Data analysis method for multiplex digital PCR using color combination
Through the combination method of direct and indirect probes and the color coding of multiple fluorophore types, the threshold complexity and data analysis complexity of multiplexed detection in the prior art are solved, and the efficient quantification of target sequences in multiplexed dPCR is achieved, which simplifies experimental design and reduces costs.
Patent Information
- Application Number
- CN202380090627.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Priority Date
- 2022-11-15
- Filing Date
- 2023-11-14
- Publication Date
- 2025-08-29
AI Technical Summary
The existing digital PCR methods have complex threshold settings and high data analysis in multiplexed detection, making it difficult to accurately quantify the concentration of multiple target sequences in complex samples, especially when multiple fluorescence detection channels are used, and the fluorescent labeled probe design of commercial instruments is complex and costly.
The combination of direct probes and indirect probes was used to detect and quantify target sequences by partitioning PCR reactions and color-coded using multiple fluorophore types, combined with simplified data analysis methods.
It realizes simplified data analysis and reduced experimental costs in multiple dPCR, and can efficiently and accurately quantify the presence and concentration of multiple target sequences in complex samples, and is suitable for a variety of biological sample sources.
Smart Images

Figure BDA0005483622190000201 
Figure BDA0005483622190000202 
Figure BDA0005483622190000203
Abstract
Description
Technical Field
[0001] The present application relates to multiplex digital polymerase chain reaction assays (dPCR assays), methods and systems, wherein a target sequence is characterized by a combination of at least two colors (color combination method). The method of the present invention differs from prior art methods in the analysis step performed to process the fluorescence record of the dPCR assay. Specifically, it is characterized by the fact that only two types of partitions need to be considered: 1) the total number of "all-negative" partitions with low fluorescence levels for all fluorophore types; and 2) the number of partitions that exhibit high fluorescence levels for all (but only) fluorophore types corresponding to the color combination encoding the target sequence. The method is both easy to implement and efficient in accurately determining the concentration of numerous target sequences (typically more than 10) in a complex sample. Background Art
[0002] Digital polymerase chain reaction (dPCR) is a powerful and sensitive method for detecting rare mutations in nucleic acid samples. This emerging technology provides quantitative information about nucleic acids with unparalleled precision. Its applications span a wide range of clinical specialties, including oncology (for example, lung cancer genotyping and monitoring, an area of active research), organ transplantation, microbiology, virology, and non-invasive prenatal testing; environmental research, and health and safety monitoring of food and feed products.
[0003] In numerous fields, from biology to medicine, there's a need to extract as much information as possible from a given sample, ideally from a single experiment. This demand for multiplexing can be driven by a variety of factors: sample scarcity or efforts to reduce analytical costs. Consequently, in digital PCR, it's necessary to test more than one or two targets at a time.
[0004] Currently, most commercially available platforms offer only two-color detection, but multiplexing strategies have been developed that involve manipulating probe and primer concentrations to generate populations of different fluorescence amplitudes for a given detection channel [1,2].
[0005] One multiplexing strategy to ensure robust results is to use multiple different detection channels, assign a target to each detection channel, and utilize a variety of fluorophores available for nucleic acid fluorescence detection. This is the "1 color-1 target" approach. For example, using allele-specific fluorescent The dPCR assay of the probe requires a dPCR instrument with R detection channels to detect R somatic mutations in biomarker genes. In this dPCR dual-channel assay setup set up on a dPCR instrument with 2 detection channels, a first probe that recognizes a first nucleic acid sequence (e.g., a wild-type allele) and a second probe that recognizes a second nucleic acid sequence (e.g., a specific mutant allele) are used. When the first probe or the second probe hybridizes with the amplicon in the dPCR partition, the probe releases its fluorophore through the exonuclease or endonuclease activity of the DNA polymerase. The fluorophore released from the first probe is detected via a first fluorescence detection channel that is different from the second fluorescence detection channel that detects the fluorophore released from the second probe. However, this “1 color-1 target” method is limited to detecting no more than R target sequences using a dPCR instrument with R detection channels [3].
[0006] One approach to increasing the level of multiplexing has been described in the literature and is called “intensity-based multiplexing” [4]. For at least one of the fluorophore types used in the assay, the assay combines two or more fluorophores that share the same fluorophore type but have different target sequences. Two or more probes sharing the same fluorophore type Probe types are combined in the assay at two different concentrations. When only two probe types are used for each fluorophore type, one probe type is at a low concentration (the "lo" type) and the other probe type is at a high concentration (the "hi" type). Therefore, after PCR, if a partition contains a target of type "lo", the fluorescence level of the associated fluorophore type in that partition will be above the set positivity threshold, but lower than if the partition contained a target of type "hi". After PCR, assuming all targets are present in the sample, for each fluorophore type that has been multiplexed based on intensity, there will be a population of negative droplets, a first population of "lo" positive droplets, a second population of "hi" positive droplets with a higher measured fluorescence level, and possibly a third population of "lo+hi" positive droplets with even higher measured fluorescence levels (these droplets contain both "lo" and "hi" targets, resulting in summation of the fluorescence signals). Using this approach, in addition to the initial binary classification of droplets based on the set positivity threshold, the measured fluorescence intensity of the partitions can be used to distinguish between different targets.
[0007] The method may not be fully reliable in the presence of inhibitors or poor quality nucleic acids, which may affect multiple targets differently, resulting in smearing, displacement or fusion of compartmentalized populations that is not observed in the controls used to calibrate the assay [5].
[0008] Another disadvantage of the intensity-based approach of Lindner et al. [4] is the complexity of droplet classification and data analysis. In fact, when using this approach, multiple thresholds must be set for each fluorophore type to distinguish between multiple positive partition populations, all with different fluorescence intensities. For example, when using a two-level intensity-based approach, three thresholds are required for each fluorophore type to properly classify the partition population and properly detect and quantify the target of interest (one threshold for "lo" positive partitions, one threshold for "hi" positive partitions, and one threshold for "lo+hi" positive partitions).
[0009] Given this shortcoming, there remains a need for higher levels of multiplexing using fewer thresholds and simpler data analysis.
[0010] In this context, Marras et al. ([6]) proposed a real-time PCR method involving color coding with two or more colors for each target (“color combination method”). However, this method only tested samples containing one target sequence (see Marras et al. Figure 1 The authors acknowledge that the use of combinatorially labeled hybridization probes can produce difficult-to-interpret results when multiple targets are present in a sample. This limitation is due to the fact that Marras et al. used real-time PCR, which means that when multiple targets are present in a sample, they are amplified simultaneously in the same reaction, leading to competing parallel PCR reactions and a modified fluorescent signal.
[0011] This limitation can be circumvented by using digital PCR (dPCR). In dPCR, when multiple targets are present in a sample, they are separated into different partitions during a partitioning step, greatly reducing the likelihood of competitive PCR reactions. However, the implementation of color combinations in dPCR has not yet been validated.
[0012] Despite this, there is still co-encapsulation (i.e., partitions containing at least 2 different target sequences) in digital PCR, and subsets of partitions will contain more than 1 type of target sequence. When using the "1 color-1 target" method, it is straightforward to infer which target sequences are present in partitions that are positive for multiple fluorophore types, because each color encodes a different type of target sequence. However, when at least one target sequence is color-coded using 2 or more fluorophore types, the task becomes extremely challenging. Partitions that are positive for more fluorophore types are ambiguous in terms of the content of the target sequence compared to the number of fluorophore types used for color coding. The processing of such fuzzy partitions and the deconvolution of the measured fluorescence signals are complex. This complexity is further exacerbated by the fact that current commercial dPCR instruments provide 5, 6 or more fluorescence detection channels. For example, the dual-color coding on a 6-channel dPCR instrument triggers simultaneous monitoring and analysis of 15 different targets in the same sample.
[0013] In this context, data interpretation of results generated by combinatorially labeled hybridization probes specific for multiple targets remains a challenge, especially when using dPCR instruments equipped with more than three fluorescence detection channels.
[0014] Therefore, there remains a need to identify a color combination method that can accurately and reproducibly quantify the presence and concentration of a large number of target sequences (usually more than 10) in complex samples using dPCR instruments containing more than three detection channels.
[0015] It is also necessary to use universal reporter probes rather than direct specific probes such as This will lead to the design and use of fewer fluorescently labeled probes, thereby reducing the cost and complexity of experimental design. Currently, universal reporter probes are typically molecular beacon probes, which may include an extended 3' end to allow hybridization of complementary mediators, as linear probes are known to produce unwanted side effects (Huang et al., PNAS 2022).
[0016] However, in practice, generating molecular beacon molecules with 3D constraints can be difficult due to their hairpin structure. Furthermore, molecular beacon reporter molecules must be synthesized by grafting a fluorophore type and a quencher onto the same chain, which can be challenging for certain fluorophore types and can be more expensive than reporter molecules containing only a fluorophore or a quencher. For these reasons, the inventors sought alternative universal reporters that were more stable and easier to produce than molecular beacons, which have 3D structural constraints due to their ring-like shape.
[0017] The objects of the present invention are therefore:
[0018] - Provide a simple, yet efficient, dPCR method for accurately determining the presence and concentration of numerous target sequences in a sample, applicable to a range of biologically relevant sample sources, and / or
[0019] - Provide universal reporters that are more stable and / or easier to produce and / or easier to use than molecular beacons. Summary of the Invention
[0020] The present application provides a method for detecting and quantifying a target sequence or multiple target sequences in a nucleic acid sample using a PCR assay (particularly a multiplex dPCR assay) involving direct probes and indirect probes.
[0021] In particular, the present invention relates to an in vitro PCR method for detecting and / or quantifying the presence of at least one nucleic acid target sequence (TSi) in a biological sample containing nucleic acid molecules, the method comprising:
[0022] A) contacting the sample with a panel containing a direct probe or an indirect probe system carrying a fluorophore group (as defined below) for each TSi;
[0023] B) amplifying the at least one nucleic acid target in the presence of an enzyme having nuclease activity;
[0024] C) detecting or measuring the fluorescence intensity of each fluorophore group;
[0025] D) Optionally, processing the data collected in step C) to quantify the concentration of at least one TSi in the biological sample.
[0026] This method can be used to detect different mutant target sequences. This method can also be used to assess microsatellite instability (MSI) and / or detect genome editing products.
[0027] In certain embodiments, the methods of the present invention comprise the main steps of a conventional dPCR assay, namely:
[0028] a) contacting the sample with a probe carrying a fluorophore that can bind directly or indirectly to a target sequence (TS);
[0029] b) separating the sample into a set of partitions;
[0030] c) exponentially amplifying the TS in the presence of a PCR reaction mixture;
[0031] d) For each partition, the fluorescence intensity of each fluorophore type is measured.
[0032] definition
[0033] As used herein, the term “digital PCR” refers to a PCR assay in which a sample is separated into a large number of partitions and a PCR reaction is performed in each partition. The signal from each partition is detected to enable quantification of the nucleic acid by statistical analysis. Currently available commercial digital PCR platforms rely on two different approaches. The earliest developed was chamber digital PCR, which relies on a two-dimensional array of microchambers to partition the sample [7]. Once the microchambers are filled with the PCR mixture, they are thermally cycled on a flat-plate thermal cycler and subsequently imaged using fluorescence to reveal the amplified positive partitions. The second approach is droplet digital PCR, in which the sample is partitioned into an emulsion of batches of microdroplets using platform-specific consumables. The emulsion is transferred to PCR tubes or plates for thermal cycling. After PCR amplification, data acquisition is performed in a process similar to flow cytometry, where the droplets are fluorescently read one by one as they pass in front of a single laser excitation source [8]. The system uses a technique called "crystal digital PCR" TMA hybrid approach to digital PCR combines the use of a two-dimensional array format and droplet partitioning. First, the sample is partitioned into a two-dimensional monolayer array of monodisperse droplets, called droplet crystals. These droplet crystals are then thermally cycled on a flat-plate thermal cycler before being transferred to a fluorescence microscope and imaged to reveal the amplified partitions. The entire process is performed within a specially designed microfluidic chip, such as the Sapphire chip or Ruby chip, and requires the use of two instruments: i) Geode, which performs thermal cycling of sample partitioning and droplet crystallization, and ii) Prism, an automated fluorescence microscope equipped with 3 or 6 different fluorescence channels ([9]). Another approach to digital PCR involves performing fluorescence imaging at multiple steps during the PCR amplification process and classifying the partitions based on the fluorescence curves obtained. This is a hybrid between digital PCR and real-time PCR. All known dPCR instruments can be used to implement the method of the present invention, in particular chamber digital PCR, droplet digital PCR, crystal digital PCR TM , BEAMing (beads, emulsion, amplification and magnetic)-based digital PCR and microfluidic chip-based digital PCR.
[0034] As used herein, the term "partition" or "partitioned" refers to separating a sample into multiple parts, i.e., "partitions." Typically, a sample is partitioned into at least 500 partitions. Partitions are typically physical, so that the sample in one partition does not mix with the sample in an adjacent partition, or does not substantially mix. Partitions can be solid or fluid. In some embodiments, partitions are solid partitions, such as micropores. In some embodiments, partitions are fluid partitions, such as droplets. In some embodiments, fluid partitions (such as droplets) are the result of a mixture of immiscible fluids (such as water and oil). In some embodiments, fluid partitions (such as droplets) are aqueous droplets surrounded by immiscible carrier fluids (such as oil). As used herein, "substantially all partitions" refers to any of at least about 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% or more of the total number of partitions. Partitions described herein can be in any suitable format. Microplates, capillaries, oil emulsions, and micro-chamber arrays with nucleic acid binding surfaces can be used to partition samples. In a preferred embodiment, the partitions in the method of the present invention are droplets. In a preferred embodiment, the use dPCR platform to perform the partitioning step in the method of the present invention. In some embodiments, the The Sapphire chip of the dPCR platform partitions the sample. Typically, the Sapphire chip contains four microchambers, each with a two-dimensional monolayer of droplets. In some embodiments, the The Ruby chip of the dPCR platform partitions the sample. Typically, a Ruby chip contains 16 microchambers, each housing a two-dimensional monolayer of droplets. In some embodiments, data from dPCR reactions in droplets from different microchambers within the Sapphire chip are combined to provide quantification of the target sequence the method is designed to detect.
[0035] In a preferred embodiment, the sample is partitioned into a sufficient number of partitions such that at least a majority of the partitions have no more than 1-5 target regions or template molecules thereof (e.g., no more than about 1, 2, 3, 4, or 5 target regions or amplicons thereof). Specifically, each partition in a majority of the partitions has more than 1 target region or amplicon, but less than 3 target regions or amplicons.
[0036] Typically, partitions will contain excess enzyme, probe, and primers so that each partition of the mixture has the potential to successfully amplify any target region present in the partition.
[0037] In a preferred embodiment, the volumes of all partitions are kept constant. The method of the present invention can also be performed on partitions whose volumes are not constant. In another embodiment, the distribution of the partition volumes around the mean volume is known before performing the method of the present invention, and the results are corrected around the mean based on this distribution. In another embodiment, the partition volumes are measured during the performance of the method, for example by using fluorescence measurements obtained on the partitions, and the results are corrected based on the measured partition volumes.
[0038] Steps a) and b) of the inventive method can be performed in any order. Therefore, the sample can first be partitioned, and then a detection reagent (e.g., a probe, an enzyme, etc.) is subsequently added to the partitioned sample. Alternatively, in a preferred embodiment, the sample can first be contacted with a detection reagent (e.g., a probe, an enzyme, etc.), and then the sample is partitioned. Preferably, in the method of the present invention, the sample is partitioned immediately after mixing the reagents so that substantially all or most reactions (e.g., DNA amplification, DNA cutting, etc.) occur after the partition. In other cases, the reagents can be mixed under a certain state, for example, at a temperature at which the reaction is slowly carried out or not carried out at all. In this state, the sample is then partitioned, and the final reaction is triggered so that the reaction is carried out, for example, by adjusting the temperature. Other triggers can also be used, such as optical or chemical triggers.
[0039] As used herein, the terms "polynucleotide" and "nucleic acid" are used interchangeably to refer to nucleotide polymers of any length. They include DNA and RNA. Nucleotides can be deoxyribonucleotides, ribonucleotides, modified nucleotides or bases, and / or their analogs, or any substrate that can be incorporated into a polymer by DNA or RNA polymerase. Polynucleotides can contain modified nucleotides, such as locked nucleic acids (LNA), minor groove binders (MGB), methylated nucleotides and their analogs, or blockers or decoys for any Tm enhancers to minimize the selection of non-targeted nucleic acids. Nucleic acids can be single-stranded, double-stranded, or in a hybridized form with a higher degree of polymerization, and may include chemical modifications. The terms "polynucleotide" or "nucleic acid" can also be used to refer to sequences encoded by nucleic acids, including sense strand (i.e., coding strand) sequences and antisense strand (i.e., non-coding strand) sequences in double-stranded nucleic acid molecules.
[0040] As used herein, the term "target sequence" refers to a unique genomic location that defines the position of an individual nucleic acid sequence of interest, including one or more consecutive nucleotides. In some embodiments, the target sequence is a single nucleotide position of interest. In some embodiments, the target sequence is any of at least about 2, 3, 5, 10, 15, 20, or 25 consecutive nucleotides. A gene may contain multiple target sequences of interest. "Target sequence" may refer to the sense or antisense strand sequence of a target region. The target sequence can be any target nucleotide sequence of interest, such as a sequence shown in a target pathogen genome, or a mutant sequence.
[0041] In the context of the present invention, a "target sequence" is preferably a mutant sequence as defined below, which is present at low levels in a sample. In some embodiments, the target sequence is not a wild-type sequence.
[0042] As used herein, the terms "mutant sequence" and "variant sequence" are used interchangeably herein and refer to any sequence change in a sequence of interest compared to a reference sequence. The purpose of the method of the present invention can be to quantify its concentration in a sample. Mutant sequences include, but are not limited to, insertions, deletions, and substitutions, including single nucleotide changes, and changes of more than one nucleotide in the sequence. Mutant sequences may be located in mutation hotspots, microsatellite sequence sites, or site-specific genome editing reagents. They may be SNVs or SNPs. "Mutation hotspots" refer to gene sites that are known to be prone to natural mutations, such as in diseased tissues or pathological conditions. As used herein, the term "single nucleotide variant" or abbreviation "SNV" refers to a single nucleotide change at a specific position in a genomic sequence. When the alternative allele is present in a population at a considerable frequency (e.g., at least 1% in a population), the SNV is also referred to as a "single nucleotide polymorphism" or "SNP." "Microsatellite sequence site" herein refers to a region in genomic DNA containing short repeat sequence elements of 1 to 7 (e.g., 1 to 5 or 1 to 4) base pairs in length. Each sequence repeated at least once within a microsatellite site is referred to herein as a "repeat unit." Each microsatellite locus typically comprises at least seven repeating units, for example at least ten repeating units or at least twenty repeating units. A "site-specific genome editing reagent" refers to a component or set of components that can be used for site-specific genome editing. Typically, such reagents contain a targeting module and a nuclease module.
[0043] The term "wild-type sequence" as used herein refers to the sequence used for comparison with the sequence of interest, such as the sequence corresponding to the dominant allele of a gene, or the unmodified sequence of a gene locus. It is typically a sequence that is more abundant in the sample being tested than the mutant sequence.
[0044] As used herein, the term "polymerase chain reaction" or "PCR" refers to a method for amplifying a specific segment of a target double-stranded DNA. PCR is well known to those skilled in the art. Exemplary PCR reaction conditions typically include two or three-step cycles. A two-step cycle has a denaturation step followed by a hybridization / extension step. A three-step cycle includes a denaturation step followed by a hybridization step followed by a separate extension step. Polymerase chain reactions that are not performed by thermal cycling are also encompassed herein, including but not limited to rolling circle amplification (RCA), isothermal PCR, and loop-mediated isothermal amplification (LAMP).
[0045] " Primer " is generally a short single-stranded polynucleotide, generally having a free 3'-OH group, which is bound to the target nucleic acid by hybridization with the target sequence, and subsequently promotes the polymerization of a polynucleotide complementary to the target nucleic acid. The length of the primer is variable, and the length is generally less than 50 nucleotides, for example, a length of 12-30 nucleotides. The primer can be DNA, RNA, or a chimera of DNA and RNA parts. In some cases, the primer may include one or more modified or non-natural nucleotide bases. In the context of the present invention, each partition may include a plurality of primer sets corresponding to a plurality of target sequences. In some embodiments, each primer set includes a forward primer and a reverse primer for amplifying the target sequence. In some embodiments, the forward primer and the reverse primer are oligonucleotide primers that anneal to the opposite strands of the nucleic acid molecule and are located on both sides of the target sequence. The primer set can produce an amplicon specific to the target fragment during the PCR reaction.
[0046] As used herein, a "tag" is a relatively short oligonucleotide containing 8 to 25 nucleotides, preferably 8 to 18 nucleotides, more preferably 10 to 16 nucleotides, and even more preferably 12 to 14 nucleotides. In the context of the present invention, it is sometimes referred to as a "flap" sequence. This sequence is contained in the 5' end region of the mediation probe and is therefore a characteristic marker of the target sequence or a portion thereof, or a portion thereof. Once the 3' end region of the mediation probe is bound to the target sequence, it is released after being cut by a nuclease and can then hybridize with a tag complementary sequence (TCS) located on a reporter molecule. This hybridization of the latter will trigger the modification of the signal carried by the reporter molecule, thereby ultimately detecting / quantifying the presence of the target sequence in the sample. The nucleotide sequence of the tag is typically optimized by conventional methods so that its melting temperature on TCS is lower than the melting temperature of the 3' end probe region of the mediation probe (this makes hybridization possible on TSi).
[0047] Thus, the "tag complementary sequence" or "TCS" corresponds to the oligonucleotide carried by the m-reporter of the CSSFR of the present invention, preferably located in its 3' region, whose sequence is partially or fully complementary to the tag oligonucleotide sequence defined above. As a tag itself, the TCS generally comprises 8 to 25 nucleotides, preferably 8 to 18 nucleotides, more preferably 10 to 16 nucleotides, and even more preferably 12 to 14 nucleotides.
[0048] A nucleic acid sequence is "complementary" to another nucleic acid when at least two consecutive bases of the nucleic acid sequence (e.g., of a first nucleic acid or primer) are capable of binding in antiparallel association or hybridizing to at least a subsequence of a second nucleic acid to form a duplex. In some embodiments, complementarity refers to hydrogen bond base pair formation preferences between the nucleotide bases G, A, T, C, and U, such that when two given polynucleotides or nucleotide sequences are annealed to each other, A pairs with T and G pairs with C in DNA, and G pairs with C and A pairs with U in RNA.
[0049] A first nucleic acid sequence that "corresponds to" a second nucleic acid sequence is a sequence that is identical to or complementary to the second nucleic acid sequence or a portion of the second nucleic acid sequence, or a sequence that comprises the second nucleic acid sequence or its complement. When the second nucleic acid sequence contains a unique feature (e.g., a mutation), a nucleic acid sequence that "corresponds to" the second nucleic acid sequence comprises the sequence having the unique feature or its complement.
[0050] As used herein, "hybridization" and "annealing" refer to a reaction in which one or more polynucleotides react to form a complex stabilized by hydrogen bonds between the bases of the nucleotide residues. Hydrogen bonds can occur by Watson-Crick base pairing, Hoogstein binding, or any other sequence-specific manner. A nucleic acid or a portion thereof hybridizes with another nucleic acid under conditions that minimize nonspecific hybridization at a given temperature in a physiological buffer (e.g., pH 6-9, 25-150 mM chloride salt). In some embodiments, the given temperature at which specific hybridization occurs is room temperature. In some embodiments, the given temperature at which specific hybridization occurs is higher than room temperature. In some embodiments, the given temperature at which specific hybridization occurs is at least about 37, 40, 42, 45, 50, 55, 60, 65, 70, 75, or 80°C. In some embodiments, the given temperature at which specific hybridization occurs is or is about 37, 40, 42, 45, 50, 55, 60, 65, 70, 75, or 80°C.
[0051] In the context of oligonucleotide hybridization, the melting temperature (T M ) is defined as the temperature at which half of an oligonucleotide molecule becomes single-stranded (thus "melted") and the other half becomes double-stranded (i.e., annealed to its complementary strand). M Depends on the length of the oligonucleotide molecule to be hybridized and its specific nucleotide sequence. M The calculation also takes into account experimental conditions, including primer / probe concentration, target oligonucleotide molecule, and salt / ionic strength. In particular, T M Should be designed to be compatible with the temperatures used during PCR cycling. M Methods and calculation tools are well known in the art. In the context of the present invention, a specific T MThe [Tag / TCS] oligonucleotides were optimized using the following values, as described below.
[0052] Each partition may comprise a polymerase, which is an enzyme that performs template-directed synthesis of polynucleotides such as DNA and / or RNA. The term "polymerase" encompasses both full-length polypeptides and domains having polymerase activity. DNA polymerases are well known to those skilled in the art and include, but are not limited to, DNA polymerases isolated or derived from Pyrococcus furiosus, Thermococcus litoralis, and Thermotoga maritime, or modified versions thereof. Other examples of commercially available polymerases include, but are not limited to, Klenow fragment (New England Biolabs Inc.), Taq DNA polymerase (QIAGEN), 9° WM DNA polymerase (New England Biolabs Inc.), Deep Vent TM DNA polymerase (New England Biolabs Inc.), Manta DNA polymerase (Enzymat-ics), Bst DNA polymerase (New England Biolabs Inc.), and phi29 DNA polymerase (New England Biolabs Inc.). In some embodiments, the polymerase is a DNA-dependent polymerase. In some embodiments, the polymerase is an RNA-dependent polymerase, such as a reverse transcriptase.
[0053] As used herein, "amplification" generally refers to the process of producing two or more copies of a desired sequence. It can be carried out by any polymerase chain reaction carried out by thermal cycling or non-thermal cycling, such as rolling circle amplification (RCA), isothermal PCR and loop-mediated isothermal amplification (LAMP) or any known method. The components of the amplified reaction may include, but are not limited to, such as primers, polynucleotide templates, polymerases, nucleotides, dNTPs, etc. "amplicon" refers to the nucleic acid fragment formed as a PCR amplification reaction product, which is a copy of a part for a specific target nucleic acid, such as a target fragment comprising a target region. Amplicon is generally double-stranded DNA, although its single chain may also be mentioned.
[0054] Droplets can support PCR amplification of template molecules using homogenous assay chemistries and workflows similar to those widely used in real-time PCR applications (
[10] ). Once droplets are generated, they can be transferred to a PCR plate and the emulsion PCR reaction run on a thermal cycler using a classical PCR program. Alternatively, Droplets generated on the system's Sapphire chip or Ruby chip can be thermally cycled using a classic PCR program. Thermal cycling is performed until endpoint.
[0055] To circumvent the technical challenges associated with amplification of low-complexity sequences (such as microsatellite sequences), the annealing temperature and / or extension time of the amplification step can be increased. For example, the typical annealing temperature is 55°C, and for microsatellite locus detection, the annealing temperature can be increased by 3 to 15°C.
[0056] As used herein, "specificity" when used in the context of a primer specific for a target nucleic acid, or a probe specific for a target nucleic acid, or a tag specific for a TCS, refers to the level of complementarity between the primer / probe and the target, or the tag and the TCS, such that there is an annealing temperature at which the primer / probe or tag will preferentially anneal to the target nucleic acid or TCS and mediate its amplification and fluorescent detection, and will not anneal to or mediate the amplification and fluorescent detection of non-target sequences / non-TCS present in the sample.
[0057] "Probe" herein refers to a molecule (e.g., protein, nucleic acid, aptamer, etc.) that specifically interacts with or specifically binds to a target polynucleotide. Non-limiting examples of molecules that specifically interact with or specifically bind to a target polynucleotide include nucleic acids (e.g., oligonucleotides), proteins (e.g., antibodies, transcription factors, zinc finger proteins, non-antibody protein scaffolds, etc.), and aptamers. Typically, the probe is labeled with a detectable marker. The probe can indicate the presence or level of the target polynucleotide by increasing or decreasing the signal of the detectable marker. In some embodiments, the probe detects the target polynucleotide in an amplification reaction by being digested by the 5' to 3' exonuclease or endonuclease activity of a DNA-dependent DNA polymerase. In the context of the present invention, the probe is preferably a nucleic acid probe. In addition, the probe sequence can incorporate modified bases, such as locked nucleic acid bases ( bases), MGB or other Tm enhancers, or means to minimize off-target effects. The probe can be a mediating probe (which does not carry any label) or a labeled probe. Examples are provided below.
[0058] As used herein, "color combination" refers to the concept of using more than one (1) fluorophore type for at least one target in the context of a digital PCR experiment. The method of the present invention requires that at least one target sequence (TS) be characterized by at least two different fluorophore types (or "colors"). Therefore, it is referred to as a "color combination approach" or "color combination method" hereinafter, in contrast to prior art dPCR methods, in which each TS is associated with only one fluorophore type / color.
[0059] As used herein, the term "fluorophore type" corresponds to the chemical structure of a given fluorophore moiety. A variety of different fluorophore types can be used in the methods of the present invention, such as FAM, VIC, Yakima HEX、ROX、 5. 550, 700, etc. Similarly, a variety of different quencher types can be used, such as TAMRA TM 、BHQ TM 1. BHQ TM 2. BHQ TM 3rd level.
[0060] The detection instrument or detection unit of the digital PCR system will use one or more fluorescence detection channels. A "fluorescence detection channel" typically combines an excitation channel that illuminates the sample with light filtered to contain only a narrowband wavelength (excitation wavelength), and an emission channel that only collects light (emission wavelength) emitted by the sample in a narrowband wavelength different from the excitation wavelength. A commercial digital PCR system has a detection instrument or detection unit that acquires data from one, or two, or three, or four, or five, or six or more different fluorescence detection channels (using a point detector, PMT, or 2D image sensor). For simplicity, the verb "imaging" can be used regardless of whether the collected data comes from a point detector or an image sensor. In all cases, each fluorescence detection channel utilizes a pair of different excitation wavelengths and emission wavelengths. In the method of the present invention, the detection instrument or detection unit is preferably capable of acquiring data from at least five, or six or more different fluorescence detection channels (using a point detector, PMT, or 2D image sensor).
[0061] For example, the Prism 6 instrument, which is the detection instrument of Stilla Technologies' Naica system, has six different fluorescence detection channels. The "blue," "cyan," "green," "yellow," "red," and "infrared" channels combine excitation channels with bandwidths of 450-490 nm, 509-519 nm, 533-557 nm, 564-586 nm, 625-643 nm, and 645-695 nm, respectively, with emission channels with bandwidths of 505-535 nm, 530-551 nm, 568-593 nm, 600-640 nm, 655-685 nm, and 708-753 nm.
[0062] When a fluorophore moiety is imaged using a detection unit having multiple detection channels, the light emitted by the fluorophore moiety is detected primarily in one of the detection channels. For example, a FAM fluorophore moiety is detected primarily in the "blue" detection channel of a Prism 6 instrument. However, light emitted by the fluorophore moiety may also be detected in other detection channels, a phenomenon known as "fluorescence spillover." For example, a FAM fluorophore moiety is also detected in the "cyan" detection channel of a Prism 6 instrument, although at a lower signal intensity than in the "blue" detection channel. The distribution of light detected from a given fluorophore type across all fluorescence detection channels is called the fluorescence signature of that fluorophore type.
[0063] In the method of the present invention, the PCR data collection step is preferably performed using an optical detector having a large number of detection channels, such as a six-color detection system (e.g., Stilla's Prism6 system, or Qiagen's Qiacuity 5-color system). On a given fluorescence detection unit (such as Prism6), different fluorophore types have different fluorescence characteristics.
[0064] As used herein, the term "sample" refers to a sample that has been subjected to the methods described herein, with or without pre-treatment, such as nucleic acid extraction, fragmentation, dilution / concentration, or other pre-treatment. The sample can be a biological sample, or can be obtained by processing or manipulating a biological sample, such as a biological fluid or biological tissue. The biological sample preferably contains, for example, tumor tissue, disseminated cells, feces, blood cells, plasma, serum, lymph nodes, urine, saliva, semen, feces, sputum, cerebrospinal fluid, tears, mucus, pancreatic juice, gastric juice, amniotic fluid, cerebrospinal fluid, or serum. Alternatively, it can be an environmental sample, such as sewage.
[0065] In some embodiments, the collected sample is ready to be loaded onto a digital PCR instrument for analysis. This is often the case when the target sequence is present at very low levels in the sample, such as when it is a mutated sequence in a tumor sample.
[0066] However, in a preferred embodiment, the concentration of the nucleic acid molecules present in the sample needs to be adjusted, such as by diluting the sample or concentrating the sample (such as by dialysis, or by freeze-drying and reconstruction), to provide a concentration suitable for dPCR. In particular, it is crucial to dilute the sample to reduce the number of sequences (such as WT sequences) present in higher quantities in the sample. In some embodiments, the method is carried out using the first sample, and the concentration of nucleic acid molecules in the sample is adjusted based on the count of the partitions that each generates a positive signal via three or more detection channels, wherein if (such as when) the count is greater than a preset value, the concentration of nucleic acid molecules in the sample is reduced by diluting the sample; or wherein if (such as when) the count is less than a preset value, the concentration of nucleic acid molecules in the sample is increased by concentrating the sample. In some embodiments, the dilution factor or concentration factor are based on the count of the partitions that each generates a positive signal via three or more detection channels. In some embodiments, the concentration of nucleic acid molecules in the sample is adjusted based on the estimated concentration of the wild-type sequence at one or more of the multiple target regions in the sample, the estimated concentration of the mutant sequence, or the estimated concentration of the specific allele sequence. In some embodiments, the method is repeated by diluting the sample to one or more concentrations to provide optimal concentrations for accurate quantification of different genetic species (eg, wild-type, mutant, and / or allelic sequences) at different target regions.
[0067] In a preferred embodiment, the concentration of the sample is adjusted so that the maximum concentration of the target sequence before partitioning the sample is at least about any of 50, 75, 100, 150, 200, 250, 500, 1000, 2000, 5000 or more copies per microliter. Preferably, it is at least about 150 to 500 copies per microliter.
[0068] The method of the present invention preferably includes the step of calculating a "fluorescence compensation matrix" or "spillover compensation matrix" using a reference sample. This step should be performed before running samples in a digital PCR experiment combining different fluorophore types. The importance of this step is well known in the art. This is due to the fact that the fluorescence detection unit does not directly measure the fluorescence intensity of a single fluorophore type. In fact, the fluorescence detection unit measures the light level received by each fluorescence detection channel from each partition. The light level in one fluorescence detection channel is the sum of the fluorescence signals of all fluorophore types, each fluorophore having a different contribution defined by its fluorescence characteristics. Typically, one fluorophore type is the main contributor to the fluorescence signal detected in a given fluorescence detection channel. However, other fluorophore types may also contribute to the total signal. For example, when using FAM, Yakima and other fluorophore types in combination on a Prism6 instrument, the fluorescence intensity of the fluorophore type is not directly measured ... and 550 fluorophore type, Yakima is the main contributor to the signal detected in the "cyan" channel, but FAM and The 550 fluorophore also has secondary signals that are consistent with the Yakima Signal summation. Overall, the fluorescence signal in a fluorescence detection channel is the sum of the fluorophore signal intensity for each fluorophore type combined in the experiment multiplied by the fluorescence signature of that fluorophore in that channel. Added to this is the additional signal from the background, known as "background fluorescence."
[0069] When using n different fluorescence detection channels and M different fluorophore types in an experiment, n signals are acquired for each partition, each of which is the sum of the M contributions of the M fluorophore types (plus "background fluorescence"). In practice, the useful information is the signal intensity I(m) for each fluorophore type. Mathematically, this corresponds to n linear equations with M unknown variables. This mathematical problem can only be solved under the following conditions:
[0070] i) The number of fluorophore types combined in the experiment does not exceed n (M≤n);
[0071] ii) All fluorophore types have fluorescence characteristics that are different from each other.
[0072] Therefore, in a digital PCR experiment or digital PCR assay, only fluorophore types with different fluorescence characteristics on a given fluorescence detection unit should be combined. In this case, a "fluorescence compensation matrix" or "spillover compensation matrix" can be applied to convert the n signals from n fluorescence detection channels into M fluorescence levels from M different fluorophore types. The "fluorescence compensation matrix" is an n×(n+1) matrix, where the "+1" is related to the assumed known "background fluorescence."
[0073] Before running a digital PCR experiment combining different fluorophore types, it is preferred to use a reference sample to calculate the fluorescence compensation matrix. Typically, a "no template control (NTC)" sample and a "single color control" sample are used to estimate the fluorescence compensation matrix. The NTC sample can estimate the "background fluorescence", while each "single color control" sample containing only one fluorophore type is used to estimate the fluorescence characteristics of each fluorophore type in all fluorescence detection channels. Such a control experiment can estimate the fluorescence compensation matrix, but the estimate may not be perfect, resulting in imperfect conversion of n signals from n fluorescence detection channels into M signals of M fluorophore types, resulting in uncertainty and error in the measurement of fluorophore signal intensities. More complex algorithms can be used to analyze the data to take into account such possible signal uncertainties.
[0074] In the following sections, unless otherwise stated, it is recommended that:
[0075] - No more than n types of fluorophores were combined in the experiment (M≤n);
[0076] - All fluorophore types have fluorescence characteristics that are different from each other;
[0077] -Spillover compensation has been estimated from a control sample.
[0078] In some embodiments, it is possible to use more than n fluorophore types, provided that these fluorophore types can be divided into n groups of fluorophore types, wherein the different fluorophore types within each group have similar fluorescence properties and can be treated indiscriminately when implementing the methods of the present invention. For example, FAM / AlexaFluor488 / Atto495 can be considered as one such group of fluorophore types.
[0079] Therefore, for each partition, the fluorescence signal intensities of M fluorophore types are measured using n signals from n fluorescence detection channels, preferably by applying a pre-generated fluorescence compensation matrix.
[0080] When a value or parameter is mentioned herein as "about", variations in the value or parameter are included (and described). For example, a description of "about X" includes a description of "X". For example, a value of about X may be within (i.e., ±) 10%, 5%, 2%, 1%, or less of X.
[0081] Color combination method of the present invention
[0082] In a first aspect, the present invention relates to a multiplex digital PCR (dPCR) method for detecting and / or quantifying the presence of a set of at least five different nucleic acid target sequences (TS) in a biological sample comprising nucleic acid molecules, the method comprising:
[0083] a) contacting the sample with a probe carrying a fluorophore that can bind directly or indirectly to TS; wherein each target sequence i (TSi) is represented by k i Characterization of different fluorophore types, k i Greater than or equal to 2;
[0084] b) separating the sample into a set of partitions;
[0085] c) exponentially amplifying the TS in the presence of a PCR reaction mixture;
[0086] d) for each partition, measuring the fluorescence intensity of each fluorophore type;
[0087] e) For each fluorophore type, count the following:
[0088] - partitions where the fluorescence signal is below the positive threshold for said fluorophore type,
[0089] - partitions having a fluorescence signal above said positive threshold for said fluorophore type,
[0090] Thus determining:
[0091] N0 = the total number of partitions with fluorescence signals below the positive threshold for all fluorophore types,
[0092] ·N i = Fluorescence signal is higher than that of TSi alone i The total number of partitions with a positive threshold for each fluorophore type,
[0093] f) processing the data collected in step e) to quantify the concentration of at least five TSi in the biological sample.
[0094] In some embodiments, the positive threshold for each fluorophore type is predefined. In some embodiments, the positive threshold is set when the method is implemented. In some embodiments, the positive threshold is predefined and adjusted when the method is implemented.
[0095] In a preferred embodiment, the positivity threshold for each fluorophore type is defined and / or adjusted so that it is above the partition cluster with the lowest fluorescence intensity (corresponding to the "all-negative cluster") and below any partition cluster with a higher fluorescence intensity level than the "all-negative cluster".
[0096] In the method of the present invention, the number of fluorophore types used to characterize each target sequence (TS) is represented by the letter "k". More precisely, in the method of the present invention, each target sequence i (TSi) is represented by k i Characterization of different fluorophore types, k i Greater than or equal to 2.
[0097] In a preferred embodiment, k i The same is true for each and all TS to be detected in the experiment. For example, each and all TS in the experiment are characterized by two (and only two) fluorophore types. Alternatively, each and all TS in the experiment are characterized by three (and only three) fluorophore types.
[0098] In this embodiment, only fluorescence signals above at most k i species (and no more than k i The partitioning of the positive threshold of the fluorophore type should be considered in the method of the present invention. i +1 kind (or k i +2 etc.) fluorophore types should not be considered in the method of the present invention. For example, if each target sequence TSi is represented by k i= 3 fluorophore types, then partitions with fluorescence signals above the positive threshold for 4, 5, etc. fluorophore types should not be considered in the method of the present invention.
[0099] More precisely, in the method of the present invention, only the fluorescence signal above the k i Partitions with a positive threshold for three fluorophore types should be considered "positive partitions". All other partitions should be considered "negative partitions" or should be excluded from the analysis. For example, if the TS consists of three fluorophore types, FAM, Yakima and 550 characterization, the fluorescence signal is higher than that of FAM, Yakima and A partition with a positive threshold of 550 would be considered "positive" for that TS. A partition that is negative for all fluorophore types would be considered "negative". All partitions that are negative for only FAM, Yakima and Subsets of 550 fluorophores (e.g., FAM only; FAM and Yakima only) Yakima only and 550; FAM, Yakima 5 and All partitions that test positive for FAM, Yakima, etc. can be considered "negative" for that TS. They can also be excluded from the analysis - they are ignored. All other and Partitions positive for any fluorophore type other than 550 will not be included in the analysis - they are ignored for that TS.
[0100] In another embodiment, k i This is different for each TS to be detected in the experiment. For example, some TS are characterized by only two (and only two) fluorophore types, while other TS are characterized by three (or four) fluorophore types.
[0101] Also in this case, for the i The target sequence TSi characterized by the type of fluorophore has a fluorescence signal higher than k i Partitioning of the positive threshold for +1 fluorophore type should not be considered in the method of the present invention. For example, if the target sequence TSi consists of k i = 3 fluorophore types, then for this Tsi, partitions with fluorescence signals above the positive threshold for 4 fluorophore types should not be considered in the method of the present invention. Similarly, if the target sequence TS j By k j = 2 types of fluorophores, then for the TS j, partitions with fluorescence signals above the positive threshold for the three fluorophore types should not be considered in the method of the present invention.
[0102] In the context of the present invention, and as set forth above, the total number of different channels, fluorophore types, wavelengths or signals that the dPCR instrument used in the proposed method is able to unambiguously detect is denoted by the letter "n".
[0103] Preferably, the number n of different fluorescence detection channels that can be used for analysis in the method of the present invention is greater than or equal to 4, preferably greater than or equal to 5, more preferably 6 or 7. It can also be greater than 7.
[0104] In the context of the present invention, the total number of different fluorophore types carried by all probes used in an assay (ie the total number of different fluorophore types combined in the experiment) is denoted by the letter "M".
[0105] In a preferred embodiment, as explained above, M is less than or equal to n.
[0106] The method of the present invention differs primarily from prior art methods in that, in step e), the partitions are classified as binary "negative or positive" based on the fluorescence intensity levels measured for the fluorophore type. Therefore, in the method of the present invention, the precise fluorescence intensity value of a partition is unimportant, as long as it is above or below a positive threshold. In the present invention, this threshold is used solely to distinguish positive from negative partitions.
[0107] As used herein, a "positive threshold" corresponds to an intensity value that distinguishes between partitions showing high intensity of one fluorophore type and partitions showing low intensity of the same fluorophore type.
[0108] In a preferred embodiment, it is defined on a 1D map view separately for each fluorophore type. It can also be defined on a 2D map view, depending on what is more appropriate for the skilled person.
[0109] Once this positivity threshold is set for each fluorophore type, it is easy to determine:
[0110] a value "N0" corresponding to the total number of partitions with a fluorescence signal below the positive threshold for all fluorophore types,
[0111] ·Number "N i ”, which corresponds to a fluorescence signal higher than the k that characterizes TSi alone i The total number of partitions with a positive threshold for each fluorophore type.
[0112] Based on these values, the concentrations Ci of at least five TSi in the biological sample can be quantified according to the classical Poisson's law.
[0113] For example, the concentrations of at least five TSi in the biological sample can be quantified using the following equation:
[0114]
[0115] where v is the partition (e.g., droplet) volume, which is assumed to be constant, and d is the dilution factor used to dilute the biological sample into the microfluidic well (or any other partitioned receptacle) where dPCR is performed.
[0116] In a specific embodiment, step e) of the method of the present invention further comprises determining a value "N1" corresponding to the total number of partitions having a fluorescence signal above the positive threshold for only one fluorophore type. This value N1 can be determined in two different situations:
[0117] 1) When an abundant sequence (eg, WT) is detected in a single color (see detailed description of this embodiment and Example 4 below).
[0118] In this first case, N1 should be used as "N i ” is included in the calculation of the concentration of the abundant sequence in the sample.
[0119] 2) When the sequence is not detected in a single color in the assay.
[0120] In this second case, N1 can be included in the sample TS i In the calculation of the concentration of , and in the analysis it is considered a "negative partition" (as the value "N0"). In this latter case, for each target sequence i, the concentration C can be calculated using the following equation i :
[0121]
[0122] where v is the partition (eg, droplet) volume, which is assumed to be constant, and d is the dilution factor used to dilute the sample from the biological sample into the microfluidic well (or any other partitioned receptacle) where dPCR is performed.
[0123] In another embodiment, N1 is excluded from the analysis and is considered an "artificial partition" or "noise partition". In this case, for each target sequence i, the concentration C can be calculated using the following equation: i :
[0124]
[0125] More generally, step e) of the method of the invention may comprise determining a value "N j ”, where j is from 1 to k i Integer between (1 <j<k i), which corresponds to the total number of partitions with fluorescence signals above the positive threshold for j fluorophore types. If no sequence is detected in the assay in j colors, then N j TS can be included in the sample i In the calculation of the concentration, it is considered as a "negative partition" in the analysis (as the value "N0"). In this latter case, for each target sequence i, the concentration C can be calculated using the following equation i :
[0126]
[0127] where v is the partition (eg, droplet) volume, which is assumed to be constant, and d is the dilution factor used to dilute the sample from the biological sample into the microfluidic well (or any other partitioned receptacle) where dPCR is performed.
[0128] Alternatively, N j Exclude from analysis and consider it as an “artificial partition” or “noise partition”. In this case, for each target sequence i, the concentration C can be calculated using the following equation i :
[0129]
[0130] For a dPCR experiment using color coding and having n different fluorescence detection channels (thus having a maximum of M ≤ n different fluorophore types), the number of different targets that can be independently measured using the color combination method according to the present invention will be given by the following equation, where k represents the number of fluorophore types used to encode each target:
[0131]
[0132] For example, using a dPCR instrument equipped with 6 different detection channels, when the color combination method of the present invention uses k=2 different fluorophore types for each target, the total number of different targets that can be detected and quantified will be 15 And if the present invention uses k=3 different fluorophore types for each target, the total number of different targets that can be detected and quantified will be 20
[0133] If the dPCR instrument is equipped with 7 different detection channels, the total number of different targets that can be detected and quantified will be 21 when the color combination method of the present invention uses k=2 different fluorophore types for each target. And if the present invention uses k=3 different fluorophore types for each target, the total number of different targets that can be detected and quantified will be 35
[0134] Thus, the method of the present invention is capable of detecting and / or quantifying the presence of at least 10, preferably at least 15, more preferably at least 20, even more preferably at least 30 different TS in a biological sample.
[0135] In certain embodiments, the methods of the present invention are also capable of detecting and / or quantifying another set of target sequences (referred to herein as TS e ), this time we use the "one color one sequence" method, that is, each TS e Characterized (encoded) by only one fluorophore type.
[0136] Two cases are then distinguished: that only one fluorophore type is also used to characterize the set TSi (ie it is used in the color combination method according to the invention); or that only one fluorophore type is not used to characterize the set TSi.
[0137] In the first case, step a) of the method of the invention uses k i different fluorophore types to detect at least five target sequences TSi of the first group, and the k i One and only one of the fluorophore types is also used to detect another target sequence TS e , the TS e Characterized by only one fluorophore type. In other words, in this embodiment, one fluorophore type is used in combination with multiple other fluorophore types to detect one or more TSi and to detect the sequence TS in a single color. e .
[0138] In this case, the method of the present invention is capable of detecting and / or quantifying at least five different nucleic acid target sequences (TSi) and one nucleic acid target sequence (TSi) in a biological sample comprising nucleic acid molecules. e ) exists, and comprises the following steps:
[0139] a) contacting the sample with a probe carrying a fluorophore capable of binding directly or indirectly to TS; wherein each of the at least five target sequences i (TSi) is represented by k i Characterization of different fluorophore types, k i is greater than or equal to 2, and wherein the sequence TS e characterized by only one fluorophore type, wherein this fluorophore type is one of the fluorophore types used to detect at least one TSi;
[0140] b) separating the sample into a set of partitions;
[0141] c) exponentially amplifying the TS in the presence of a PCR reaction mixture;
[0142] d) for each partition, measuring the fluorescence intensity of each fluorophore type;
[0143] e) For each fluorophore type, count the following:
[0144] - partitions where the fluorescence signal is below the positive threshold for said fluorophore type,
[0145] - partitions having a fluorescence signal above said positive threshold for said fluorophore type,
[0146] Thus determining:
[0147] N0 = the total number of partitions with fluorescence signals below the positive threshold for all fluorophore types,
[0148] N i = Fluorescence signal is higher than that of TSi alone i The total number of partitions with positive thresholds for each fluorophore type, N e = Fluorescence signal higher than that used only to characterize TS e The total number of partitions with a positive threshold for the fluorophore type,
[0149] f) processing the data collected in step e) to quantify the at least five TSi and the TS e concentration.
[0150] In this embodiment, only fluorescence signals above at most k i species (and no more than k i The partitioning of the positive threshold of the fluorophore type should be considered in the method of the present invention. i +1 kind (or k i +2 etc.) fluorophore types should not be considered in the method of the present invention. For example, if each target sequence TSi is represented by k i = 3 fluorophore types, then partitions with fluorescence signals above the positive threshold for 4, 5, etc. fluorophore types should not be considered in the method of the present invention.
[0151] In this embodiment, the amount of
[0152] -TS e The concentration of , by using the following equation:
[0153]
[0154] -TSi concentration, which is used to characterize TS e The fluorophore (and k-1 other fluorophores) is characterized by using the following equation:
[0155]
[0156] -TSi concentration, which is used to characterize TS e Characterize a fluorophore other than a fluorophore by using the following equation:
[0157]
[0158] where v is the partition (e.g., droplet) volume, which is assumed to be constant, and d is the dilution factor used to dilute the biological sample into the microfluidic well (or any other partitioned receptacle) where dPCR is performed.
[0159] In the second case, the method of the invention is able to detect and / or quantify the presence of two different groups of TS in a biological sample comprising nucleic acid molecules:
[0160] - a set of at least five TSi according to the color combination method of the invention, as defined above and below,
[0161] - Contains one or more target sequences TS characterized by the type of fluorophore e For a group of TS, the fluorophore type was not used to characterize the group of TSi.
[0162] In this case, step a) of the process of the invention is defined as:
[0163] a) contacting the sample with a probe carrying a fluorophore that can bind directly or indirectly to two sets of TS; wherein for the first set of target sequences, each target sequence i (TSi) is represented by k i Characterization of different fluorophore types, k i greater than or equal to 2, and wherein the second set of target sequences is characterized by other fluorophore types not used to characterize the first subset of TSi;
[0164] The other steps of the method of the present invention remain unchanged.
[0165] In particular, C i The calculation takes into account the value N defined above i and N o , and the formula:
[0166]
[0167] where v is the partition (e.g., droplet) volume, which is assumed to be constant, and d is the dilution factor used to dilute the biological sample into the microfluidic well (or any other partitioned receptacle) where dPCR is performed.
[0168] One of the first steps of the method of the invention consists in bringing the sample into contact with a probe carrying a fluorophore capable of binding directly or indirectly to the TS.
[0169] One skilled in the art can use any probe that can be coupled to a fluorophore and binds to the TS directly or through another molecule (usually unlabeled, such as a mediating probe).
[0170] Examples of fluorophore-carrying probes that can directly bind to TS are probe.
[0171] Examples of probes carrying fluorophores that can indirectly bind to TS are molecular beacons or complementary single-stranded fluorescent reporters (CSSFRs) described herein. These reporter molecules are typically associated with mediating probes that can directly bind to TS. The mediating probes can also be bound to reporter molecules.
[0172] The color combination analysis of the present invention can use a variety of detection systems. In particular, the following direct probes and indirect probes can be used.
[0173] probe
[0174] As used herein, “ The probe consists of an oligonucleotide sequence, referred to as the "probe sequence" or "target sequence," to which a fluorophore moiety and a quencher are covalently attached. Typically, the fluorophore moiety is attached to the 5' end of the probe and the quencher is covalently attached to the 3' end of the probe.
[0175] Each The probe consists of a sequence complementary to the target sequence, one type of fluorophore, and one type of quencher. The probe types will differ at least in the target sequence or the type of fluorophore used.
[0176] In one embodiment, the data of the method of the present invention is obtained using at least two, four, six, eight, ten or twenty Probes are generated, each carrying a different fluorophore type, the combination of which will characterize the target sequence in a unique way.
[0177] The color combination method of the present invention requires the use of two or more different For each target sequence, two or more different probes are used. The probes must have different fluorophore types and may have different nucleotide sequences or quenchers.
[0178] For a given target, when two or more different In the case where the probes have different and non-overlapping nucleotide sequences, the The probes are said to be "non-competitive". In the case where the probes share the same nucleotide sequence, the The probe is said to be "competitive".
[0179] In a particularly preferred embodiment, the method of the present invention uses at least two competing Probes, i.e., at least two probes carrying different fluorophore types and containing the same nucleotide sequence complementary to the same target sequence probe.
[0180] When using "competitive" When using two competing probes, the concentrations of the two probes in the reaction mixture may need to be adjusted so that both probes are cleaved at similar rates during PCR. In fact, if the two probes are at equal concentrations, and if a competing The probe preferentially binds to the target sequence during PCR. The probe will be preferentially cleaved in each cycle of the PCR reaction. This may result in only "more preferential" The increased fluorescence level of one probe masks the signal of the other probe. By decreasing the concentration of the "more preferred" probe relative to the "other probe," the effective binding efficiency of the two probes can be balanced in each PCR cycle. As a result, the fluorescence levels of both fluorescent probe types can be detected.
[0181] In one embodiment of the present invention, competitive Probe color combination involves, in a first step, designing an assay with a single target sequence rather than multiple target sequences. This first step is used to check whether the fluorescent signal of the positive partition is sufficiently separated from the fluorescent signal of the negative partition for the two colors encoding the single target sequence. This verification is performed using fluorescent probe types separately or using a mixture of the two fluorescent probe types. If, when using a mixture of the two fluorescent probe types, at least one of the two fluorescent signals of the two colors encoding the single target sequence is not sufficiently separated, the probe concentrations in the color mixture can be adjusted so that the fluorescent signals of the two fluorescent probe types used in encoding the single target sequence are sufficiently separated.
[0182] Example 1 below discloses how to use such probe.
[0183] Other direct probes
[0184] Alternative direct probes have been described in the art and can be used in conjunction with the methods of the present invention. Probe combination or substitution Probe use. For example, molecular beacon hybridization probes or probe pairs can be used, as disclosed by Marras S. et al. (2019). In addition, the so-called "yin-yang" probes disclosed by Li Q. et al. (2022) can be used. These probes are double-stranded probes consisting of two long complementary oligonucleotides that specifically hybridize to the target sequence. The positive strand is labeled with a fluorophore and the negative strand is labeled with a quencher. In the presence of the target sequence, the negative strand is replaced by the target and the fluorophore emits fluorescence. Therefore, these double-stranded probes interact directly with the target and do not include a complementary label sequence that mediates the interaction with the probe described below.
[0185] Mediating probe
[0186] In other embodiments, instead of Probes, data from the methods of the present invention are generated by using probes carrying fluorophores that indirectly detect target sequences. In this embodiment, the probes carrying fluorophores are referred to as "fluorescent detection molecules." These molecules themselves do not bind to the target sequence. However, they contain tag-complementary sequences that are complementary to sequences present on mediating probes, which are capable of directly binding to TS. Therefore, such embodiments relate to mediating probes that are capable of directly binding to target sequences.
[0187] In the methods of the present invention, either competitive mediating probes or non-competitive mediating probes can be used.
[0188] In a particularly preferred embodiment, the method of the present invention uses at least two competitive mediating probes, ie, at least two mediating probes carrying different fluorophore types and containing the same nucleotide sequence complementary to the same target sequence.
[0189] In the methods of the present invention, for a given target, two or more "non-competitive" intervening probes may also be used, wherein the intervening probes have different (overlapping or non-overlapping) nucleotide sequences that are complementary to the target sequence.
[0190] In a specific embodiment, for each target sequence TS i , design a group of at least two mediating probe types and at least two fluorescent detection molecules.
[0191] In the "color combination" approach of the present invention, each fluorescent detection molecule is associated with a different fluorophore type, so that each target sequence is preferably associated with at least two fluorophore types.
[0192] More specifically, for each target sequence TS i , the set contains at least two mediator probes, each mediator probe containing:
[0193] ○3' end probe region, which is closely related to the target sequence TS i complementary;
[0194] ○5' end mediating region, which contains at least one tag sequence;
[0195] o A biological cleavage site located between the mediating region and the probe region, allowing an enzyme with exonuclease or endonuclease activity to mediate cleavage of both regions during target sequence amplification.
[0196] In each group, at least two mediator probes have 3' end probe regions that are identical to TS i The complementary identical sequences, while the 5' end mediating regions of at least two mediating probes contain different tag sequences, which can activate different signals after being cleaved (for example, binding to different probes carrying fluorophores).
[0197] And, for each target sequence TS i , the group contains at least two fluorescent detection molecules, said molecules containing at least:
[0198] o a single sequence (tag-complementary sequence - TCS) that is complementary to and hybridizes to at least one tag sequence (tag) located in the 5'-terminal mediating region of one mediating probe of the set, and
[0199] o a quencher group and a fluorophore whose fluorescence is altered by hybridization or extension of the tag sequence (once cleaved) in the 5'-terminal mediating region to the tag-complementary sequence (TCS) on the detector molecule,
[0200] In each group, at least two fluorescent detection molecules carry different fluorophore types, so the target sequence TS i Ultimately it will be characterized by at least two different tags, at least two different TCSs, and at least two different fluorophore types.
[0201] Thus, in this preferred embodiment, the mediating probe is capable of binding directly to the TS and, upon binding during the amplification reaction, releases a tag that is complementary to a tag-complementary sequence (TCS) located on a fluorescent detection molecule carrying a quencher group and a fluorophore whose fluorescence is altered by hybridization or extension of the mediating probe's tag sequence (once released) on the TCS on the detection molecule.
[0202] In practice, when a partition contains a target sequence of interest, the PCR reaction will trigger an increase in the fluorescence intensity of at least two fluorophore types carried by the fluorescent detection molecule or "reporter". Based on the measured fluorescence intensity of each fluorophore type, a similar method as described above can be used to probes, classifying each partition as negative or positive.
[0203] Fluorescent reporter
[0204] In the method of the present invention, the fluorescent detection molecule can be any universal reporter classically associated with a mediating probe. In particular, any linear or beacon universal reporter containing a tag-complementary sequence, a fluorophore type, and a quencher can be used. If the fluorescent detection molecule contains a ring, the tag-complementary sequence TCS can be located inside the ring (
[11] ) or outside the ring (see EP2776585).
[0205] In a preferred embodiment, the fluorescent detection molecule used in the method of the present invention is any reporter probe carrying at least one fluorophore type, a quencher and a TCS, such as molecular beacons, Scorpions, HybProbes, Hybeacons, Biomers and any other tool that has been successfully established as a universal reporter (see, for example, https: / / www.biomers.net / en / Products / DNA / Mediator_Probe_PCR.html).
[0206] In particularly preferred embodiments, the fluorescent detection molecule used in the methods of the present invention is a molecular beacon or a complementary single-stranded fluorescent detection reporter (CSSFR) molecule, as will now be described in more detail.
[0207] Molecular beacon molecules
[0208] Molecular beacon molecules are well known in the art. They are described in, for example, EP2776585,
[11] , etc. These molecules are specifically designed to have a nucleotide hairpin structure, coupled to a quencher and a fluorophore type.
[0209] In these reporter molecules, the tag-complementary sequence (TCS) can be present within the hairpin structure or outside the hairpin structure.
[0210] The present inventors have successfully tested the method of the present invention by measuring the concentration of six target sequences using four molecular beacon reporters ( Figure 5-6 , Example 2A). In this example, the TCS is located in the hairpin structure of the molecular beacon ( Figure 5-6 ).
[0211] Complementary single-stranded fluorescent reporter (CSSFR)
[0212] In practice, generating molecular beacons with 3D constraints can be challenging due to their hairpin structure. Furthermore, molecular beacon reporters must be synthesized by grafting a fluorophore type and a quencher onto the same chain, which can be challenging for certain fluorophore types and can be more expensive than reporter molecules containing only a fluorophore or a quencher. For these reasons, the inventors proposed using CSSFR as an alternative mediating probe.
[0213] The complementary single-stranded fluorescent reporter contains the following oligonucleotides (see Figure 7 ):
[0214] - A master reporter oligonucleotide molecule (m-reporter) comprising:
[0215] i) a sequence complementary to the tag sequence carried by the corresponding mediating probe ("tag complementary sequence", TCS), and
[0216] ii) a reporter molecule at its 5′ end, which can be a fluorophore or a quencher group;
[0217] - a complementary reporter oligonucleotide molecule (c-reporter) comprising:
[0218] i) a sequence complementary to the 5' end sequence of the m-reporter;
[0219] ii) a reporter molecule at its 3' end or 5' end, which can be a fluorophore group (if the m-reporter has a quencher group) or a quencher group (if the m-reporter has a fluorophore group).
[0220] In another embodiment, the c-reporter can be modified at both the 3' and 5' ends to add a quencher and a fluorophore group, or two fluorophore groups, or two quencher groups.
[0221] In this system, the fluorescence of the fluorophore group changes upon hybridization or extension of the tag sequence in the 5'-terminal mediator region to the tag-complementary sequence (TCS) on the m-reporter once cleaved from the mediator probe.
[0222] These complexes are described in more detail below.
[0223] The inventors successfully tested the method of the present invention by measuring the concentration of six target sequences using four CSSFR molecules ( Figure 7 , Example 2B).
[0224] Use common reporters, especially CSSFR instead of Probes offer several advantages:
[0225] First, only a small number of universal reporters are needed to implement a "color combination" multiplexing approach. When using M detection channels, only M universal reporters are needed to achieve color combination. This is independent of the number of fluorophore types combined for each target sequence.
[0226] For example, using six detection channels and two fluorophore types per target sequence, only six CSSFR types are needed to detect up to 15 different targets. Furthermore, for each target sequence, only two different mediator probes need to be designed, each probe binding to a different CSSFR.
[0227] By using the following 6 CSSFR molecules:
[0228] ○CSSFR#1-FAM: Contains TCS#1 and fluorophore type FAM
[0229] ○CSSFR#2-YY: Contains TCS#2 and fluorophore type YY
[0230] ○CSSFR#3-ATTO550: Contains TCS#3 and fluorophore type ATTO550
[0231] ○CSSFR#4-ROX: Contains TCS#4 and fluorophore type ROX
[0232] ○CSSFR#5-Cy5: Contains TCS#5 and fluorophore type Cy5
[0233] ○CSSFR#6-ATTO700: Contains TCS#6 and fluorophore type ATTO700
[0234] If the target sequence TS1 is detected using:
[0235] ○ Mediator probe #1: contains TS1-specific sequence + tag #1 (trigger CSSFR #1)
[0236] ○ Mediator probe #2: contains the same TS1-specific sequence as #1 + tag #2 (trigger CSSFR #2)
[0237] If the target sequence TS2 is detected using:
[0238] ○ Mediator probe #3: contains TS2-specific sequence + tag #1 (trigger CSSFR #1)
[0239] ○ Mediator probe #4: contains the same TS2-specific sequence as #3 + tag #3 (trigger CSSFR #3)
[0240] If the target sequence TS3 is detected using:
[0241] ○ Mediator probe #5: contains TS3 specific sequence + tag #1 (trigger CSSFR #1)
[0242] ○ Mediator probe #6: contains the same TS3-specific sequence as #5 + tag #4 (trigger CSSFR #4)
[0243] If the target sequence TS4 is detected using:
[0244] ○ Mediator probe #7: contains TS4-specific sequence + tag #1 (trigger CSSFR #1)
[0245] ○ Mediator probe #8: Contains the same TS4-specific sequence as #7 + tag #5 (trigger CSSFR #5)
[0246] ○…
[0247] The table below compares the number of detection channels required to achieve a given multiplexing level using a color combination of 2 colors per target sequence. The number of probe types and the number of CSSFR types.
[0248]
[0249]
[0250] Use generic reporters instead of Another advantage of the probes is that they shorten the assay development time and reduce costs. In fact, compared to unmodified oligonucleotide sequences such as PCR primers or mediating probes, fluorescently labeled oligonucleotides (such as PCR primers or fluorescent reporter molecules) typically take longer to manufacture. Typically, PCR primers or mediator probes can be ordered and delivered within a week, while fluorescently labeled oligonucleotides can take over a month to ship from standard oligonucleotide manufacturers. Similarly, the cost of fluorescently labeled oligonucleotides is typically 5 to 10 times that of equivalent primer sequences. Therefore, the fewer fluorescently labeled molecules required, the better the cost and development time.
[0251] Another advantage of using universal reporters is that the same reporter can be used in multiple assays targeting different types of sequences or mutations. These assays differ from one another in the type of mediator probes, which have different 3' target-specific sequences but share the same set of reporter tag sequences. By sharing reporters across different assays, the reporter fluorescently labeled oligonucleotides can be ordered in bulk, further reducing costs through economies of scale.
[0252] Finally, with the Another advantage of the universal reporter approach in “color panel” multiplexing is that the optimization of reporter ratios and compensation matrices only needs to be done once and does not need to be changed during assay development and mediating probe sequence optimization. As discussed in the probe section, two competing The concentration ratio between probes needs to be adjusted for each probe sequence. Therefore, this ratio may need to be adjusted each time the probe sequence is changed during assay development. Changes in probe sequence may also result in modifications to the compensation matrix, which then require readjustment during assay development. Such adjustments require the collection of additional experimental data and can be cumbersome when using more than three detection channels. In contrast, when using reporters for "color combinations" according to the present invention, the sequence does not change during assay development. Assay development typically involves optimization of primers and target-specific mediating probe sequences, neither of which are fluorescently labeled.
[0253] PCR method using CSSFR reporter
[0254] In a second aspect (which can be combined with the first aspect or considered alone), the present invention also relates to an in vitro PCR method for detecting and / or quantifying the presence of at least one (preferably at least three, more preferably at least five) nucleic acid target sequences (TSi) in a biological sample containing nucleic acid molecules, the method comprising:
[0255] A) For each TSi, the sample is exposed to a panel consisting of:
[0256] i) at least one mediating probe comprising:
[0257] - a 3' terminal probe region complementary to said target sequence (TSi),
[0258] - a 5' end mediating region containing a tag sequence, and
[0259] a biological cleavage site located between the mediating region and the probe region, such that an enzyme with nuclease activity can mediate cleavage of both regions during amplification of the nucleic acid target sequence (TSi), and
[0260] ii) at least one complementary single-stranded fluorescent reporter (CSSFR) complex of the present invention,
[0261] B) amplifying the at least one nucleic acid target in the presence of an enzyme having nuclease activity, thereby separating the 5'-terminal mediating region of the mediating probe at the cleavage site when the 3'-terminal probe region hybridizes with its complementary target sequence, so that the tag sequence contained in the cleaved 5'-terminal mediating region of the mediating probe hybridizes with the tag complementary sequence TCS present on the CSSFR molecule, thereby stimulating the fluorophore present in the sample to detect a change in the signal emitted by the fluorophore;
[0262] C) detecting or measuring the fluorescence intensity of each fluorophore group,
[0263] D) Optionally, processing the data collected in step C) to quantify the concentration of at least one TSi in the biological sample.
[0264] The 3'-terminal probe region complementary to the target sequence typically contains 13 to 30 nucleotides, preferably 15 to 25 nucleotides. Furthermore, the 3' end of the mediating probe can be blocked with a phosphate group or other conventional blocking agents (C3 / C6 spacers, dideoxynucleotides, phosphates, reverse bases, 3' amino groups) to prevent any unwanted amplification of this side of the molecule. This blocking step is recommended by many oligonucleotide manufacturers; see, for example, https: / / www.biomers.net / en / Products / DNA / Real-time_PCR / PCR_Blocker.html.
[0265] Preferably, the cleavage site between the 5' end mediating region and the 3' probe region is located just after the first hybridizing base of the 3' probe region, as proposed in
[15] .
[0266] As used herein, the term "CSSFR complex" of the present invention refers to a bimolecular nucleotide complex comprising:
[0267] - a master reporter oligonucleotide molecule (m-reporter), comprising at least one sequence complementary to the tag sequence ("tag complementary sequence", TCS) carried by the mediating probe of the group associated with the TSi, and a reporter molecule at its 5' end, which reporter molecule can be a fluorophore or a quencher group;
[0268] - a complementary reporter oligonucleotide molecule (c-reporter) containing a sequence complementary to the 5' end sequence of the m-reporter at its 3' end and / or 5' end and / or between its 3' end and 5' end, and:
[0269] o If the m-reporter has a quencher group, then contains a fluorophore group, or at least one fluorophore group, or
[0270] ○ If the m-reporter has a fluorophore group, it contains a quencher group,
[0271] The fluorescence of the fluorophore of the c-reporter or m-reporter molecule is altered by hybridization or extension of the associated tag sequence of the 5'-terminal mediating region (once cleaved from the mediating probe) to the tag complementary sequence (TCS) on the m-reporter.
[0272] The m-reporter molecule in the CSSFR complex is a linear nucleotide molecule containing at least 30 nucleotides. More specifically, it generally contains 30 to 80 nucleotides, preferably 40 to 50 nucleotides.
[0273] The m-reporter molecules in the CSSFR reporter of the present invention contain at least one, preferably at least two, and more preferably three or more tag-complementary sequences (TCSs), which are partially or completely complementary to the tag sequences on the corresponding mediating probes. In the context of the present invention, these tag-complementary sequences (TCSs) should be relatively short, i.e., typically containing 8 to 25 nucleotides, preferably 8 to 18 nucleotides, more preferably 10 to 16 nucleotides, and even more preferably 12 to 14 nucleotides. As described above, these TCSs are oligonucleotides having a sequence identical to the sequence of at least one tag contained in at least one mediating probe in the set.
[0274] The 3' end of the m-reporter molecule is preferably blocked by a phosphate group or other conventional blockers (C3 / C6 spacer, dideoxynucleotide, phosphate, inverted base, 3' amino group) to avoid any unwanted amplification on this side.
[0275] The c-reporter molecule in the CSSFR complex of the present invention is relatively short, typically comprising 8 to 25 nucleotides, preferably 8 to 18 nucleotides, more preferably 10 to 16 nucleotides, and even more preferably 12 to 14 nucleotides.
[0276] When carrying a quencher compatible with multiple fluorophores, a c-reporter molecule can be used in a CSSFR complex containing different m-reporter molecules. For example, the quencher BHQ1 can be used to quench blue and till fluorophores, so a c-reporter carrying BHQ1 can be used to hybridize with an m-reporter carrying blue and till fluorophores (see Example 2).
[0277] In the reporter complex, the m-reporter molecule preferably contains at least two different tag-complementary sequences (TCS), preferably a large number of such sequences, as disclosed in
[16] .
[0278] In the reporter complex, the complementary reporter oligonucleotide molecule (c-reporter) is shorter in size, typically comprising 8 to 25 nucleotides, preferably 8 to 18 nucleotides, more preferably 10 to 16 nucleotides, even more preferably 12 to 14 nucleotides (typically 15 to 20 nucleotides), preferably about 18 nucleotides.
[0279] The method of the present invention is preferably a multiplexed method capable of detecting and / or quantifying the presence of at least two, at least three, at least four, at least five, and more preferably at least ten nucleic acid target sequences (TSi) in a sample of interest. More preferably, it is a multiplex digital PCR (dPCR) method. Even more preferably, it is a multiplex digital PCR method as described in the first aspect.
[0280] In this approach, a single color label can be used and multiple target sequences can be distinguished by measuring different intensity levels of that color (such intensity-based multiplexing methods are known in the art, see for example
[17] ).
[0281] However, preferably, the methods of the present invention utilize at least two-color labeling for some (when not all) target sequences. In other words, the methods of the present invention preferably involve the use of at least two differently labeled reporter complexes for at least one TSi of the plurality of target sequences whose presence is detected by the methods of the present invention (without excluding the case where only a single color is used for some other TSi).
[0282] In the methods of the present invention, each TSi can be characterized by a specific fluorophore or combination of fluorophores that is different from the fluorophores or combinations of fluorophores of the other target sequences.
[0283] In any case, when the target sequence is characterized by two or more fluorophores, in the method of the invention, groups associated with different target sequences TSi and TSj can be used, these groups containing CSSFR complexes carrying the same fluorophore group, or even the same CSSFR complex.
[0284] By the method of the invention, for example six TSi can be detected using four differently labeled CSSFR complexes whose m-reporter master molecules carry two different TCSs (see Example 2B.1).
[0285] By the method of the invention, for example 12 or 15 TSi can be detected using six CSSFR molecules carrying different TCSs and six different fluorophores (see Examples 2B.2. and 2B.3.).
[0286] As shown in Example 5, in the method of the present invention, it is advantageous to adjust the concentration of the main reporter oligonucleotide molecule (m-reporter) in the reporter complex so that the concentration is finally between 0.05 and 2 μM, preferably between 0.1 and 0.5 μM, and more preferably between 0.1 and 0.25 μM.
[0287] In addition, for each target sequence TSi, the tag sequence is designed so that the melting temperature T of the tag sequence TAGi hybridized on the corresponding TCSi of the CSSFR molecule is M Ultimately lower than the T of the 3' end probe region of the mediating probe hybridized on the target sequence TSi M Preferably, the hybrid T M T should be compared to [mediating probe / TSi] hybridization M It is 3°C or more lower, preferably 5°C or more lower, and more preferably 10°C or more lower.
[0288] Methods involving using 2 different labels per TSi
[0289] In a first embodiment, the method of the present invention involves the use of at least two mediating probes and at least two reporter complexes for one target sequence to be detected. In this embodiment, the TS to be detected is characterized by a unique combination of at least two different fluorophore types, preferably exactly two fluorophore types.
[0290] In this case, if Figure 17 As shown in A, for at least one (preferably each) TSi of a plurality of target sequences, the set may thus contain:
[0291] - at least two mediating probes as defined above, each probe comprising a 3'-terminal probe region complementary to the target sequence TSi and a 5'-terminal mediating region comprising a tag sequence, wherein the tag sequences of the at least two mediating probes are different and are complementary to and hybridize to at least one TCS of at least one reporter complex in the set, and
[0292] - at least two reporter complexes as defined above, wherein each m-reporter molecule contains one or more different tag-complementary sequences (TCS) that are complementary to and hybridize to a tag sequence located in the 5'-terminal mediating region of one of the at least two mediating probes in the set,
[0293] Each of the at least two reporter complexes is differently labeled such that the at least one (preferably each) TSi is represented by k i Characterization of different fluorophore types, k i Greater than or equal to 2.
[0294] Preferably, at least one of the reporter complexes in the set contains at least two or more different tag-complementary sequences (TCS) that are complementary to and hybridize with at least two or more different tag sequences located in the 5'-terminal mediating regions of at least two or more mediating probes that are specific for two or more different target sequences. Figure 17 Highlighted in B. The presence of multiple TCSs on reporter molecules has also been described in the art (
[16] ).
[0295] In a specific embodiment, the method of the present invention is used to detect at least two target sequences TSi and TSj, wherein:
[0296] -TSi group contains:
[0297] ○ Two mediating probes as defined above, whose 3' portions are specific for the target sequence TSi and whose 5' portions contain the first tag sequence TAGi1 or the second tag sequence TAGi2, respectively,
[0298] o two CSSFR complexes as defined above, each containing a TCS specific for TAGi1 or TAGi2, respectively, said complexes being differently labeled,
[0299] And among them:
[0300] -TSj group contains:
[0301] ○ Two mediating probes as defined above, whose 3' portions are specific for the target sequence TSj and whose 5' portions contain the first tag sequence TAGj1 or the second tag sequence TAGj2, respectively,
[0302] o Two CSSFR complexes as defined above, each complex containing a TCS specific for TAGj1 and for TAGj2, said complexes being differently labeled.
[0303] In this method, one of the two tags, TAGi and TAGj, can be completely or partially identical if the two target sequences, TSi and TSj, share a common fluorophore. However, in this case, the other TAGi or TAGj must be different. In other words, all TAGi and TAGj cannot have the same nucleotide sequence.
[0304] In this particular embodiment, both groups specific for two different target sequences TSi and TSj contain at least one CSSFR complex carrying the same fluorophore group. Figure 17 Highlighted in B.
[0305] In other words, two groups specific for two different target sequences TSi and TSj may contain at least one common CSSFR complex. Figure 17 Highlighted in B.
[0306] In a preferred embodiment, the set used in the method of the invention contains at least two reporter complexes as defined above for each TSi, each of the at least two reporter complexes being differently labeled, such that each TSi consists of k i Characterization of different fluorophore types, k i Greater than or equal to 2.
[0307] In another preferred embodiment, the set used in the method of the invention contains at least two reporter complexes as defined above for certain TSi, each of the at least two reporter complexes being differently labeled, such that each TSi is represented by k i Characterization of different fluorophore types, k iis greater than or equal to 2, and for certain TSj contains only one reporter complex as defined above, such that said TSj is detected in only one color.
[0308] Methods involving the use of one label per TSi
[0309] In a second embodiment, the method of the present invention involves the use of only one mediating probe to detect a specific TSi. In this case, the mediating probe contains a tag capable of hybridizing to TCS present on at least two differently labeled CSSFR reporters, thereby ultimately detecting TSi by color combination.
[0310] In this case, the method of the invention involves, for at least one (preferably each) TSi of a plurality of target sequences, a set comprising:
[0311] i) a mediating probe as defined above, comprising a 3' terminal probe region complementary to the target sequence TSi and a 5' terminal mediating region comprising a tag sequence, and
[0312] ii) at least two reporter complexes as defined above, wherein each m-reporter molecule contains the same tag-complementary sequence (TCS) that is complementary to and hybridizes to a tag sequence located in the 5'-terminal mediating region of the mediating probe of the set,
[0313] Each of the at least two reporter complexes is differently labeled such that the at least one (preferably each) TSi is represented by k i Characterization of different fluorophore types, k i Greater than or equal to 2.
[0314] This embodiment is as Figure 18 As shown in A.
[0315] In this method, at least one (preferably each) of the m-reporter molecules contained in the at least two reporter complexes associated with each TSi may contain at least two or more different tag complementary sequences (TCSs) that are complementary to and hybridize with at least two or more different tag sequences located in the 5'-terminal mediating regions of at least two or more mediating probes specific for two or more different target sequences. Figure 18 This is explained in B. The presence of multiple TCSs on reporter molecules has also been described in the art (
[16] ).
[0316] In this context, the method of the invention aimed at detecting at least two target sequences TSi and TSj may therefore involve:
[0317] -Groups containing:
[0318] ○ 1 mediating probe, whose 3' part is specific to the target sequence TSi and whose 5' part contains the tag sequence TAGi,
[0319] o 2 CSSFR complexes, each containing a TCS specific for TAGi, said complexes being differently labeled,
[0320] as well as:
[0321] -Groups containing:
[0322] ○ 1 mediating probe, whose 3' part is specific for the target sequence TSj and whose 5' part contains the tag sequence TAGj,
[0323] o Two CSSFR complexes, each containing a TCS specific for TAGj, which are differently labeled.
[0324] In a particular embodiment of the method of the invention, the two groups specific for two different target sequences TSi and TSj contain at least one CSSFR complex carrying the same fluorophore group.
[0325] In other words, two groups specific for two different target sequences TSi and TSj may contain one or more common CSSFR complexes.
[0326] The method of the present invention can be carried out using a set designed according to the two specific embodiments described above, namely by using:
[0327] - A set for detecting a target sequence TSi, comprising:
[0328] ○ 1 mediating probe, whose 3' part is specific to the target sequence TSi and whose 5' part contains the tag sequence TAGi,
[0329] o two CSSFR complexes as defined above, each complex containing a TCS specific for TAGi, said complexes being differently labeled,
[0330] And, in the same method:
[0331] - A set for detecting a target sequence TSj, comprising:
[0332] ○ Two mediating probes, whose 3' part is specific to the target sequence TSj, and whose 5' part contains the first tag sequence TAGj1 or the second tag sequence TAGj2, respectively,
[0333] o Two CSSFR complexes as defined above, each complex containing a TCS specific for TAGj1 and for TAGj2, said complexes being differently labeled.
[0334] Detect TSi with only one color
[0335] In some cases (see below for WT sequences), it may be useful and preferred to detect a specific target sequence with only one color. The methods of the present invention also encompass this situation and may involve using a mediating probe specific for only one CSSFR to detect a specific TSi.
[0336] Therefore, in a preferred embodiment of the method of the present invention (e.g. Figure 7 ), at least one TSi may be detected using a group comprising:
[0337] o only one mediating probe as defined above, the 3' portion of which is specific for the target sequence TSi and the 5' portion of which contains TAGi,
[0338] o Only one CSSFR complex as defined above, containing a TCS specific for TAGi and a fluorophore group,
[0339] This allows the TSi to be detected using only one color.
[0340] like Figure 17 As proposed by C, when the method of the present invention is used to detect at least two target sequences TSi and TSj, it may involve, for example:
[0341] - A panel for detecting TSi, comprising:
[0342] ○ Two mediating probes as defined above, whose 3' portions are specific for the target sequence TSi and whose 5' portions contain the first tag sequence TAGi1 or the second tag sequence TAGi2, respectively,
[0343] o two CSSFR complexes as defined above, each complex containing a TCS specific for TAGi1 or for TAGi2, respectively, said complexes being differently labeled,
[0344] as well as:
[0345] - A group for TSj containing:
[0346] o only one mediating probe as defined above, the 3' portion of which is specific for the target sequence TSj and the 5' portion of which contains TAGj,
[0347] o Only one CSSFR complex as defined above, containing a TCS specific for TAGj and a fluorophore group,
[0348] Thus, the TSj can be detected using only one color.
[0349] Alternatively, and as Figure 18 As proposed by C, when the method of the present invention is used to detect at least two target sequences TSi and TSj, it may involve:
[0350] - A panel for detecting TSi, comprising:
[0351] o Only one mediating probe, whose 3' portion is specific for the target sequence TSi and whose 5' portion contains TAGj,
[0352] ○ Only one CSSFR complex containing TCS specific for TAGi and a fluorophore group,
[0353] So that the TSi can be detected with only one color,
[0354] and a panel for detecting TSj, comprising:
[0355] ○ 1 mediating probe, whose 3' part is specific to the target sequence TSi and whose 5' part contains the tag sequence TAGi,
[0356] o Two CSSFR complexes, each containing a TCS specific for TAGi, which are differently labeled.
[0357] In a preferred embodiment, the method of the second aspect, using the CSSFR reporter of the invention, comprises the same steps and embodiments as the color combination method of the invention (particularly the thresholding steps and calculations), as disclosed in the first aspect of the invention.
[0358] WT enriched in its own channel, one color only
[0359] As will be further detailed in the statistics section below, in certain embodiments, the present invention provides that a given first target sequence (typically, the abundant target species is wild type) that is significantly more abundant than the abundance of other target species in the sample being analyzed is color-coded using a first set of fluorophore types, while all other target sequences are color-coded using two or more fluorophore types, each selected from a second set of fluorophore types, all of which are different from the first set.
[0360] Thus, in preferred embodiments of the invention, no more than one fluorophore type is used for the most abundant target sequence in a sample (typically, the abundant target sequence is wild type).
[0361] In this case, since unique fluorophores will be associated with specific sequences of interest, there will be n-1 types of fluorophores remaining for detecting other target sequences. For example, if the number of fluorescence detection channels n of the dPCR instrument is 6, the method of the present invention will be performed by assigning a specific fluorophore to each TS i Assign a unique combination of two of the five fluorophore types to detect in addition to the WT sequence Different TS i If the number n of fluorescence detection channels of the dPCR instrument is 7, the method of the present invention will be as follows: i Assign a unique combination of two of the six fluorophore types to detect in addition to the WT sequence Different TS i .
[0362] Embodiment using large Stokes shift dyes
[0363] In the prior art methods for detecting fluorescent dyes used in digital PCR methods, fluorophores are assigned to "channels," which actually correspond to excitation sources in a fluorescence reader, such as LEDs and filters, coupled to emission filters. These emission / excitation filter pairs are designed based on the emission and excitation spectra of commonly used fluorophores, such as FAM, HEX, ROX, Dye, Atto TM Dye and Yakima Yellow. In the fluorescence reader described in WO2022 / 063845, for example, six pairs of emission LEDs and filters / excitation filters are described, which define six usable channels.
[0364] In embodiments of the present invention, additional encoding channels are provided by using large Stokes shift dyes (LSSDs) and correspondingly decoupling the emission / excitation pairs of the prior art (
[12] ,
[13] ). In other words, while the prior art typically involves channels containing fixed emission / excitation filter pairs, the use of LSSDs in this embodiment of the present invention requires that the fluorescence reader be able to excite the LSSD in a first channel while simultaneously detecting its fluorescence emission in a remote, independent channel. This approach means that the fluorescence detection hardware can select the excitation and emission hardware independently of each other, rather than as a fixed pair.
[0365] In a preferred embodiment of the invention, at least one of the fluorophore types is one of the Large Stokes Shift Dyes (LSSD).
[0366] In this embodiment of the invention, color combinations can therefore be achieved by using one or more LSSDs in combination with fluorophores commonly used in the prior art. Where k is the number of colors used per target and n is the total number of fluorescence detection channels, any increase in n will significantly increase the multiplexing capacity of a given dPCR system. For example, using a dPCR system with 6 channels and using two colors to encode each target allows multiplexing of up to 15 targets; while using a dPCR system with 6 channels and the ability to decouple excitation and emission, adding an LSSD allows multiplexing of up to 21 targets.
[0367] A skilled artisan will know how to select an LSSD for a specific application on a specific system. Factors to consider include the spectral separation of available fluorophores based on their fluorescence properties, and the charge carried by the LSSD molecule, which may interfere with DNA or the chemistry used by a specific dPCR instrument.
[0368] In a non-limiting example, the present inventors have successfully implemented an experimental protocol using the following LSSD:
[0369]
[0370] In the method of the present invention, these LSSD (DyLight TM -LS-515; DyLight TM -LS510; DY-521-XL), and any other oligonucleotide sequence such as Probe-conjugated LSSD.
[0371] In a more preferred embodiment, in the methods of the present invention, no more than one fluorophore type is used for the most abundant species in the sample, and at least one of the fluorophore types is a Large Stokes Shift Dye (LSSD).
[0372] Statistical analysis of the data processing scheme of the present invention
[0373] When using color combination to detect target sequence, the subregion containing multiple targets (encapsulation altogether) is fuzzy, and must be excluded from analysis.For example, mensuration is set to use FAM and Cy3 to detect target 1, uses FAM and Cy5 to detect target 2, and uses Cy3 and Cy5 fluorophores to detect target 3.In this type of example, FAM, Cy3 and Cy5 are had to positive subregion and may be the encapsulation altogether of target sequence 1 and target sequence 2, or the encapsulation altogether of target sequence 1 and target sequence 3, or the encapsulation altogether of target sequence 2 and target sequence 3, or the result of the encapsulation altogether of target sequence 1, target sequence 2 and target sequence 3.Therefore, when subregion is classified as FAM, Cy3 and Cy5 positive in experiment, it is impossible to predict which target sequences are present in this subregion.This type of triple positive subregion is positive, but is fuzzy aspect its content.
[0374] The consequence of removing ambiguous partitions is a loss of sensitivity of the assay.
[0375] The loss in sensitivity is directly proportional to the number of all droplets excluded relative to the maximum number of analyzable droplets.
[0376] Because all partitions that are positive for any other target j are excluded during analysis for a given target i, it can be shown that the loss of sensitivity for that target i is:
[0377]
[0378] Where v is the droplet volume, d is the dilution factor, c k is the concentration of target k, i is the identifier of the target to be studied, and j is the identifier of all other targets.
[0379] In addition, due to the error of digital PCR results (V 分析 ) (see e.g.
[14] ), the measurement error (loss of precision) for a given target i increases
[0380] From the above it can be seen that the loss of sensitivity and precision depends only on experimental factors:
[0381]
[0382] This is Figure 3 This is illustrated in , where theoretical calculations provide the sensitivity of target i as a function of the sum of the concentrations of the other targets in the assay using a Sapphire chip (Stilla Technologies, 1, Mail du Professeur Georges Mathé-94800 Villejuif, France). From this graph, we can see that there is a sharp loss of sensitivity between 100 cp / μL and 1000 cp / μL.
[0383] Indeed, when droplets with more than one target sequence are removed from the analysis, the contents of these droplets are not analyzed. This loss of analyzed droplets directly impacts the sensitivity of the assay. The greater the co-encapsulation, the more sensitivity is affected. Figure 3 The figure shows the encapsulation event model under different background gene concentrations and the effect of background gene concentration level on sensitivity. When the background level is below 100 cp / μl, the sensitivity loss is less than 10%, but as the background level increases, the sensitivity loss increases sharply.
[0384] According to the present invention, when the sample analyzed is a liquid biopsy type, 80% of the samples will have a wild-type ctDNA concentration in the PCR mixture below 200 cp / μL, while the mutant ctDNA concentration will be 10-fold lower. Therefore, according to the present invention, when using a color combination to detect wild-type DNA, a sensitivity loss of up to 20% is expected in 80% of cases. For this reason, the color combination method according to the present invention excels in applications such as detection of rare events, where the expected concentration is low, resulting in only a small loss of sensitivity.
[0385] The color combination according to the present invention also performs well when detecting only one target in a given sample, i.e. when the presence of a given target is most often associated with the absence of all other targets. In fact, in this case, ∑ j≠i vc j =0, and there is no sensitivity loss.
[0386] Calculation of relative sensitivity of the method of the present invention in determining mutant allele fraction
[0387] The color combination method of the present invention has an impact on the absolute sensitivity of the assay. Assuming the assay and digital PCR system have perfect analytical sensitivity, i.e., if a detectable target is present in a partition, the partition will always be called positive, then the limit of detection (LOD) at a 95% confidence level for the assay performed using the color combination method for each target i will be:
[0388]
[0389] where V0 is the volume of all partitions in the digital PCR experiment.
[0390] This means that if the volume under analysis If the average target concentration is at least greater than 3 copies, at least one positive partition is detected with 95% confidence and the sample is called "positive" for target i.
[0391] In some applications, especially in liquid biopsies, the most important sensitivity metric is not absolute sensitivity, but sensitivity relative to a reference template such as wild-type (WT) DNA.
[0392] In this case, the metric of interest is the mutant allele fraction (MAF):
[0393]
[0394] The minimum detectable concentration of the mutant target is calculated as above It depends on the concentration of WT DNA (the concentration of the wild-type target is included in the sum of all other target concentrations ∑ j≠i c j middle).
[0395] Assuming that the WT DNA concentration is significantly higher than the concentration of any other target in the assay, the lowest measurable MAF using the color combination is:
[0396]
[0397] Assume that the dilution factor d = 1 and ∑ j≠i c j ≈c WT .
[0398] As a next step, one can write:
[0399]
[0400] where x = vc WT becomes the average droplet occupancy of wild-type DNA (the average number of wild-type DNA molecules per droplet).
[0401] Figure 4 Shows the function f(x)=e x / x graph. It can be seen that when x=vc WT = 1, the lowest possible MAF measurement value is obtained, and MAF mi1 =3e / N.
[0402] In contrast, in the context of prior art methods, where one fluorophore type per target sequence is used in the assay design, the lowest possible MAF measurements occur at the highest WT concentration, i.e., at saturation. This occurs when When the minimum
[0403] Thus, when using the method of the present invention in combination with a digital system capable of generating N=20 000 partitions, the lowest MAF measurable for a given assay is ln(20 000)*e=27 times higher than when using a simple "1 color=1 target" assay of the prior art.
[0404] To better understand this, using the method according to the present invention, the lowest MAF that can be measured is 0.03% for the Sapphire chip (Stilla Technologies, 1, Mail du Professeur Georges Mathé-94800 Villejuif, France) and 0.05% for the Opal chip (Stilla Technologies, 1, Mail du Professeur Georges Mathé-94800 Villejuif, France). These values are still acceptable, considering that the reported MAFs with clinical utility are usually above 0.01%.
[0405] Alternatively, given x=vc, we can compare WT MAF mi1 , comparing the prior art method of "1 color = 1 target" with the "color combination" method according to the present invention:
[0406]
[0407] Therefore, the loss of relative sensitivity increases with increasing WT concentration.
[0408] For example, on a Sapphire chip (Stilla Technologies, 1, Mail du Professeur Georges Mathé-94800 Villejuif, France), if c WT =1000cp / μL (corresponding to x=0.62), the relative sensitivity loss is e 0.62 =1.86, and the minimum MAF achievable in the color combination method according to the present invention is 0.44%, while the simple assay design of the prior art is 0.24%.
[0409] Statistical analysis also demonstrated that additional target sequences beyond the 15 targets could be detected using only one of the colors used in the color combination without any significant loss in performance.
[0410] In this method, we use only one fluorophore type to detect the first target sequence TS e TS e The concentration is recorded as C e All other target sequences TS i Both fluorophore types were used for detection.
[0411] Concentration C e This can be done by counting partitions that are negative for all fluorophore types and partitions that are negative for TS only. eThis means that all partitions that are positive for more than one fluorophore type are excluded from Ts. e Therefore, TS e The sensitivity loss is
[0412]
[0413] Remove TS e The sum of the concentrations of all targets except the fluorophore is the main parameter causing sensitivity loss, in the same way as for targets detected using two different fluorophore types.
[0414] In cases where a target sequence is expected to be highly abundant (e.g., a wild-type sequence), a different and independent fluorophore type (e.g., FAM / blue channel) can be preferentially used to detect the abundant target sequence, while other fluorophore types and detection channels can be used to detect low-concentration target sequences (e.g., mutant target sequences) through color combinations. Using this approach, the sensitivity of the assay for low-concentration target sequences is not affected or reduced by the presence of abundant isolated target sequences.
[0415] Generate a fluorescence compensation matrix in the context of target sequences encoded using the method of the present invention
[0416] In a preferred embodiment, the method of the present invention includes, before step a), a step of generating a fluorescence compensation matrix, as described above, which is then applied to measure the fluorescence levels or signal intensities from M fluorophore types in each partition using n signals from n fluorescence detection channels.
[0417] Specifically, a compensation matrix is constructed in which, for each fluorescent probe used in the assay, fluorescence parameters are defined for each fluorescent channel.
[0418] In prior art methods, the compensation matrix is constructed by collecting fluorescence data from samples using single-color controls for all fluorescent probes present in the assay. In this case, the single-color control for a given fluorescent probe consists of a mixture of all primers and all fluorescent probes used in the assay, supplemented with a DNA template of the target sequence detected by the fluorescent probe of interest.
[0419] In contrast, in the method of the present invention, in which the target sequence is coded using a color combination, the generation of the fluorescence compensation matrix requires a different setup: in this embodiment of the method of the present invention, the mixture of primers and fluorescent probes is identical to the reaction mixture in the prior art method, but one of the fluorescent probes used to color-code the target sequence to be investigated is missing. For example, if TS1 is detected by two probes: one green and one yellow, the mixture of the green single-color control does not contain the yellow probe for the target TS1, thus ensuring that in this particular case, TS1 is detected by only one of the probes of interest (green), which serves as a reference for the compensation matrix.
[0420] Computer implementation of the data analysis method of the present invention
[0421] Each of the steps d) and / or e) and / or f) described previously in the method according to the invention is not carried out in a purely abstract or purely intellectual manner, but involves the use of technical means.
[0422] Typically, step d) described previously in the method according to the invention is implemented by an optical detector (for measuring the fluorescence intensity of each fluorophore type in each partition) and at least one computer, a central processing or computing unit, an analog electronic circuit (preferably dedicated), a digital electronic circuit (preferably dedicated) and / or a microprocessor (preferably dedicated). In addition, software means can be used to set a positive threshold intensity for each fluorophore type.
[0423] Typically, each step e) and / or f) previously described in the method according to the invention can be implemented by means of at least one computer, a central processing or computing unit, an analog electronic circuit (preferably dedicated), a digital electronic circuit (preferably dedicated) and / or a microprocessor (preferably dedicated) and / or software.
[0424] In another aspect, the present invention relates to a computer program comprising instructions which, when executed by a computer, can implement steps e) and f) of the method according to the invention (and preferably also implement at least part of step d) of the method according to the invention, in particular setting a positive threshold intensity for each fluorophore type).
[0425] In another aspect, the present invention relates to a computer program product comprising instructions which, when the program is executed by a computer, cause the computer to perform steps e) and f) of the method according to the invention (and preferably also to perform at least part of step d) of the method according to the invention, in particular setting a positive threshold intensity for each fluorophore type).
[0426] In another aspect, the present invention relates to a computer-readable storage medium comprising instructions which, when executed by a computer, cause the computer to perform steps e) and f) of the method according to the invention (and preferably also to perform at least part of step d) of the method according to the invention, in particular setting a positive threshold intensity for each fluorophore type).
[0427] Advantages of dPCR assays over existing technologies
[0428] As mentioned above, “intensity-based multiplexing” by Lindner et al. 2021 ([4]) combines two or more fluorophore types that share the same fluorophore type but have different target sequences for at least one fluorophore type used in the assay. Probe type. Two or more probes sharing the same fluorophore type Probe types are combined at two different concentrations in the assay. By using only two probe types per fluorophore type, one probe type will have a low concentration (the "lo" type) and one probe type will have a high concentration (the "hi" type). Therefore, after PCR, if a partition contains a target of type "lo", the fluorescence level of the corresponding fluorophore type in that partition will be above the set positivity threshold, but lower than if the partition contained a target for type "hi". After PCR, assuming all targets are present in the sample, for each fluorophore type for which intensity-based multiplexing has been implemented, there will be a negative droplet population, a first "lo" positive droplet population, a second "hi" positive droplet population (with a higher measured fluorescence level), and possibly a third "lo+hi" positive droplet population (with an even higher measured fluorescence level) (these droplets will contain both "lo" and "hi" targets, causing the fluorescence signals to add). In this way, in addition to the initial binary classification of droplets based on the set positivity threshold, different targets can be distinguished by using the measured fluorescence intensity of the partitions.
[0429] Assuming 2 fluorescence intensity levels are used for each of the M=N fluorescence detection channels / fluorophore types, the maximum number of targets that can be detected, i.e., the maximum multiplexing level, is a maximum of 2 N. Using 6 detection channels, this results in a maximum of 12 targets.
[0430] When compared to the "color combination" approach of the present invention, the maximum multiplexing level of intensity-based multiplexing decreases, and quickly decreases significantly, once the number of fluorescent channels exceeds 5. For example, with n = 10 fluorescent detection channels, the color combination approach of the present invention can detect up to 45 targets, while the intensity-based multiplexing of Lindner et al. can detect less than half that number, i.e., a maximum of 20 targets.
[0431]
[0432] Another disadvantage of the intensity-based approach of Lindner et al. is the complexity of droplet classification and data analysis compared to the color combination of the present invention. Using the color combination of the present invention, only one positive threshold needs to be set for each fluorophore type used in the experiment. Using the intensity-based approach, multiple thresholds must be set for each fluorophore type to distinguish between multiple positive partition populations, all with different fluorescence intensities. When using a 2-level intensity-based approach, three thresholds are required for each fluorophore type to properly classify the partition populations and properly detect and quantify the target of interest: one threshold for "lo" positive partitions, one threshold for "hi" positive partitions, and one threshold for "lo+hi" positive partitions.
[0433] The following table compares the threshold values of the two methods at different numbers of fluorescence detection channels:
[0434]
[0435] This table highlights that the color combination approach of the present invention enables higher multiplexing levels while lowering thresholds and simplifying data analysis.
[0436] Furthermore, when using intensity-based multiplexing, partition classification using a positive threshold often fails due to interactions between PCR amplification of targets associated with one fluorophore type and simultaneous PCR amplification of targets associated with another fluorophore type. For example, if a partition contains Probe type related targets also contain "hi"-Cy5 If the two targets are related by probe type, the two targets will be amplified simultaneously during PCR amplification. This simultaneous amplification may reduce the efficiency of one or both PCR reactions, resulting in "hi"-FAM at the end of PCR amplification. The measured fluorescence intensity of the probe type may be lower than expected and may be different from that of "lo"-FAM When analyzing data using the above positive threshold, partitions may be misclassified as containing the "lo"-FAM target rather than the "hi"-FAM target, leading to errors in detection and quantification. This is particularly the case when two or more When probe types "compete" for the same set of PCR primers during PCR amplification, more complex partitioning classification methods have been used to address this issue. These methods rely on drawing multiple multidimensional polygonal regions around all partitions containing a given target of interest. While this polygonal classification approach remains practical when using two or three fluorescence detection channels (2D or 3D polygons), it becomes extremely cumbersome with higher numbers of detection channels.
[0437] Another drawback of intensity-based multiplexing methods is that the bin classification is not robust to the "rain" phenomenon in digital PCR.
[0438] Ideally, in digital PCR, all partitions containing the same target of interest (or multiple targets) should always be amplified with reaction efficiency and have the same measured fluorescence level. For a well-designed assay, there should be a significant difference in the measured fluorescence levels between negative and positive partitions. In addition, the measured fluorescence level of a partition cannot be between the negative and positive partition levels, because this cannot correspond to either the negative or positive partition. However, there are partitions with intermediate levels of fluorescence in the experiment. They are typically partitions containing target nucleic acid molecules, but the PCR reaction efficiency is reduced, resulting in an endpoint fluorescence level lower than the conventional fluorescence level of the positive partition. These partitions with intermediate fluorescence intensity are called "rain".
[0439] Rain can be caused by a variety of factors:
[0440] - Poor assay design;
[0441] -Partial failure of the digital PCR system or the digital PCR consumables used:
[0442] Thermal failure during PCR
[0443] ○ Fluorescence reading error;
[0444] ○ Abnormal partition volume;
[0445] ○Dust particles;
[0446] - The sample contains PCR inhibitors;
[0447] - The sample causes a decrease in PCR efficiency.
[0448] Given the many causes of “rain,” a certain degree of rain is inevitable when conducting digital PCR experiments.
[0449] When using a simple "1 color 1 target" approach in digital PCR, rain is considered a positive partition when the fluorescence level is above the set positive threshold. Or the rain is excluded from the analysis. However, when using the "intensity-based multiplexing" approach, rain can cause additional misclassification problems. In fact, rain from a partition that should have a "hi" fluorescence intensity level may end up having a fluorescence intensity corresponding to a partition with a "lo" fluorescence intensity level. In these cases, the partition will be misclassified as containing a target corresponding to the "lo" fluorescence intensity level, rather than being classified as containing a target corresponding to the "hi" fluorescence intensity level. When using the "intensity-based multiplexing" approach, misclassification of such rain partitions is inevitable, which may lead to false positive results and additional errors in the quantification of targeted nucleic acids.
[0450] When using the "color combination" approach according to the present invention, only one positive threshold is set for each fluorophore type, so that the rain can be processed in the same way as when using the simple "1 color 1 target" approach.
[0451] In summary, the “color combination” approach described in this paper has the following advantages over “intensity-based multiplexing”:
[0452] -When the number of detection channels exceeds 5, the multiplexing level increases;
[0453] - Simplified zoning and classification;
[0454] -The number of positive thresholds required to classify a partition is significantly reduced;
[0455] - Improved robustness against rain.
[0456] CSSFR complex of the present invention and kit containing the complex
[0457] The present invention also relates to the CSSFR complex of the invention as described above per se.
[0458] As used herein, the term "CSSFR complex" refers to a bimolecular nucleotide complex containing:
[0459] - a master reporter oligonucleotide molecule (m-reporter), which contains at least one sequence complementary to the tag sequence ("tag complementary sequence", TCS) carried by the mediating probe of the group associated with the TSi, and contains a reporter molecule at its 5' end, which reporter molecule can be a fluorophore or a quencher group;
[0460] - a complementary reporter oligonucleotide molecule (c-reporter) containing a sequence complementary to the 5' end sequence of the m-reporter at its 3' end and / or 5' end and / or between the 3' end and the 5' end, and:
[0461] o If the m-reporter has a quencher group, a fluorophore group, or at least one fluorophore group; or
[0462] ○ If the m-reporter has a fluorophore group, it contains a quencher group;
[0463] The fluorescence of the fluorophore group of the c-reporter or m-reporter changes due to hybridization or extension of the associated tag sequence of the 5' end mediating region to the tag complementary sequence (TCS) on the m-reporter once it is cleaved from the mediating probe.
[0464] The m-reporter molecule in the CSSFR complex is a linear nucleotide molecule containing at least 30 nucleotides. More specifically, it generally contains 30 to 80 nucleotides, preferably 40 to 50 nucleotides.
[0465] The m-reporter molecule in the CSSFR reporter of the present invention contains at least one, preferably at least two, and more preferably three or more tag-complementary sequences (TCSs), which are partially or fully complementary to the tag sequences located on the corresponding mediating probes. In the context of the present invention, these tag-complementary sequences (TCSs) should be relatively short, i.e., they typically contain 8 to 25 nucleotides, preferably 8 to 18 nucleotides, more preferably 10 to 16 nucleotides, and even more preferably 12 to 14 nucleotides.
[0466] The 3' end of the m-reporter molecule is preferably blocked with a phosphate group or other conventional blocking agents (e.g., C3 / C6 spacers, dideoxynucleotides, phosphates, inverted bases, 3' amino groups) to prevent any unwanted amplification of this side of the molecule. This blocking step is recommended by many oligonucleotide manufacturers; see, for example, https: / / www.biomers.net / en / Products / DNA / Real-time_PCR / PCR_Blocker.html.
[0467] The c-reporter molecule in the CSSFR complex of the present invention is relatively short, typically comprising 8 to 25 nucleotides, preferably 8 to 18 nucleotides, more preferably 10 to 16 nucleotides, and even more preferably 12 to 14 nucleotides.
[0468] When carrying a quencher compatible with multiple fluorophores, a c-reporter molecule can be used in a CSSFR complex containing different m-reporter molecules. For example, the quencher BHQ1 can be used to quench blue and till fluorophores, so a c-reporter carrying BHQ1 can be used to hybridize with an m-reporter carrying blue and till fluorophores (see Example 2).
[0469] In the reporter complex, the m-reporter molecule preferably contains at least two different tag-complementary sequences (TCS), preferably a large number of such sequences, as disclosed in
[16] .
[0470] In the reporter complex, the size of the complementary reporter oligonucleotide molecule (c-reporter) is relatively short. It generally comprises 8 to 25 nucleotides, preferably 8 to 18 nucleotides, more preferably 10 to 16 nucleotides, even more preferably 12 to 14 nucleotides (generally 15 to 20 nucleotides), preferably about 18 nucleotides.
[0471] In another aspect, the present invention also relates to the in vitro use of at least one complementary single-stranded fluorescent reporter (CSSFR) complex as defined above in a PCR method (preferably a dPCR method, more preferably a dPCR method as described above) to detect and / or quantify the presence of at least one, preferably at least two, and more preferably at least five nucleic acid target sequences (TSi) in a biological sample containing nucleic acid molecules. As shown in Examples 2.B.2. and 2.B.3, the CSSFR complex of the present invention can be advantageously used to reliably and rapidly highlight the presence and quantify 12 or 15 different nucleic acid target sequences (TSi).
[0472] In another aspect, the present invention relates to a kit comprising at least two, preferably at least three, more preferably at least four complementary single-stranded fluorescent reporter (CSSFR) complexes as defined above. The sequences of the m-reporter molecules in these universal reporters have advantageously been designed to detect at least two, three, four, five, six, seven, eight, nine, ten or more TSs using a minimum number of fluorophore groups.
[0473] Preferably, each CSSFR complex in the kit carries a different fluorophore group.
[0474] The CSSFR complexes contained in the kit can be used to detect one or more TSs. When they carry different TCSs, they can be used to detect multiple TSs. Some complexes can also be used to detect only one TS.
[0475] The kit of the present invention may further comprise designed mediating probes, such that according to the method of the present invention, TS is detected by two mediating probes, each of which carries two different tags specifically recognized by two differently labeled CSSFR complexes. In this case, the kit contains at least two mediating probes, whose 3'-terminal probe regions are complementary to the target sequence TSi, and whose 5'-terminal mediating regions contain two different tag sequences, wherein the tag sequences are complementary to and hybridize with the tag-complementary sequences carried by the m-reporter oligonucleotide molecules of the at least two complementary single-stranded fluorescent reporter (CSSFR) complexes in the kit.
[0476] Alternatively, or in addition, the kit of the present invention may further comprise a designed mediating probe such that, according to the method of the present invention, TS is detected by only one mediating probe carrying a tag that is specifically recognized by two differently labeled CSSFR complexes. In this case, the kit contains at least one mediating probe whose 3' terminal region is complementary to the target sequence TSi and whose 5' terminal region contains a tag sequence that is complementary to and hybridizes with at least two tag-complementary sequences carried by the m-reporter oligonucleotide molecules of at least two complementary single-stranded fluorescent reporter (CSSFR) complexes in the kit.
[0477] The kit of the present invention may comprise any one of the above-mentioned mediating probes.
[0478] The kit of the present invention may also comprise at least one CSSFR complex capable of detecting two, three or more target sequences (because it contains appropriately selected TCSs in its m-reporter molecule).
[0479] The kit of the invention may alternatively or additionally comprise at least one CSSFR complex capable of detecting only one target sequence.
[0480] The kit of the present invention may further comprise any buffer or molecular tool useful for putting the method of the present invention into practice, in particular:
[0481] (a) amplification reagents for amplifying nucleic acid targets, and / or
[0482] (b) Nuclease.
[0483] It may contain instructions for the appropriate use of the kit to detect multiple target sequences. BRIEF DESCRIPTION OF THE DRAWINGS
[0484] Figure 1 Data from an experiment testing six target sequences at a concentration of 100 cps / μL, where each target sequence used a color combination of two fluorophore types, and all six target sequences had a total of four fluorophore types (Example 1). The units on the x- and y-axes are arbitrary fluorescence units (AFU), reflecting the fluorescence intensity of the fluorophore type.
[0485] Figure 2 a) Dilution series of a single target sequence detected by a color combination, without any other target sequence. b) Dilution series of a single target sequence detected by a color combination, with 5 other target sequences present in background. c) Confidence interval for a target sequence (PhiX) at 100 cp / μl under conditions of increasing background levels of another target sequence (Lambda).
[0486] Figure 3 - Assay sensitivity of target at increasing background levels.
[0487] Figure 4 - Function f(x) = e x / x chart.
[0488] Figure 5 - The principle of combining mediating probes with molecular beacons as universal reporters is described in detail.
[0489] Figure 6- shows the principle of combining a mediating probe with a molecular beacon as a universal reporter, A: target sequence 1; B: target sequence 2.
[0490] Figure 7 - The principle of combining mediating probes with CSSFR as a universal reporter is described in detail.
[0491] Figure 8 1D thresholding in a universal reporter experiment using a linear reporter. The x-axis is the droplet index, stacked across 8 samples; the y-axis is arbitrary fluorescence units (AFU), reflecting the fluorescence intensity of the fluorophore type.
[0492] Figure 9 - Experimental data for detecting three target sequences at a concentration of 100 cps / μL, where the color combination of each target sequence uses three fluorophore types (Example 3). The units on the x-axis and y-axis are arbitrary fluorescence units (AFU), which reflect the fluorescence intensity of the fluorophore type.
[0493] Figure 10 Data from a typical experiment are shown, which tested 11 target sequences at a concentration of 100 cps / μL (except ESR1 E380WT and ALB, the former was used at approximately 200 cps / μL, and the latter was used at a concentration of approximately 160 cps / μL), using a total of 5 fluorophore types, where for 10 target sequences, the color combination of each target sequence used two fluorophore types, while one gene (del19ref) was visualized using only one fluorophore type (Cy3 / green) (see Example 4). The units on the x-axis and y-axis are arbitrary fluorescence units (AFU), reflecting the fluorescence intensity of the fluorophore type.
[0494] Figure 11 1D thresholding in a universal reporter experiment using a linear reporter, as explained in Example B.2. The x-axis is the droplet index, stacked across 16 conditions; the y-axis is arbitrary fluorescence units (AFU), reflecting the fluorescence intensity of the fluorophore type. The plot shows that optimal separation across all six color channels is achieved with primer concentrations between 0.25 and 0.5 μM and mediating probe concentrations between 0.5 and 1 μM.
[0495] Figure 12 - Target sequence concentrations disclosed in Example B.2, depending on the concentrations of primers and mediating probes. The results are based on optimal conditions, which were obtained at primer concentrations between 0.25-0.5 μM and mediating probe concentrations between 0.5-1 μM.
[0496] Figure 131D thresholding in a universal reporter experiment using a linear reporter, as explained in Example B.3. The x-axis is the droplet index, stacked across 16 conditions; the y-axis is arbitrary fluorescence units (AFU), reflecting the fluorescence intensity of the fluorophore type. The exposure time was doubled for all channels, with blue fixed at 250 ms. The plot shows that optimal separation of the six color channels is achieved with primer concentrations between 0.25 and 0.5 μM and mediating probe concentrations between 0.5 and 1 μM.
[0497] Figure 14 - Target sequence concentrations disclosed in Example B.3, depending on the concentrations of primers and mediating probes. The results are based on optimal conditions, which were obtained at primer concentrations between 0.25-0.5 μM and mediating probe concentrations between 0.5-1 μM.
[0498] Figure 15 - Design optimization of c-reporter and tag sequence lengths. The figure shows that the best separation is achieved with the shortest c-reporter and shortest tag sequences tested.
[0499] Figure 16 - Design optimization of m-reporter concentration. The figure shows that the best separation can be achieved with m-reporter concentrations between 0.1 and 0.25 μM.
[0500] Figure 17 - Detailed description of the principle of combining a mediating probe with CSSFR as a universal reporter, when the target sequence is characterized by one or two TAG sequences, the complementary sequence (TCS) of the TAG sequence is carried by one or two CSSFR complexes.
[0501] (A) TSi is characterized by two colors (blue and green), and the panel for detecting the TSi contains:
[0502] - two mediating probes specific for TSi (3' part) and containing TAGi1 and TAGi2 (5' part), respectively, and
[0503] - Two CSSFR complexes, one containing a TCS specific for TAGi1 and one containing a TCS specific for TAGi2, the two complexes are differently labeled (blue / green).
[0504] (B) Similar to (A), TSi is represented by two colors, but one CSSFR complex contains a TCS shared with the group detecting another target sequence.
[0505] (C) In the PCR method, at least one target sequence is detected by a single color. Thus, in this example, TSi is detected by a panel containing:
[0506] - 1 mediating probe specific for TSi (3' portion) and containing TAGi (5' portion) - 1 CSSFR complex containing TCS specific for TAGi and a fluorophore group (green)
[0507] And TSj is detected by a group containing:
[0508] - 2 different mediator probes specific for TSj (3' part) and containing TAGj1 and TAGj2 (5' part)
[0509] - Two CSSFR complexes, one containing a TCS specific for TAGj1 and one containing a TCS specific for TAGj2, the two complexes are differently labeled (pink / red).
[0510] Figure 18 - Detailed description of the principle of combining a mediating probe with two CSSFRs as a universal reporter, when the target sequence is characterized by only one TAG sequence, whose complementary sequence (TCS) is carried by one or two CSSFR complexes.
[0511] (A) TSi is characterized by two colors (blue and green), and the panel for detecting the TSi contains:
[0512] - A mediating probe that specifically recognizes TSi (3' portion) and contains TAGi (5' portion)
[0513] - Two CSSFR complexes, each containing a TCS specific for TAGi, which are differently labeled (blue / green).
[0514] (B) Three target sequences TS1, TS2, and TS3 are detected by three different mediating probes containing TAG1, TAG2, and TAG3, respectively. These probes are recognized in a combinatorial order by CSSFR carrying multiple target sequences, so that each TS is ultimately represented by two colors (blue and green for TS1; blue and red for TS2; and green and red for TS3).
[0515] (C) Detection of two target sequences, TSi and TSj; TSi is detected in one color (green) and TSj is detected in two colors (blue and red).
[0516] The panel used to detect TSi contains:
[0517] - 1 mediator probe that is specific for TSi (3' portion) and contains TAGi (5' portion)
[0518] - A CSSFR complex containing a TCS specific for TAGi and a fluorophore group (green)
[0519] The panel used to detect TSj contains:
[0520] - 1 mediating probe that is specific for TSj (3' part) and contains TAGj (5' part)
[0521] - 2 CSSFR complexes, each containing a TCS specific for TAGj, which are differently labeled (blue / red) DETAILED DESCRIPTION
[0522] Example
[0523] Example 1: Two methods were used for each target sequence. Probes to implement the color combination method of the present invention: 6 target sequences - 2 colors per target sequence - a total of 4 colors
[0524] Materials and Methods
[0525] Forward and reverse primers for different target sequences (see table below) were used at a concentration of 0.5 μM.
[0526] Two probes with different fluorophores and quenchers were used for each target sequence. The target sequences and probe-dye combinations, as well as the concentrations of these probes used, are detailed in the table below.
[0527] The fluorophore type / color combinations used for each target sequence were as follows: ESR1 L536P (infrared and yellow), PhiX174 (infrared and cyan), PBR322 (red and infrared), ALB (red and cyan), Lambda (yellow and cyan), and puc18 (yellow and red).
[0528]
[0529]
[0530]
[0531] These sequences are shown in the sequence listing as SEQ ID NOs: 1-24.
[0532] Supplier details are as follows:
[0533] -Kaneka Eurogentec SA-5Rue Bois Saint-Jean,4102Seraing,Belgium;
[0534] -IDT - Integrated DNA Technologies, Inc. - 1710 Commercial Park - Coralville, Iowa 52241 – USA.
[0535] The target sequence for this assay was double-stranded synthetic DNA ("gBlocks TM " fragment), which corresponds to the amplicon, was used at a concentration of approximately 100 cps / μL.
[0536] When performing PCR, a fluorescent dye is added to the reaction. Multiplex PCR mixtures were prepared (Stilla Technologies, 1, Mail du Professeur Georges Mathé-94800 Villejuif, France). To improve component stability, 4% (vol / vol) DMSO was included in the reaction. 7 μl of the reaction was loaded onto an Opal chip (Stilla Technologies, 1, Mail du Professeur Georges Mathé-94800 Villejuif, France). Negative controls (no DNA) and single-color controls were added to control the reactions and establish matrix compensation.
[0537] Partitioning and PCR cycling were performed in a Geode instrument (Stilla Technologies, 1, Mail du Professeur Georges Mathé - 94800 Villejuif, France).
[0538] The cycling PCR program had an initial denaturation step at 95°C for 3 minutes, followed by 60 cycles of 95°C for 15 seconds and 62°C for 30 seconds as denaturation and hybridization-extension temperatures, respectively.
[0539] The chip was then depressurized (returned to atmospheric pressure) at 5 mbar / s at 25° C. The chip was imaged using a Prism 6 imager (Stilla Technologies, 1, Mail du Professeur Georges Mathé-94800 Villejuif, France) with the following exposure times:
[0540] Blue: 125ms
[0541] Cyan: 350ms
[0542] Green: 125ms
[0543] Yellow: 150ms
[0544] Red: 500ms; and
[0545] Infrared: 500ms.
[0546] Data were analyzed using Crystal Miner software (Stilla Technologies, 1, Mail du Professeur Georges Mathé-94800 Villejuif, France). For matrix compensation, single-color controls were used.
[0547] Set a positive threshold to identify negative and positive droplets from the rest. This is typically done on a 1D spot map view.
[0548] In the next step, the population editor in Crystal Miner software is used to define populations for each target sequence. For example, for the Phix174 target sequence, positive droplets are designated as those positive for both infrared and cyan, while droplets that display no fluorescence are counted as negative. Droplets displaying any other color combination are excluded from the analysis. In this way, the number of droplets positive for a target sequence can be retrieved and other characteristics, such as the concentration of the target sequence in the sample, can be estimated.
[0549] Figure 1 Shown are data from a typical experiment using a total of four fluorophore types to detect six target sequences at a concentration of 100 cps / μL, where the color combination method of the present invention used two fluorophore types per target sequence.
[0550] result
[0551] To assess the dynamic range available when detecting multiple target sequences encoding two fluorophore types / colors, a series of experiments were performed following the protocol detailed above.
[0552] A good linear relationship between expected and actual concentrations was observed between 0.1 and 10,000 cp / μL, regardless of whether only one target sequence was added to the sample ( Figure 2 a) Or detect 6 target sequences together ( Figure 2 This was true for both the PCR assay and the assays b), in which the concentration of one target sequence was varied between 0.1 and 10,000 cp / μl, while the concentration of the other five targets was kept constant at 100 cp / μl. Furthermore, the detection limits achieved were comparable to those routinely achieved with prior art methods using one color per target sequence, even in the presence of large background concentrations.
[0553] In another experiment, the confidence level of detecting a target sequence at a fixed concentration was investigated while varying the amount of background target sequence ( Figure 2 c) Here, a target sequence (PhiX) at a fixed concentration of 100 cp / μl was detected in the presence of increasing levels of background target sequence (Lambda) from 0.1 cp / μl up to 10,000 cp / μl.
[0554] It can be seen that the confidence interval for a fixed concentration of PhiX remains stable at approximately 10% for background target sequence Lambda concentrations up to 2000 cp / μl, as expected, and then rises sharply for higher background target concentrations.
[0555] This effect is believed to originate from co-encapsulation events, which are excluded from analysis according to the method of the present invention: the higher the background target sequence concentration, the greater the number of co-encapsulation events, and therefore the fewer droplets analyzed according to the method. As a direct consequence, the confidence level in the fixed target sequence concentration decreases when the background target sequence concentration (which can be, for example, wild type) is too high.
[0556] As discussed previously, and particularly as illustrated in the section entitled "Statistical Analysis of the Inventive Data Processing Scheme," whether this consequence of the inventive method constitutes a practical limitation depends primarily on the application. For rare event detection in liquid biopsies, the expected concentrations are low, so this effect is not a factor. In the case of detecting a reference target sequence or a high-concentration target sequence, a single fluorophore type can be used solely to detect the high-concentration target sequence, thereby overcoming the effect of co-encapsulation events.
[0557] Example 2: Using two mediating probes (MPs) to trigger two universal reporters (URs) per target sequence to implement the color combination method of the present invention
[0558] The method consists of using a non-fluorescent probe (mediating probe, MP) that consists of a sequence specific for the target and an artificial sequence called a "flap" at the 5' end that is not complementary to the target. During the extension process, the polymerase cleaves the probe after the first base of hybridization with the target, thereby releasing the flap sequence. This flap sequence in turn hybridizes with a universal reporter, which can be, for example, a molecular beacon (Example 2.A. below) or a linear reporter (Example 2.B. below).
[0559] A. Using Molecular Beacons as Universal Reporters
[0560] exist Figure 5 The use of molecular beacons as universal reporters is schematically depicted in FIG.
[0561] In this example, for each target sequence, two mediating probes are allowed to activate two molecular beacons as universal reporters in a competitive relationship, such as Figure 6 As shown, a total of 6 target sequences encoded using 4 different fluorescence channels were focused.
[0562] Materials and Methods
[0563] For each target sequence, double-stranded synthetic DNA corresponding to the amplicon ("gBlocks TM ” snippet).
[0564] For color combination experiments, a mixture was prepared in which the estimated concentration of each DNA fragment was 1000 cp / μL (10x).
[0565] The color combinations applied for each target sequence are as follows: ESR1 L536P (green and red), PhiX 174 (red and cyan), PBR322 (green and yellow), ALB (red and yellow), Lambda (green and cyan), and puc18 (yellow and cyan).
[0566] All oligonucleotides were purchased from Kaneka Eurogentec SA (5 Rue Bois Saint-Jean, 4102 Seraing, Belgium). In this strategy, a blocking agent is added to prevent uncut mediating probes from hybridizing with molecular beacons, which would result in increased fluorescence background. In a preliminary step, primers, probes, molecular beacons, and blocking agents corresponding to the six target sequences were assembled in unique stock solutions for each reagent type. The composition of the reagent mixture and the sequences of the oligonucleotides are as follows:
[0567] Primer mixture The primer sequences listed in the table in Example 1.A. above were used, with each primer at a concentration of 5 μM.
[0568] The mediator probe mixture was prepared from the following elements, all of which contained a phosphate 3' modification (no 5' modification), and each mediator probe was mixed at 5 μM:
[0569] PhiXMP_Cyan MB GTCTCGGTACTCTCTCCGAGATTATGCGCCAAATGCTTAC LambdaMP_cyanMB CTCGGTACTCTCTGACTGATTGCCCGTCTCCGCT pUC18MP_cyan MB TCGGTACTCTCTGACCCGGGTACCGAGCTCGAATT LambdaMP_GreenMB CGTGTGACTGATACTGATTGCCCGTCTCCGCT pBRMP_Green MB CGTGTGACTGATACGCCCAGTCCTGCTCGCTTCG ESR1MP_Green MB GTGTGACTGATACTGCCCCCCTATGACCTGCT pUC18MP_yellow MB TCCTGCCTGCCCCGGGTACCGAGCTCGAATT pBR322MP_Yellow MB TCCTGCCTGCCGCCCAGTCCTGCTCGCTTCG AlbMP_Yellow MB CTGCCTGCCGTGCTGAAACATTCACCTTCCATGCA ESR1MP_Red MB CTCCGACCGGTGCCCCCCTATGACCTGCT PhiXMP_Red MB CTCCGACCGGTCCGAGATTATGCGCCAAATGCTTAC AlbMP_Red MB CTCCGACCGGTGCTGAAACATTCACCTTCCATGCA
[0570] These sequences are listed in the sequence listing as SEQ ID NOs: 25-36.
[0571] A blocker mix was prepared from the following elements, all containing a phosphate 3' modification (no 5' modification), and each blocker was mixed at 5 μM:
[0572]
[0573]
[0574] These sequences are listed in the sequence listing as SEQ ID NOs: 37-48.
[0575] A molecular beacon mixture was prepared from the following ingredients, mixed at 5 μM for each molecular beacon:
[0576]
[0577] These sequences are listed in the sequence listing as SEQ ID NOs: 49-52.
[0578] PCR sample preparation
[0579] The experiments were performed with six target sequences at an approximate concentration of 100 cp / μL. A negative control (NTC, no template control) without template was also performed. Two replicates were performed for each condition.
[0580] In addition to the above DNA template mixture and oligonucleotide mixture, a PCR product from Stilla Technologies (Stilla Technologies, 1, Mail du Professeur Georges Mathé-94800 Villejuif, France) was also used. Multiplex PCR mix.
[0581] The detailed mixture preparation for each of the two experimental conditions is as follows:
[0582]
[0583]
[0584] Chip loading and dPCR run
[0585] PCR samples were loaded onto Sapphire chips (Stilla Technologies, 1, Mail du Professeur Georges Mathé-94800 Villejuif, France) and processed in a Geode instrument according to standard procedures. The conventional Sapphire partitioning and release procedures were used, as well as the cycling PCR program described below:
[0586] Initial denaturation: 95°C for 3 minutes;
[0587] 60 cycles: 95°C for 15 seconds, then 62°C for 30 seconds.
[0588] After the dPCR run, the chip was scanned using the Prism6 reader and the standard Sapphire scanning template (ScanningTemplate_Prism6_SapphireChip_naica-multiplex-PCR-MIX_Taqman_v1.4).
[0589] Data Analysis
[0590] Data analysis was performed using CrystalMiner software. To generate the compensation matrix, a single-color control was used, which contained a mixture of the universal reporter combined with a single mediator probe to activate only one color.
[0591] 1D thresholds were set for each color channel to define negative and positive populations. Next, color assignments were set for each target sequence in the Population Editor section of the software. For example, PhiX174 was defined as a population that was positive in the cyan and red channels and negative in all other channels. After population editing, the results were exported and the quantitative results reviewed. For each of the six targets, the experimentally measured concentrations were in good agreement with the theoretical concentration of 100 cp / μL:
[0592]
[0593] B. Using a linear reporter as a universal reporter B.1.6 target sequences / 4 colors
[0594] exist Figure 7 The use of a linear reporter as a universal reporter is schematically depicted in .
[0595] In this example, for each target sequence, two mediating probes are placed in competition allowing the activation of two linear reporters acting as universal reporters. A total of 6 target sequences encoded using 4 different fluorescence channels were considered.
[0596] Materials and Methods
[0597] For each target sequence, double-stranded synthetic DNA corresponding to the amplicon ("gBlocks TM " fragment, SEQ ID NO: 152-166).
[0598] For color combination experiments, a mixture was prepared in which the estimated concentration of each DNA fragment was 1000 cp / μL (10x).
[0599] The color combinations applied for each target sequence are as follows: ESR1 L536P (infrared and red), PhiX 174 (red and cyan), PBR322 (infrared and yellow), ALB (red and yellow), Lambda (infrared and cyan), and puc18 (yellow and cyan).
[0600] All oligonucleotides were purchased from Kaneka Eurogentec SA (5 Rue Bois Saint-Jean, 4102 Seraing, Belgium). In a preliminary step, primers, probes, and linear reporters corresponding to the six target sequences (the m-reporter strand, which contains the binding site for the flap sequence and the fluorophore; and the c-reporter strand, which is complementary to the m-reporter strand and carries the quencher) were assembled in a unique stock solution for each reagent type. The composition of the reagent mixture and the sequences of the oligonucleotides are as follows:
[0601] Primer mixture The primer sequences listed in the table in Example 1.A. above were used, with each primer at a concentration of 5 μM.
[0602] The mediator probe mixture was prepared from the following elements, all of which contained a phosphate 3' modification (no 5' modification), and each mediator probe was mixed at 5 μM:
[0603] PhiXMP_Cyan LR GTCTCGGTACTCTCTCCGAGATTATGCGCCAAATGCTTAC LambdaMP_Cyan LR ACTCTCTCTTGGTCTACTGATTGCCCGTCTCCGCT pUC18MP_Cyan LR TCTCGGTACTCTCTCCCGGGTACCGAGCTCGAATT pUC18MP_Yellow LR AGCTGCGTTGTATCCCGGGTACCGAGCTCGAATT pBR322MP_Yellow LR AGCTGCGTTGTATCGCCCAGTCCTGCTCGCTTCG AlbMP_Yellow LR CTAGCTGCGTGTATGCTGAAACATTCACCTTCCATGCA ESR1MP_Red LR GTTGGATCGATGGTGCCCCCCTATGACCTGCT PhiXMP_Red LR GTTGGATCGATGGTCCGAGATTATGCGCCAAATGCTTAC AlbMP_Red LR GTTGGATCGATGGTGCTGAAACATTCACCTTCCATGCA LambdaMP_Infrared LR GTACGATTGTGGTGACTGATTGCCCGTCTCCGCT pBRMP_Infrared LR CGATTGTGGTGAGCGCCCAGTCCTGCTCGCTTCG ESR1MP_Infrared LR GATTGTGGGTGAGCTGCCCCCCTATGACCTGCT
[0604] These sequences are listed in the sequence listing as SEQ ID NOs: 53-64.
[0605] An m-reporter strand mix was prepared from the following elements, all containing a fluorophore indicated as a 5' modification and a phosphate 3' modification, and each m-reporter strand was mixed at 5 μM:
[0606]
[0607] These sequences are listed in the sequence listing as SEQ ID NOs: 65-68.
[0608] • A c-reporter mix was prepared from the following elements containing the quencher indicated as a 3' modification (no 5' modification) and each c-reporter strand was mixed at 5 μM:
[0609]
[0610] These sequences are listed in the Sequence Listing as SEQ ID NOs: 69-72.
[0611] PCR sample preparation
[0612] The experiment was performed at two linear reporter A chain concentrations (0.25 μM and 0.1 μM) with an approximate concentration of 100 cp / μL for each of the six targets. A negative control (NTC, no template control) with no template was also performed for both linear reporter concentrations. Two replicates were performed for each condition.
[0613] In addition to the above DNA template mixture and oligonucleotide mixture, a PCR product from Stilla Technology (Stilla Technologies, 1, Mail du Professeur Georges Mathé-94800 Villejuif, France) was also used. Multiplex PCR mix.
[0614] The detailed mixture preparation for each of the four experimental conditions is as follows:
[0615]
[0616]
[0617] Chip loading and dPCR run
[0618] PCR samples were loaded onto Sapphire chips (Stilla Technologies, 1, Mail du Professeur Georges Mathé-94800 Villejuif, France) and processed in a Geode instrument according to standard procedures. The conventional Sapphire partitioning and release procedures were used, as well as the cycling PCR program described below:
[0619] Initial denaturation: 95°C for 3 minutes
[0620] 60 cycles: 95°C for 15 seconds, then 58°C for 30 seconds
[0621] After the dPCR run, the chip was scanned using the Prism6 reader and the standard Sapphire scanning template (ScanningTemplate_Prism6_SapphireChip_naica-multiplex-PCR-MIX_Taqman_v1.4).
[0622] Data Analysis
[0623] Data analysis was performed using CrystalMiner software. To generate the compensation matrix, a single-color control was used, which contained a mixture of the universal reporter combined with a single mediator probe to activate only one color.
[0624] Set 1D thresholds for each color channel to define negative and positive populations, such as Figure 8 shown.
[0625] Next, color assignments were set for each target sequence in the Population Editor section of the software. For example, PhiX174 was defined as a population that was positive in the cyan and red channels and negative in all other channels. After population editing, the results were exported and the quantification was reviewed. For each of the six targets, the experimentally measured concentrations were in good agreement with the theoretical concentration of 100 cp / μL:
[0626]
[0627] B.2.12 target sequences / 6 colors
[0628] In this example, two competing mediating probes were used to activate two linear reporters (as universal reporters) to detect color combinations for ten targets. Two additional targets were detected using a single mediating probe to activate a single universal reporter, using a single color (blue or red). Red was also used in combination with another color to detect additional targets. Blue was used to detect only one target (TSN).
[0629] In general, 12 targets were detected in this example, and the color attribution of each target is shown in the following table:
[0630]
[0631] Materials and Methods
[0632] For each target sequence, double-stranded synthetic DNA corresponding to the amplicon ("gBlocks TM ” fragment) (SEQ ID NO: 152-166).
[0633] For color combination experiments, a mixture was prepared in which the estimated concentration of each DNA fragment was 3000 cp / μL (30x).
[0634] All oligonucleotides were purchased from Kaneka Eurogentec SA (5 Rue Bois Saint-Jean, 4102 Seraing, Belgium). In a preliminary step, primers, probes, and linear reporters corresponding to the 12 target sequences (one m-reporter with a binding site and a fluorophore carrying a flap sequence and another c-reporter strand complementary to the m-reporter strand and carrying a quencher) were assembled in unique stock solutions for each reagent type. The composition of the reagent mixture and the sequences of the oligonucleotides are as follows:
[0635] Primer mixture: The primer sequences listed in the table below were used, with each primer at a concentration of 2.5 μM.
[0636]
[0637]
[0638] • The mediator probe mixture was prepared from the following elements, all of which contained a phosphate 3' modification (no 5' modification), and each mediator probe was mixed at 5 μM ({X} represents LNA):
[0639]
[0640]
[0641] An m-reporter strand mix was prepared from the following elements, all containing a fluorophore indicated as a 5' modification and a phosphate 3' modification, and each m-reporter strand was mixed at 5 μM:
[0642]
[0643]
[0644] A c-reporter strand mix was prepared from the following elements containing the quencher indicated as a 3' modification (no 5' modification) and each c-reporter strand was mixed at 10 μM:
[0645]
[0646]
[0647] PCR sample preparation
[0648] The experiment was performed at four primer mix concentrations and two mediator probe concentrations, with an approximate concentration of 100 cp / μL for each of the twelve targets. A negative control (NTC, no template control) without template was also performed for each condition. Both positive and negative controls were repeated twice.
[0649] In addition to the above DNA template mixture and oligonucleotide mixture, a PCR product from Stilla Technology (Stilla Technologies, 1, Mail du Professeur Georges Mathé-94800 Villejuif, France) was also used. PCR mixture.
[0650] The detailed mixture preparation for each of the sixteen experimental conditions is as follows:
[0651]
[0652]
[0653]
[0654] Chip loading and dPCR run
[0655] PCR samples were loaded onto Ruby Chip consumables (Stilla Technologies, 1, Mail du Professeur Georges Mathé-94800 Villejuif, France) and processed in a Geode instrument according to standard procedures. Conventional Ruby partitioning and release procedures were used, along with the cycling PCR program described below:
[0656] Initial denaturation: 95°C for 3 minutes
[0657] 60 cycles: 95°C for 15 seconds, then 58°C for 60 seconds
[0658] After the dPCR run, scan the chip using a Prism6 reader with the following exposure times:
[0659] Blue 500ms;
[0660] Cyan: 800ms
[0661] Green: 250ms
[0662] Yellow: 350ms
[0663] Red 1000ms; and
[0664] Infrared 1000ms.
[0665] Data Analysis
[0666] Data analysis was performed using CrystalMiner software. To generate the compensation matrix, a single-color control was used, which contained a mixture of the universal reporter combined with a single mediator probe to activate only one color.
[0667] Set 1D thresholds for each color channel to define negative and positive populations, such as Figure 11 The optimal conditions for setting 1D thresholds in all six color channels were obtained using 0.5 μM primer and 0.5 μM mediator.
[0668] Next, color assignments were set for each target sequence in the Population Editor section of the software. For example, PhiX174 was defined as a population that was positive in the cyan and red channels and negative in all other channels. After population editing, the results were exported and the quantitative results reviewed. For each of the twelve targets, the experimentally measured concentrations were in good agreement with the theoretical concentration of 100 cp / μL, as shown in Figure 2. Figure 12 .
[0669] B.3.15 target sequences / 6 colors
[0670] In this example, two competitive mediating probes were used to activate two linear reporters (as universal reporters) to detect the color combinations of fifteen targets. The color attribution of each target is shown in the following table:
[0671]
[0672] Materials and Methods
[0673] For each target sequence, double-stranded synthetic DNA corresponding to the amplicon ("gBlocks TM " fragment, SEQ ID NO: 152-166).
[0674] For color combination experiments, a mixture was prepared in which the estimated concentration of each DNA fragment was 3000 cp / μL (30x).
[0675] All oligonucleotides were purchased from Kaneka Eurogentec SA (5 Rue Bois Saint-Jean, 4102 Seraing, Belgium). In a preliminary step, primers, probes, and linear reporters corresponding to the 15 target sequences (one m-reporter strand containing a binding site for the flap sequence and a fluorophore; and a c-reporter strand complementary to the m-reporter strand, which carries a quencher) were assembled in a unique stock solution for each reagent. The composition of the reagent mixture and the sequences of the oligonucleotides are as follows:
[0676] Primer mixture The primer sequences listed in Example B.2 and the primers listed in the table below were used, with each primer at a concentration of 2.5 μM.
[0677]
[0678]
[0679] The mediator probe mixture was prepared from the sequences listed in Example B.2 and the following elements, all of which contained a phosphate 3' modification (no 5' modification), and each mediator probe was mixed at 5 μM ({X} represents LNA):
[0680]
[0681] • The m-reporter strand mix and c-reporter strand mix were prepared in the same concentrations and sequence as described in Example B.2.
[0682] PCR sample preparation
[0683] As in Example B.2, the experiment was performed at four primer mix concentrations and two mediating probe concentration combinations, with an approximate concentration of 100 cp / μL for each of the 15 targets. A negative control (NTC, no template control) with no template was also performed for each condition. Both the positive and negative controls were repeated twice.
[0684] In addition to the above DNA template mixture and oligonucleotide mixture, a PCR product from Stilla Technology (Stilla Technologies, 1, Mail du Professeur Georges Mathé-94800 Villejuif, France) was also used. PCR mixture.
[0685] The detailed mixture preparation for each of the sixteen experimental conditions is as follows:
[0686]
[0687]
[0688]
[0689] Chip loading and dPCR run
[0690] PCR samples were loaded onto Ruby Chip consumables (Stilla Technologies, 1, Mail du Professeur Georges Mathé-94800 Villejuif, France) and processed in a Geode instrument according to standard procedures. Conventional Ruby partitioning and release procedures were used, along with the cycling PCR program described below:
[0691] Initial denaturation: 95°C for 3 minutes
[0692] 60 cycles: 95°C for 15 seconds, then 58°C for 60 seconds
[0693] After the dPCR run, scan the chip using a Prism6 reader with the following exposure times:
[0694] Blue 500ms;
[0695] Cyan: 800ms
[0696] Green: 250ms
[0697] Yellow: 350ms
[0698] Red 1000ms; and
[0699] Infrared 1000ms.
[0700] Data Analysis
[0701] Data analysis was performed using CrystalMiner software. The same compensation matrix was used as in Example B.2.
[0702] Set 1D thresholds for each color channel to define negative and positive populations, such as Figure 13 The optimal conditions for setting 1D thresholds in all six color channels were obtained using 0.5 μM primer and 0.5 μM mediator.
[0703] Next, color assignments were set for each target sequence in the Population Editor section of the software. For example, PhiX174 was defined as a population that was positive in the cyan and red channels and negative in all other channels. After population editing, the results were exported and the quantitative results reviewed. For each of the fifteen targets, the experimentally measured concentrations were in good agreement with the theoretical concentration of 100 cp / μL, as shown in Figure 2. Figure 14 .
[0704] Example 3: For each target sequence, three different colored Probes to implement the color combination method of the present invention
[0705] Materials and Methods
[0706] Forward and reverse primers for different target sequences (see table below) were used at a concentration of 0.5 μM.
[0707] Three probes with different fluorophores and quenchers were used for each target sequence at a concentration of 0.25 μM. The color combinations applied for each target sequence were as follows: ESR1 L536P (green, yellow, and infrared), PhiX 174 (yellow, red, and infrared), and ALB (yellow, red, and cyan).
[0708]
[0709]
[0710]
[0711] Supplier details are as follows:
[0712] Kaneka Eurogentec SA-5Rue Bois Saint-Jean,4102Seraing,Belgium;
[0713] IDT - Integrated DNA Technologies, Inc. - 1710 Commercial Park - Coralville, Iowa 52241 – USA.
[0714] The target sequence for this assay was double-stranded synthetic DNA (“gBlocks TM " fragment, SEQ ID NO: 152-166), which corresponds to the amplicon, was used at the following concentrations:
[0715] ESR1 L536P: 450 cps / μL
[0716] PhiX 174: 450 cps / μL
[0717] ALB: 600 cps / μL.
[0718] When performing PCR, a fluorescent dye is added to the reaction. Multiplex PCR mixtures (Stilla Technologies, 1, Mail du Professeur Georges Mathé-94800 Villejuif, France) were prepared. 4% (vol / vol) DMSO was included in the reaction to improve component stability. 7 μl of the reaction was loaded onto an Opal chip (Stilla Technologies, 1, Mail du Professeur Georges Mathé-94800 Villejuif, France). Negative controls (no DNA) and single-color controls were included to control the reactions and to establish matrix compensation.
[0719] Partitioning and PCR cycling were performed in a Geode instrument (Stilla Technologies, 1, Mail du Professeur Georges Mathé - 94800 Villejuif, France).
[0720] The cycling PCR program had an initial denaturation step at 95°C for 3 minutes, followed by 60 cycles of 95°C for 15 seconds and 62°C for 30 seconds as denaturation and hybridization-extension temperatures, respectively.
[0721] The chip was then depressurized (returned to atmospheric pressure) at 5 mbar / s at 25° C. The chip was imaged using a Prism 6 imager (Stilla Technologies, 1, Mail du Professeur Georges Mathé-94800 Villejuif, France) with the following exposure times:
[0722] Blue 125ms;
[0723] ·Cyan 400ms;
[0724] Green: 125ms
[0725] Yellow: 175ms
[0726] Red 500ms; and
[0727] Infrared 500ms.
[0728] The data were analyzed using Crystal Miner software (Stilla Technologies, 1, Mail du Professeur Georges Mathé - 94800 Villejuif, France). For matrix compensation, a single color control was used. A threshold was set to separate negative droplets from the remaining droplets. This was typically done on a 1D dot plot view. In the next step, a population editor in the Crystal Miner software was used to define populations for each target sequence. For example, for the Phix174 target sequence, positive droplets were designated as those that were positive for infrared, red, and yellow, while droplets that did not show fluorescence were counted as negative droplets. Droplets that showed any other combination of colors were excluded from the analysis ( Figure 9 ).
[0729] result
[0730] By obtaining the number of positive droplets for each target sequence according to the method of the present invention, the concentration of the target sequence in the sample and other characteristics can be estimated.
[0731] After population editing, the results were exported and the quantitative results were reviewed. For each of the three targets, the experimentally measured concentrations were in good agreement with the theoretical concentrations:
[0732] Concentration, cps / μL Uncertainty percentage ESR1 445.8 5.91 Phyx 459.3 5.82 ALB 606.1 5.02
[0733] Example 4: Using 2 types per target Probes to achieve color combinations, combined with single Probes detect the final target: 10 target sequences - 2 colors per target sequence - and one gene in a single color
[0734] Materials and Methods
[0735] Forward and reverse primers for different target sequences (see table below) were used at a concentration of 0.5 μM.
[0736] Two probes with different fluorophores and quenchers were used for each target sequence, except for one target sequence. Details of the primers, probes with dyes and quenchers, and the concentrations used are listed in the table below.
[0737] The color combinations applied to each target sequence are as follows: ESR1 L536P (blue and cyan), PhiX 174 (infrared and yellow), PBR322 (blue and infrared), ALB (blue and green), Lambda (yellow and cyan), puc18 (infrared and cyan), TP53 R282W (cyan and green), TP53 R248WT (yellow and green), MRM1 (infrared and green), ESR1E380WT (blue and yellow), and Del19ref (green).
[0738]
[0739]
[0740]
[0741]
[0742]
[0743] In SEQ ID NO:98, "+" corresponds to the LNA nucleic acids at positions 2, 5, and 6 of SEQ ID NO:99.
[0744] Supplier details are as follows:
[0745] -Kaneka Eurogentec SA-5Rue Bois Saint-Jean,4102Seraing,Belgium;
[0746] -IDT - Integrated DNA Technologies, Inc. - 1710 Commercial Park - Coralville, Iowa 52241 – USA.
[0747] The target sequence for this assay was double-stranded synthetic DNA (“gBlocks TM " fragments, which correspond to amplicons, were used at an approximate concentration of 100 cps / μL, with the exception of ESR1 E380WT, which was approximately 200 cps / μL, and ALB, which was approximately 160 cps / μL.
[0748] When performing PCR, add a fluorescent-free PCR mixture (Stilla Technologies, 1, Mail du Professeur Georges Mathé-94800 Villejuif, France). To improve component stability, 4% (vol / vol) DMSO was included in the reaction. 7 μL of the reaction was loaded onto an Opal chip (Stilla Technologies, 1, Mail du Professeur Georges Mathé-94800 Villejuif, France). Negative controls (no DNA) and single-color controls were added to control the reaction and establish matrix compensation.
[0749] Partitioning and PCR cycling were performed in a Geode instrument (Stilla Technologies, 1, Mail du Professeur Georges Mathé - 94800 Villejuif, France).
[0750] The cycling PCR program had an initial denaturation step at 95°C for 3 minutes, followed by 60 cycles of 95°C for 15 seconds and 62°C for 30 seconds as denaturation and hybridization-extension temperatures, respectively.
[0751] The chip was then depressurized (returned to atmospheric pressure) at 5 mbar / s at 25° C. The chip was imaged using a Prism 6 imager (Stilla Technologies, 1, Mail du Professeur Georges Mathé-94800 Villejuif, France) with the following exposure times:
[0752] Blue 125ms;
[0753] Cyan: 350ms
[0754] Green: 125ms
[0755] Yellow: 150ms
[0756] Red 500ms; and
[0757] Infrared 500ms.
[0758] Data were analyzed using Crystal Miner software (Stilla Technologies, 1, Mail du Professeur Georges Mathé-94800 Villejuif, France). For matrix compensation, single-color controls were used.
[0759] Set a threshold to separate negative droplets from the rest. This is typically done on a 1D spot map view.
[0760] In the next step, the population editor in Crystal Miner software was used to define populations for each target sequence. For example, for the Phix174 target sequence, positive droplets were designated as those that were positive for infrared and yellow. In addition, droplets that showed no fluorescence were counted as negative droplets. Droplets that showed any other color combination were excluded from the analysis ( Figure 10 ).
[0761] result
[0762] In this way, the number of droplets positive for a target sequence can be retrieved and other properties such as the concentration of said target sequence in the sample can be estimated.
[0763] Example 5: Effect of Ac-reporter length and tag sequence Tm on probe / CSSFR structure optimization
[0764] In this example, the effect of the length of the c-reporter and the length of the tag sequence included in the mediating probe was studied. A mediating probe was used to activate a cyan universal reporter to detect a target (PhiX174) in single color. Four different mediating probes were tested with increasing tag sequence lengths (13, 15, 18, and 21 nucleotides), thereby increasing the Tm value when bound to the m-reporter. For each mediating probe, two different c-reporters were evaluated, with lengths of 18 or 24 nucleotides.
[0765] Materials and Methods
[0766] For the target sequence, double-stranded synthetic DNA corresponding to the PhiX 174 amplicon was used ("gBlocks TM " fragment, SEQ ID NO: 152-166), with an estimated concentration of 1000 cp / μL (10x).
[0767] The Tm values of the tag sequence and the c-reporter when bound to the m-reporter were estimated using the IDT online tool (https: / / eu.idtdna.com / calc / analyzer) using the following parameters:
[0768] Oligonucleotide concentration: 0.5 μM
[0769] ·Na + Concentration: 50mM
[0770] Mg ++ Concentration: 5mM
[0771] dNTP concentration: 0.2 μM
[0772] All oligonucleotides were purchased from Kaneka Eurogentec SA (5 Rue Bois Saint-Jean, 4102 Seraing, Belgium). In a preliminary step, primers, probes, and linear reporters (one m-reporter strand containing a binding site for the flap sequence and a fluorophore, and a second c-reporter strand complementary to the m-reporter strand, carrying a quencher) were assembled in unique stock solutions for each reagent type. The composition of the reagent mixture and the sequences of the oligonucleotides are as follows:
[0773] Primer mixture: The primer sequences listed in the table below were used, with each primer at a concentration of 5 μM.
[0774]
[0775]
[0776] Each mediator probe was prepared individually at a concentration of 5 μM. All probes contained a phosphate 3' modification (no 5' modification). The sequences are as follows:
[0777]
[0778] *Tm when the tag sequence binds to the m-reporter
[0779] Teal_m-reporter mixture labeled cyan was prepared at 5 μM. The sequence is described in the previous example.
[0780] Each c-reporter strand was prepared individually at 5 μM and contained a BHQ1 quencher at the 3' position. The sequences are as follows:
[0781]
[0782] *Tm when c-reporter binds to m-reporter
[0783] PCR sample preparation
[0784] Each combination of mediator probe and c-reporter was tested separately. The target concentration was approximately 100 cp / μL. For the mediator probe carrying a 15-nucleotide tag, a negative control (NTC, no template control) without template was also performed.
[0785] In addition to the above DNA template mixture and oligonucleotide mixture, a PCR product from Stilla Technology (Stilla Technologies, 1, Mail du Professeur Georges Mathé-94800 Villejuif, France) was also used. Multiplex PCR mix.
[0786] The detailed mixtures for each condition were prepared as follows:
[0787]
[0788]
[0789] Chip loading and dPCR run
[0790] PCR samples were loaded onto Sapphire chips (Stilla Technologies, 1, Mail du Professeur Georges Mathé-94800 Villejuif, France) and processed in a Geode instrument according to standard procedures. The conventional Sapphire partitioning and release procedures were used, as well as the cycling PCR program described below:
[0791] Initial denaturation: 95°C for 3 minutes
[0792] 45 cycles: 95°C for 15 seconds, then 58°C for 30 seconds
[0793] After the dPCR run, the chip was scanned using the Prism6 reader and the standard Sapphire scanning template (ScanningTemplate_Prism6_SapphireChip_naica-multiplex-PCR-MIX_Taqman_v1.4).
[0794] Data Analysis
[0795] Data analysis was performed using CrystalMiner software. 1D thresholds were set for the cyan channel to define negative and positive populations, as Figure 15 After 1D thresholding, the results were exported and the quantitative results and separation scores were reviewed. The results are shown below:
[0796]
[0797] Regarding the length of the c-reporter, the separation between the positive and negative populations was very low, and it was not possible to set a threshold using the longest c-reporter. For the mediating probes carrying the longest tag sequences (21 and 18 nucleotides), the quantitative results were inconsistent with the target concentration, and the separation scores were less than 5 under all conditions. In contrast, when shorter c-reporters were used, better separation was obtained, and thresholds could be set for three of the four mediating probes tested. The quantitative results obtained for these three mediating probes were close to the target concentration. These results may be explained by the potential competition between the c-reporter and the m-reporter complementary chain formed by extension of the released tag sequence. The higher the length and Tm of the c-reporter, the stronger the competition.
[0798] In terms of tag sequence length, the longest tag sequence (21 nt) did not show good separation, while the thresholds for the other three mediating probes could be easily set when using the shortest c-reporter. The best separation score was obtained with the mediating probe carrying the shortest tag sequence. In fact, the separation scores of the mediating probes with tag sequences of 13 and 15 nucleotides were both higher than 6. This may be explained by the Tm characteristics of the tag sequence when it is linked to the m-reporter relative to the Tm characteristics of the sequence-specific part of the mediating probe when it is linked to the target. In fact, the mediating probe must first hybridize to the target to release the tag sequence during extension, and then the tag sequence will hybridize to the m-reporter to generate a signal. Therefore, the Tm of the specific part of the sequence should be higher than the Tm of the tag sequence. In this model, the Tm of the specific part of the probe when bound to the target is estimated to be 69.2°C. The difference in Tm between the specific part of the probe and the tag sequence is shown below:
[0799]
[0800] *Tm when the tag binds to the m-reporter
[0801] **Tm(probe specific part / target)-Tm(label / m-reporter)
[0802] A Tm difference of 4.4°C did not appear to be sufficient for efficient tag release, whereas good results were observed using a specific probe with a Tm 9.6°C higher than the mediating probe tag sequence.
[0803] Effect of Bm-reporter concentration
[0804] In this example, the effect of m-reporter concentration was investigated. Increasing concentrations of cyan m-reporter (0.1-0.75 μM) were tested. A single mediator probe was used to activate a cyan universal reporter for single-color detection of a single target (PhiX 174). The three best mediator probes described in Example 5A were tested in combination with four different cyan m-reporter concentrations.
[0805] Materials and Methods
[0806] For the target sequence, double-stranded synthetic DNA corresponding to the PhiX amplicon was used ("gBlocks TM " fragment, SEQ ID NO: 152-166), with an estimated concentration of 1000 cp / μL (10x).
[0807] All oligonucleotides were purchased from Kaneka Eurogentec SA (5 Rue Bois Saint-Jean, 4102 Seraing, Belgium). In a preliminary step, primers, probes, and linear reporters (one m-reporter strand containing a binding site for the flap sequence and a fluorophore; and a c-reporter strand complementary to the m-reporter strand, which carries a quencher) were assembled in unique stock solutions for each reagent type. The composition of the reagent mixture and the sequences of the oligonucleotides are as follows:
[0808] Primer mixture The primer sequences described in Example 5A were used, and the concentration of each primer was 10 μM.
[0809] • Mediating probes carrying tag sequences of 13, 15 or 18 nucleotides have been prepared at a concentration of 5 μM, respectively. The sequences are described in Example B.2.
[0810] Teal_m-reporter mixture labeled cyan was prepared at 5 μM. The sequence is as described in the previous example.
[0811] The 18-nucleotide c-reporter chain (Teal_c-reporter_v3) was prepared separately at 5 μM. The sequence is as follows:
[0812] PCR sample preparation
[0813] Experiments were performed for each mediator probe individually with increasing concentrations of the cyan m-reporter. Under each condition, the ratio of m-reporter to c-reporter was kept constant, with the c-reporter concentration being 1.5 times that of the m-reporter. The target concentration was approximately 100 cp / μL.
[0814] In addition to the above DNA template mixture and oligonucleotide mixture, a PCR product from Stilla Technology (Stilla Technologies, 1, Mail du Professeur Georges Mathé-94800 Villejuif, France) was also used. Multiplex PCR mix.
[0815] The detailed mixture preparation for each mediator probe tested is as follows:
[0816]
[0817]
[0818] Chip loading and dPCR run
[0819] PCR samples were loaded onto Sapphire chips (Stilla Technologies, 1, Mail du Professeur Georges Mathé-94800 Villejuif, France) and processed in a Geode instrument according to standard procedures. The conventional Sapphire partitioning and release procedures were used, as well as the cycling PCR program described below:
[0820] Initial denaturation: 95°C for 3 minutes
[0821] 45 cycles: 95°C for 15 seconds, then 58°C for 30 seconds
[0822] After the dPCR run, the chip was scanned using the Prism6 reader and the standard Sapphire scanning template (ScanningTemplate_Prism6_SapphireChip_naica-multiplex-PCR-MIX_Taqman_v1.4).
[0823] Data Analysis
[0824] Data analysis was performed using CrystalMiner software. 1D thresholds were set for the cyan channel to define negative and positive populations, as Figure 16 After 1D thresholding, the results were exported and the quantitative results and separation scores were reviewed. The results are shown below:
[0825]
[0826]
[0827] For the three mediator probes tested, separation between positive and negative populations was very poor at high concentrations of m-reporter. It was impossible to set a threshold at the highest m-reporter concentration, and quantification results were inconsistent with target concentration. Conversely, lowering the m-reporter concentration improved results and enabled correct threshold setting, resulting in accurate quantification. The best results were obtained with mediator probes carrying tag sequences of 18 and 15 nucleotides and the lowest m-reporter concentrations (0.1 and 0.25 μM).
[0828] References
[0829] [1]Q.Zhong,S.Bhattacharya,S.Kotsopoulos,J.Olson,V.Taly,A.D.Grifiths,D.R.Link,J.W.Larson,Multiplex digital PCR:breaking the one target per colorbarrier of quantitative PCR,Lab Chip 11(13)(2011)2167;
[0830] [2]V.Taly,D.Pekin,L.Benhaim,S.K.Kotsopoulos,D.Le Corre,X.Li,I.Atochin,D.R.Link,A.D.Griffiths,K.Pallier,H.Blons,O.Bouche,B.Landi,J.B.Hutchison,P.Laurent-Puig,Multiplex Picodroplet Digital PCR to Detect KRASMutations inCirculating DNA from the Plasm a of Colorectal Cancer Patients,Clin.Chem.59(12)(2013)1722–1731
[0831] [3]A.S.Whale,J.F.Huggett,S.Tzonev,Fundamentals of multiplexingwithdigital PCR,BDQ(May)(2016)
[0832] [4]Loic Lindner,Pauline Cayrou,Sylvie Jacquot,Marie-ChristineBirling,Yann Herault,Guillaume Pavlovic,Reliable and robust droplet digitalPCR(ddPCR)and RT-ddPCR protocols for mouse studies,Methods,Volume 191,2021,Pages 95-106,
[0833] [5]T.Weissensteiner,J.S.Lanchbury,Strategy for controllingpreferentialamplification and avoiding false negatives in PCR typing,BioTechniques 21(December(6))(1996)1102–1108
[0834] [6]Marras SAE,Tyagi S,Antson DO,Kramer FR.Color-codedmolecularbeacons for multiplex PCR screening assays.PLoS One.2019 Mar18;14(3):e0213906
[0835] [7]Alexandra S.Whale,Jim F.Huggett,Svilen Tzonev,Fundamentalsofmultiplexing with digital PCR,Biomolecular Detection and Quantification,Volume 10,2016,Pages 15-23
[0836] [8]Benjamin J Hindson 1,Kevin D Ness,Donald A Masquelier,PhillipBelgrader,Nicholas J Heredia,Anthony J Makarewicz,Isaac J Bright,MichaelY Lucero,Amy L Hiddessen,Tina C Legler,Tyler K Kitano,Michael R Hodel,Jonathan F Petersen,Paul W Wyatt,Erin R Steenblock,Pallavi H Shah,LucJBousse,Camille B Troup,Jeffrey C Mellen,Dean K Wittmann,Nicholas GErndt,Thomas H Cauley,Ryan T Koehler,Austin P So,Simant Dube,Klint ARose,LuzMontesclaros,Shenglong Wang,David P Stumbo,Shawn P Hodges,Steven Romine,FredP Milanovich,Helen E White,John F Regan,George AKarlin-Neumann,Christopher MHindson,Serge Saxonov,Bill W Colston,High-throughput droplet digital PCRsystem for absolute quantitation of DNAcopy number,Anal Chem.2011 Nov 15;83(22):8604-10.doi:10.1021 / ac202028g.Epub 2011 Oct 28.
[0837] [9]J Madic,A Zocevic,V Senlis,E Fradet,B Andre,S Muller,R Dangla,M EDroniou,Three-color crystal digital PCR,Biomol Detect Quantif.2016 Nov3;10:34-46.doi:10.1016 / j.bdq.2016.10.002
[0838]
[10] Hinson et al.,2011,Anal.Chem.83:8604-8610;Pinheiro et al.,2012,Anal.Chem.84:1003-1011
[0839]
[11] Qiuying Huang,Dongmei Chen,Chen Du,Qiaoqiao Liu,Su Lin,LanlanLiang,Ye Xu,Yiqun Liao,Qingge Li,Highly multiplex PCR assays by coupling the5'-flap endonuclease activity of Taq DNA polymerase andmolecular beaconreporters,Proc Natl Acad Sci U S A.2022 Mar1;119(9):e2110672119.
[0840]
[12] James A.Richardson,Trevor Morgan,Michael Andreou and TomBrown,Useof a large Stokes-shift fluorophore to increase the multiplexingcapacity of apoint-of-care DNA diagnostic device,Analyst,issue 13,2013
[0841]
[13] Maksim V Sednev,Vladimir N Belov and Stefan W Hell,Fluorescentdyeswith large Stokes shifts for super-resolution optical microscopy ofbiologicalobjects:a review,Methods Appl.Fluoresc.3 042004
[0842]
[14] Basu AS;Digital Assays Part I:Partitioning Statistics and DigitalPCR;SLASTechnol.,August 2017;22(4);pages:369-386
[0843]
[15] Schlenker F et al.Cancers 2021,13,5742
[0844]
[16] Huang Q.et al,PNAS 2022,Vol.119,N°9
[0845]
[17] Whale AS et al,Fundamentals of multiplexing with digitalPCR.Biomol DetectQuantif.2016 May 27:10:15-23。
Claims
1. A multiplex digital PCR (dPCR) method for detecting and / or quantifying the presence of a set of at least five different nucleic acid target sequences (TS) in a biological sample containing nucleic acid molecules, the method comprising: a) contacting the sample with a probe carrying a fluorophore that can directly or indirectly bind to TS; Each target sequence i (TSi) is represented by k i Characterization of different fluorophore types, k i Greater than or equal to 2; b) separating the sample into a set of partitions; c) exponentially amplifying the TS in the presence of a PCR reaction mixture; d) for each partition, measuring the fluorescence intensity of each fluorophore type; e) For each fluorophore type, count the following: - partitions where the fluorescence signal is below the positive threshold for said fluorophore type, - partitions having a fluorescence signal above said positive threshold for said fluorophore type, Thus determining: N0 = the total number of partitions with fluorescence signals below the positive threshold for all fluorophore types, ·N i = Fluorescence signal is higher than that of TSi alone i The total number of partitions with a positive threshold for each fluorophore type, f) processing the data collected in step e) to quantify the concentration of at least five TSi in the biological sample.
2. The method according to claim 1, wherein for each target sequence TSi, the concentration Ci thereof is calculated in step f) according to Poisson's law, preferably using the equation where v is the volume of the partition and d is the dilution factor used to dilute the biological sample into the microfluidic well for dPCR.
3. The method according to claim 1 or 2, wherein step e) further comprises determining N1, which corresponds to the total number of partitions with a fluorescence signal above a positive threshold for only one fluorophore type, and wherein in step f) the equation Calculate Ci.
4. The method according to any one of claims 1 to 3, wherein step d) further comprises setting a positive threshold intensity for each fluorophore type, wherein the positive threshold is preferably defined separately for each fluorophore type on a 1D map view and corresponds to an intensity value that distinguishes partitions showing high intensity of a fluorophore type from partitions showing low intensity of the same fluorophore type.
5. The method according to any one of claims 1 to 4, wherein k i For all target sequences i is constant and the fluorescence signal is higher than k i Bins with a positive threshold of +1 fluorophore type were not considered.
6. The method according to any one of claims 1 to 5, wherein for measuring the intensity of the fluorophore types, step d) uses a number n of different fluorescence detection channels, wherein n is greater than or equal to 4, preferably greater than or equal to 5, more preferably 6 or 7.
7. The method according to any one of claims 1 to 6, wherein if M is the total number of different fluorophore types carried by all probes, and if n is the number of different fluorescence detection channels used in step d) for measuring the intensity of the fluorophore types, then M is less than or equal to n.
8. The method according to any one of claims 1 to 7, wherein each of the at least five TSs is characterized by a unique combination of exactly two different fluorophore types.
9. The method according to any one of claims 1 to 8, wherein the probe carrying a fluorophore is a probe that directly binds to TSi, and the probe is preferably probes, each TSi is carried by a different type of fluorophore i The probes are specifically identified and their combination characterizes each TSi in a unique manner.
10. The method according to any one of claims 1 to 8, wherein the probe carrying a fluorophore is bound to a mediating probe, which directly binds to the TS and, once bound, releases a tag complementary to a tag complementary sequence (TCS) located on a fluorescent detection molecule carrying a quencher group and a fluorophore, and once released, its fluorescence changes due to the hybridization or extension of the tag sequence of the mediating probe on the TCS on the detection molecule. The method according to claim 10 , wherein the fluorescent detection molecule is a universal reporter detection molecule, preferably a molecular beacon reporter or a complementary single-stranded fluorescent detection reporter (CSSFR).
12. The method according to any one of claims 1 to 11, wherein for each partition, the fluorescence signal intensity of the fluorophore type is measured using the signal of the fluorescence detection channel used in step d) for measuring the intensity of the fluorophore type by applying a previously generated fluorescence compensation matrix.
13. The method according to any one of claims 1 to 12, wherein the sample concentration is adjusted before partitioning so that the maximum concentration of TS is 200 cp / μL.
14. The method of any one of claims 1-13, wherein at least one of the fluorophore types is one of the Large Stokes Shift Dyes (LSSD).
15. Computer program product comprising instructions which, when the program is executed by a computer, cause the computer to perform steps e) and f) of the method according to any one of claims 1 to 14.
Citation Information
Patent Citations
Bifunctional oligonucleotide probe for universal real time multianalyte detection
EP2776585A1
Three-dimensional sample scanning system
WO2022063845A1