ("F") and a nucleotide modified with a 2'-O-methyl modification ("M") according to the following formula: 3' (M) a (F) b (M) c (F) d (M) e (F) f (M) g (F) h (M) i (F) j (M) k (F) l (M) m (F) n (M) o 5', wherein M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and a, b, c, d, e, f, g, h, i, j, k, l, m, n and o are any of 0-16, wherein the antisense strand is any of the following: 3'(M)0(F)0(M)6(F)1(M)1(F)1(M)3(F)1(M)2(F)1(M)1(F)1(M)1(F)2(M)1 5', and the antisense strand comprises the nucleotide sequence according to SEQ ID NO: 6.

[0246] In some embodiments of the isolated oligonucleotide of the present disclosure, wherein the antisense strand of the isolated oligonucleotide comprises a nucleotide modified with a 2'-F modification ("F") and a nucleotide modified with a 2'-O-methyl modification ("M") according to the following formula: 3' (M) a (F) b (M) c (F) d (M) e (F) f (M) g (F) h (M) i (F) j (M) k (F) l (M) m (F) n (M) o 5', wherein M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and a, b, c, d, e, f, g, h, i, j, k, l, m, n and o are any of 0-16, wherein the antisense strand is any of the following: 3'(M)0(F)0(M)6(F)1(M)1(F)1(M)3(F)1(M)2(F)1(M)1(F)1(M)1(F)2(M)1 5', and the antisense strand comprises the nucleotide sequence according to SEQ ID NO: 6, and the sense strand comprises the nucleotide sequence according to SEQ ID NO: 389.

[0247] In some embodiments of the isolated oligonucleotide of the present disclosure, wherein the antisense strand of the isolated oligonucleotide comprises a nucleotide modified with a 2'-F modification ("F") and a nucleotide modified with a 2'-O-methyl modification ("M") according to the following formula: 3' (M) a (F) b (M) c (F) d (M) e (F) f (M) g (F) h (M) i (F) j (M) k (F) l (M) m (F) n (M) o5', wherein M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and a, b, c, d, e, f, g, h, i, j, k, l, m, n and o are any of 0-16, wherein the antisense strand is any of the following: 3'(M)0(F)0(M)6(F)1(M)1(F)1(M)3(F)1(M)2(F)1(M)1(F)1(M)1(F)2(M)1 5', and the antisense strand comprises the nucleotide sequence according to SEQ ID NO: 5.

[0248] In some embodiments of the isolated oligonucleotide of the present disclosure, wherein the antisense strand of the isolated oligonucleotide comprises a nucleotide modified with a 2'-F modification ("F") and a nucleotide modified with a 2'-O-methyl modification ("M") according to the following formula: 3' (M) a (F) b (M) c (F) d (M) e (F) f (M) g (F) h (M) i (F) j (M) k (F) l (M) m (F) n (M) o 5', wherein M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and a, b, c, d, e, f, g, h, i, j, k, l, m, n and o are any of 0-16, wherein the antisense strand is any of the following: 3'(M)0(F)0(M)6(F)1(M)1(F)1(M)3(F)1(M)2(F)1(M)1(F)1(M)1(F)2(M)1 5', and the antisense strand comprises the nucleotide sequence according to SEQ ID NO: 5, and the sense strand comprises the nucleotide sequence according to SEQ ID NO: 39.

[0249] Targeting ligands In some embodiments, in the sense strand or antisense strand of the isolated oligonucleotide of the present disclosure, or both, a terminal or internal nucleotide is connected to a targeting ligand. In some embodiments, the targeting ligand is attached to one or more nucleotides at the 5' end of the sense strand of the isolated oligonucleotide of the present disclosure. In some embodiments, the targeting ligand is attached to one or more nucleotides at the 3' end of the sense strand of the isolated oligonucleotide of the present disclosure. In some embodiments, the targeting ligand is attached to one or more nucleotides at the 5' end of the antisense strand of the isolated oligonucleotide of the present disclosure. In some embodiments, the targeting ligand is attached to one or more nucleotides at the 3' end of the antisense strand of the isolated oligonucleotide of the present disclosure. In some embodiments, the targeting ligand is attached to one or more nucleotides of at least two single-stranded nucleotides at the 3' end of the antisense strand of the isolated oligonucleotide of the present disclosure.

[0250] In some embodiments, the targeting ligand is selected from one or more of a carbohydrate, a peptide, a lipid, an antibody or fragment thereof, an aptamer, albumin, fibrinogen, and folic acid. In some embodiments, the targeting ligand binds to a surface protein on a cell expressing the target mRNA of the isolated oligonucleotide of the present disclosure. In some embodiments, the targeting ligand mediates entry of the isolated oligonucleotide of the present disclosure into a cell expressing the target mRNA of the isolated oligonucleotide of the present disclosure.

[0251] In some embodiments, the targeting ligand is a therapeutic ligand. In some embodiments, the targeting ligand is a therapeutic antibody.

[0252] In some embodiments, the targeting ligand is attached to the isolated oligonucleotide of the present disclosure via a linker. In some embodiments, the linker is any one of a protein, DNA, RNA, or a chemical compound. In some embodiments, the isolated oligonucleotide of the present disclosure, the linker, and the targeting ligand form a scaffold. As used herein, the term "scaffold" refers to a compound or complex comprising a linker of the present disclosure, wherein the linker is covalently attached to the ligand or the isolated oligonucleotide or both.

[0253] In some embodiments, the isolated oligonucleotide of the present disclosure, a linker, and a targeting ligand form a conjugate. As used herein, the term "conjugate" refers to a compound or complex comprising an isolated oligonucleotide covalently attached to a ligand via a linker of the present disclosure.

[0254] As used herein, the term "targeting ligand" or "ligand" refers to a moiety that, when covalently attached to an oligonucleotide, is capable of mediating its entry into, promoting, or permitting its delivery to a target site (e.g., a target cell or tissue). In some embodiments, the targeting ligand comprises a sugar ligand moiety (e.g., N-acetylgalactosamine (GalNAc)) that can direct the uptake of the oligonucleotide into the liver.

[0255] In some embodiments, the targeting ligand binds to the asialoglycoprotein receptor (ASGPR).In some embodiments, the targeting ligand binds (e.g., via the ASGPR) to the liver, such as a parenchymal cell of the liver.

[0256] Suitable targeting ligands include, but are not limited to, those disclosed in Winkler (Ther. Deliv., 2013, 4(7): 791-809), PCT Patent Application Publication Nos. WO / 2016 / 100401, WO / 2012 / 089352, and WO / 2009 / 082607, and U.S. Patent Application Publication Nos. 2009 / 0239814, 2012 / 0136042, 2013 / 0158824, and 2009 / 0247608, each of which is incorporated by reference.

[0257] In some embodiments, the targeting ligand comprises a carbohydrate moiety.

[0258] As used herein, "carbohydrate moiety" refers to a moiety comprising one or more monosaccharide units, each monosaccharide unit having at least six carbon atoms (which may be linear, branched, or cyclic), wherein an oxygen atom, a nitrogen atom, or a sulfur atom is bonded to each carbon atom. In some embodiments, the carbohydrate moiety comprises a monosaccharide, a disaccharide, a trisaccharide, or a tetrasaccharide. In some embodiments, the carbohydrate moiety comprises an oligosaccharide containing from about 4-9 monosaccharide units. In some embodiments, the carbohydrate moiety comprises a polysaccharide (e.g., starch, glycogen, cellulose, or a polysaccharide gum).

[0259] In some embodiments, the carbohydrate moiety comprises a monosaccharide, a disaccharide, a trisaccharide, or a tetrasaccharide. In some embodiments, the carbohydrate moiety comprises an oligosaccharide (e.g., containing from about 4 to about 9 monosaccharide units). In some embodiments, the carbohydrate moiety comprises a polysaccharide (e.g., starch, glycogen, cellulose, or a polysaccharide gum).

[0260] In some embodiments, the ligand is capable of binding to a human asialoglycoprotein receptor (ASGPR), eg, human asialoglycoprotein receptor 2 (ASGPR2).

[0261] In some embodiments, the carbohydrate moiety comprises a sugar (e.g., one, two, or three sugars). In some embodiments, the carbohydrate moiety comprises galactose or a derivative thereof (e.g., one, two, or three galactoses or a derivative thereof). In some embodiments, the carbohydrate moiety comprises N-acetylgalactosamine or a derivative thereof (e.g., one, two, or three N-acetylgalactosamines or a derivative thereof). In some embodiments, the carbohydrate moiety comprises N-acetyl-D-galactosamine or a derivative thereof (e.g., one, two, or three N-acetyl-D-galactosamines or a derivative thereof).

[0262] In some embodiments, the carbohydrate moiety comprises N-acetylgalactosamine (e.g., one, two, or three N-acetylgalactosamines). In some embodiments, the carbohydrate moiety comprises N-acetyl-D-galactosamine (e.g., one, two, or three N-acetyl-D-galactosamines).

[0263] In some embodiments, the carbohydrate moiety comprises mannose or a derivative thereof (e.g., mannose-6-phosphate). In some embodiments, the carbohydrate moiety further comprises a linking moiety that connects one or more sugars (e.g., N-acetyl-D-galactosamine) to the linker.

[0264] In some embodiments, the linker comprises a thioether (e.g., thiosuccinimide or a hydrolyzed analog thereof), a disulfide, a triazole, a thiophosphate, a phosphodiester, an ester, an amide, or any combination thereof. In some embodiments, the linker is a three-branched connecting portion. Suitable targeting ligands include, but are not limited to, those disclosed in PCT Application Publication Nos. WO / 2015 / 006740, WO / 2016 / 100401, WO / 2017 / 214112, WO / 2018 / 039364, and WO / 2018 / 045317, each of which is incorporated herein by reference.

[0265] In some embodiments, the targeting ligand comprises a lipid or lipid moiety (e.g., one, two, or three lipid moieties). In some embodiments, the lipid moiety comprises (e.g., one, two, or three) C8-C24 fatty acids, cholesterol, vitamins, sterols, phospholipids, or any combination thereof.

[0266] In some embodiments, the targeting ligand comprises a peptide or peptide portion (e.g., one, two, or three peptide portions). In some embodiments, the peptide portion comprises (e.g., one, two, or three) integrins, insulin, glucagon-like peptides, or any combination thereof. In some embodiments, the targeting ligand comprises an antibody or antibody portion (e.g., transferrin). In some embodiments, the targeting ligand comprises one, two, or three antibody portions (e.g., transferrin).

[0267] In some embodiments, the targeting ligand comprises an oligonucleotide (e.g., an aptamer or a CpG). In some embodiments, the targeting ligand comprises one, two, or three oligonucleotides (e.g., an aptamer or a CpG).

[0268] In some embodiments, the ligand comprises: one, two, or three sugars (e.g., N-acetyl-D-galactosamine); one, two, or three lipid moieties; one, two, or three peptide moieties; one, two, or three antibody moieties; one, two, or three oligonucleotides; or any combination thereof.

[0269] In some embodiments, a linker is attached to an isolated oligonucleotide of the disclosure via a phosphate group or an analog of a phosphate group in the isolated oligonucleotide.

[0270] In some embodiments, the ligand comprises a sugar ligand moiety (eg, N-acetylgalactosamine (GalNAc)) that can direct uptake of the oligonucleotide into the liver.

[0271] In some embodiments, the ligand comprises GalNAc or a derivative thereof. In some embodiments, the ligand comprises the GalNAc G1b structure shown below.

[0272]

[0273] GalNAc G1b In some embodiments, the ligand comprises three GalNAc moieties or three derivatives thereof. In some embodiments, the ligand comprises three GalNAc G1b moieties. In some embodiments, wherein the ligand comprises three GalNAc G1b moieties, the GalNAc G1b moieties are positioned consecutively. In some embodiments, the consecutively positioned GalNAc G1b moieties are located at the 3' end of the sense strand. In some embodiments, wherein the ligand comprises three consecutively positioned GalNAc G1b ("G1b") moieties, the first G1b moiety is connected to the second G1b moiety, and the second G1b is connected to the third G1b moiety. In some embodiments, the first GalNAc G1b moiety is connected to the sense strand of the isolated oligonucleotide of the present disclosure.

[0274] In some embodiments of the isolated oligonucleotide of the present disclosure, wherein the ligand comprises three GalNAcG1b ("G1b") moieties, wherein a first GalNAc G1b moiety is linked to the sense strand of the isolated oligonucleotide, the first GalNAcG1b moiety is further linked to a second GalNAc G1b moiety, and the second G1b is linked to a third G1b moiety. In some embodiments, wherein the ligand comprises three GalNAc G1b moieties, the three GalNAc G1b moieties are located consecutively on the 3' end of the sense strand.

[0275] In some embodiments of the isolated oligonucleotides of the present disclosure, the isolated oligonucleotide is connected to a ligand (e.g., GalNAc G1b or three GalNAc G1b moieties). In some embodiments, the isolated oligonucleotide is connected to a ligand via an internal or terminal nucleotide of the isolated oligonucleotide. In some embodiments, the isolated oligonucleotide is connected to a ligand via a ligand linker.

[0276] In some embodiments of the isolated oligonucleotide of the present disclosure, wherein the isolated oligonucleotide comprises a sense strand and an antisense strand, and wherein the ligand comprises three GalNAc G1b moieties, and the three GalNAc G1b moieties are consecutively located at the 3' end of the sense strand, the ligand is linked to the terminal nucleotide on the sense strand of the isolated oligonucleotide. In some embodiments, the ligand is linked to the terminal nucleotide on the sense strand via a ligand linker. In some embodiments, the ligand linker is a monovalent linker. In some embodiments, the ligand linker is a divalent linker. In some embodiments, the ligand linker is a trivalent linker.

[0277] In some embodiments of the isolated oligonucleotides of the present disclosure, wherein the sense strand comprises a nucleotide sequence identical to a region selected from any one of the following nucleotide positions from the 5' end of the CFB mRNA sequence according to SEQ ID NO: 1: a) 495 to 534; b) 1465 to 1485; and c) 1822 to 1849, and the antisense strand is substantially complementary to the sense strand such that the sense and antisense strands together form a double-stranded region, the targeting ligand is attached to the 3' end of the sense strand. In some embodiments, the targeting ligand comprises three GalNAc G1b moieties.

[0278] In some embodiments of the isolated oligonucleotides of the present disclosure, wherein the sense strand comprises a nucleotide sequence identical to a region selected from any one of the following nucleotide positions from the 5' end of the CFB mRNA sequence according to SEQ ID NO: 1: a) 495 to 534; b) 1465 to 1485, and c) 1822 to 1849, and the antisense strand is substantially complementary to the sense strand such that the sense and antisense strands together form a double-stranded region, wherein the targeting ligand comprises three GalNAc Glb moieties attached to the 3' end of the sense strand, the sense strand comprises a nucleotide sequence according to SEQ ID NO: 37 (5' AGUGAUGAGAUCUCUUUCCA 3'); SEQ ID NO: 39 (5' GAUCUCUUUCCACUGCUAUA 3'); SEQ ID NO: 49 (5'ACAAUGAGCAACAUGUGUUA 3'); SEQ ID NO: 55 (5' AAGCAGGAAUUCCUGAAUUA 3'); SEQ ID NO: 56 (5' CAGGAAUUCCUGAAUUUUAA 3'); SEQ ID NO: 58 (5' AAUUCCUGAAUUUUAUGACA3'); or SEQ ID NO: 389 (5' ACUGCUAUGACGGUUACACA 3').

[0279] The connection at the 3' end of the isolated oligonucleotide of the present disclosure can be directly via a 5', 3' or 2' hydroxyl group, or indirectly via a non-nucleotide linker or nucleoside (utilizing the 2' or 3' hydroxyl position of the nucleoside). The connection can also utilize a functionalized sugar or core base of the 3' terminal nucleotide. In some embodiments, the ligands described herein can be attached to the isolated oligonucleotide of the present disclosure by various ligand linkers, which can be cleavable or non-cleavable.

[0280] Modification of phosphate groups Modified terminal phosphate group The present disclosure also provides oligonucleotides and conjugates containing modified phosphate groups (also referred to as phosphate mimetics or phosphate derivatives) for nucleic acid delivery. The present disclosure also relates to oligonucleotides and conjugates containing modified phosphate groups, for example, in the delivery of nucleic acids and / or the treatment or prevention of disease.

[0281] In some embodiments, the present disclosure provides phosphate mimetics of the 5' terminal nucleotide. Without wishing to be bound by theory, it is understood that when incorporated into an oligonucleotide (e.g., at the 5' end of the antisense strand), the phosphate mimetics can improve Ago2 binding / loading and enhance the metabolic stability of the oligonucleotide, thereby enhancing the potency and duration of the isolated oligonucleotide (e.g., dsRNA or siRNA).

[0282] In some embodiments of the isolated oligonucleotides of the present disclosure, the oligonucleotides include 5' terminal nucleotide modifications. In some embodiments, the 5' terminal modifications provide a functional effect of a phosphate group, but are more stable in the environmental conditions to which the oligonucleotides are exposed when administered to a subject. In some embodiments, the isolated oligonucleotides include phosphate mimics that are more resistant to phosphatases and other enzymes while minimizing the negative effects on the function of the oligonucleotides (e.g., when used as RNAi inhibitor molecules, minimizing any reduction in gene target knockdown).

[0283] In some embodiments, the 5' end modification is a chemical modification.In some embodiments, the chemical modification enhances stability against nucleases or other enzymes that degrade or interfere with the structure or activity of the isolated oligonucleotide.

[0284] In some embodiments, the sense strand or antisense strand of the isolated oligonucleotide of the present disclosure comprises a 5' terminal phosphate group. In some embodiments, the 5' terminal phosphate group comprises an unmodified phosphate having the formula: -OP(=O)(OH)OH. In some embodiments, the 5' terminal phosphate group comprises a modified phosphate. In some embodiments, the 5' terminal phosphate group comprises a modified phosphate having the formula: -CH2-P(=X)(OR 1 )OR 2 A modified phosphate, wherein X is O or S, R 1 is H or C1-C6 alkyl, and R 2 is H or C1-C6 alkyl. In some embodiments, the modified phosphate is referred to as a "phosphate mimetic."

[0285] As used herein, the term "halo" or "halogen" refers to fluorine, chlorine, bromine, and iodine.

[0286] As used herein, the term "aryl" includes groups having aromaticity (including "conjugated") or polycyclic ring systems having one or more aromatic rings and not containing any heteroatoms in the ring structure. The term aryl includes both monovalent and divalent species. Examples of aryl groups include, but are not limited to, phenyl, biphenyl, naphthyl, and the like. Conveniently, aryl is phenyl.

[0287] As used herein, the term "alkyl" or "C1-C6 alkyl" is intended to include C1, C2, C3, C4, C5 or C6 straight (linear) saturated aliphatic hydrocarbon groups and C3, C4, C5 or C6 branched saturated aliphatic hydrocarbon groups. For example, C1-C6 alkyl is intended to include C1, C2, C3, C4, C5 and C6 alkyl groups. Examples of alkyl groups include moieties having 1 to 6 carbon atoms, such as, but not limited to, methyl, ethyl, n-propyl, isopropyl, n-butyl, sec-butyl, tert-butyl, n-pentyl, isopentyl or n-hexyl. In some embodiments, straight or branched chain alkyl groups have six or fewer carbon atoms (e.g., C1-C6 for straight chain and C3-C6 for branched chain), and in another embodiment, straight or branched chain alkyl groups have four or fewer carbon atoms. In some embodiments, straight chain alkyl groups have one carbon atom. In some embodiments, straight chain alkyl groups have two carbon atoms.

[0288] In some embodiments, a phosphate mimetic is attached to the 5' end of an isolated oligonucleotide (eg, siRNA) as shown in the following formula:

[0289] in: B is H or a nucleobase moiety; X is O or S; R 1 is H or C1-C6 alkyl; R 2 is H or C1-C6 alkyl; Y 1 is O or S; Y 2 is O or S; Z is H, halogen or -OR Z ; R Z is H, C1-C6 alkyl or -(C1-C6 alkyl)-(C6-C 10 Aryl), wherein C1-C6 alkyl or -(C1-C6 alkyl)-(C6-C 10 aryl) is optionally substituted by one or more R Za replace; Each R Za are independently halogen, C1-C6 alkyl, or -O-(C1-C6 alkyl), wherein C1-C6 alkyl or -O-(C1-C6 alkyl) is optionally substituted with one or more halogen; and Attachment of nucleotides to isolated oligonucleotides (eg, siRNA) is indicated.

[0290] In some embodiments, a phosphate mimetic is attached to the 5' end of an isolated oligonucleotide (eg, siRNA) as shown in the following formula: , in: B is H or a nucleobase moiety; X is O or S; R 1 is H or C1-C6 alkyl; R 2 is H or C1-C6 alkyl; Y 1 is O or S; Y 2 is O or S; and Attachment of nucleotides to isolated oligonucleotides (eg, siRNA) is indicated.

[0291] In some embodiments, a phosphate mimetic is attached to the 5' end of an isolated oligonucleotide (eg, siRNA) as shown in the following formula: , in: B is H or a nucleobase moiety; X is O or S; R 1 is H or C1-C6 alkyl; R 2 is H or C1-C6 alkyl; and Attachment of nucleotides to isolated oligonucleotides (eg, siRNA) is indicated.

[0292] In some embodiments, X is O.

[0293] In some embodiments, X is S.

[0294] In some embodiments, R 1 It’s H.

[0295] In some embodiments, R 1 is a C1-C6 alkyl group (e.g., methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, pentyl or hexyl).

[0296] In some embodiments, R 1 It's methyl.

[0297] In some embodiments, R 2 It’s H.

[0298] In some embodiments, R 2is a C1-C6 alkyl group (e.g., methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, pentyl or hexyl).

[0299] In some embodiments, R 2 It's methyl.

[0300] In some embodiments, Y 1 It's O.

[0301] In some embodiments, Y 1 It’s S.

[0302] In some embodiments, Y 2 It's O.

[0303] In some embodiments, Y 2 It’s S.

[0304] In some embodiments, Z is H.

[0305] In some embodiments, Z is not H.

[0306] In some embodiments, Z is halogen (eg, F, Cl, Br, or I).

[0307] In some embodiments, Z is F or Cl.

[0308] In some embodiments, Z is F.

[0309] In some embodiments, Z is -OR Z .

[0310] In some embodiments, Z is -OH.

[0311] In some embodiments, Z is not -OH.

[0312] In some embodiments, Z is -O-(C1-C6 alkyl) (e.g., wherein C1-C6 alkyl is methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, pentyl, or hexyl).

[0313] In some embodiments, Z is -OCH3.

[0314] In some embodiments, Z is -O-(C1-C6 alkyl)-O-(C1-C6 alkyl) (e.g., wherein C1-C6 alkyl is methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, pentyl, or hexyl).

[0315] In some embodiments, Z is -OCH2CH2OCH3.

[0316] In some embodiments, Z is optionally replaced by one or more R Za Substituted-O-(C1-C6 alkyl)-(C6-C 10 aryl).

[0317] In some embodiments, Z is -O-(C1-C6 alkyl)-(C6-C 10 aryl).

[0318] In some embodiments, Z is .

[0319] In some embodiments, Z is optionally replaced by one or more R Za Replaced .

[0320] In some embodiments, Z is optionally substituted with one or more halogens. .

[0321] In some embodiments, Z is optionally substituted with one or more C1-C6 alkyl or -O-(C1-C6 alkyl) , wherein C1-C6 alkyl or -O-(C1-C6 alkyl) is optionally substituted with one or more halogens.

[0322] In some embodiments, R Z It’s H.

[0323] In some embodiments, R Z Not H.

[0324] In some embodiments, R Z is optionally replaced by one or more R Za Substituted C1-C6 alkyl (e.g., methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, pentyl or hexyl).

[0325] In some embodiments, R Z is C1-C6 alkyl (e.g., methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, pentyl or hexyl) optionally substituted with one or more halogen (e.g., F, Cl, Br or I), or -O-(C1-C6 alkyl) (e.g., wherein C1-C6 alkyl is methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, pentyl or hexyl) optionally substituted with one or more halogen.

[0326] In some embodiments, R Z is a C1-C6 alkyl group (e.g., methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, pentyl or hexyl).

[0327] In some embodiments, R Z It is methyl, ethyl or propyl.

[0328] In some embodiments, R Z It's methyl.

[0329] In some embodiments, R Z is C1-C6 alkyl (e.g., methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, pentyl or hexyl) substituted by one or more halogen (e.g., F, Cl, Br or I).

[0330] In some embodiments, R Z is C1-C6 alkyl (e.g., methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, pentyl or hexyl) substituted with one or more -O-(C1-C6 alkyl) (e.g., wherein C1-C6 alkyl is methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, pentyl or hexyl), wherein -O-(C1-C6 alkyl) is optionally substituted with one or more halogens.

[0331] In some embodiments, R Z is optionally replaced by one or more R Za Substituted-(C1-C6 alkyl)-(C6-C 10 aryl).

[0332] In some embodiments, R Z is a -(C1-C6 alkyl)-(C6-C 10 -C6 alkyl) is optionally substituted with one or more halogens.

[0333] In some embodiments, R Z It is -(C1-C6 alkyl)-(C6-C 10 aryl).

[0334] In some embodiments, at least one R Za is a halogen (eg, F, Cl, Br, or I).

[0335] In some embodiments, at least one RZa It is F or Cl.

[0336] In some embodiments, at least one R Za is C1-C6 alkyl (e.g., methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, pentyl or hexyl) optionally substituted with one or more halogen (e.g., F, Cl, Br or I).

[0337] In some embodiments, at least one R Za is a C1-C6 alkyl group (e.g., methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, pentyl or hexyl).

[0338] In some embodiments, at least one R Za is C1-C6 alkyl (e.g., methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, pentyl or hexyl) substituted by one or more halogen (e.g., F, Cl, Br or I).

[0339] In some embodiments, at least one R Za is -O-(C1-C6 alkyl) optionally substituted with one or more halogens (eg, F, Cl, Br, or I).

[0340] In some embodiments, at least one R Za It is -O-(C1-C6 alkyl).

[0341] In some embodiments, at least one R Za is -O-(C1-C6 alkyl) substituted by one or more halogens (eg, F, Cl, Br, or I).

[0342] In some embodiments, B is H.

[0343] In some embodiments, B is a nucleobase moiety.

[0344] As used herein, the term "nucleobase moiety" refers to a nucleobase that is attached, eg, via an atom of the nucleobase or a functional group thereof, to the remainder of an isolated oligonucleotide (eg, dsRNA or siRNA) of the disclosure.

[0345] In some embodiments, the nucleobase moiety is adenine (A), cytosine (C), guanine (G), thymine (T), or uracil (U).

[0346] In some embodiments, the nucleobase moiety is uracil (U).

[0347] In some embodiments, a phosphate mimetic is attached to the 5' end of the isolated oligonucleotide as shown in the following formula: , in: B is a nucleobase moiety, wherein the nucleobase moiety is uracil (U), wherein the uracil is at position 1 from the 5' end of the sense strand or at position 1 from the 5' end of the antisense strand; X is O; R 1 is a C1 alkyl group; R 2 is H; and Attachment of nucleotides to isolated oligonucleotides (eg, siRNA) is indicated.

[0348] In some embodiments of the isolated oligonucleotides of the disclosure, a phosphate mimetic is attached to the 5' end of the antisense strand of the isolated oligonucleotide.

[0349] In some embodiments, the phosphate mimetic is attached to the 5' terminal uridine of the antisense strand of the isolated oligonucleotide, having the following structure (5'-MeEPmU).

[0350]

[0351] 5'-MeEPmU, where "mU" is a 2'-O-methyl modified uridine nucleotide and "MeEP" is a monomethyl protected phosphate mimetic.

[0352] In some embodiments, a phosphate mimetic is attached to the 5' terminal uridine of the antisense strand of an isolated oligonucleotide having the following structure (5'-MeEPmUs).

[0353]

[0354] 5'-MeEPmUs, where "mU" is a 2'-O-methyl modified uridine nucleotide, "MeEP" is a monomethyl protected phosphate mimetic, and "s" is a phosphorothioate internucleotide linkage.

[0355] In some embodiments, a phosphate mimetic is attached to the 5' terminal uridine of the antisense strand of an isolated oligonucleotide having the following structure (5'-EPmUs).

[0356]

[0357] 5'-EPmUs, where "mU" is a 2'-O-methyl modified uridine nucleotide, "EP" is a phosphate mimetic, and "s" is a phosphorothioate internucleotide linkage.

[0358] The terms "5'-MeEP," "5'-MeEP," and "5' MeEP" are used interchangeably herein.

[0359] In some embodiments of the isolated oligonucleotides of the present disclosure, wherein the sense strand comprises a nucleotide sequence identical to a region selected from any one of the following nucleotide positions from the 5' end of the CFB mRNA sequence according to SEQ ID NO: 1: a) 495 to 534; b) 1465 to 1485; and c) 1822 to 1849, and the antisense strand is substantially complementary to the sense strand such that the sense and antisense strands together form a double-stranded region, the antisense strand comprises a monomethyl-protected phosphate mimetic (MeEP). In some embodiments, the MeEP is linked to the 5' end of the antisense strand (5'-MeEP).

[0360] In some embodiments, wherein MeEP is linked to the 5' end of the antisense strand, the phosphate mimetic is attached to the 5' terminal uridine of the antisense strand.

[0361] In some embodiments, the 5' terminal uridine is a 2'-O-methyl modified nucleotide.

[0362] In some embodiments of the isolated oligonucleotides of the present disclosure, wherein the sense strand comprises a nucleotide sequence identical to a region selected from any one of the following nucleotide positions from the 5' end of the CFB mRNA sequence according to SEQ ID NO: 1: a) 495 to 534; b) 1465 to 1485, and c) 1822 to 1849, and the antisense strand is substantially complementary to the sense strand such that the sense and antisense strands together form a double-stranded region, wherein the antisense strand comprises 5'-MeEP linked to the 5' end of the antisense strand, the antisense strand comprises a sequence according to SEQ ID NO: 3 (5' UGGAAAGAGAUCUCAUCACUCA 3'); SEQ ID NO: 5 (5' UAUAGCAGUGGAAAGAGAUCUC 3'); SEQ ID NO: 6 (5' UGUGUAACCGUCAUAGCAGUGG 3'); SEQ ID NO: 15 (5' UAACACAUGUUGCUCAUUGUCU 3'); SEQ ID NO: The nucleic acid sequence of SEQ ID NO: 21 (5'UAAUUCAGGAAUUCCUGCUUCU 3'); SEQ ID NO: 22 (5' UUAAAAUUCAGGAAUUCCUGCU 3'); or SEQ ID NO: 24 (5' UGUCAUAAAAUUCAGGAAUUCC 3').

[0363] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a nucleotide sequence identical to a region selected from the group consisting of: a) 495 to 534; b) 1465 to 1485; and c) 1822 to 1849 from the 5' end of the CFB mRNA sequence according to SEQ ID NO: 1, and the antisense strand is substantially complementary to the sense strand such that the sense and antisense strands together form a double-stranded region, wherein the antisense strand comprises 5'-MeEP linked to the 5' end of the antisense strand, and the sense strand comprises a targeting ligand comprising three GalNAc G1b moieties attached to the 3' end of the sense strand.

[0364] Modified backbone phosphate / phosphodiester bonds In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand or the antisense strand, or both, comprises at least one nucleotide having a modified phosphate backbone. In some embodiments, the sense strand of the isolated oligonucleotide comprises at least one nucleotide having a modified phosphate backbone. In some embodiments, the antisense strand of the isolated oligonucleotide comprises at least one nucleotide having a modified phosphate backbone. In some embodiments, wherein the isolated oligonucleotides of the present disclosure comprise a modified phosphate backbone, the modified phosphate backbone comprises a modified phosphodiester bond. The phosphodiester bond comprises a linkage having the formula: ,in represents attachment to the 3' carbon of the first nucleotide in the isolated oligonucleotide of the present disclosure; and represents attachment to the 5' carbon of the second nucleotide in the isolated oligonucleotide of the present disclosure. In some embodiments, the phosphodiester bond is unmodified, wherein Z 1 It's O and Z 2 Is OH or O – In some embodiments, the phosphodiester bond is modified, wherein Z 1 is O, S, NH or N(C1-C6 alkyl) and Z 2 OH, SH, NH2, NH (C1-C6 alkyl), O – 、S – 、HN – or (C1-C6 alkyl)N – , and when Z 1 When it is O, Z 2 Not OH or O – .

[0365] In some embodiments, Z1 is O.

[0366] In some embodiments, Z1 is S.

[0367] In some embodiments, Z1 is NH.

[0368] In some embodiments, Z1 is N(C1-C6 alkyl).

[0369] In some embodiments, Z2 is OH.

[0370] In some embodiments, Z2 is SH.

[0371] In some embodiments, Z2 is NH2.

[0372] In some embodiments, Z2 is NH(C1-C6 alkyl).

[0373] In some embodiments, Z2 is SH, NH2, or NH(C1-C6 alkyl).

[0374] In some embodiments, Z2 is O – .

[0375] In some embodiments, Z2 is S – .

[0376] In some embodiments, Z2 is HN – .

[0377] In some embodiments, Z2 is (C1-C6 alkyl)N – .

[0378] In some embodiments, Z2 is S – 、HN – or (C1-C6 alkyl)N – .

[0379] In some embodiments, Z1 is O and Z2 is SH.

[0380] In some embodiments, Z1 is O and Z2 is NH2.

[0381] In some embodiments, Z1 is O and Z2 is NH(C1-C6 alkyl).

[0382] In some embodiments, Z1 is S and Z2 is OH.

[0383] In some embodiments, Z1 is S and Z2 is SH.

[0384] In some embodiments, Z1 is S and Z2 is NH2.

[0385] In some embodiments, Z1 is S and Z2 is NH(C1-C6 alkyl).

[0386] In some embodiments, Z1 is NH and Z2 is OH.

[0387] In some embodiments, Z1 is NH and Z2 is SH.

[0388] In some embodiments, Z1 is NH and Z2 is NH2.

[0389] In some embodiments, Z1 is NH and Z2 is NH(C1-C6 alkyl).

[0390] In some embodiments, Z1 is N(C1-C6 alkyl) and Z2 is OH.

[0391] In some embodiments, Z1 is N(C1-C6 alkyl) and Z2 is SH.

[0392] In some embodiments, Z1 is N(C1-C6 alkyl) and Z2 is NH2.

[0393] In some embodiments, Z1 is N(C1-C6 alkyl) and Z2 is NH(C1-C6 alkyl).

[0394] In some embodiments, Z1 is O and Z2 is S – .

[0395] In some embodiments, Z1 is O and Z2 is HN – .

[0396] In some embodiments, Z1 is O and Z2 is (C1-C6 alkyl)N – .

[0397] In some embodiments, Z1 is S and Z2 is O – .

[0398] In some embodiments, Z1 is S and Z2 is S – .

[0399] In some embodiments, Z1 is S and Z2 is HN – .

[0400] In some embodiments, Z1 is S and Z2 is (C1-C6 alkyl)N – .

[0401] In some embodiments, Z1 is NH and Z2 is O – .

[0402] In some embodiments, Z1 is NH and Z2 is S – .

[0403] In some embodiments, Z1 is NH and Z2 is HN – .

[0404] In some embodiments, Z1 is NH and Z2 is (C1-C6 alkyl)N – .

[0405] In some embodiments, Z1 is N(C1-C6 alkyl) and Z2 is O – .

[0406] In some embodiments, Z1 is N(C1-C6 alkyl) and Z2 is S – .

[0407] In some embodiments, Z1 is N(C1-C6 alkyl) and Z2 is HN – .

[0408] In some embodiments, Z1 is N(C1-C6 alkyl) and Z2 is (C1-C6 alkyl)N – .

[0409] In some embodiments, the modified phosphodiester bond comprises a phosphorothioate internucleotide linkage.

[0410] In some embodiments, the modified phosphodiester bond comprises or ,in represents attachment to the 3' carbon of the first nucleotide in the isolated oligonucleotide of the present disclosure; and represents attachment to the 5' carbon of the second nucleotide in the isolated oligonucleotide of the present disclosure.

[0411] In some embodiments, the modified phosphodiester bond comprises ,in represents attachment to the 3' carbon of the first nucleotide in the isolated oligonucleotide of the present disclosure; and represents attachment to the 5' carbon of the second nucleotide in the isolated oligonucleotide of the present disclosure.

[0412] In some embodiments, the modified phosphodiester bond comprises ,in represents attachment to the 3' carbon of the first nucleotide in the isolated oligonucleotide of the present disclosure; and represents attachment to the 5' carbon of the second nucleotide in the isolated oligonucleotide of the present disclosure.

[0413] In some embodiments, the isolated oligonucleotides of the present disclosure comprise at least one modified phosphodiester bond. In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand or the antisense strand or both comprise one or more modified phosphodiester bonds. In some embodiments, only the sense strand comprises one or more modified phosphodiester bonds. In some embodiments, only the antisense strand comprises one or more modified phosphodiester bonds. In some embodiments, both the sense strand and the antisense strand comprise one or more modified phosphodiester bonds.

[0414] In some embodiments, the isolated oligonucleotide comprises at least two modified phosphodiester bonds. In some embodiments, the isolated oligonucleotide comprises at least three modified phosphodiester bonds. In some embodiments, the isolated oligonucleotide comprises at least four modified phosphodiester bonds. In some embodiments, the isolated oligonucleotide comprises at least five modified phosphodiester bonds. In some embodiments, the isolated oligonucleotide comprises at least six modified phosphodiester bonds. In some embodiments, the isolated oligonucleotide comprises at least seven modified phosphodiester bonds. In some embodiments, the isolated oligonucleotide comprises at least eight modified phosphodiester bonds. In some embodiments, the isolated oligonucleotide comprises at least nine modified phosphodiester bonds. In some embodiments, the isolated oligonucleotide comprises at least ten modified phosphodiester bonds. In some embodiments, the isolated oligonucleotide comprises at least eleven modified phosphodiester bonds. In some embodiments, the isolated oligonucleotide comprises at least twelve modified phosphodiester bonds. In some embodiments, the isolated oligonucleotide comprises at least thirteen modified phosphodiester bonds. In some embodiments, the isolated oligonucleotide comprises at least fourteen modified phosphodiester bonds. In some embodiments, the isolated oligonucleotide comprises at least fifteen modified phosphodiester bonds. In some embodiments, the isolated oligonucleotide comprises at least sixteen modified phosphodiester bonds. In some embodiments, the isolated oligonucleotide comprises at least seventeen modified phosphodiester bonds. In some embodiments, the isolated oligonucleotide comprises at least eighteen modified phosphodiester bonds. In some embodiments, the isolated oligonucleotide comprises at least nineteen modified phosphodiester bonds. In some embodiments, the isolated oligonucleotide comprises at least twenty modified phosphodiester bonds. In some embodiments, the isolated oligonucleotide comprises more than twenty modified phosphodiester bonds. In some embodiments, the isolated oligonucleotide comprises between twenty and thirty modified phosphodiester bonds. In some embodiments, the isolated oligonucleotide comprises between thirty and forty modified phosphodiester bonds. In some embodiments, the isolated oligonucleotide comprises between forty and fifty modified phosphodiester bonds.

[0415] In some embodiments, the isolated oligonucleotide comprises at least two phosphorothioate internucleotide linkages. In some embodiments, the isolated oligonucleotide comprises at least three phosphorothioate internucleotide linkages. In some embodiments, the isolated oligonucleotide comprises at least four phosphorothioate internucleotide linkages. In some embodiments, the isolated oligonucleotide comprises at least five phosphorothioate internucleotide linkages. In some embodiments, the isolated oligonucleotide comprises at least six phosphorothioate internucleotide linkages. In some embodiments, the isolated oligonucleotide comprises at least seven phosphorothioate internucleotide linkages. In some embodiments, the isolated oligonucleotide comprises at least eight phosphorothioate internucleotide linkages. In some embodiments, the isolated oligonucleotide comprises at least nine phosphorothioate internucleotide linkages. In some embodiments, the isolated oligonucleotide comprises at least ten phosphorothioate internucleotide linkages. In some embodiments, the isolated oligonucleotide comprises at least eleven phosphorothioate internucleotide linkages. In some embodiments, the isolated oligonucleotide comprises at least twelve phosphorothioate internucleotide linkages. In some embodiments, the isolated oligonucleotide comprises at least thirteen phosphorothioate internucleotide linkages. In some embodiments, the isolated oligonucleotide comprises at least fourteen phosphorothioate internucleotide linkages. In some embodiments, the isolated oligonucleotide comprises at least fifteen phosphorothioate internucleotide linkages. In some embodiments, the isolated oligonucleotide comprises at least sixteen phosphorothioate internucleotide linkages. In some embodiments, the isolated oligonucleotide comprises at least seventeen phosphorothioate internucleotide linkages. In some embodiments, the isolated oligonucleotide comprises at least eighteen phosphorothioate internucleotide linkages. In some embodiments, the isolated oligonucleotide comprises at least nineteen phosphorothioate internucleotide linkages. In some embodiments, the isolated oligonucleotide comprises at least twenty phosphorothioate internucleotide linkages. In some embodiments, the isolated oligonucleotide comprises more than twenty phosphorothioate internucleotide linkages. In some embodiments, the isolated oligonucleotide comprises between twenty and thirty phosphorothioate internucleotide linkages. In some embodiments, the isolated oligonucleotide comprises between thirty and forty phosphorothioate internucleotide linkages. In some embodiments, the isolated oligonucleotide comprises between forty and fifty phosphorothioate internucleotide linkages.

[0416] In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least one modified phosphodiester bond. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least two modified phosphodiester bonds. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least three modified phosphodiester bonds. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least four modified phosphodiester bonds. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least five modified phosphodiester bonds. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least six modified phosphodiester bonds. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least seven modified phosphodiester bonds. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least eight modified phosphodiester bonds. In some embodiments, the sense strand and / or antisense strand of an isolated oligonucleotide each comprises at least nine modified phosphodiester bonds. In some embodiments, the sense strand and / or antisense strand of an isolated oligonucleotide each comprises at least ten modified phosphodiester bonds. In some embodiments, the sense strand and / or antisense strand of an isolated oligonucleotide each comprises at least eleven modified phosphodiester bonds. In some embodiments, the sense strand and / or antisense strand of an isolated oligonucleotide each comprises at least twelve modified phosphodiester bonds. In some embodiments, the sense strand and / or antisense strand of an isolated oligonucleotide each comprises at least thirteen modified phosphodiester bonds. In some embodiments, the sense strand and / or antisense strand of an isolated oligonucleotide each comprises at least fourteen modified phosphodiester bonds. In some embodiments, the sense strand and / or antisense strand of an isolated oligonucleotide each comprises at least fifteen modified phosphodiester bonds. In some embodiments, the sense strand and / or antisense strand of an isolated oligonucleotide each comprises at least sixteen modified phosphodiester bonds. In some embodiments, the sense strand and / or antisense strand of the oligonucleotide of separation each comprises at least seventeen modified phosphodiester bonds. In some embodiments, the sense strand and / or antisense strand of the oligonucleotide of separation each comprises at least eighteen modified phosphodiester bonds. In some embodiments, the sense strand and / or antisense strand of the oligonucleotide of separation each comprises at least nineteen modified phosphodiester bonds. In some embodiments, the sense strand and / or antisense strand of the oligonucleotide of separation each comprises at least twenty modified phosphodiester bonds.

[0417] In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least one phosphorothioate internucleotide linkage. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least two phosphorothioate internucleotide linkages. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least three phosphorothioate internucleotide linkages. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least four phosphorothioate internucleotide linkages. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least five phosphorothioate internucleotide linkages. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least six phosphorothioate internucleotide linkages. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least seven phosphorothioate internucleotide linkages. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least eight phosphorothioate internucleotide linkages. In some embodiments, the sense strand and / or antisense strand of the oligonucleotide of separation each comprises at least nine phosphorothioate internucleotide linkages. In some embodiments, the sense strand and / or antisense strand of the oligonucleotide of separation each comprises at least ten phosphorothioate internucleotide linkages. In some embodiments, the sense strand and / or antisense strand of the oligonucleotide of separation each comprises at least eleven phosphorothioate internucleotide linkages. In some embodiments, the sense strand and / or antisense strand of the oligonucleotide of separation each comprises at least twelve phosphorothioate internucleotide linkages. In some embodiments, the sense strand and / or antisense strand of the oligonucleotide of separation each comprises at least thirteen phosphorothioate internucleotide linkages. In some embodiments, the sense strand and / or antisense strand of the oligonucleotide of separation each comprises at least fourteen phosphorothioate internucleotide linkages. In some embodiments, the sense strand and / or antisense strand of the oligonucleotide of separation each comprises at least fifteen phosphorothioate internucleotide linkages. In some embodiments, the sense strand and / or antisense strand of the oligonucleotide of separation each comprise at least sixteen phosphorothioate nucleotides and are connected. In some embodiments, the sense strand and / or antisense strand of the oligonucleotide of separation each comprise at least seventeen phosphorothioate nucleotides and are connected. In some embodiments, the sense strand and / or antisense strand of the oligonucleotide of separation each comprise at least eighteen phosphorothioate nucleotides and are connected. In some embodiments, the sense strand and / or antisense strand of the oligonucleotide of separation each comprise at least nineteen phosphorothioate nucleotides and are connected. In some embodiments, the sense strand and / or antisense strand of the oligonucleotide of separation each comprise at least twenty phosphorothioate nucleotides and are connected.

[0418] In some embodiments, the modified phosphodiester bonds are continuously located on the sense strand or the antisense strand or both. In some embodiments, some but not all of the modified phosphodiester bonds are continuously located on the sense strand or the antisense strand or both. In some embodiments, the modified phosphodiester bonds are discontinuously located on the sense strand or the antisense strand or both.

[0419] It is envisioned within the present disclosure that the oligonucleotides are isolated in which any phosphodiester bond on the sense strand or the antisense strand can be modified. In some embodiments, any phosphodiester bond on the antisense strand can be modified. In some embodiments, any phosphodiester bond on the antisense strand can be modified.

[0420] In some embodiments of the isolated oligonucleotides of the present disclosure, the antisense strand comprises between one and twenty, between one and fifteen, between one and ten, between one and five, or less than five modified phosphodiester bonds. In some embodiments, between one and twenty, between one and fifteen, between one and ten, between one and five, or less than five modified phosphodiester bonds comprise phosphorothioate internucleotide linkages. In some embodiments, the antisense strand comprises less than five modified phosphodiester bonds. In some embodiments, the antisense strand comprises one, two, three, or four modified phosphodiester bonds. In some embodiments, wherein the antisense strand comprises one, two, three, or four modified phosphodiester bonds, the one, two, three, or four modified phosphodiester bonds comprise phosphorothioate internucleotide linkages. In some embodiments, the antisense strand comprises four modified phosphodiester bonds. In some embodiments, wherein the antisense strand comprises four modified phosphodiester bonds, the modified phosphodiester bonds comprise phosphorothioate.

[0421] In some embodiments, wherein the antisense strand comprises at least one, at least two, at least three, or at least four phosphorothioate internucleotide linkages, the phosphorothioate internucleotide linkages extend to the nucleotides at positions 1 and 2 from the first nucleotide at the 5' terminus of the antisense strand. In some embodiments, wherein the antisense strand comprises at least one, at least two, at least three, or at least four phosphorothioate internucleotide linkages, the phosphorothioate internucleotide linkages extend to the nucleotides at positions 2 and 3 from the first nucleotide at the 5' terminus of the antisense strand. In some embodiments, wherein the antisense strand comprises at least one, at least two, at least three, or at least four phosphorothioate internucleotide linkages, the phosphorothioate internucleotide linkages extend to the nucleotides at positions 20 and 21 from the first nucleotide at the 5' terminus of the antisense strand. In some embodiments, wherein the antisense strand comprises at least one, at least two, at least three, or at least four phosphorothioate internucleotide linkages, the phosphorothioate internucleotide linkages extend to the nucleotides at positions 21 and 22 from the first nucleotide at the 5' terminus of the antisense strand. In some embodiments, wherein the antisense strand comprises at least one, at least two, at least three, or at least four modified phosphodiester bonds, wherein the modified phosphodiester bonds comprise phosphorothioate internucleotide linkages, the phosphorothioate internucleotide linkages are located between the nucleotides at positions 1 and 2, positions 2 and 3, positions 20 and 21, and positions 21 and 22 from the first nucleotide at the 5' end of the antisense strand.

[0422] In some embodiments of the isolated oligonucleotides of the present disclosure, wherein the antisense strand comprises at least one, at least two, at least three, or at least four phosphorothioate internucleotide linkages, the phosphorothioate internucleotide linkages are located between the nucleotides at positions 1 to 3 and the nucleotides at positions 20 to 22 from the first nucleotide at the 5' end of the antisense strand.

[0423] In some embodiments of the isolated oligonucleotide of the present disclosure, wherein the antisense strand comprises at least four phosphorothioate internucleotide linkages, the phosphorothioate internucleotide linkages are located between the nucleotides at positions 1 to 3 and the nucleotides at positions 20 to 22 from the first nucleotide at the 5' end of the antisense strand.

[0424] In some embodiments of the isolated oligonucleotides of the present disclosure, the antisense strand comprises four phosphorothioate internucleotide linkages. In some embodiments, wherein the antisense strand comprises four phosphorothioate internucleotide linkages, the phosphorothioate internucleotide linkages are located between the nucleotides at positions 1 to 3 and the nucleotides at positions 20 to 22 from the first nucleotide at the 5' end of the antisense strand.

[0425] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises between one and twenty, between one and fifteen, between one and ten, between one and five, or less than five modified phosphodiester bonds. In some embodiments, between one and twenty, between one and fifteen, between one and ten, between one and five, or less than five modified phosphodiester bonds comprise phosphorothioate internucleotide linkages. In some embodiments, the sense strand comprises less than five modified phosphodiester bonds. In some embodiments, wherein the sense strand comprises less than five modified phosphodiester bonds, the sense strand comprises one, two, three, or four modified phosphodiester bonds. In some embodiments, wherein the sense strand comprises one, two, three, or four modified phosphodiester bonds, the one, two, three, or four modified phosphodiester bonds comprise phosphorothioate internucleotide linkages. In some embodiments, the sense strand comprises four modified phosphodiester bonds. In some embodiments, wherein the sense strand comprises four modified phosphodiester bonds, the modified phosphodiester bonds comprise phosphorothioate internucleotide linkages.

[0426] In some embodiments, wherein the sense strand comprises at least one, at least two, at least three, or at least four modified phosphodiester bonds, the phosphodiester bonds comprise phosphorothioate internucleotide linkages. In some embodiments, wherein the sense strand comprises at least one, at least two, at least three, or at least four phosphorothioate internucleotide linkages, the phosphorothioate internucleotide linkages extend from the first nucleotide at the 5' terminus of the sense strand to the nucleotides at positions 1 and 2. In some embodiments, wherein the sense strand comprises at least one, at least two, at least three, or at least four phosphorothioate internucleotide linkages, the phosphorothioate internucleotide linkages extend from the first nucleotide at the 5' terminus of the sense strand to the nucleotides at positions 2 and 3. In some embodiments, wherein the sense strand comprises at least one, at least two, at least three, or at least four phosphorothioate internucleotide linkages, the phosphorothioate internucleotide linkages extend from the first nucleotide at the 5' terminus of the sense strand to the nucleotides at positions 18 and 19. In some embodiments, wherein the sense strand comprises at least one, at least two, at least three, or at least four phosphorothioate internucleotide linkages, the phosphorothioate internucleotide linkages being between the nucleotides at positions 19 and 20 from the first nucleotide at the 5' terminus of the sense strand. In some embodiments, wherein the sense strand comprises at least one, at least two, at least three, or at least four modified phosphodiester bonds, wherein the modified phosphodiester bonds comprise phosphorothioate internucleotide linkages, the phosphorothioate internucleotide linkages being between the nucleotides at positions 1 and 2, positions 2 and 3, positions 18 and 19, and positions 19 and 20 from the first nucleotide at the 5' terminus of the sense strand.

[0427] In some embodiments of the isolated oligonucleotides of the present disclosure, wherein the sense strand comprises at least one, at least two, at least three, or at least four phosphorothioate internucleotide linkages, the phosphorothioate internucleotide linkages are located between the nucleotides at positions 1 to 3 and the nucleotides at positions 18 to 20 from the first nucleotide at the 5' end of the sense strand.

[0428] In some embodiments of the isolated oligonucleotide of the present disclosure, wherein the sense strand comprises at least four phosphorothioate internucleotide linkages, the at least four phosphorothioate internucleotide linkages are located between the nucleotides at positions 1 to 3 and the nucleotides at positions 18 to 20 from the first nucleotide at the 5' end of the sense strand.

[0429] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises four phosphorothioate internucleotide linkages. In some embodiments, wherein the sense strand comprises four phosphorothioate internucleotide linkages, the phosphorothioate internucleotide linkages are located between the nucleotides at positions 1 to 3 and the nucleotides at positions 18 to 20 from the first nucleotide at the 5' end of the sense strand.

[0430] In some embodiments of the isolated oligonucleotides of the present disclosure, wherein the antisense strand and the sense strand comprise four phosphorothioate internucleotide linkages, the antisense strand comprises phosphorothioate internucleotide linkages between nucleotides at positions 1 to 3 and nucleotides at positions 20 to 22 from the first nucleotide at the 5' terminus of the antisense strand, and the sense strand comprises phosphorothioate internucleotide linkages between nucleotides at positions 1 to 3 and nucleotides at positions 18 to 20 from the first nucleotide at the 5' terminus of the sense strand.

[0431] In some embodiments of the isolated oligonucleotide of the present disclosure, the antisense strand comprises any one of the following: i) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 370 (5' [MeEPmUs][fGs][fU][mC][fA][mU][fA][mA][fA][mU][mU][mC][fA][mG][fG][mA][mA][mU][mUs][mCs][mC] 3'); ii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 371 (5' [MeEPmUs][fUs][fA][mA][fA][mA][fU][mU][mC][fA][mG][mG][mA][fA][mU][fU][mC][mC][mU][mGs][mCs][mU] 3'); iii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 372 (5' [MeEPmUs][fGs][fG][mA][fA][mA][fG][mA][mG][fA][mU][mC][mU][fC][mA][fU][mC][mA][mC][mUs][mCs][mA] 3'); iv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 373 (5' [MeEPmUs][fAs][fA][mU][fU][mC][fA][mG][mG][fA][mA][mU][mU][fC][mC][fU][mG][mC][mU][mUs][mCs][mU] 3'); v) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 374 (5' [MeEPmUs][fAs][fA][mC][fA][mC][fA][mU][mG][fU][mU][mG][mC][fU][mC][fA][mU][mU][mG][mUs][mCs][mU] 3'); vi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 375 (5' [MeEPmUs][fGs][fU][mG][fU][mA][fA][mC][mC][fG][mU][mC][mA][fU][mA][fG][mC][mA][mG][mUs][mGs][mG] 3'); vii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 376 (5' [MeEPmUs][fAs][fU][mA][fG][mC][fA][mG][mU][fG][mG][mA][mA][fA][mG][fA][mG][mA][mU][mCs][mUs][mC] 3'); viii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 377 (5' [mUs][fGs][fU][mC][fA][mU][fA][mA][fA][mU][mU][mC][fA][mG][fG][mA][mA][mU][mUs][mCs][mC] 3'); ix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 378 (5' [MeEPmUs][fUs][fA][mA][fA][mA][fU][mU][mC][fA][mG][mG][mA][fA][mU][fU][mC][mC][mU][mGs][mCs][mU] 3'); or x) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 379 (5' [mUs][fGs][fG][mA][fA][mA][fG][mA][mG][fA][mU][mC][mU][fC][mA][fU][mC][mA][mC][mUs][mCs][mA] 3'), wherein "m" is a 2'-O-methyl modified nucleotide, "f" is a 2'-F modified nucleotide, "s" is a phosphorothioate internucleotide linkage, and "MeEP" is a monomethyl-protected phosphate mimetic.

[0432] In some embodiments of the isolated oligonucleotide of the present disclosure, wherein the sense strand comprises any of: i) the sense strand of the nucleic acid sequence according to SEQ ID NO: 381 (5' [mAs][mAs][mU][mU][mC][fC][mU][fG][fA][fA][fU][mU][mU][mA][mU][mG][mAs][mCs][mA][G1b][G1b][G1b] 3'); ii) the sense strand of the nucleic acid sequence according to SEQ ID NO: 382 (5' [mCs][mAs][mG][mG][mA][fA][mU][fU][fC][fC][fU][mG][mA][mA][mU][mU][mU][mUs][mAs][mA][G1b][G1b][G1b] 3'); iii) the sense strand of the nucleic acid sequence according to SEQ ID NO: 383 (5' [mAs][mGs][mU][mG][mA][fU][mG][fA][fG][fA][fU][mC][mU][mC][mU][mU][mU][mCs][mCs][mA][G1b][G1b][G1b] 3'); iv) the sense strand of the nucleic acid sequence according to SEQ ID NO: 384 (5' [mAs][mAs][mG][mC][mA][fG][mG][fA][fA][fU][fU][mC][mC][mU][mG][mA][mA][mUs][mUs][mA][G1b][G1b][G1b] 3'); v) the sense strand of the nucleic acid sequence according to SEQ ID NO: 385 (5' [mAs][mCs][mA][mA][mU][fG][mA][fG][fC][fA][fA][mC][mA][mU][mG][mU][mG][mUs][mUs][mA][G1b][G1b][G1b] 3'); vi) the sense strand of the nucleic acid sequence according to SEQ ID NO: 386 (5' [mAs][mCs][mU][mG][mC][fU][mA][fU][fG][fA][fC][mG][mG][mU][mU][mA][mC][mAs][mCs][mA][G1b][G1b][G1b] 3'); or vii) the sense strand of the nucleic acid sequence according to SEQ ID NO: 387 (5' [mGs][mAs][mU][mC][mU][fC][mU][fU][fU][fC][fC][mA][mC][mU][mG][mC][mU][mAs][mUs][mA][G1b][G1b][G1b] 3'), wherein "m" is a 2'-O-methyl modified nucleotide, "f" is a 2'-F modified nucleotide, "s" is a phosphorothioate internucleotide linkage, and "G1b" is a GalNac G1b portion.

[0433] In some embodiments of the isolated oligonucleotide of the present disclosure, the oligonucleotide is selected from: i) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 370 (5' [MeEPmUs][fGs][fU][mC][fA][mU][fA][mA][mA][fA][mU][mU][mC][fA][mG][fG][mA][mA][mU][mUs][mCs][mC] 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 381 (5' [mAs][mAs][mU][mU][mC][fC][mU][fG][fA][fA][fU][mU][mU][mU][mA][mU][mG][mAs][mCs][mA][G1b][G1b][G1b] 3'); ii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 371 (5' [MeEPmUs][fUs][fA][mA][fA][mA][fU][mU][mC][fA][mG][mG][mA][fA][mU][fU][mC][mC][mU][mGs][mCs][mU] 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 382 (5' [mCs][mAs][mG][mG][mA][fA][mU][fU][fC][fC][fU][mG][mA][mA][mU][mU][mU][mUs][mAs][mA][G1b][G1b][G1b] 3'); iii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 372 (5' [MeEPmUs][fGs][fG][mA][fA][mA][fG][mA][mG][fA][mU][mC][mU][fC][mA][fU][mC][mA][mC][mUs][mCs][mA] 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 383 (5' [mAs][mGs][mU][mG][mA][fU][mG][fA][fG][fA][fU][mC][mU][mC][mU][mU][mCs][mA][G1b][G1b][G1b] 3'); iv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 373 (5' [MeEPmUs][fAs][fA][mU][fU][mC][fA][mG][mG][fA][mA][mU][mU][fC][mC][fU][mG][mC][mU][mUs][mCs][mU] 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 384 (5' [mAs][mAs][mG][mC][mA][fG][mG][fA][fA][fU][fU][mC][mC][mU][mG][mA][mA][mUs][mUs][mA][G1b][G1b][G1b] 3'); v) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 374 (5' [MeEPmUs][fAs][fA][mC][fA][mC][fA][mU][mG][fU][mU][mG][mC][fU][mC][fA][mU][mU][mG][mUs][mCs][mU] 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 385 (5' [mAs][mCs][mA][mA][mU][fG][mA][fG][fC][fA][fA][mC][mA][mU][mG][mU][mG][mUs][mUs][mA][G1b][G1b][G1b] 3'); vi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 375 (5' [MeEPmUs][fGs][fU][mG][fU][mA][fA][mC][mC][fG][mU][mC][mA][fU][mA][fG][mC][mA][mG][mUs][mGs][mG] 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 386 (5' [mAs][mCs][mU][mG][mC][fU][mA][fU][fG][fA][fC][mG][mG][mU][mU][mA][mC][mAs][mCs][mA][G1b][G1b][G1b] 3'); vii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 376 (5' [MeEPmUs][fAs][fU][mA][fG][mC][fA][mG][mU][fG][mG][mA][mA][fA][mG][fA][mG][mA][mU][mCs][mUs][mC] 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 387 (5' [mGs][mAs][mU][mC][mU][fC][mU][fU][fU][fC][fC][mA][mC][mU][mG][mC][mU][mAs][mUs][mA][G1b][G1b][G1b] 3'); viii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 377 (5' [mUs][fGs][fU][mC][fA][mU][fA][mA][mA][fA][mU][mU][mC][fA][mG][fG][mA][mA][mU][mUs][mCs][mC] 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 381 (5' [mAs][mAs][mU][mU][mC][fC][mU][fG][fA][fA][fU][mU][mU][mU][mA][mU][mG][mAs][mCs][mA][G1b][G1b][G1b] 3'); ix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 378 (5' [mUs][fUs][fA][mA][fA][mA][fU][mU][mC][fA][mG][mG][mA][fA][mU][fU][mC][mC][mU][mGs][mCs][mU] 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 382 (5' [mCs][mAs][mG][mG][mA][fA][mU][fU][fC][fC][fU][mG][mA][mA][mU][mU][mU][mUs][mAs][mA][G1b][G1b][G1b] 3'); or x) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 379 (5' [mUs][fGs][fG][mA][fA][mA][fG][mA][mG][fA][mU][mC][mU][fC][mA][fU][mC][mA][mC][mUs][mCs][mA] 3'), and the antisense strand of the nucleic acid sequence according to SEQ ID NO: 383 (5' [mAs][mGs][mU][mG][mA][fU][mG][fA][fG][fA][fU][mC][mU][mC][mU][mU][mCs][mA][G1b][G1b][G1b] 3'), wherein "m" is a 2'-O-methyl modified nucleotide, "f" is a 2'-F modified nucleotide, "s" is a phosphorothioate internucleotide linkage, "MeEP" is a monomethyl protected phosphate mimetic, and "G1b" is a GalNAc G1b moiety.

[0434] Nucleic acids and vectors The present disclosure also provides vectors encoding at least one isolated oligonucleotide disclosed herein. In some embodiments, the vector is any one of a plasmid, a cosmid, or a viral vector. In some embodiments, the vector is an adenoviral vector. In some embodiments, the vector is a lentiviral vector. In some embodiments, the plasmid is an expression plasmid. In some embodiments, the vector encodes one isolated oligonucleotide disclosed herein. In some embodiments, the vector encodes more than one isolated oligonucleotide disclosed herein. In some embodiments, the vector encodes two, three, four, or five isolated oligonucleotides disclosed herein. In some embodiments, the vector encodes more than five isolated oligonucleotides disclosed herein.

[0435] The present disclosure provides nucleic acids comprising a sequence encoding an isolated oligonucleotide (eg, dsRNA or siRNA) targeting CFB described herein.

[0436] In some embodiments, the nucleic acid is ribonucleic acid (RNA). In some embodiments, the nucleic acid is deoxyribonucleic acid (DNA). The DNA can be a vector or plasmid, for example, an expression vector.

[0437] " vector " is any nucleic acid molecule for nucleic acid cloning and / or transfer into a cell. A vector can be a replicon, and another nucleotide sequence can be attached thereto to allow the replication of the attached nucleotide sequence." replicon " can be the effect of the autonomous unit that replicates in vivo in nucleic acid, that is, any genetic element (for example, plasmid, phage, clay, chromosome, viral genome) that can be replicated under its own control. The term " vector " includes nucleic acid molecules for both viruses and non-viral (for example, plasmid) that are used to introduce nucleic acid into the cell in vitro, in vitro and / or in vivo. A large amount of vectors known in the art can be used for manipulating nucleic acid, mixing response element and promoter into gene etc. For example, the nucleic acid fragment corresponding to response element and promoter can be inserted into a suitable vector and can be completed by connecting appropriate nucleic acid fragment to the selected vector with complementary sticky ends. Alternatively, the end of nucleic acid molecule can be enzymatically modified, or any site can be produced by connecting nucleotide sequence (joint) to nucleic acid end. Such a vector can be engineered to contain the sequence of encoding selective markers, and the selective marker provides the selection of the cell containing vector and / or the nucleic acid of vector mixed into the cell genome. Such markers allow for the identification and / or selection of host cells that incorporate and express the protein encoded by the marker.A "recombinant" vector refers to a viral or non-viral vector comprising one or more heterologous nucleotide sequences (i.e., a transgene), e.g., two, three, four, five or more heterologous nucleotide sequences.

[0438] The term "expression" or "expression" of a polynucleotide coding sequence means that the sequence is transcribed and, optionally, translated. Generally, according to the present disclosure, expression of a coding sequence of the present disclosure will result in the production of a polypeptide of the present disclosure. The complete expressed polypeptide or fragment can also function in intact cells without purification.

[0439] In some embodiments, the vector is an expression vector for producing the siRNA of the present disclosure. An exemplary expression vector may comprise a sequence encoding the sense and / or antisense strand of an isolated oligonucleotide of the present disclosure under the control of a suitable promoter for transcription. Interfering RNA can be expressed from a variety of eukaryotic promoters known to those of ordinary skill in the art, including pol III promoters, such as U6 or H1 promoters, or pol II promoters, such as cytomegalovirus promoters. Those skilled in the art will recognize that these promoters may also be suitable for allowing inducible expression of interfering RNA.

[0440] The isolated oligonucleotides (e.g., dsRNA and siRNA) of the present disclosure can be endogenously expressed from plasmid or viral expression vectors, or from a minimal expression cassette (e.g., a PCR-generated fragment comprising one or more promoters and an appropriate template or templates for transcribing the siRNA). Examples of commercially available plasmid-based expression vectors for shRNA include members of the pSilencer series (Ambion), and pCpG-siRNA (InvivoGen). Examples of kits for the production of PCR-generated shRNA expression cassettes include Silencer Express (Ambion) and siXpress (Mirus).

[0441] Viral vectors for the in vivo expression of isolated oligonucleotides (e.g., siRNA and dsRNA) in eukaryotic cells are also considered within the scope of the present disclosure. Viral vectors can be derived from a variety of viruses, including adenovirus, adeno-associated virus, slow virus (e.g., HIV, FIV and EIAV) and herpes virus. Examples of commercially available viral vectors for shRNA expression include pSilencer adeno (Ambion) and pLenti6 / BLOCK-iT™-DEST (Invitrogen). The selection of viral vectors, the method for expressing siRNA from vectors and the method for delivering viral vectors (e.g., incorporating into nanoparticles) are within the ordinary skill of those skilled in the art.

[0442] It will be apparent to those skilled in the art that any suitable carrier optionally incorporated into nanoparticles can be used for delivering the isolated oligonucleotides (e.g., dsRNA or siRNA) of the disclosure described herein to cells or subjects. The carrier can be delivered to cells in vivo. In other embodiments, the carrier can be delivered to cells in vitro, and then the cells containing the carrier are delivered to subjects. The selection of delivery vectors can be made based on many factors known in the art, including the age and species of the target host, in vitro and in vivo delivery, the level of desired expression and persistence, intended purpose (e.g., for treatment or screening), target cells or organs, delivery routes, the size of isolated polynucleotides, safety issues, etc.

[0443] Delivery system The present disclosure also provides a delivery system comprising at least one isolated oligonucleotide disclosed herein or a vector of the present disclosure encoding at least one isolated oligonucleotide disclosed herein. In some embodiments, the delivery system is any of a liposome, a nanoparticle, a polymer-based delivery system, or a ligand-conjugate delivery system. In some embodiments, the ligand-conjugate delivery system comprises one or more of an antibody, a peptide, a sugar moiety, or a combination thereof.

[0444] In some embodiments, the delivery system of the present disclosure comprises nanoparticles comprising isolated oligonucleotides (e.g., siRNA or dsRNA) of the present disclosure that target CFB mRNA for degradation. In some embodiments, the nanoparticles comprise polymer-based nanoparticles, lipid-polymer-based nanoparticles, metal-based nanoparticles, carbon nanotube-based nanoparticles, nanocrystals, or polymer micelles. In some embodiments, the polymer-based nanoparticles comprise multi-block copolymers, di-block copolymers, polymer micelles, or hyperbranched macromolecules. In some embodiments, the polymer-based nanoparticles comprise multi-block copolymers or di-block copolymers. In some embodiments, the polymer-based nanoparticles are pH responsive. In some embodiments, the polymer-based nanoparticles further comprise a buffer component.

[0445] In some embodiments, the delivery system comprises a liposome. A liposome is a spherical vesicle having at least one lipid bilayer and, in some embodiments, an aqueous core. In some embodiments, the lipid bilayer of the liposome may comprise a phospholipid. An illustrative but non-limiting example of a phospholipid is phosphatidylcholine, but the lipid bilayer may comprise another lipid, such as phosphatidylethanolamine. The liposome may be multilamellar, i.e., composed of several lamellar lipid bilayers, or unilamellar liposomes having a single lipid bilayer. Liposomes can be prepared within a specific size range that makes them viable targets for phagocytosis. The size range of the liposome may be from 20 nm to 100 nm, 100 nm to 400 nm, 1 μm and larger, or 200 nm to 3 μm. Examples of lipidoids and lipid-based formulations are provided in U.S. published application 20090023673. In other embodiments, the one or more lipids are one or more cationic lipids. One skilled in the art will recognize which liposomes are suitable for siRNA encapsulation.

[0446] In some embodiments, the liposomes or nanoparticles of the present disclosure comprise micelles. Micelles are aggregates of surfactant molecules. Exemplary micelles comprise aggregates of amphiphilic macromolecules, polymers, or copolymers in aqueous solution, wherein the hydrophilic head portion is exposed to the surrounding solvent, while the hydrophobic tail region is isolated in the center of the micelle.

[0447] In some embodiments, the nanoparticles comprise nanocrystals. Exemplary nanocrystals are crystalline particles having at least one dimension less than 1000 nanometers, preferably less than 100 nanometers.

[0448] In some embodiments, nanoparticles include nanoparticles based on polymers. In some embodiments, polymers include multi-block copolymers, diblock copolymers, polymer micelles or hyperbranched macromolecules. In some embodiments, particles include one or more cationic polymers. In some embodiments, cationic polymers are chitosan, protamine, polylysine, polyhistidine, polyarginine or poly (ethylene) imine. In other embodiments, one or more polymers contain buffer components, degradable components, hydrophilic components, cleavable key components or a certain combination thereof.

[0449] In some embodiments, the nanoparticle or a portion thereof is degradable. In other embodiments, the lipid and / or polymer of the nanoparticle is degradable.

[0450] In some embodiments, any of these delivery systems of the present disclosure may include a buffer component. In other embodiments, any of the present disclosure may include a buffer component and a degradable component. In still other embodiments, any of the present disclosure may include a buffer component and a hydrophilic component. In yet other embodiments, any of the present disclosure may include a buffer component and a cleavable bond component. In yet other embodiments, any of the present disclosure may include a buffer component, a degradable component and a hydrophilic component. In still other embodiments, any of the present disclosure may include a buffer component, a degradable component and a hydrophilic component. In yet other embodiments, any of the present disclosure may include a buffer component, a degradable component and a cleavable bond component. In additional embodiments, any of the present disclosure may include a buffer component, a hydrophilic component and a cleavable bond component. In yet another embodiment, any of the present disclosure may include a buffer component, a degradable component, a hydrophilic component and a cleavable bond component. In some embodiments, the particle is composed of one or more polymers containing a combination of any of the aforementioned components.

[0451] In some embodiments of the isolated oligonucleotides of the present disclosure, the delivery system comprises a ligand-conjugate delivery system. In some embodiments, the ligand-conjugate delivery system comprises one or more of an antibody, a peptide, a sugar moiety, a lipid, or a combination thereof.

[0452] In further embodiments, the isolated oligonucleotides of the present disclosure (e.g., siRNA or dsRNA) targeting CFB mRNA are conjugated to, complexed with, or encapsulated by one or more lipids or polymers of a delivery system. In further embodiments, the isolated oligonucleotides of the present disclosure (e.g., siRNA or dsRNA) targeting CFB mRNA can be encapsulated in the hollow core of a nanoparticle. Alternatively or additionally, the isolated oligonucleotides of the present disclosure (e.g., siRNA or dsRNA) targeting CFB mRNA can be incorporated into, for example, a lipid- or polymer-based shell of a delivery system via embedding. Alternatively or additionally, the isolated oligonucleotides of the present disclosure (e.g., siRNA or dsRNA) targeting CFB mRNA can be attached to the surface of a delivery system. In some embodiments, the isolated oligonucleotides of the present disclosure (e.g., siRNA or dsRNA) targeting CFB mRNA are conjugated to, for example, via covalent attachment, one or more lipids or polymers of a delivery system.

[0453] In some embodiments, the ligand conjugate delivery system further comprises a targeting agent. In some embodiments, the targeting agent comprises a peptide ligand, a nucleotide ligand, a polysaccharide ligand, a fatty acid ligand, a lipid ligand, a small molecule ligand, an antibody, an antibody fragment, an antibody mimetic, or an antibody mimetic fragment.

[0454] In some embodiments, the oligonucleotide of separation disclosed herein can also include the oligonucleotide delivery or the part that takes in specific tissue or cell (such as hepatocyte) that promotes separation.In certain embodiments, ligand targe...

Claims

1. An isolated oligonucleotide comprising a sense strand and an antisense strand, wherein: The sense strand comprises a nucleotide sequence substantially identical to a region of 19-25 nucleotides comprised between any one of the following nucleotide positions from the 5' end of the human CFB mRNA sequence according to SEQ ID NO: 1: a) 493 to 534; b) 991 to 1054; c) 1384 to 1500; d) 1606 to 1686; e) 1821 to 1881; f) 2116 to 2307; and g) 2382 to 2468, And the antisense strand is substantially complementary to the sense strand, such that the sense strand and the antisense strand together form a double-stranded region.

2. The isolated oligonucleotide of claim 1 , wherein the sense strand comprises a nucleotide sequence that is at least 70%, at least 80%, at least 90%, at least 95%, or at least 99% identical to a region of 19-25 nucleotides comprised between any one of the following nucleotide positions from the 5' end of the human CFB mRNA sequence according to SEQ ID NO: 1: a) 493 to 534; b) 991 to 1054; c) 1384 to 1500; d) 1606 to 1686; e) 1821 to 1881; f) 2116 to 2307; and g) 2382 to 2468.

3. The isolated oligonucleotide according to claim 1, wherein the sense strand comprises a nucleotide sequence identical to a region of 19-25 nucleotides comprised between any one of the following nucleotide positions from the 5' end of the human CFB mRNA sequence according to SEQ ID NO: 1: a) 493 to 534; b) 991 to 1054; c) 1384 to 1500; d) 1606 to 1686; e) 1821 to 1881; f) 2116 to 2307; and g) 2382 to 2468.

4. The isolated oligonucleotide according to any one of claims 1 to 3, wherein the sense strand comprises a nucleotide sequence substantially identical to a region between any one of the following nucleotide positions from the 5' end of the human CFB mRNA sequence according to SEQ ID NO: 1: a) 503 to 523; and b) 2190 to 2210.

5. The isolated oligonucleotide of claim 4, wherein the sense strand comprises a nucleotide sequence that is at least 70%, at least 80%, at least 90%, at least 95%, or at least 99% identical to a region selected from any one of the following nucleotide positions from the 5' end of the human CFB mRNA sequence according to SEQ ID NO: 1: a) 503 to 523; and b) 2190 to 2210.

6. The isolated oligonucleotide according to claim 4, wherein the sense strand comprises a nucleotide sequence identical to a region between any one of the following nucleotide positions from the 5' end of the human CFB mRNA sequence according to SEQ ID NO: 1: a) 503 to 523; and b) 2190 to 2210.

7. The isolated oligonucleotide according to any one of claims 1 to 3, wherein the sense strand comprises a nucleotide sequence substantially identical to a region between any one of the following nucleotide positions from the 5' end of the human CFB mRNA sequence according to SEQ ID NO: 1: a) 493 to 534; b) 991 to 1054; c) 1384 to 1500; d) 1666 to 1686; e) 1821 to 1881; f) 2116 to 2136; g) 2232 to 2307; and h) 2394 to 2468.

8. The isolated oligonucleotide of claim 7, wherein the sense strand comprises a nucleotide sequence that is at least 70%, at least 80%, at least 90%, at least 95%, or at least 99% identical to a region selected from any one of the following nucleotide positions from the 5' end of the human CFB mRNA sequence according to SEQ ID NO: 1: a) 493 to 534; b) 991 to 1054; c) 1384 to 1500; d) 1666 to 1686; e) 1821 to 1881; f) 2116 to 2136; g) 2232 to 2307; and h) 2394 to 2468.

9. The isolated oligonucleotide according to claim 7, wherein the sense strand comprises a nucleotide sequence identical to a region between any one of the following nucleotide positions from the 5' end of the human CFB mRNA sequence according to SEQ ID NO: 1: a) 493 to 534; b) 991 to 1054; c) 1384 to 1500; d) 1666 to 1686; e) 1821 to 1881; f) 2116 to 2136; g) 2232 to 2307; and h) 2394 to 2468.

10. The isolated oligonucleotide according to any one of claims 1 to 3, wherein the sense strand comprises a nucleotide sequence substantially identical to a region between any one of the following nucleotide positions from the 5' end of the human CFB mRNA sequence according to SEQ ID NO: 1: a) 995 to 1019; b) 1606 to 1626; c) 1860 to 1880; and d) 2382 to 2402.

11. The isolated oligonucleotide of claim 10, wherein the sense strand comprises a nucleotide sequence that is at least 70%, at least 80%, at least 90%, at least 95%, or at least 99% identical to a region selected from any one of the following nucleotide positions from the 5' end of the human CFB mRNA sequence according to SEQ ID NO: 1: a) 995 to 1019; b) 1606 to 1626; c) 1860 to 1880; and d) 2382 to 2402.

12. The isolated oligonucleotide according to claim 10, wherein the sense strand comprises a nucleotide sequence identical to a region between any one of the following nucleotide positions from the 5' end of the human CFB mRNA sequence according to SEQ ID NO: 1: a) 995 to 1019; b) 1606 to 1626; c) 1860 to 1880; and d) 2382 to 2402.

13. The isolated oligonucleotide of any one of claims 1-12, wherein the isolated oligonucleotide is capable of inducing degradation of the CFB mRNA.

14. The isolated oligonucleotide of any one of claims 1-13, wherein the sense strand or antisense strand is a single-stranded RNA molecule.

15. The isolated oligonucleotide of any one of claims 1-13, wherein both the sense strand and the antisense strand are single-stranded RNA molecules.

16. The isolated oligonucleotide of any one of claims 1-15, wherein the antisense strand comprises a 3' overhang.

17. The isolated oligonucleotide of claim 16, wherein the 3' overhang comprises at least one nucleotide.

18. The isolated oligonucleotide of any one of claims 1-17, wherein the sense strand comprises an RNA sequence of at least 20 nucleotides in length.

19. The isolated oligonucleotide of any one of claims 1-18, wherein the antisense strand comprises an RNA sequence of at least 22 nucleotides in length.

20. The isolated oligonucleotide of any one of claims 1-19, wherein the double-stranded region is between 19 and 21 nucleotides in length.

21. The isolated oligonucleotide of any one of claims 1-20, wherein the antisense strand comprises a nucleotide sequence according to any one of SEQ ID NOs: 2-35.

22. The isolated oligonucleotide of any one of claims 1-21, wherein the sense strand comprises a nucleotide sequence according to any one of SEQ ID NOs: 36-69.

23. The isolated oligonucleotide of claim 6, wherein the double-stranded region comprises: i) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 5 (5' UAUAGCAGUGGAAAGAGAUCUC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 39 (5' GAUCUCUUUCCACUGCUAUA 3'); or ii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 28 (5' UAAGUAUUGGGGUCAGCAUAGG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 62 (5' UAUGCUGACCCCAAUACUUA 3').

24. The isolated oligonucleotide of claim 9, wherein the double-stranded region comprises: i) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 2 (5' UAAAGAGAUCUCAUCACUCACA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 36 (5' UGAGUGAUGAGAUCUCUUUA 3'); ii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 3 (5' UGGAAAGAGAUCUCAUCACUCA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 37 (5' AGUGAUGAGAUCUCUUUCCA 3'); iii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 4 (5' UCAGUGGAAAGAGAUCUCAUCA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 38 (5' AUGAGAUCUCUUUCCACUGA 3'); iv) an antisense strand of the nucleic acid sequence according to SEQ ID NO: 6 (5' UGUGUAACCGUCAUAGCAGUGG 3'), and a sense strand of the nucleic acid sequence according to SEQ ID NO: 389 (5' ACUGCUAUGACGGUUACACA 3'); v) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 7 (5' UUUGACUAGACACUUUUUGGCU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 41 (5' CCAAAAAGUGUCUAGUCAAA 3'); vi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 9 (5' UAAUUAAGUUGACUAGACACUU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 43 (5' GUGUCUAGUCAACUUAAUUA 3'); vii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 11 (5' UAUAUCUUGGCUUCACACCAUA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 45 (5' UGGUGUGAAGCCAAGAUAUA 3'); viii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 12 (5' UUAGACAUCCAGAUAAUCCUCC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 46 (5' AGGAUUAUCUGGAUGUCUAA 3'); ix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 13 (5' UAAGCAUUGAUGUUCACUUGGU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 47 (5' CAAGUGAACAUCAAUGCUUA 3'); x) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 14 (5' UAAAGCAUUGAUGUUCACUUGG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 48 (5' AAGUGAACAUCAAUGCUUUA 3'); xi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 15 (5' UAACACAUGUUGCUCAUUGUCU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 49 (5' ACAAUGAGCAACAUGUGUUA 3'); xii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 16 (5' UUUGACUUUGAACACAUGUUGC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 50 (5' AACAUGUGUUCAAAGUCAAA 3'); xiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 17 (5' UAUAUCCUUGACUUUGAACACA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 51 (5' UGUUCAAAGUCAAGGAUAUA 3'); xiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 19 (5' UAAGUACUCAGACACCACAGCC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 53 (5' CUGUGGUGUCUGAGUACUUA 3'); xv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 20 (5' UAUUCAGGAAUUCCUGCUUCUU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 54 (5' GAAGCAGGAAUUCCUGAAUA 3'); xvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 21 (5' UAAUUCAGGAAUUCCUGCUUCU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 55 (5' AAGCAGGAAUUCCUGAAUUA 3'); xvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 22 (5' UUAAAAUUCAGGAAUUCCUGCU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 56 (5' CAGGAAUUCCUGAAUUUUAA 3'); xviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 23 (5' UAUAAAAUUCAGGAAUUCCUGC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 57 (5' AGGAAUUCCUGAAUUUUAUA 3'); xix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 24 (5' UGUCAUAAAAUUCAGGAAUUCC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 58 (5' AAUUCCUGAAUUUUAUGACA 3'); xx) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 26 (5' UUUAUUCUUGAGCUUGAUCAGG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 60 (5' UGAUCAAGCUCAAGAAUAAA 3'); xxi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 27 (5' UUUGACUUUGUCAUAGCCUGGG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 61 (5' CAGGCUAUGACAAAGUCAAA 3'); xxii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 29 (5' UUUCUCUUGUGAACUAUCAAGG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 63 (5' UUGAUAGUUCACAAGAGAAA 3'); xxiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 30 (5' UAAACGACUUCUCUUGUGAACU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 64 (5' UUCACAAGAGAAGUCGUUUA 3'); xxiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 31 (5' UUUUUUGCAGACAUCCACUACU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 65 (5' UAGUGGAUGUCUGCAAAAAA 3'); xxv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 33 (5' UAACCCAAAUCCUCAUCUUGGA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 67 (5' CAAGAUGAGGAUUUGGGUUA 3'); xxvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 34 (5' UAAACCCAAAUCCUCAUCUUGG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 68 (5' AAGAUGAGGAUUUGGGUUUA 3'); or xxvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 35 (5' UCAGCUGUUUUAAUUCAAUCCC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 69 (5' GAUUGAAUUAAAACAGCUGA 3').

25. The isolated oligonucleotide of claim 12, wherein the double-stranded region comprises: i) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 8 (5' UUAAGUUGACUAGACACUUUUU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 42 (5' AAAGUGUCUAGUCAACUUAA 3'); ii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 10 (5' UCAAUUAAGUUGACUAGACACU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 44 (5' UGUCUAGUCAACUUAAUUGA 3'); iii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 18 (5' UGAGAUCUUGGCCUGCCAUGGU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 52 (5' CAUGGCAGGCCAAGAUCUCA 3'); iv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 25 (5' UUAUUCUUGAGCUUGAUCAGGG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 59 (5' CUGAUCAAGCUCAAGAAUAA 3'); or v) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 32 (5' UCAUCUUGGAGUUUCUCCUUCA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 66 (5' AAGGAGAAACUCCAAGAUGA 3').

26. The isolated oligonucleotide of any one of claims 1-25, wherein the isolated oligonucleotide attenuates expression of the CFB mRNA by at least 50% at a dose of 0.1 nM.

27. The isolated oligonucleotide of claim 26, wherein the double-stranded region comprises: i) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 2 (5' UAAAGAGAUCUCAUCACUCACA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 36 (5' UGAGUGAUGAGAUCUCUUUA 3'); ii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 3 (5' UGGAAAGAGAUCUCAUCACUCA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 37 (5' AGUGAUGAGAUCUCUUUCCA 3'); iii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 4 (5' UCAGUGGAAAGAGAUCUCAUCA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 38 (5' AUGAGAUCUCUUUCCACUGA 3'); iv) an antisense strand of the nucleic acid sequence according to SEQ ID NO: 6 (5' UGUGUAACCGUCAUAGCAGUGG 3'), and a sense strand of the nucleic acid sequence according to SEQ ID NO: 389 (5' ACUGCUAUGACGGUUACACA 3'); v) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 7 (5' UUUGACUAGACACUUUUUGGCU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 41 (5' CCAAAAAGUGUCUAGUCAAA 3'); vi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 9 (5' UAAUUAAGUUGACUAGACACUU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 43 (5' GUGUCUAGUCAACUUAAUUA 3'); vii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 11 (5' UAUAUCUUGGCUUCACACCAUA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 45 (5' UGGUGUGAAGCCAAGAUAUA 3'); viii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 12 (5' UUAGACAUCCAGAUAAUCCUCC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 46 (5' AGGAUUAUCUGGAUGUCUAA 3'); ix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 13 (5' UAAGCAUUGAUGUUCACUUGGU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 47 (5' CAAGUGAACAUCAAUGCUUA 3'); x) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 14 (5' UAAAGCAUUGAUGUUCACUUGG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 48 (5' AAGUGAACAUCAAUGCUUUA 3'); xi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 15 (5' UAACACAUGUUGCUCAUUGUCU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 49 (5' ACAAUGAGCAACAUGUGUUA 3'); xii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 16 (5' UUUGACUUUGAACACAUGUUGC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 50 (5' AACAUGUGUUCAAAGUCAAA 3'); xiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 17 (5' UAUAUCCUUGACUUUGAACACA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 51 (5' UGUUCAAAGUCAAGGAUAUA 3'); xiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 19 (5' UAAGUACUCAGACACCACAGCC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 53 (5' CUGUGGUGUCUGAGUACUUA 3'); xv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 20 (5' UAUUCAGGAAUUCCUGCUUCUU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 54 (5' GAAGCAGGAAUUCCUGAAUA 3'); xvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 21 (5' UAAUUCAGGAAUUCCUGCUUCU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 55 (5' AAGCAGGAAUUCCUGAAUUA 3'); xvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 22 (5' UUAAAAUUCAGGAAUUCCUGCU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 56 (5' CAGGAAUUCCUGAAUUUUAA 3'); xviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 23 (5' UAUAAAAUUCAGGAAUUCCUGC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 57 (5' AGGAAUUCCUGAAUUUUAUA 3'); xix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 24 (5' UGUCAUAAAAUUCAGGAAUUCC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 58 (5' AAUUCCUGAAUUUUAUGACA 3'); xx) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 26 (5' UUUAUUCUUGAGCUUGAUCAGG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 60 (5' UGAUCAAGCUCAAGAAUAAA 3'); xxi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 27 (5' UUUGACUUUGUCAUAGCCUGGG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 61 (5' CAGGCUAUGACAAAGUCAAA 3'); xxii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 29 (5' UUUCUCUUGUGAACUAUCAAGG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 63 (5' UUGAUAGUUCACAAGAGAAA 3'); xxiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 30 (5' UAAACGACUUCUCUUGUGAACU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 64 (5' UUCACAAGAGAAGUCGUUUA 3'); xxiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 31 (5' UUUUUUGCAGACAUCCACUACU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 65 (5' UAGUGGAUGUCUGCAAAAAA 3'); xxv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 33 (5' UAACCCAAAUCCUCAUCUUGGA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 67 (5' CAAGAUGAGGAUUUGGGUUA 3'); xxvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 34 (5' UAAACCCAAAUCCUCAUCUUGG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 68 (5' AAGAUGAGGAUUUGGGUUUA 3'); xxvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 35 (5' UCAGCUGUUUUAAUUCAAUCCC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 69 (5' GAUUGAAUUAAAACAGCUGA 3'); xxviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 8 (5' UUAAGUUGACUAGACACUUUUU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 42 (5' AAAGUGUCUAGUCAACUUAA 3'); xxix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 10 (5' UCAAUUAAGUUGACUAGACACU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 44 (5' UGUCUAGUCAACUUAAUUGA 3'); xxx) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 18 (5' UGAGAUCUUGGCCUGCCAUGGU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 52 (5' CAUGGCAGGCCAAGAUCUCA 3'); xxxi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 25 (5' UUAUUCUUGAGCUUGAUCAGGG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 59 (5' CUGAUCAAGCUCAAGAAUAA 3'); xxxii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 32 (5' UCAUCUUGGAGUUUCUCCUUCA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 66 (5' AAGGAGAAACUCCAAGAUGA 3'); xxxiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 5 (5' UAUAGCAGUGGAAAGAGAUCUC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 39 (5' GAUCUCUUUCCACUGCUAUA 3'); or xxxiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 28 (5' UAAGUAUUGGGGUCAGCAUAGG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 62 (5' UAUGCUGACCCCAAUACUUA 3').

28. The isolated oligonucleotide of any one of claims 1-25, wherein the isolated oligonucleotide attenuates expression of the CFB mRNA by at least 50% at a dose of 0.02 nM.

29. The isolated oligonucleotide of claim 28, wherein the double-stranded region comprises: i) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 2 (5' UAAAGAGAUCUCAUCACUCACA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 36 (5' UGAGUGAUGAGAUCUCUUUA 3'); ii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 3 (5' UGGAAAGAGAUCUCAUCACUCA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 37 (5' AGUGAUGAGAUCUCUUUCCA 3'); iii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 4 (5' UCAGUGGAAAGAGAUCUCAUCA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 38 (5' AUGAGAUCUCUUUCCACUGA 3'); iv) an antisense strand of the nucleic acid sequence according to SEQ ID NO: 6 (5' UGUGUAACCGUCAUAGCAGUGG 3'), and a sense strand of the nucleic acid sequence according to SEQ ID NO: 389 (5' ACUGCUAUGACGGUUACACA 3'); v) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 9 (5' UAAUUAAGUUGACUAGACACUU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 43 (5' GUGUCUAGUCAACUUAAUUA 3'); vi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 12 (5' UUAGACAUCCAGAUAAUCCUCC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 46 (5' AGGAUUAUCUGGAUGUCUAA 3'); vii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 13 (5' UAAGCAUUGAUGUUCACUUGGU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 47 (5' CAAGUGAACAUCAAUGCUUA 3'); viii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 14 (5' UAAAGCAUUGAUGUUCACUUGG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 48 (5' AAGUGAACAUCAAUGCUUUA 3'); ix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 22 (5' UUAAAAUUCAGGAAUUCCUGCU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 56 (5' CAGGAAUUCCUGAAUUUUAA 3'); x) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 23 (5' UAUAAAAUUCAGGAAUUCCUGC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 57 (5' AGGAAUUCCUGAAUUUUAUA 3'); xi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 24 (5' UGUCAUAAAAUUCAGGAAUUCC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 58 (5' AAUUCCUGAAUUUUAUGACA 3'); xii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 30 (5' UAAACGACUUCUCUUGUGAACU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 64 (5' UUCACAAGAGAAGUCGUUUA 3'); xiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 34 (5' UAAACCCAAAUCCUCAUCUUGG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 68 (5' AAGAUGAGGAUUUGGGUUUA 3'); xiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 35 (5' UCAGCUGUUUUAAUUCAAUCCC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 69 (5' GAUUGAAUUAAAACAGCUGA 3'); xv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 5 (5' UAUAGCAGUGGAAAGAGAUCUC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 39 (5' GAUCUCUUUCCACUGCUAUA 3'); or xvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 28 (5' UAAGUAUUGGGGUCAGCAUAGG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 62 (5' UAUGCUGACCCCAAUACUUA 3').

30. The isolated oligonucleotide of claim 25, wherein the isolated oligonucleotide attenuates the expression of CFB mRNA by 20% to 50% at a dose of 0.02 nM.

31. The isolated oligonucleotide of claim 30, wherein the double-stranded region comprises: i) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 8 (5' UUAAGUUGACUAGACACUUUUU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 42 (5' AAAGUGUCUAGUCAACUUAA 3'); ii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 10 (5' UCAAUUAAGUUGACUAGACACU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 44 (5' UGUCUAGUCAACUUAAUUGA 3'); iii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 18 (5' UGAGAUCUUGGCCUGCCAUGGU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 52 (5' CAUGGCAGGCCAAGAUCUCA 3'); iv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 25 (5' UUAUUCUUGAGCUUGAUCAGGG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 59 (5' CUGAUCAAGCUCAAGAAUAA 3'); v) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 32 (5' UCAUCUUGGAGUUUCUCCUUCA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 66 (5' AAGGAGAAACUCCAAGAUGA 3'); vi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 31 (5' UUUUUUGCAGACAUCCACUACU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 65 (5' UAGUGGAUGUCUGCAAAAAA 3'); vii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 33 (5' UAACCCAAAUCCUCAUCUUGGA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 67 (5' CAAGAUGAGGAUUUGGGUUA 3'); viii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 26 (5' UUUAUUCUUGAGCUUGAUCAGG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 60 (5' UGAUCAAGCUCAAGAAUAAA 3'); ix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 27 (5' UUUGACUUUGUCAUAGCCUGGG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 61 (5' CAGGCUAUGACAAAGUCAAA 3'); x) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 29 (5' UUUCUCUUGUGAACUAUCAAGG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 63 (5' UUGAUAGUUCACAAGAGAAA 3'); xi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 15 (5' UAACACAUGUUGCUCAUUGUCU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 49 (5' ACAAUGAGCAACAUGUGUUA 3'); xii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 16 (5' UUUGACUUUGAACACAUGUUGC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 50 (5' AACAUGUGUUCAAAGUCAAA 3'); xiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 17 (5' UAUAUCCUUGACUUUGAACACA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 51 (5' UGUUCAAAGUCAAGGAUAUA 3'); xiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 19 (5' UAAGUACUCAGACACCACAGCC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 53 (5' CUGUGGUGUCUGAGUACUUA 3'); xv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 20 (5' UAUUCAGGAAUUCCUGCUUCUU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 54 (5' GAAGCAGGAAUUCCUGAAUA 3'); xvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 21 (5' UAAUUCAGGAAUUCCUGCUUCU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 55 (5' AAGCAGGAAUUCCUGAAUUA 3'); xvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 7 (5' UUUGACUAGACACUUUUUGGCU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 41 (5' CCAAAAAGUGUCUAGUCAAA 3'); or xviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 11 (5' UAUAUCUUGGCUUCACACCAUA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 45 (5' UGGUGUGAAGCCAAGAUAUA 3').

32. An isolated oligonucleotide comprising a sense strand and an antisense strand, wherein: The sense strand comprises a nucleotide sequence substantially identical to a region of 19-25 nucleotides comprised between any one of the following nucleotide positions from the 5' end of the CFB mRNA sequence according to SEQ ID NO: 1: a) 5 to 38; b) 340 to 606; c) 776 to 828; d) 939 to 1227; e) 1305 to 1606; f) 1667 to 1746; g) 18:15 to 23:13; and h) 2378 to 2417, And the antisense strand is substantially complementary to the sense strand, such that the sense strand and the antisense strand together form a double-stranded region.

33. The isolated oligonucleotide of claim 32, wherein the isolated oligonucleotide attenuates the expression of CFB mRNA by 20% to 50% at a dose of 0.1 nM.

34. The isolated oligonucleotide of claim 33, wherein the double-stranded region comprises: i) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 94 (5' UGACACUUUUUGGCUCCUGUGA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 204 (5' ACAGGAGCCAAAAAGUGUCA 3'); ii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 124 (5' UAUGUUGCUCAUUGUCUUUCUU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 234 (5' GAAAGACAAUGAGCAACAUA 3'); iii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 169 (5' UCUCUUGUGAACUAUCAAGGGG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 279 (5' CCUUGAUAGUUCACAAGAGA 3'); iv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 87 (5' UGUACAUGAAGGAGUCUUGGCA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 197 (5' CCAAGACUCCUUCAUGUACA 3'); v) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 163 (5' UGUCAGCAUAGGGACUCACUCC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 273 (5' AGUGAGUCCCUAUGCUGACA 3'); vi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 104 (5' UCUUCAACUUGUGGUCUUCAUA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 214 (5' UGAAGACCACAAGUUGAAGA 3'); vii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 121 (5' UCUCAUUGUCUUUCUUGGAAGC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 231 (5' UUCCAAGAAAGACAAUGAGA 3'); viii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 99 (5' UUUCUCAAUUAAGUUGACUAGA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 209 (5' UAGUCAACUUAAUUGAGAAA 3'); ix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 155 (5' UCUCUCUCACAGCUGCCUUUCU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 265 (5' AAAGGCAGCUGUGAGAGAGA 3'); x) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 144 (5' UCUUAUUCUUGAGCUUGAUCAG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 254 (5' GAUCAAGCUCAAGAAUAAGA 3'); xi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 136 (5' UCUGACCUUGAUUGAGUGUUCC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 246 (5' AACACUCAAUCAAGGUCAGA 3'); xii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 76 (5' UGGAUUGCUCUGCACUCUGCCU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 186 (5' GCAGAGUGCAGAGCAAUCCA 3'); xiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 134 (5' UAACAAUGUGCUGCUGUCAGCA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 244 (5' CUGACAGCAGCACAUUGUUA 3'); xiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 158 (5' UAUUGAGCAUCUCUCUCACAGC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 268 (5' UGUGAGAGAGAUGCUCAAUA 3'); xv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 153 (5' UCAUUCUUGAUGUAGACCUCCU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 263 (5' GAGGUCUACAUCAAGAAUGA 3'); xvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 73 (5' UGAAACUCCAGACCUAGACCUG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 183 (5' GGUCUAGGUCUGGAGUUUCA 3'); xvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 152 (5' UCUUGAUGUAGACCUCCUUCCG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 262 (5' GAAGGAGGUCUACAUCAAGA 3'); xviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 147 (5' UCAGAGCUUUGAUAUCCUGUGC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 257 (5' ACAGGAUAUCAAAGCUCUGA 3'); xix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 101 (5' UCAUAACUUGCCACCUUCUCAA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 211 (5' GAGAAGGUGGCAAGUUAUGA 3'); xx) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 174 (5' UUUCUGGUUUUUGCAGACAUCC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 284 (5' AUGUCUGCAAAAACCAGAAA 3'); xxi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 118 (5' UUUUCUUGGAAGCCAAAGCAUU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 228 (5' UGCUUUGGCUUCCAAGAAAA 3'); xxii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 149 (5' UAAACAGAGCUUUGAUAUCCUG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 259 (5' GGAUAUCAAAGCUCUGUUUA 3'); xxiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 95 (5' UGACUAGACACUUUUUGGCUCC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 205 (5' AGCCAAAAAGUGUCUAGUCA 3'); xxiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 142 (5' UUUCUUGAGCUUGAUCAGGGCA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 252 (5' CCCUGAUCAAGCUCAAGAAA 3'); xxv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 160 (5' UCAUAUUGAGCAUCUCUCUCAC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 270 (5' GAGAGAGAUGCUCAAUAUGA 3'); xxvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 164 (5' UGUAUUGGGGUCAGCAUAGGGA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 274 (5' CCUAUGCUGACCCCAAUACA 3'); xxvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 74 (5' UUGAAACUCCAGACCUAGACCU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 184 (5' GUCUAGGUCUGGAGUUUCAA 3'); xxviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 91 (5' UAUCCAUCUAGCACCAGGUAGA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 201 (5' UACCUGGUGCUAGAUGGAUA 3'); xxix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 167 (5' UGUGAACUAUCAAGGGGCCGCC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 277 (5' CGGCCCCUUGAUAGUUCACA 3'); xxx) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 175 (5' UUUGGAGUUUCUCCUUCAGCCA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 285 (5' GCUGAAGGAGAAACUCCAAA 3'); xxxi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 72 (5' UAAACUCCAGACCUAGACCUGG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 182 (5' AGGUCUAGGUCUGGAGUUUA 3'); xxxii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 119 (5' UCUUUCUUGGAAGCCAAAGCAU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 229 (5' GCUUUGGCUUCCAAGAAAGA 3'); xxxiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 154 (5' UCUUUCUUAUCCCCAUUCUUGA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 264 (5' AAGAAUGGGGAUAAGAAAGA 3'); xxxiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 70 (5' UCUAGACCUGGUCACAUUCCCU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 180 (5' GGAAUGUGACCAGGUCUAGA 3'); xxxv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 92 (5' UCUGUCUGAUCCAUCUAGCACC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 202 (5' UGCUAGAUGGAUCAGACAGA 3'); xxxvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 116 (5' UCAAAGCAUUGAUGUUCACUUG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 226 (5' AGUGAACAUCAAUGCUUUGA 3'); xxxvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 84 (5' UGAGAGUGUAACCGUCAUAGCA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 194 (5' CUAUGACGGUUACACUCUCA 3'); xxxviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 89 (5' UGUCGUACAUGAAGGAGUCUUG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 199 (5' AGACUCCUUCAUGUACGACA 3'); xxxix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 83 (5' UGAGUGUAACCGUCAUAGCAGU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 193 (5' UGCUAUGACGGUUACACUCA 3'); xL) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 107 (5' UUAAUUGGGUCCCCGCCCAUGU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 217 (5' AUGGGCGGGGACCCAAUUAA 3'); xLi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 100 (5' UAUAACUUGCCACCUUCUCAAU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 210 (5' UGAGAAGGUGGCAAGUUAUA 3'); xLii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 157 (5' UUUGAGCAUCUCUCUCACAGCU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 267 (5' CUGUGAGAGAGAUGCUCAAA 3'); xLiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 77 (5' UCUCACAUUGUAGUAGGGAGAC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 187 (5' CUCCCUACUACAAUGUGAGA 3'); xLiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 105 (5' UGACUUCAACUUGUGGUCUUCA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 215 (5' AAGACCACAAGUUGAAGUCA 3'); xLv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 130 (5' UCAGGUUUUCCAUAUCCUUGAC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 240 (5' CAAGGAUAUGGAAAACCUGA 3'); xLvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 166 (5' UAACUAUCAAGGGGCCGCCAGA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 276 (5' UGGCGGCCCCUUGAUAGUUA 3'); xLvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 131 (5' UCACAGAGACUCAGAGACUGGC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 241 (5' CAGUCUCUGAGUCUCUGUGA 3'); xLviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 127 (5' UCUUUGAACACAUGUUGCUCAU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 237 (5' GAGCAACAUGUGUUCAAAGA 3'); xLix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 111 (5' UAUCAAUGACAGUAAUUGGGUC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 221 (5' CCCAAUUACUGUCAUUGAUA 3'); L) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 93 (5' UCUUUUUGGCUCCUGUGAAGUU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 203 (5' CUUCACAGGAGCCAAAAAGA 3'); or Li) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 71 (5' UAACUCCAGACCUAGACCUGGU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 181 (5' CAGGUCUAGGUCUGGAGUUA 3').

35. The isolated oligonucleotide of claim 32, wherein the isolated oligonucleotide attenuates expression of CFB mRNA by at least 50% at a dose of 0.1 nM.

36. The isolated oligonucleotide of claim 35, wherein the double-stranded region comprises: i) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 171 (5' UAUGAAACGACUUCUCUUGUGA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 281 (5' ACAAGAGAAGUCGUUUCAUA 3'); ii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 165 (5' UAUCACCUCUGCAAGUAUUGGG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 275 (5' CAAUACUUGCAGAGGUGAUA 3'); iii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 129 (5' UUUUCCAUAUCCUUGACUUUGA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 239 (5' AAAGUCAAGGAUAUGGAAAA 3'); iv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 176 (5' UAUCUUGGAGUUUCUCCUUCAG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 286 (5' GAAGGAGAAACUCCAAGAUA 3'); v) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 177 (5' UCUCAUCUUGGAGUUUCUCCUU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 287 (5' GGAGAAACUCCAAGAUGAGA 3'); vi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 138 (5' UCAUAAAAUUCAGGAAUUCCUG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 248 (5' GGAAUUCCUGAAUUUUAUGA 3'); vii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 140 (5' UGUCAUAGUCAUAAAAUUCAGG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 250 (5' UGAAUUUUAUGACUAUGACA 3'); viii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 148 (5' UAACAGAGCUUUGAUAUCCUGU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 258 (5' AGGAUAUCAAAGCUCUGUUA 3'); ix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 150 (5' UCAAACAGAGCUUUGAUAUCCU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 260 (5' GAUAUCAAAGCUCUGUUUGA 3'); x) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 179 (5' UGAAAACCCAAAUCCUCAUCUU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 289 (5' GAUGAGGAUUUGGGUUUUCA 3'); xi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 90 (5' UAAAGCUUCGGCCACCUCUUGA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 200 (5' AAGAGGUGGCCGAAGCUUUA 3'); xii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 172 (5' UUUUUGCAGACAUCCACUACUC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 282 (5' GUAGUGGAUGUCUGCAAAAA 3'); xiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 88 (5' UCGUACAUGAAGGAGUCUUGGC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 198 (5' CAAGACUCCUUCAUGUACGA 3'); xiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 168 (5' UUUGUGAACUAUCAAGGGGCCG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 278 (5' GCCCCUUGAUAGUUCACAAA 3'); xv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 81 (5' UGUGGAAAGAGAUCUCAUCACU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 191 (5' UGAUGAGAUCUCUUUCCACA 3'); xvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 159 (5' UAUAUUGAGCAUCUCUCUCACA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 269 (5' UGAGAGAGAUGCUCAAUAUA 3'); xvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 82 (5' UCAUAGCAGUGGAAAGAGAUCU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 192 (5' AUCUCUUUCCACUGCUAUGA 3'); xviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 97 (5' UUUAAGUUGACUAGACACUUUU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 207 (5' AAGUGUCUAGUCAACUUAAA 3'); xix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 132 (5' UUUGCUUGUGGUAAUCGGUACC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 242 (5' UACCGAUUACCACAAGCAAA 3'); xx) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 123 (5' UGUUGCUCAUUGUCUUUCUUGG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 233 (5' AAGAAAGACAAUGAGCAACA 3'); xxi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 126 (5' UUUUGAACACAUGUUGCUCAUU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 236 (5' UGAGCAACAUGUGUUCAAAA 3'); xxii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 162 (5' UGAGAUGUCCUUGACUUUGUCA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 272 (5' ACAAAGUCAAGGACAUCUCA 3'); xxiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 79 (5' UCAUCACUCACAUUGUAGUAGG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 189 (5' UACUACAAUGUGAGUGAUGA 3'); xxiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 151 (5' UCAGACACAAACAGAGCUUUGA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 261 (5' AAAGCUCUGUUUGUGUCUGA 3'); xxv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 143 (5' UAUUCUUGAGCUUGAUCAGGGC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 253 (5' CCUGAUCAAGCUCAAGAAUA 3'); xxvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 117 (5' UAAGCCAAAGCAUUGAUGUUCA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 227 (5' AACAUCAAUGCUUUGGCUUA 3'); xxvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 133 (5' UAAAGUACUCAGACACCACAGC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 243 (5' UGUGGUGUCUGAGUACUUUA 3'); xxviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 122 (5' UUUGCUCAUUGUCUUUCUUGGA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 232 (5' CAAGAAAGACAAUGAGCAAA 3'); xxix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 110 (5' UCAAUGACAGUAAUUGGGUCCC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 220 (5' GACCCAAUUACUGUCAUUGA 3'); xxx) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 173 (5' UGUUUUUGCAGACAUCCACUAC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 283 (5' AGUGGAUGUCUGCAAAAACA 3'); xxxi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 156 (5' UGAGCAUCUCUCUCACAGCUGC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 266 (5' AGCUGUGAGAGAGAUGCUCA 3'); xxxii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 141 (5' UCUUGAUCAGGGCAACGUCAUA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 251 (5' UGACGUUGCCCUGAUCAAGA 3'); xxxiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 135 (5' UCUUGAUUGAGUGUUCCUUGUC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 245 (5' CAAGGAACACUCAAUCAAGA 3'); xxxiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 170 (5' UGACUUCUCUUGUGAACUAUCA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 280 (5' AUAGUUCACAAGAGAAGUCA 3'); xxxv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 178 (5' UAAUCCUCAUCUUGGAGUUUCU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 288 (5' AAACUCCAAGAUGAGGAUUA 3'); xxxvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 114 (5' UAUAGACAUCCAGAUAAUCCUC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 224 (5' GGAUUAUCUGGAUGUCUAUA 3'); xxxvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 139 (5' UCAUAGUCAUAAAAUUCAGGAA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 249 (5' CCUGAAUUUUAUGACUAUGA 3'); xxxviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 125 (5' UCAUGUUGCUCAUUGUCUUUCU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 235 (5' AAAGACAAUGAGCAACAUGA 3'); xxxix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 145 (5' UGAGACAAAUGGGCCUGAUAGU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 255 (5' UAUCAGGCCCAUUUGUCUCA 3'); xL) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 113 (5' UCUCAUCAAUGACAGUAAUUGG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 223 (5' AAUUACUGUCAUUGAUGAGA 3'); xLi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 120 (5' UGUCUUUCUUGGAAGCCAAAGC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 230 (5' UUUGGCUUCCAAGAAAGACA 3'); xLii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 75 (5' UGAUCUGCAGGUACGUGUCUGC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 185 (5' AGACACGUACCUGCAGAUCA 3'); xLiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 112 (5' UCAUCAAUGACAGUAAUUGGGU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 222 (5' CCAAUUACUGUCAUUGAUGA 3'); xLiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 108 (5' UAUGACAGUAAUUGGGUCCCCG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 218 (5' GGGACCCAAUUACUGUCAUA 3'); xLv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 128 (5' UGACUUUGAACACAUGUUGCUC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 238 (5' GCAACAUGUGUUCAAAGUCA 3'); xLvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 161 (5' UCUUGACUUUGUCAUAGCCUGG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 271 (5' AGGCUAUGACAAAGUCAAGA 3'); xLvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 85 (5' UUUGUCACAGAUCGCUGUCUGC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 195 (5' AGACAGCGAUCUGUGACAAA 3'); xLviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 137 (5' UGAAUUCCUGCUUCUUUUUUCC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 247 (5' AAAAAAGAAGCAGGAAUUCA 3'); xLix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 80 (5' UGAAAGAGAUCUCAUCACUCAC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 190 (5' GAGUGAUGAGAUCUCUUUCA 3'); L) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 115 (5' UCAUAGACAUCCAGAUAAUCCU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 225 (5' GAUUAUCUGGAUGUCUAUGA 3'); Li) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 96 (5' UGUUGACUAGACACUUUUUGGC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 206 (5' CAAAAAGUGUCUAGUCAACA 3'); Lii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 146 (5' UAAGUGGUAGUUGGAGGAAGCC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 256 (5' CUUCCUCCAACUACCACUUA 3'); Liii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 78 (5' UAUCACUCACAUUGUAGUAGGG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 188 (5' CUACUACAAUGUGAGUGAUA 3'); Liv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 103 (5' UUUCACACCAUAACUUGCCACC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 213 (5' UGGCAAGUUAUGGUGUGAAA 3'); Lv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 102 (5' UCACCAUAACUUGCCACCUUCU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 212 (5' AAGGUGGCAAGUUAUGGUGA 3'); Lvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 109 (5' UAAUGACAGUAAUUGGGUCCCC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 219 (5' GGACCCAAUUACUGUCAUUA 3'); Lvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 86 (5' UCAUGAAGGAGUCUUGGCAGGA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 196 (5' CUGCCAAGACUCCUUCAUGA 3'); Lviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 106 (5' UCUCAUCAUGCUGUACACUGCC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 216 (5' CAGUGUACAGCAUGAUGAGA 3'); or Lix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 98 (5' UCUCAAUUAAGUUGACUAGACA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 208 (5' UCUAGUCAACUUAAUUGAGA 3').

37. The isolated oligonucleotide of claim 32, wherein the isolated oligonucleotide attenuates the expression of CFB mRNA by 20% to 50% at a dose of 0.02 nM.

38. The isolated oligonucleotide of claim 37, wherein the double-stranded region comprises: i) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 165 (5' UAUCACCUCUGCAAGUAUUGGG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 275 (5' CAAUACUUGCAGAGGUGAUA 3'); ii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 129 (5' UUUUCCAUAUCCUUGACUUUGA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 239 (5' AAAGUCAAGGAUAUGGAAAA 3'); iii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 176 (5' UAUCUUGGAGUUUCUCCUUCAG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 286 (5' GAAGGAGAAACUCCAAGAUA 3'); iv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 177 (5' UCUCAUCUUGGAGUUUCUCCUU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 287 (5' GGAGAAACUCCAAGAUGAGA 3'); v) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 138 (5' UCAUAAAAUUCAGGAAUUCCUG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 248 (5' GGAAUUCCUGAAUUUUAUGA 3'); vi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 140 (5' UGUCAUAGUCAUAAAAUUCAGG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 250 (5' UGAAUUUUAUGACUAUGACA 3'); vii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 148 (5' UAACAGAGCUUUGAUAUCCUGU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 258 (5' AGGAUAUCAAAGCUCUGUUA 3'); viii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 150 (5' UCAAACAGAGCUUUGAUAUCCU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 260 (5' GAUAUCAAAGCUCUGUUUGA 3'); ix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 179 (5' UGAAAACCCAAAUCCUCAUCUU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 289 (5' GAUGAGGAUUUGGGUUUUCA 3'); x) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 90 (5' UAAAGCUUCGGCCACCUCUUGA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 200 (5' AAGAGGUGGCCGAAGCUUUA 3'); xi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 172 (5' UUUUUGCAGACAUCCACUACUC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 282 (5' GUAGUGGAUGUCUGCAAAAA 3'); xii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 88 (5' UCGUACAUGAAGGAGUCUUGGC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 198 (5' CAAGACUCCUUCAUGUACGA 3'); xiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 168 (5' UUUGUGAACUAUCAAGGGGCCG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 278 (5' GCCCCUUGAUAGUUCACAAA 3'); xiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 81 (5' UGUGGAAAGAGAUCUCAUCACU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 191 (5' UGAUGAGAUCUCUUUCCACA 3'); xv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 159 (5' UAUAUUGAGCAUCUCUCUCACA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 269 (5' UGAGAGAGAUGCUCAAUAUA 3'); xvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 82 (5' UCAUAGCAGUGGAAAGAGAUCU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 192 (5' AUCUCUUUCCACUGCUAUGA 3'); xvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 97 (5' UUUAAGUUGACUAGACACUUUU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 207 (5' AAGUGUCUAGUCAACUUAAA 3'); xviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 132 (5' UUUGCUUGUGGUAAUCGGUACC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 242 (5' UACCGAUUACCACAAGCAAA 3'); xix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 123 (5' UGUUGCUCAUUGUCUUUCUUGG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 233 (5' AAGAAAGACAAUGAGCAACA 3'); xx) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 79 (5' UCAUCACUCACAUUGUAGUAGG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 189 (5' UACUACAAUGUGAGUGAUGA 3'); xxi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 117 (5' UAAGCCAAAGCAUUGAUGUUCA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 227 (5' AACAUCAAUGCUUUGGCUUA 3'); xxii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 122 (5' UUUGCUCAUUGUCUUUCUUGGA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 232 (5' CAAGAAAGACAAUGAGCAAA 3'); xxiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 110 (5' UCAAUGACAGUAAUUGGGUCCC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 220 (5' GACCCAAUUACUGUCAUUGA 3'); xxxiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 135 (5' UCUUGAUUGAGUGUUCCUUGUC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 245 (5' CAAGGAACACUCAAUCAAGA 3'); xxv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 178 (5' UAAUCCUCAUCUUGGAGUUUCU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 288 (5' AAACUCCAAGAUGAGGAUUA 3'); xxvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 114 (5' UAUAGACAUCCAGAUAAUCCUC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 224 (5' GGAUUAUCUGGAUGUCUAUA 3'); xxvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 125 (5' UCAUGUUGCUCAUUGUCUUUCU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 235 (5' AAAGACAAUGAGCAACAUGA 3'); xxviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 113 (5' UCUCAUCAAUGACAGUAAUUGG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 223 (5' AAUUACUGUCAUUGAUGAGA 3'); xix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 120 (5' UGUCUUUCUUGGAAGCCAAAGC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 230 (5' UUUGGCUUCCAAGAAAGACA 3'); xxx) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 75 (5' UGAUCUGCAGGUACGUGUCUGC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 185 (5' AGACACGUACCUGCAGAUCA 3'); xxxi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 112 (5' UCAUCAAUGACAGUAAUUGGGU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 222 (5' CCAAUUACUGUCAUUGAUGA 3'); xxxii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 108 (5' UAUGACAGUAAUUGGGUCCCCG 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 218 (5' GGGACCCAAUUACUGUCAUA 3'); xxxiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 115 (5' UCAUAGACAUCCAGAUAAUCCU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 225 (5' GAUUAUCUGGAUGUCUAUGA 3'); xxxiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 102 (5' UCACCAUAACUUGCCACCUUCU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 212 (5' AAGGUGGCAAGUUAUGGUGA 3'); xxxv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 109 (5' UAAUGACAGUAAUUGGGUCCCC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 219 (5' GGACCCAAUUACUGUCAUUA 3'); xxxvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 106 (5' UCUCAUCAUGCUGUACACUGCC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 216 (5' CAGUGUACAGCAUGAUGAGA 3'); xxxvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 98 (5' UCUCAAUUAAGUUGACUAGACA 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 208 (5' UCUAGUCAACUUAAUUGAGA 3'); xxxviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 124 (5' UAUGUUGCUCAUUGUCUUUCUU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 234 (5' GAAAGACAAUGAGCAACAUA 3'); xxxix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 121 (5' UCUCAUUGUCUUUCUUGGAAGC 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 231 (5' UUCCAAGAAAGACAAUGAGA 3'); or xL) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 107 (5' UUAAUUGGGUCCCCGCCCAUGU 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 217 (5' AUGGGCGGGGACCCAAUUAA 3').

39. The isolated oligonucleotide of claim 32, wherein the isolated oligonucleotide attenuates expression of the CFB mRNA by at least 50% at a dose of 0.02 nM.

40. The isolated oligonucleotide of claim 39, wherein the double-stranded region comprises an antisense strand of the nucleic acid sequence according to SEQ ID NO: 171 (5' UAUGAAACGACUUCUCUUGUGA 3'), and a sense strand of the nucleic acid sequence according to SEQ ID NO: 281 (5' ACAAGAGAAGUCGUUUCAUA 3').

41. The isolated oligonucleotide of any one of claims 1-40, wherein the sense strand or the antisense strand or both comprise one or more modified nucleotides.

42. The isolated oligonucleotide of claim 41, wherein the antisense strand comprises a monomethyl-protected phosphate mimetic (5'-MeEP).

43. The isolated oligonucleotide of any one of claims 1-42, wherein in the sense strand or the antisense strand or both, a terminal nucleotide or an internal nucleotide is linked to a targeting ligand.

44. The isolated oligonucleotide of claim 43, wherein the targeting ligand comprises at least one GalNAcG1b moiety.

45. The isolated oligonucleotide of any one of claims 1-44, wherein the antisense strand comprises nucleotides modified with a 2'-F modification and nucleotides modified with a 2'-O-methyl modification according to the following formula: 3'(M)0(F)0(M)6(F)1(M)1(F)1(M)3(F)1(M)2(F)1(M)1(F)1(M)1(F)2(M)15'.

46. ​​The isolated oligonucleotide of any one of claims 1-45, wherein the sense strand comprises nucleotides modified with a 2'-F modification and nucleotides modified with a 2'-O-methyl modification according to the following formula: 5'(M)0(F)0(M)5(F)1(M)1(F)4(M)9 3'.

47. The isolated oligonucleotide of any one of claims 1-46, wherein the antisense strand comprises any of: i) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 370 (5' [MeEPmUs][fGs][fU][mC][fA][mU][fA][mA][mA][fA][mU][mU][mC][fA][mG][fG][mA][mA][mU][mUs][mCs][mC] 3'); ii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 371 (5' [MeEPmUs][fUs][fA][mA][fA][mA][fU][mU][mC][fA][mG][mG][mA][fA][mU][fU][mC][mC][mU][mGs][mCs][mU] 3'); iii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 372 (5' [MeEPmUs][fGs][fG][mA][fA][mA][fG][mA][mG][fA][mU][mC][mU][fC][mA][fU][mC][mA][mC][mUs][mCs][mA] 3'); iv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 373 (5' [MeEPmUs][fAs][fA][mU][fU][mC][fA][mG][mG][fA][mA][mU][mU][fC][mC][fU][mG][mC][mU][mUs][mCs][mU] 3'); v) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 374 (5' [MeEPmUs][fAs][fA][mC][fA][mC][fA][mU][mG][fU][mU][mG][mC][fU][mC][fA][mU][mU][mG][mUs][mCs][mU] 3'); vi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 375 (5' [MeEPmUs][fGs][fU][mG][fU][mA][fA][mC][mC][fG][mU][mC][mA][fU][mA][fG][mC][mA][mG][mUs][mGs][mG] 3'); vii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 376 (5' [MeEPmUs][fAs][fU][mA][fG][mC][fA][mG][mU][fG][mG][mA][mA][fA][mG][fA][mG][mA][mU][mCs][mUs][mC] 3'); viii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 377 (5' [mUs][fGs][fU][mC][fA][mU][fA][mA][fA][mU][mU][mC][fA][mG][fG][mA][mA][mU][mUs][mCs][mC] 3'); ix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 378 (5' [MeEPmUs][fUs][fA][mA][fA][mA][fU][mU][mC][fA][mG][mG][mA][fA][mU][fU][mC][mC][mU][mGs][mCs][mU] 3'); or x) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 379 (5' [mUs][fGs][fG][mA][fA][mA][fG][mA][mG][fA][mU][mC][mU][fC][mA][fU][mC][mA][mC][mUs][mCs][mA] 3'), where "m" is a 2'-O-methyl modified nucleotide, "f" is a 2'-F modified nucleotide, "s" is a phosphorothioate internucleotide linkage, and "MeEP" is a monomethyl protected phosphate mimetic.

48. The isolated oligonucleotide of any one of claims 1-47, wherein the sense strand comprises any of: i) the sense strand of the nucleic acid sequence according to SEQ ID NO: 381 (5' [mAs][mAs][mU][mU][mC][fC][mU][fG][fA][fA][fU][mU][mU][mA][mU][mG][mAs][mCs][mA][G1b][G1b][G1b] 3'); ii) the sense strand of the nucleic acid sequence according to SEQ ID NO: 382 (5' [mCs][mAs][mG][mG][mA][fA][mU][fU][fC][fC][fU][mG][mA][mA][mU][mU][mU][mUs][mAs][mA][G1b][G1b][G1b] 3'); iii) the sense strand of the nucleic acid sequence according to SEQ ID NO: 383 (5' [mAs][mGs][mU][mG][mA][fU][mG][fA][fG][fA][fU][mC][mU][mC][mU][mU][mU][mCs][mCs][mA][G1b][G1b][G1b] 3'); iv) the sense strand of the nucleic acid sequence according to SEQ ID NO: 384 (5' [mAs][mAs][mG][mC][mA][fG][mG][fA][fA][fU][fU][mC][mC][mU][mG][mA][mA][mUs][mUs][mA][G1b][G1b][G1b] 3'); v) the sense strand of the nucleic acid sequence according to SEQ ID NO: 385 (5' [mAs][mCs][mA][mA][mU][fG][mA][fG][fC][fA][fA][mC][mA][mU][mG][mU][mG][mUs][mUs][mA][G1b][G1b][G1b] 3'); vi) the sense strand of the nucleic acid sequence according to SEQ ID NO: 386 (5' [mAs][mCs][mU][mG][mC][fU][mA][fU][fG][fA][fC][mG][mG][mU][mU][mA][mC][mAs][mCs][mA][G1b][G1b][G1b] 3'); or vii) the sense strand of the nucleic acid sequence according to SEQ ID NO: 387 (5' [mGs][mAs][mU][mC][mU][fC][mU][fU][fU][fC][fC][mA][mC][mU][mG][mC][mU][mAs][mUs][mA][G1b][G1b][G1b] 3'), wherein "m" is a 2'-O-methyl modified nucleotide, "f" is a 2'-F modified nucleotide, "s" is a phosphorothioate internucleotide linkage, and "G1b" is the GalNac G1b moiety.

49. The isolated oligonucleotide of claim 47, wherein the double-stranded region comprises: i) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 370 (5' [MeEPmUs][fGs][fU][mC][fA][mU][fA][mA][mA][fA][mU][mU][mC][fA][mG][fG][mA][mA][mU][mUs][mCs][mC] 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 381 (5' [mAs][mAs][mU][mU][mC][fC][mU][fG][fA][fA][fU][mU][mU][mU][mA][mU][mG][mAs][mCs][mA][G1b][G1b][G1b] 3'); ii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 371 (5' [MeEPmUs][fUs][fA][mA][fA][mA][fU][mU][mC][fA][mG][mG][mA][fA][mU][fU][mC][mC][mU][mGs][mCs][mU] 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 382 (5' [mCs][mAs][mG][mG][mA][fA][mU][fU][fC][fC][fU][mG][mA][mA][mU][mU][mU][mUs][mAs][mA][G1b][G1b][G1b] 3'); iii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 372 (5' [MeEPmUs][fGs][fG][mA][fA][mA][fG][mA][mG][fA][mU][mC][mU][fC][mA][fU][mC][mA][mC][mUs][mCs][mA] 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 383 (5' [mAs][mGs][mU][mG][mA][fU][mG][fA][fG][fA][fU][mC][mU][mC][mU][mU][mCs][mA][G1b][G1b][G1b] 3'); iv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 373 (5' [MeEPmUs][fAs][fA][mU][fU][mC][fA][mG][mG][fA][mA][mU][mU][fC][mC][fU][mG][mC][mU][mUs][mCs][mU] 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 384 (5' [mAs][mAs][mG][mC][mA][fG][mG][fA][fA][fU][fU][mC][mC][mU][mG][mA][mA][mUs][mUs][mA][G1b][G1b][G1b] 3'); v) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 374 (5' [MeEPmUs][fAs][fA][mC][fA][mC][fA][mU][mG][fU][mU][mG][mC][fU][mC][fA][mU][mU][mG][mUs][mCs][mU] 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 385 (5' [mAs][mCs][mA][mA][mU][fG][mA][fG][fC][fA][fA][mC][mA][mU][mG][mU][mG][mUs][mUs][mA][G1b][G1b][G1b] 3'); vi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 375 (5' [MeEPmUs][fGs][fU][mG][fU][mA][fA][mC][mC][fG][mU][mC][mA][fU][mA][fG][mC][mA][mG][mUs][mGs][mG] 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 386 (5' [mAs][mCs][mU][mG][mC][fU][mA][fU][fG][fA][fC][mG][mG][mU][mU][mA][mC][mAs][mCs][mA][G1b][G1b][G1b] 3'); vii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 376 (5' [MeEPmUs][fAs][fU][mA][fG][mC][fA][mG][mU][fG][mG][mA][mA][fA][mG][fA][mG][mA][mU][mCs][mUs][mC] 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 387 (5' [mGs][mAs][mU][mC][mU][fC][mU][fU][fU][fC][fC][mA][mC][mU][mG][mC][mU][mAs][mUs][mA][G1b][G1b][G1b] 3'); viii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 377 (5' [mUs][fGs][fU][mC][fA][mU][fA][mA][mA][fA][mU][mU][mC][fA][mG][fG][mA][mA][mU][mUs][mCs][mC] 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 381 (5' [mAs][mAs][mU][mU][mC][fC][mU][fG][fA][fA][fU][mU][mU][mU][mA][mU][mG][mAs][mCs][mA][G1b][G1b][G1b] 3'); ix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 378 (5' [mUs][fUs][fA][mA][fA][mA][fU][mU][mC][fA][mG][mG][mA][fA][mU][fU][mC][mC][mU][mGs][mCs][mU] 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 382 (5' [mCs][mAs][mG][mG][mA][fA][mU][fU][fC][fC][fU][mG][mA][mA][mU][mU][mU][mUs][mAs][mA][G1b][G1b][G1b] 3'); or x) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 379 (5' [mUs][fGs][fG][mA][fA][mA][fG][mA][mG][fA][mU][mC][mU][fC][mA][fU][mC][mA][mC][mUs][mCs][mA] 3'), and the sense strand of the nucleic acid sequence according to SEQ ID NO: 383 (5' [mAs][mGs][mU][mG][mA][fU][mG][fA][fG][fA][fU][mC][mU][mC][mU][mU][mCs][mA][G1b][G1b][G1b] 3').

50. A vector encoding the isolated oligonucleotide according to any one of claims 1-49.

51. A delivery system comprising the isolated oligonucleotide of any one of claims 1-49 or the vector of claim 50.

52. A pharmaceutical composition comprising at least one isolated oligonucleotide according to any one of claims 1-49, the vector according to claim 50, or the delivery system according to claim 51 and a pharmaceutically acceptable carrier, diluent or excipient.

53. A kit comprising at least one isolated oligonucleotide according to any one of claims 1-49, the vector according to claim 50, the delivery system according to claim 51, or the pharmaceutical composition according to claim 52.

54. A method of inhibiting or downregulating the expression or level of CFB in a subject in need thereof, wherein the method comprises administering to the subject an effective amount of at least one isolated oligonucleotide according to any one of claims 1-49, the vector according to claim 50, the delivery system according to claim 51, or the pharmaceutical composition according to claim 52.

55. A method of treating or preventing a disease or disorder associated with aberrant or increased expression or activity of CFB, or a disease or disorder in which CFB plays a role, in a subject in need thereof, wherein the method comprises administering to the subject an effective amount of at least one isolated oligonucleotide according to any one of claims 1-49, the vector according to claim 50, the delivery system according to claim 51, or the pharmaceutical composition according to claim 52.

Images