Method for detecting target nucleic acids

The method addresses the limitation of fluorescent wavelength constraints in real-time PCR by using multiple primer sets and probes to discriminate multiple target nucleic acids at a single wavelength, enhancing the detection of pathogenic variants for diseases like citrin deficiency.

WO2026004461A1PCT designated stage Publication Date: 2026-01-02SEKISUI MEDICAL CO LTD
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
PCT/JP2025/019350
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-06-26
Filing Date
2025-05-28
Publication Date
2026-01-02

AI Technical Summary

Technical Problem

Existing real-time PCR methods using fluorescently labeled probes are limited by the number of available fluorescent wavelengths, making it difficult to perform multiplex measurements of five or more target genes simultaneously, particularly in the context of diseases like citrin deficiency with multiple pathogenic variants.

Method used

A method for discriminating target nucleic acids using simultaneous multiplex real-time PCR, involving the use of multiple primer sets and fluorescently labeled probes, with specific design features to allow discrimination of multiple target nucleic acids at a single fluorescence wavelength, including steps for amplification, Ct value comparison, and fluorescence value comparison.

Benefits of technology

Enables simultaneous detection and discrimination of multiple target nucleic acids, including pathogenic variants, without the need for cumbersome signal subtraction processes, facilitating early diagnosis of diseases like citrin deficiency.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 00000042_0000
    Figure 00000042_0000
  • Figure 00000042_0001
    Figure 00000042_0001
  • Figure 00000043_0000
    Figure 00000043_0000
Patent Text Reader

Abstract

The present disclosure provides a method for detecting target nucleic acids that enables simultaneous detection of a plurality of target nucleic acids at one fluorescence wavelength using a comparatively simple method, and that is useful for testing for diseases having numerous pathogenic variants, such as citrin deficiency. The method for detecting target nucleic acids according to the present disclosure includes steps (a) and (b)-(c) and / or (d)-(e), and makes it possible to detect two or more target nucleic acids included in a sample using simultaneous multiplex real-time PCR. (a) A step in which the sample, a primer set, and a fluorescence-labeled probe are brought into contact and the target nucleic acids in the sample are amplified. (b) A step in which amplification curves based on step (a) are created, and Ct values are obtained from a set threshold value. (c) A step in which a set Ct value and the Ct values obtained in step (b) are compared for each target nucleic acid. (d) A step in which amplification curves based on step (a) are created, and fluorescence values within a set number of cycles are obtained. (e) A step in which a fluorescence value within a set number of cycles and the fluorescence values obtained in step (d) are compared for each target nucleic acid.
Need to check novelty before this filing date? Find Prior Art

Description

Method for distinguishing target nucleic acids

[0001] The present disclosure relates to a method for distinguishing a target nucleic acid.

[0002] A typical method for detecting a target nucleic acid involved in a disease is real-time PCR using a fluorescently labeled probe (see Patent Documents 1 and 2).

[0003] One example of a device to which real-time PCR can be applied is the "LightCycler® 96 System" (Roche), which allows for a combination of up to four types of fluorescence measurement using four filters. The present inventors have already constructed a simultaneous multiplex measurement system that detects a total of four genes, including the required genes TREC, KREC, and SMN1, plus an internal standard gene, ribonuclease P (referred to as RNase P), using four types of fluorescence measurement, in anticipation of genetic testing for, for example, primary immunodeficiency and spinal muscular atrophy as screening items for newborns (see Patent Document 1, etc.).

[0004] Patent No. 6761093 Patent No. 7063886

[0005] In real-time PCR using fluorescently labeled probes, theoretically one fluorescent substance is selected for one target nucleic acid. Therefore, when detecting multiple target nucleic acids, the types of fluorescent wavelengths available on the device are limited, limiting its application to simultaneous multiplex measurements, which detect multiple target nucleic acids simultaneously in a single amplification reaction.

[0006] As mentioned above, the inventors have already constructed a simultaneous multiplexed measurement system that detects four genes using four types of fluorescence measurement. Given the need for early diagnosis and treatment of the two diseases mentioned above, this system is becoming increasingly popular in Japan as an expanded screening test for neonatal disease. However, among the congenital metabolic disorders currently detected in publicly funded newborn mass screening tests in Japan, some diseases, such as citrin deficiency, have many false negatives, and screening tests that measure metabolites are not satisfactory. The causative genes for some of these diseases have been identified; for example, it has been reported that pathogenic variants (also called pathogenic mutations) of the SLC25A13 gene are involved in the onset of citrin deficiency. There are many types of pathogenic variants for this disease, but the variants that are particularly prevalent in Japanese people are six types with high allele frequencies, which are said to cover more than 90% of cases. Therefore, it is expected that the presence or absence of variants in the causative gene will be detected in newborn screening. However, the fluorescent wavelengths of general thermal cycler devices for real-time PCR are limited, making it difficult to perform multiplex measurements of five or more target genes in a single run.

[0007] In Patent Document 2, multiple oligonucleotide probes labeled with the same fluorescent dye molecule having different Tm (melting temperature) values ​​and non-complementary tag portions and quenching molecules are used, enabling detection of multiple target nucleic acids with a single fluorescent dye. However, specific features are required in the design of the tag portion and quenching molecule of the probe oligonucleotide, and a process of subtracting signals obtained at different Tm temperatures is required to obtain a calculated signal, which requires cumbersome work.

[0008] The present disclosure has been made in consideration of the above-described current situation, and aims to provide a method for discriminating target nucleic acids that can simultaneously discriminate multiple target nucleic acids using a single fluorescence wavelength in a relatively easy manner, and that is also useful for testing diseases with multiple pathogenic variants, such as citrin deficiency.

[0009] Disclosure 1 provides a method for discriminating target nucleic acids by simultaneous multiplex real-time PCR, comprising the steps of (a) and (b) to (c) and / or (d) to (e) below, for discriminating two or more target nucleic acids contained in a sample. (a) A step of contacting the sample with a primer set and a fluorescently labeled probe to amplify the target nucleic acids in the sample. (b) A step of creating an amplification curve according to step (a) and obtaining a Ct value from a set threshold. (c) A step of comparing a Ct value set for each target nucleic acid with the Ct value obtained in step (b). (d) A step of creating an amplification curve according to step (a) and obtaining a fluorescence value within a set number of cycles. (e) A step of comparing a fluorescence value within a set number of cycles for each target nucleic acid with the fluorescence value obtained in step (d).

[0010] Disclosure 2 is a discrimination method according to Disclosure 1, in which two or more primer sets (1) each consisting of one type of forward primer and one type of reverse primer are used as the primer set, and / or one or more primer sets (2) each including two or more types of at least one of a forward primer and a reverse primer and one or more types of the other.

[0011] Disclosure 3 is the discrimination method of Disclosure 2, in which two or more of the primer sets (1) are used as the primer sets, and two or more fluorescently labeled probes labeled with the same fluorescent label are used as the fluorescently labeled probes.

[0012] Disclosure 4 relates to the discrimination method of Disclosure 2, in which one or more of the primer sets (2) are used as the primer set, and one or more fluorescently labeled probes are used as the fluorescently labeled probe.

[0013] The present disclosure 5 is the method of any one of disclosures 1 to 4, wherein the step (a) is performed in the same container.

[0014] Disclosure 6 is any one of the discrimination methods of Disclosures 1 to 5, wherein the fluorescently labeled probes are modified at both ends of each of the target nucleic acids or are designed to sandwich each of the target nucleic acids.

[0015] Disclosure 7 is the discrimination method of any one of Disclosures 1 to 6, wherein, when setting the Ct value for each target nucleic acid in step (c), the difference between the center values ​​of each Ct value range for the same template amount is 5 or more, and the Ct value ranges do not overlap.

[0016] Disclosure 8 is a discrimination method according to any one of Disclosures 1 to 7, wherein, when setting the fluorescence values ​​within the cycle numbers set for each of the target nucleic acids in step (e), the ratio of the center values ​​of each fluorescence value range is 1.4 times or more, and the fluorescence value ranges for the set cycle numbers do not overlap.

[0017] Disclosure 9 is the method of any one of Disclosures 1 to 8, wherein the two or more target nucleic acids include at least one selected from the group consisting of a combination of different gene variants selected from deletion mutations, insertion mutations, and point mutations, and a combination of a first gene variant and a wild type of the first gene variant.

[0018] The present disclosure 10 is a method of any one of disclosures 1 to 9, wherein the sample used in step (a) is a piece of blood on a filter paper that has been soaked in blood and then dried, and is used directly without any pretreatment.

[0019] The present disclosure 11 relates to any one of the discrimination methods of the present disclosures 1 to 10, wherein the fluorescently labeled probe has a fluorescent substance moiety and a quencher moiety and includes a partial sequence complementary to a template for a nucleic acid amplification reaction, and the amplified target nucleic acid is detected by detecting fluorescence generated by irradiating the fluorescent substance moiety with excitation light. The present disclosure will be described in detail below.

[0020] According to the present disclosure, it is possible to provide a method for discriminating target nucleic acids (e.g., a method for identifying gene variants) that can simultaneously detect multiple target nucleic acids at a single fluorescent wavelength using a relatively easy method and is useful for testing diseases with multiple pathogenic variants, such as citrin deficiency.

[0021] 1 shows an amplification curve at the fluorescence wavelength of the fluorescent dye Cy5 (Example 1). 2 shows an amplification curve at the fluorescence wavelength of the fluorescent dye Red610 (Example 2). 3 shows an amplification curve at the fluorescence wavelength of the fluorescent dye Cy5 (Example 3). 4 shows an amplification curve at the fluorescence wavelength of the fluorescent dye Red610 (Example 4). 5 shows an amplification curve at the fluorescence wavelength of the fluorescent dye Hex (Example 5). 6 shows an amplification curve at the fluorescence wavelength of the fluorescent dye Hex (Example 6). 7 shows an amplification curve at the fluorescence wavelength of the fluorescent dye Red610 (Example 7). 8 shows an amplification curve at the fluorescence wavelength of the fluorescent dye Hex obtained in Example 8. 9 shows an amplification curve at the fluorescence wavelength of the fluorescent dye Red610 obtained in Example 8.

[0022] (Explanation of Terms) In this specification, "nucleic acid" means a polymer of nucleotides (polynucleotide). Nucleotides are ribonucleotides in RNA and deoxyribonucleotides in DNA, and may be either natural or non-natural. Examples of nucleic acids include DNA and RNA (including subunits such as cDNA and mRNA). Nucleic acids may be single-stranded or double-stranded.

[0023] "Target nucleic acid" refers to a nucleic acid or region thereof selected for extension, replication, amplification, and detection. The target nucleic acid is present in a sample before amplification. The target nucleic acid amplified by a PCR reaction is called an "amplification product." When the target nucleic acid is amplified, a new nucleic acid sequence is incorporated into the amplification product. The added nucleic acid sequence is part of the amplification product.

[0024] A "primer" is an oligonucleotide that has a base sequence complementary to a target nucleic acid and can act as a starting point for elongation. An oligonucleotide refers to a short polynucleotide, with a chain length of, for example, 1 to 200 nucleotides. A primer is typically a single-stranded nucleic acid, and has, for example, a first portion that is complementary to and hybridizes with the target nucleic acid, and a second portion that is complementary to and hybridizes with the probe. A set (pair) of primers that are set to sandwich the region to be amplified is called a "primer set." A primer set usually consists of a forward primer and a reverse primer.

[0025] A "probe" refers to a labeled oligonucleotide that forms a duplex structure with a target nucleic acid sequence due to at least partial complementarity between the probe and the target nucleic acid sequence. For example, a probe hybridizes to the second portion of a primer due to complementarity between the probe sequence and the second portion of the primer sequence. A probe labeled with a fluorescent substance is called a "fluorescently labeled probe."

[0026] "Real-time PCR" is a method for monitoring (detecting) the amplification process (i.e., the process of generating an amplified product) over time in PCR (polymerase chain reaction). Among real-time PCR methods, a method for simultaneously detecting multiple target nucleic acids in a single amplification reaction (PCR reaction) is called "simultaneous multiplex real-time PCR."

[0027] In real-time PCR, the amplification process is monitored using a fluorescent substance, and the curve graphed with the X-axis representing the amplification reaction cycle number (also referred to as the reaction cycle number) and the Y-axis representing the fluorescence value (also referred to as the fluorescence signal) resulting from the amplification reaction is called an "amplification curve." Depending on the thermal cycler, the fluorescence signal may be expressed in relative fluorescence units (RFU). The "Ct value (Threshold cycle)" represents the cycle number at which the amplification product reaches a certain amount (threshold), and is sometimes referred to as the "Cq value (Quantification cycle)." In other words, the Ct value (Cq value) is the cycle number at which the amplification curve intersects with the threshold.

[0028] (Method for Distinguishing Target Nucleic Acids) The method for distinguishing according to the present disclosure is a method for distinguishing two or more target nucleic acids contained in a sample by simultaneous multiplex real-time PCR.

[0029] The discrimination method includes the following step (a), and the following steps (b) to (c) and / or the following steps (d) to (e). That is, the discrimination method is any of an embodiment including the following steps (a) to (c), an embodiment including the following steps (a) to (e), or an embodiment including the following steps (a), (d), and (e), and may further include one or more other steps: (a) a step of contacting a sample with a primer set and a fluorescently labeled probe to amplify a target nucleic acid in the sample; (b) a step of creating an amplification curve according to the step (a) and obtaining a Ct value from a set threshold; (c) a step of comparing the Ct value set for each target nucleic acid with the Ct value obtained in the step (b); (d) a step of creating an amplification curve according to the step (a) and obtaining a fluorescence value at a set number of cycles; and (e) a step of comparing the fluorescence value at a set number of cycles for each target nucleic acid with the fluorescence value obtained in the step (d).

[0030] The step (b) is performed after the following step (a), and the step (c) is performed after the step (b). The step (d) is performed after the following step (a), and the step (e) is performed after the step (d). When the discrimination method includes the steps (a) to (e), the steps (b) and (d) may be performed in any order, or may be performed in parallel.

[0031] <Step (a)> Substances other than the sample that are subjected to the PCR reaction are referred to as "PCR reagents." The PCR reagents used in step (a) may include, in addition to a primer set and a fluorescently labeled probe, for example, a polymerase and a buffer. The buffer is not particularly limited as long as it has the function of suppressing the action of substances that inhibit DNA amplification reactions, such as positively charged substances (such as certain proteins) and negatively charged substances (such as certain sugars and pigments) present in the body fluids of living organisms.

[0032] The step (a) is preferably carried out in the same container, for example. A tube (also referred to as a PCR reaction tube) is suitably used as the container. The step (a) preferably includes, for example, an addition step of adding a sample and a PCR reagent to the PCR reaction tube, a reaction step of performing a PCR reaction with the tube sealed, and a detection step of detecting the amplification product amplified by the PCR reaction over time with the sample present in the tube.

[0033] (Addition step) The sample subjected to the above step (a) is a sample suspected of containing two or more target nucleic acids. The sample is preferably blood, and more preferably blood on filter paper that has been soaked in blood and then dried. Examples of samples include, but are not limited to, blood on filter paper collected from the heel of a newborn in newborn mass screening, and blood on filter paper collected at the same time as optional screening. Hereinafter, "blood on filter paper that has been soaked in blood and then dried" will also be simply referred to as "dried blood on filter paper."

[0034] The dried blood spot can be obtained by soaking filter paper in blood, drying it, and then using a punching tool to extract a paper strip with a punched hole (hereinafter simply referred to as a "punched strip"). The size of the punched strip cut from the dried blood spot must be within an appropriate range of blood content, so it is preferably 1.2 to 2.0 mm in diameter, more preferably 1.5 to 1.8 mm. Furthermore, the amount of whole blood contained in the punched strip is preferably 0.95 v / v % to 6.6 v / v % relative to the total PCR reaction solution volume, more preferably 1.4 v / v % to 5.2 v / v %. In the step (A) above, it is particularly preferable to use dried blood spot obtained by soaking filter paper in whole blood and then drying it as the nucleic acid sample, and to use a circular punched strip with a diameter of 1.2 mm to 2.0 mm that contains 0.95 v / v % to 6.6 v / v % of whole blood relative to the total reaction solution volume.

[0035] The sample is preferably a section of blood on a filter paper (dried blood) that has been soaked in blood and then dried, and used directly without pretreatment. Samples that have not undergone pretreatment may typically contain substances that inhibit DNA amplification, such as hemoglobin contained in blood or precipitates of blood components generated by thermal denaturation during PCR. However, for example, if the punched piece is used as the sample and the PCR reaction is performed in a PCR reaction tube sealed with a cap, the floating of blood component precipitates and the punched piece itself can be sufficiently suppressed. This allows the blood on the filter paper to be directly subjected to PCR without the need for complicated pretreatment, such as separation and purification, from the dried blood, without affecting fluorescence measurement.

[0036] In the step (a), at least one or more primer sets are used. In particular, in the step (a), it is preferable to use two or more of the following primer sets (1) or one or more of the following primer sets (2). Primer set (1): A primer set consisting of one type of forward primer and one type of reverse primer. Primer set (2): A primer set including two or more types of at least one of a forward primer and a reverse primer, and one or more types of the other.

[0037] Specific examples of the use of two or more primer sets (1) include an embodiment in which two or more primer sets corresponding to two or more target nucleic acids to be distinguished are used. That is, the two or more primer sets preferably include a first primer set and a second primer set corresponding to different target nucleic acids.

[0038] Examples of the primer set (2) include a primer set consisting of two types of forward primers and one type of reverse primer (i.e., a common reverse primer), and a primer set consisting of two types of reverse primers and one type of forward primer (i.e., a common forward primer).

[0039] The use of one or more primer sets (2) is suitable, for example, when a gene variant (also referred to as a "first gene variant") is to be distinguished from a wild-type of the first gene variant. In this case, for example, when a primer set consisting of two forward primers and one common reverse primer is used as the primer set (2), the common reverse primer can be used both as a reverse primer for the first gene variant and as a reverse primer for the wild-type.

[0040] The molar concentration (final concentration) of each primer set is preferably 0.1 to 1.0 μM, more preferably 0.2 to 0.5 μM.

[0041] When two or more primer sets (1) are used in step (a), it is preferable to use two or more fluorescently labeled probes labeled with the same fluorescent substance. Specifically, probes corresponding to two or more target nucleic acids to be distinguished and labeled with the same fluorescent substance are used. For example, the two or more fluorescently labeled probes include a first probe and a second probe corresponding to different target nucleic acids, and it is preferable that these first probe and second probe are labeled with the same fluorescent substance.

[0042] When one or more of the primer sets (2) are used in step (a), it is preferable to use one or more fluorescently labeled probes as the fluorescently labeled probes. For example, when a first gene variant and a wild-type of the first gene variant are to be distinguished from each other, if one fluorescently labeled probe is used, the fluorescently labeled probe can be used both as a probe for the first gene variant and as a probe for the wild-type.

[0043] The molar concentration (final concentration) of each fluorescently labeled probe is preferably 0.01 to 0.3 μM, more preferably 0.03 to 0.15 μM.

[0044] Each fluorescently labeled probe is preferably designed to sandwich the target nucleic acid. That is, each fluorescently labeled probe is preferably modified at both ends of the target nucleic acid, more preferably modified at both ends with a fluorescent substance and a quencher, respectively, and even more preferably has a fluorescent substance moiety and a quencher moiety and includes a partial sequence complementary to a template for a nucleic acid amplification reaction. When such a fluorescently labeled probe is used, the discrimination method of the present disclosure can detect the amplified target nucleic acid by detecting fluorescence generated by irradiating the fluorescent substance moiety with excitation light. Note that the fluorescent substance moiety is a moiety modified with a fluorescent substance, and the quencher moiety is a moiety modified with a quencher. It is particularly preferable that the fluorescently labeled probe has a fluorescent substance moiety at the 5' end of the target nucleic acid and a quencher moiety at the 3' end.

[0045] Examples of fluorescent substances include Quasar (registered trademark) 670, CAL Fluor (registered trademark) Orange 560, CAL Fluor (registered trademark) Red 610, FAM (e.g., 5-carboxyfluorescein, 6-carboxyfluorescein), Cy3, and Cy5. Examples of quenchers include BHQ (registered trademark)-1 and BHQ (registered trademark)-2. These are available from, for example, LGC Biosearch Technologies.

[0046] In the above step (a), when two or more primer sets are used, it is preferable to set the molar concentration (final concentration) of each primer constituting one primer set to be different from that of each primer constituting the other primer sets, or to use two or more fluorescently labeled probes and set the molar concentration (final concentration) of one of the fluorescently labeled probes to be different from that of the other fluorescently labeled probes. This makes it even easier to simultaneously detect multiple target nucleic acids with a single fluorescent wavelength.

[0047] The molar concentration (concentration) of each primer and the molar concentration (final concentration) of the fluorescently labeled probe may be set, for example, taking into consideration the Ct value of each target nucleic acid.

[0048] In the above step (a), the amount (total amount) of PCR reagent added to the PCR reaction tube is preferably, for example, 20 to 50 μL. In the above addition step, the sample may be added to the PCR reaction tube and then the PCR reagent, or the PCR reagent may be added and then the sample, or both may be added simultaneously. However, it is preferable to add the sample to the PCR reaction tube and then the PCR reagent. It is also preferable to perform centrifugation before starting the PCR reaction.

[0049] (Reaction Step) The PCR reaction tube preferably has a structure that allows a punched piece of blood from a filter paper to be inserted smoothly and that allows it to be sealed with a cap. The shape of the PCR reaction tube is preferably a circular opening at the top of the tube (e.g., an inner diameter of approximately 2.5 mm to 10 mm) with the bottom narrower than the top opening, and more preferably an inverted cone shape. The volume of the PCR reaction tube may be any volume that can adequately accommodate the reaction solution even after adding PCR reagents and undergoing temperature changes due to the PCR reaction; for example, a volume of 0.1 mL to 0.3 mL is preferred, a volume of 0.15 mL to 0.25 mL is more preferred, and a volume of 0.2 mL is most preferred.

[0050] The PCR reaction tubes are preferably 96-well PCR reaction tubes with 96 connected tubes or 8-well PCR reaction tubes with 8 connected tubes. The material of the reaction tubes is preferably one that minimizes contamination of the reaction solution and has rigidity that prevents deformation even when the internal pressure changes due to temperature changes in the PCR reaction, such as polypropylene.

[0051] A cap is preferably used to seal the PCR reaction tube. The cap may have any structure as long as it fits over the opening of the PCR reaction tube and can seal it. As with the PCR reaction tube, the cap is preferably made of a material that does not deform due to internal pressure fluctuations caused by the PCR reaction, and is also preferably made of a material with high optical transparency, specifically polypropylene.

[0052] The temperature change at each step in the PCR reaction may be automatically controlled using, for example, a thermal cycler, etc. For example, by sealing the tube with a cap or the like before starting the PCR reaction, it is possible to prevent the generation of bubbles due to temperature changes, prevent the sample (preferably the punch piece) from floating up, and suppress vibration.

[0053] (Detection Step) The amplification product generated by the PCR reaction can be detected (and quantified) by, for example, detecting the fluorescence intensity (fluorescence value) generated from the amplification product. For example, conventionally known methods such as the intercalator method, TaqMan (registered trademark) probe method, hybridization method, and cycling probe method are preferably used for fluorescence detection. The fluorescence intensity is detected, for example, using a fluorometer. Generally, an apparatus equipped with a PCR reaction unit (e.g., a thermal cycler) and an optical system unit (e.g., a fluorometer) is preferably used. Examples of such an apparatus include SmartCycler (registered trademark) (trade name, manufactured by Takara Bio Inc.), LightCycler (registered trademark) (trade name, manufactured by Roche), and ABI PRISM7000 (trade name, manufactured by Applied Biosystems).

[0054] The detection of the amplification product may be carried out at or after the completion of the PCR reaction, or may be carried out in parallel with the PCR reaction. When the detection of the amplification product is carried out in parallel with the PCR reaction, the detection of the amplification product may be carried out, for example, over time. The detection over time may be carried out, for example, continuously or discontinuously (intermittently). In addition, the target nucleic acid contained in the sample can be quantified by counting the number of PCR cycles at which a predetermined amount of the amplification product is obtained. The copy number per 1 μL of whole blood in the sample may be converted and quantified from a calibration curve of Cq values ​​calculated from a standard.

[0055] <Step (b)> An amplification curve is obtained by the amplification reaction (PCR reaction) in step (a) above. Based on this amplification curve, a Ct value is obtained from a set threshold. The threshold is generally set to distinguish the amplification signal from the background, and can be set at any point in the exponential amplification phase of the amplification curve. However, depending on the device used, the threshold may be fixed, so the threshold should be followed. For example, the threshold is fixed in the "LightCycler (registered trademark) 96 System" (Roche), and the Ct value is obtained from that threshold.

[0056] <Step (c)> Prior to step (c), a Ct value range is set for each target nucleic acid. For example, it is preferable to set the central values ​​of the Ct value ranges for each target nucleic acid so that the difference between them at the same template amount is 5 or more and the respective Ct value ranges do not overlap. That is, for example, it is preferable to set Ct1 and Ct2 so that the difference (absolute value) between the central value of the Ct value range of the first target nucleic acid (referred to as Ct1) and the central value of the Ct value range of the second target nucleic acid (referred to as Ct2) at the same template amount is 5 or more and the respective Ct value ranges with Ct1 and Ct2 as their central values ​​do not overlap. This makes it easier to distinguish between target nucleic acids.

[0057] In the step (c), the central values ​​(for example, Ct1 and Ct2) of a Ct value range preset for each target nucleic acid are compared with the Ct value obtained in the step (b).

[0058] <Step (d)> Based on the amplification curve obtained in step (a), in step (d), a fluorescence value is selected from the fluorescence values ​​(which can be expressed in RFU) within the set number of cycles. Preferably, the fluorescence value in the set final cycle is selected. The fluorescence value (which can be expressed in RFU) selected in this way is used as the fluorescence value obtained in step (d).

[0059] <Step (e)> Prior to step (e), a fluorescence value range within a set number of cycles is set for each target nucleic acid. For example, it is preferable to set the ratio of the center value of the fluorescence value range at the set number of cycles for each target nucleic acid to 1.4 times or more, and to set the fluorescence value ranges at the set number of cycles so that they do not overlap. That is, for example, it is preferable to set F1 and F2 so that the ratio (F1 / F2 or F2 / F1) of the center value of the fluorescence value range at the set number of cycles for the first target nucleic acid (referred to as F1) to the center value of the fluorescence value range at the set number of cycles for the second target nucleic acid (referred to as F2) is 1.4 times or more, and so that the fluorescence value ranges with F1 and F2 as their center values ​​do not overlap. In this case, too, discrimination of the target nucleic acid is made easier.

[0060] In the step (e), the fluorescence value at a predetermined cycle number (e.g., F1 and F2) for each target nucleic acid is compared with the fluorescence value obtained in the step (d). For example, when the comparison in the step (c) is difficult (e.g., when the Ct values ​​cannot be used for discrimination), it is effective to perform the steps (d) to (e) in addition to or instead of the steps (b) to (c).

[0061] In the above steps (c) and (e), it is particularly preferable to perform the comparison by combining differences in the shape of the amplification curve, the fluorescence intensity, and the timing of the rise of amplification. This makes it easier to distinguish target nucleic acids when measured using the same fluorescence wavelength, and also makes it easier to identify complexes of target nucleic acids (complex variants, etc.). In particular, the discrimination method of the present disclosure is significant in that it makes it possible to identify the presence of multiple target nucleic acids that differ from each other in one or more of the Ct value and the fluorescence value by using either one of the two elements, the Ct value and the fluorescence value, or a combination of both.

[0062] The target nucleic acid to be identified by the identification method of the present disclosure is not particularly limited, and examples thereof include microorganisms, complex biological mixtures, tissues, body fluids, serum, preserved biological samples, environmental isolates, in vitro preparations, etc. Specifically, the target nucleic acid includes DNA and RNA derived from whole blood, as well as exogenous nucleic acids introduced into whole blood by viruses, etc. Preferably, the target nucleic acid is nucleic acid derived from whole blood of a newborn, for example.

[0063] The discrimination method of the present disclosure allows two or more target nucleic acids amplified by PCR to be simultaneously detected and each to be discriminated (also referred to as identified). In the discrimination method, the two or more target nucleic acids to be discriminated preferably include at least one selected from the group consisting of a combination of different genetic variants among deletion mutations, insertion mutations, and point mutations, and a combination of any given genetic variant (first genetic variant) and the wild type of the first genetic variant. That is, for example, when the two or more target nucleic acids include two different target nucleic acids, the combination of the two target nucleic acids is preferably any one of a combination of a deletion mutation and an insertion mutation, a combination of an insertion mutation and a point mutation, a combination of a point mutation and a deletion mutation, or a combination of a first genetic variant and the wild type of the first genetic variant.

[0064] In addition, when the two or more target nucleic acids to be distinguished contain a combination of different gene variants, it is preferable to use primer set (1) in the above step (a). Furthermore, when the two or more target nucleic acids to be distinguished contain a combination of a first gene variant and a wild-type of the first gene variant, it is preferable to use primer set (2) in the above step (a). When the two or more target nucleic acids to be distinguished contain both a combination of different gene variants and a combination of a first gene variant and a wild-type of the first gene variant, it is preferable to use both primer set (1) and primer set (2) in the above step (a). It can be said that primer set (1) is preferable as a set of a forward primer and a reverse primer for each mutation (e.g., deletion mutation, insertion mutation, point mutation, etc.), and primer set (2) is preferable as a set of a forward primer and a reverse primer for both the wild-type and mutant types (e.g., deletion mutation, insertion mutation, point mutation, etc.).

[0065] The discrimination method of the present disclosure is particularly useful for genetic testing (e.g., screening tests) of diseases in which multiple pathogenic variants exist in the causative gene. Examples of such diseases include citrin deficiency and glycogen storage disease. Therefore, it is particularly preferable that the target nucleic acid contains at least one causative gene selected from the group consisting of citrin deficiency and glycogen storage disease. In particular, the target nucleic acid preferably contains the causative gene for citrin deficiency (SLC25A13 gene), more preferably contains two or more pathogenic variants of the SLC25A13 gene, and even more preferably contains two or more of Type 1, Type 2, Type 3, Type 4, Type 5, and Type 19 variants of the SLC25A13 gene.

[0066] Citrin deficiency can be definitively diagnosed by detecting pathogenic mutations in both alleles of the causative gene, SLC25A13. It has been reported that among these pathogenic mutations, there is a high-frequency mutation specific to Japanese people (Ayako Tabata et al., "Identification of 13 novel mutations including a retrotransposal insertion in SLC25A13 gene and frequency of 30 mutations found in patients with citrin deficiency," Journal of Human Genetics, 2008, Vol. 53(6), pp. 534-545). According to this report, six types of variants, Type 1, Type 2, Type 3, Type 4, Type 5, and Type 19, account for more than 90% of the mutation frequency. For example, by using the discrimination method of the present disclosure with the "LightCycler (registered trademark) 96 System," a total of six genes can be detected using up to three types of fluorescence, excluding the internal standard gene RNase P. Therefore, the method of the present disclosure is particularly useful for screening for citrin deficiency, in which six types of variants account for more than 90% of mutation frequencies. The method of the present disclosure used for genetic testing for citrin deficiency is also one of the inventions by the present inventors.

[0067] The present disclosure will be described in more detail below with reference to examples, but the present disclosure is not limited to these examples. In Figures 1 to 9, the X axis represents the reaction cycle number, and the Y axis represents the fluorescence signal (RFU). In Figures 1 to 9, for ease of viewing, the 1st to 19th cycles are omitted, and only the 20th to 45th cycles are shown.

[0068] Examples 1 to 8 (a) Test Materials (a-1) Primers for Amplifying Each Variant of the SLC25A13 Gene The following primers were synthesized by Sigma-Aldrich and used as primers for amplifying each variant of the SLC25A13 gene and the internal standard gene (RNase P).

[0069] Forward primer for Type 1 variant: 5'-TTTCCCCCTACAGACGACC-3' (SEQ ID NO: 1) Forward primer for Type 1 wild type: 5'-CCCCTACAGAC[GTAT]GACC-3' (SEQ ID NO: 2) ([GTAT] represents the four bases deleted at this position.) Reverse primer for Type 1 variant: 5'-CTAAGGAAACCCCAGAATGC-3' (SEQ ID NO: 3) Forward primer for Type 2 variant: 5'-CTTCTTTTGGACTGTATAGAGACT-3' (SEQ ID NO: 4) Reverse primer for Type 2 variant: 5'-GCCAAGCCCTAGATGCCT-3' (SEQ ID NO: 5) Forward primer for Type 3 variant: 5'-GCTGCCCGGGGGAGATTA-3' (SEQ ID NO: 6) Reverse primer for Type 3 variant: 5'-AAGAACACATTATTTCCATACCAC-3' (SEQ ID NO: 7) Forward primer for Type 4 variant: 5'-CTCTTGTTTTCAATTTATTTGAGG-3' (SEQ ID NO: 8) Reverse primer for Type 4 variant: 5'-GGTGCCAGCCAGAGTTGT-3' (SEQ ID NO: 9) Forward primer for Type 5 variant (1): 5'-TCTTGCTGGAGGCTGCAGA-3' (SEQ ID NO: 10) Forward primer for Type 5 variant (2): 5'-CTTGCTGGAGGCTGCAGA-3' (SEQ ID NO: 11) Forward primer for Type 5 wild type: 5'-ATTCTTGCTGGAGGCTGCGAA-3' (SEQ ID NO: 12) Reverse primer for Type 5 variant (1): 5'-TAGGAAAGCCGAGGTGCC-3' (SEQ ID NO: 13) Reverse primer for Type 5 variant (2): 5'-GCCTGTCTAGGAAAAGCCG-3' (SEQ ID NO: 14) Forward primer for Type 19 variant: 5'-TCCTCCCTTGGCAGCC-3' (SEQ ID NO: 15) Reverse primer for Type 19 variant: 5'-AATGTAGAACCATCGCTGTAGC-3' (SEQ ID NO: 16) Forward primer for RNase P: 5'-GCGGAGGGAAGCTCATCA-3' (SEQ ID NO: 17) Reverse primer for RNase P: 5'-GTCTGACCTCGCGCGGA-3' (SEQ ID NO: 18).

[0070] (a-2) Probes for detecting each variant type of the SLC25A13 gene The following fluorescently labeled detection probes were synthesized by Prime Tech as probes for confirming the amplification of each variant type of the SLC25A13 gene. In this example, two combinations were selected as combination (1): a pair (combination) of variants Types 1, 2, and 5, and a pair (combination) of Types 3, 4, and 19. Three combinations were selected as combination (2): a pair of Types 2 and 19, a pair of Types 3 and 4, and a pair of Types 1 and 5, each of which was assigned two or three types of fluorescent dyes. Furthermore, for combination (3), one type of fluorescent dye was selected for differential detection of Type 1 variant and wild type. Note that only the base sequence portion of each of the following probes is listed in the sequence listing.

[0071] Fluorescently labeled probe for Type 1 variant (1): 5'-X 1 -AGAGGCAGGTGAGCAAAGAGGAG-Q 2 -3' (base sequence portion: SEQ ID NO: 19) Fluorescently labeled probe for Type 1 variant (2): 5'-X 2 -AGAGGCAGGTGAGCAAAGAGGAG-Q 1 -3' (base sequence portion: SEQ ID NO: 19) Fluorescently labeled probe for Type 2 variant: 5'-X 1 -CCTGACATGAATTAGCAAGACTGCG-Q 2 -3' (base sequence portion: SEQ ID NO: 20) Fluorescently labeled probe for Type 3 variant: 5'-X 3 -TGGCCAAACCACTTACAGCG-Q 2 -3' (base sequence portion: SEQ ID NO: 21) Fluorescently labeled probe for Type 4 variant: 5'-X 3 -CGCTCCTTAAACAACATGGAACTCATTAG-Q 2 -3' (base sequence portion: SEQ ID NO: 22) Fluorescently labeled probe for Type 5 variant (1): 5'-X 1 -TTAACCACAGATCCTGCACAAGGG-Q 2-3' (base sequence portion: SEQ ID NO: 23) Fluorescently labeled probe for Type 5 variant (2): 5'-X 2 -TTAACCACAGATCCTGCACAAGGG-Q 1 -3' (base sequence portion: SEQ ID NO: 23) Fluorescently labeled probe for Type 5 variant (3): 5'-X 3 -TTAACCACAGATCCTGCACAAGGG-Q 1 -3' (base sequence portion: SEQ ID NO: 23) Fluorescently labeled probe for Type 19 variant (1): 5'-X 3 -CCGCCCCCGATTTCTCCA-Q 2 -3' (base sequence portion: SEQ ID NO: 24) Fluorescently labeled probe for Type 19 variant (2): 5'-X 1 -CCGCCCCCGATTTCTCCA-Q 2 -3' (base sequence portion: SEQ ID NO: 24) Fluorescent detection probe for RNase P: 5'-X 4 -CCACGAGCTGAGTGCGTCCTG-Q 1 -3' (base sequence portion: SEQ ID NO: 25)

[0072] Here, each symbol in the above sequence is as follows: X 1 is the site labeled with a fluorescent substance (Quasar (registered trademark) 670). 2 is the site labeled with a fluorescent substance (CAL Fluor (registered trademark) Orange 560). 3 is the site labeled with a fluorescent substance (CAL Fluor (registered trademark) Red 610). 4 is the fluorescent substance (FAM) labeling site. 1 is the site of labeling with a quencher (BHQ (registered trademark)-1). 2 indicates the labeling site with a quencher (BHQ (registered trademark)-2). All of the above fluorescent dyes and quenchers are manufactured by LGC Biosearch Technologies.

[0073] (a-3) Plasmids To quantify PCR amplification products, plasmids containing the partial gene sequences corresponding to each variant (wild-type and mutant-type) of the SLC25A13 gene shown below incorporated into a vector were commissioned to Eurofins Genomics (Tokyo, Japan) and used as variant negative and positive controls. In the sequences of each plasmid below, uppercase letters represent exon sequences, and lowercase letters represent intron sequences.

[0074] Type 1 variant plasmid (SEQ ID NO: 26): gagaaaaagaagccaaactgaaggctatactgaaatatgagaaatgaaaaaaggggatgtttttaaattttataatgtaaattgtaataaattggtatatttgttgcttgtgtttgttttgttttcccctacagAC (4 bpdel) GACCTTAGCAGACATTGAACGGATTGCTCCTCTGGAAGAGGGA ACTCTGCCCTTTAACTTGGCTGAGGCCCAGAGGCAGgtgagcaaagaggagcaaacttgcattctggggtttccttagcaggatacccccaaccctgttccacttgcagttgcctttgcggcattggtatctgacttaaccatttttctgttttgcaccaaaactctcgataaattttaaagg Note that (4 bpdel) indicates that 4 bases are deleted at this position.

[0075] Type 1 wild type plasmid (SEQ ID NO: 27): gagaaaaagaagccaaactgaaggctatactgaaatatgagaaatgaaaaaaggggatgtttttaaattttataatgtaaattgtaataaattggtatatttgttgcttgtgtttgttttcccctacagACGTATGACCTTAGCAGACATTGAACGGATTGCTCCTCTGGAAGAGGGAAC TCTGCCCTTTAACTTGGCTGAGGCCCAGAGGCAGgtgagcaaagaggagcaaacttgcattctgggtttccttagcaggatacccccaac cctgttccacttgcagttgcctttgcggcatggtatctgacttaaccatttttctgttttgcaccaaaactctcgataaattttaaagg

[0076] Type 2 variant plasmid (SEQ ID NO: 28): CTGTTGGAGCCACTGCTGTGTATCCTATCGATCTTGTAAAAACTCGAATGCAGAACCAACGATCAACTGGCTCTTTTGTGGGGAGAACTCATGTATAAAACAGCTTTGACTGTTTTAAGAAAGTGCTACGCTATGAAGGCTTCTTTGGACTGTATAGAGattag tgccacatgctcaatacctgttaggtgaaataacactcaaaggtttggtttctcatcttagtgcctgacatgaattagcaagactgcgttaaaatggaaatacagcagattttcaattatccatgctaatgggagtaggctggaggcatctagggcttggctaa. The "a" at position 160 is the SNP site.

[0077] Type 3 variant plasmid (SEQ ID NO: 29): ggacagcaaaataggcatttttaattgaatcggattttaactttctttccacggccagcagttcaaagcacagtttttatatagtgagaatgtgaccagactgagatggtgttgtgtctctcctgcagGTATGCCTGCAGCATCTTTAGTGACCCCTGCTGATGTTATCAAGACGAGATTACAGGTGGCTGCCCG GGGAGATTACAGGTGGCTGCCCGGGCTGGCCAAAC CACTTACAGCGGAGTGATAGACTGCTTTAGAAAGATACTGCGTGAAGAAGGACCAAAGCTCTGTGGAAGGGAGCTGGTGGtatggaaataatgtgttcttaactaactctttggtatcaggtaaattttttaaaatatctaattatatctgtgattatctccat The sequence from positions 201 to 222 is a repeated sequence.

[0078] Type 4 variant plasmid (SEQ ID NO: 30): cttctctcttgttttcaatttatttgagGCTGCTGGAGGTACCACATCCCATCAAGTTAGTTTCTCCTATTTTAATGGATTTAATTCGCTCCTTAACAAACATGGAACTCATTAGAAAGATCTATAGAACTCTGGCTGGCACCAGGAAA GATGTTGAAGTGACTAAGGgtgagtgagaatatatctgaattctagcctgcaagtattgtggtgtattattattattagggtgaagaaggcaactagtactttaattattttttctatcccattgacacatattaactatatgataacgtgtg. The "A" at position 127 is the SNP site.

[0079] Type 5 variant plasmid (SEQ ID NO: 31): tagcatatattgacagatgcatatttataagtgttaatgactttctttatattttcatcagcttctataaatattttttcttcaagGTGAACGATTTTGTGAGGGATAAATTTATGCACAAAGATGGTTCGGTCCCACTTGCAGCAGAAATTCTTGCTGGAGGCTGCataagtaccttttgaagctctctt cattgaaaagacttgtttcacatatatatcactaccatggtcaacaggtgtggactaaggcttctgtttaaccacagatcctgcacaagggcagagtctactagggcacctcggcttttcctagacaggcgaaccattccagaggtggaagggtaaatgtttctgaccttactgcctgttaagtcatgcctgt Note that "a" at position 169 is the SNP site.

[0080] Type 5 wildtype plasmid (SEQ ID NO: 32): tagcatatattgacagatgcatattttataagtgttataatgactttctttatattttcatcagcttctataaatattttttcttcaagGTGAACGATTTTGTGAGGGATAAATTTATGCACAAAGATGGTTCGGTCCCACTTGCAGCAGAAATTCTTGCTGGAGGCTGCgtaagtaccttttgaagctctctt cattgaaaagacttgtttcacatatatatcactaccatggtcaacaggtgtggactaaggcttctgtttaaccacagatcctgcacaagggcagag tctactagggcacctcggcttttcctagacaggcgaaccattccagaggtggaaggtaaatgtttctgaccttactgcctgttaagtcatgcctgt

[0081] Type 19 variant (mutated) plasmid (SEQ ID NO: 33): gagcccgaacccctttccactgccaacacctcacctcgccccccgccgcccatcttcctcctcccttggcagccccgccccccgattattctccattttttaaagCTCGTGTATTTCGATCCTCACCCCAGTTTGGTGTAACTTTGCTGACTTACGAATTGCTACAGCGATGGTTCTACATTGATTTTGG AGGAGTgtaagtatcatgctaaatctgctgctaaattttggctgctgctaatgctctgttgtcgtagggaaaggtacctcagtctagtctataataaaatagaagattagggaaatgttgaaattgtgttaacaaggtcatttccaaggggaacatacaactgatgagaatgtatcaactcc The sequence from positions 1 to 80 is the inserted portion.

[0082] RNaseP gene partial sequence (SEQ ID NO: 34): ATAGGGCGGAGGGGAAGCTCATCAGTGGGGCCACGAGCTGAGTGCGTCCTGTCACTCCACTCCCATGTCCCTTGGGAAGGTCTGAG ACTAGGGCCAGAGGCGGCCCTAAACAGGGCTCTCCCTGAGCTTCGGGGAGGTGAGTTCCCAGAGAACGGGGCTCCGCGCGAGGTCA GACTGGGCAGGAGATGCCGTGGACCCCGCCCTTCGGGGAGGGGCCCGGCGGATGCCTCCTTTGCCGGAGCTTGGAACAGACTCAC GGCCAGCGAAGTGAGTTCAATGGCTGAGGTGAGGTACCCCGCAGGGGACCTCATAACCCAATTCAGACTACTCTCCTCCGCCCAT

[0083] (b) PCR Reagent for Combination (1) A PCR reagent having the following composition was prepared using the following PCR buffer and the enzyme "BIOTAQ (registered trademark) HS DNA Polymerase" included in the "Ampdirect (registered trademark) Plus Enzyme Set" manufactured by Shimadzu Corporation.

[0084] PCR buffer (Ampdirect® Plus) 0.03 U / μL BIOTAQ® HS DNA polymerase 0.8 μM (final concentration) forward primer for Type 1 variant 0.8 μM (final concentration) reverse primer for Type 1 variant 0.5 μM (final concentration) forward primer for Type 2 variant 0.5 μM (final concentration) reverse primer for Type 2 variant 0.35 μM (final concentration) forward primer for Type 3 variant 0.35 μM (final concentration) reverse primer for Type 3 variant 1.0 μM (final concentration) forward primer for Type 4 variant 1.0 μM (final concentration) reverse primer for Type 4 variant 1.0 μM (final concentration) forward primer (1) for Type 5 variant 1.0 μM (final concentration) reverse primer (1) for Type 5 variant 0.35 μM (final concentration) forward primer for Type 19 variant 0.35 μM (final concentration) reverse primer for Type 19 variant 0.1 μM (final concentration) forward primer for RNase P 0.1 μM (final concentration) reverse primer for RNase P 0.15 μM (final concentration) fluorescent-labeled probe for Type 1 variant (1) 0.1 μM (final concentration) fluorescent-labeled probe for Type 2 variant 0.15 μM (final concentration) fluorescent-labeled probe for Type 3 variant 0.06 μM (final concentration) fluorescent-labeled probe for Type 4 variant 0.15 μM (final concentration) fluorescent-labeled probe for Type 5 variant (1) 0.030 μM (final concentration) fluorescent-labeled probe for Type 19 variant (1) 0.04 μM (final concentration) RNase P detection probe

[0085] (c) Preparation and Measurement of Control Dried Blood Filter Paper for Confirmation of Reactivity of Each Variant Type: A leukocyte-removed human red blood cell fraction (100%) was mixed with a variant type plasmid and an RNase P plasmid (33,333 copies / μL) in a mass ratio of 6:4. 40 μL of this mixture was impregnated onto filter paper and allowed to dry. A 1.5 mm diameter punch was taken from the dried blood filter paper section and placed in a PCR reaction tube. 40 μL of the PCR reagent (b) above was added, and the specificity for each variant type was confirmed by real-time PCR under the following PCR reaction conditions:

[0086] (d) PCR reaction conditions: 1) 95°C: 15 minutes; 2) 95°C: 15 seconds, 63°C: 80 seconds (45 cycles); 3) 37°C: 5 minutes.

[0087] (e) Equipment: Thermal cycler: "LightCycler (registered trademark) 96 System" (Roche)

[0088] (f) Analysis of Amplification Curves The obtained amplification curves are shown in FIGS. 1 and 2 for each measurement wavelength (Cy5, Red610) set in the above-mentioned device (Examples 1 and 2).

[0089] As shown in Figure 1, the shape and rise of the amplification curves for Type 1, 2, and 5 variants, which are detected at the same fluorescence wavelength (Cy5), are characterized by the following: when compared using the same template amount (10,000 copies / reaction), the Cq value of the Type 1 variant was 28.2, while the Cq values ​​of the Type 2 and 5 variants were calculated to be 35.3 and 38.1, respectively, indicating a difference of 5 cycles or more. Meanwhile, the fluorescence value (RFU) of the Type 2 variant at the 45th cycle was 0.190, and the fluorescence value (RFU) of the Type 5 variant was 0.345, resulting in a Type 2 / Type 5 ratio of 1.8. 1 as the center value, the Cq value range of the Type 1 variant is 26.2 to 30.2, and the Cq value range of the Type 2 variant is 33.3 to 37.3, and these ranges do not overlap. On the other hand, when the range width centered on the fluorescence value (RFU) at the 45th cycle is ±25%, the fluorescence value range of the Type 2 variant is 0.143 to 0.238, and the fluorescence value range of the Type 5 variant is 0.259 to 0.431, and these ranges do not overlap.

[0090] From the above results, it is possible to distinguish Type 1 variants from Type 2 variants or Type 5 variants by setting the Cq value range, and furthermore, it is possible to distinguish Type 2 variants from Type 5 variants by setting the range width of the fluorescence value (RFU) at the 45th cycle.

[0091] As shown in Figure 2, the shape and rise of the amplification curves for Type 3, 4, and 19 variants, detected at the same fluorescence wavelength (Red 610), were characterized by a comparison using the same template amount (10,000 copies / reaction). The Cq value for the Type 4 variant was 34.3, while the Cq values ​​for the Type 3 and 19 variants were calculated to be the same 26.8, a difference of 5 cycles or more. Meanwhile, the fluorescence value (RFU) of the Type 3 variant at the 45th cycle was 1.70, and the fluorescence value (RFU) of the Type 19 variant was 0.596, resulting in a Type 3 / Type 19 ratio of 2.85. Therefore, when the Cq value obtained in Figure 2 is taken as the center value and the range is set to ±2, the Cq value range of the Type 4 variant is 32.3 to 36.3, and the Cq value ranges of the Type 3 and Type 19 variants are the same, 24.8 to 28.8, and the ranges do not overlap. On the other hand, when the range width centered on the fluorescence value (RFU) at the 45th cycle is set to ±40%, the fluorescence value range of the Type 3 variant is 1.02 to 2.38, and the fluorescence value range of the Type 19 variant is 0.358 to 0.834, and the ranges do not overlap.

[0092] From the above results, it is possible to distinguish Type 4 variants from Type 3 variants or Type 19 variants by setting the Cq value range, and furthermore, it is possible to distinguish Type 3 variants from Type 19 variants by setting the range width of the fluorescence value (RFU) at the 45th cycle.

[0093] (g) PCR Reagents for Combination (2) A PCR reagent with the following composition was prepared using the PCR buffer and the enzyme "BIOTAQ (registered trademark) HS DNA Polymerase" included in the "Ampdirect (registered trademark) Plus Enzyme Set" manufactured by Shimadzu Corporation. Note that the concentrations of fluorescent-labeled probes Types 1, 3, and 19 were set lower than those of fluorescent-labeled probes Types 2, 4, and 5 in order to terminate real-time PCR midway.

[0094] PCR buffer (Ampdirect® Plus) 0.03 U / μL BIOTAQ® HS DNA polymerase 0.35 μM (final concentration) forward primer for Type 1 variant 0.35 μM (final concentration) reverse primer for Type 1 variant 0.17 μM (final concentration) forward primer for Type 2 variant 0.17 μM (final concentration) reverse primer for Type 2 variant 0.35 μM (final concentration) forward primer for Type 3 variant 0.35 μM (final concentration) reverse primer for Type 3 variant 0.2 μM (final concentration) forward primer for Type 4 variant 0.2 μM (final concentration) reverse primer for Type 4 variant 0.6 μM (final concentration) forward primer for Type 5 variant (1) 0.6 μM (final concentration) Reverse primer for Type 5 variant (1) 0.35 μM (final concentration) Forward primer for Type 19 variant 0.35 μM (final concentration) Reverse primer for Type 19 variant 0.125 μM (final concentration) Forward primer for RNase P 0.125 μM (final concentration) Reverse primer for RNase P 0.035 μM (final concentration) Fluorescently labeled probe for Type 1 variant (2) 0.1 μM (final concentration) Fluorescently labeled probe for Type 2 variant 0.035 μM (final concentration) Fluorescently labeled probe for Type 3 variant 0.15 μM (final concentration) Fluorescently labeled probe for Type 4 variant 0.15 μM (final concentration) Fluorescently labeled probe for Type 5 variant (2) 0.025 μM (final concentration) Fluorescently labeled probe (2) for Type 19 variant 0.04 μM (final concentration) RNase P detection probe

[0095] (h) Preparation and Measurement of Control Dried Blood Filters for Confirming Reactivity of Each Variant Type: A leukocyte-depleted human red blood cell fraction (100%) was mixed with a variant type plasmid and an RNase P plasmid (33,333 copies / μL) in a mass ratio of 6:4. 40 μL of this mixture was impregnated onto filter paper and dried. A 1.5 mm diameter punch was taken from the dried blood filter and placed in a PCR reaction tube. 40 μL of the PCR reagent (g) above was added, and specificity for each variant type was confirmed by real-time PCR under the following PCR reaction conditions: Furthermore, to confirm the detection of two variant types at a single fluorescent wavelength, plasmid mixes of Type 2 and 19, Type 1 and 5, and Type 3 and 4 were prepared and subjected to the reaction.

[0096] (i) PCR reaction conditions: 1) 95°C: 15 minutes; 2) 95°C: 15 seconds, 63°C: 80 seconds (45 cycles); 3) 37°C: 5 minutes.

[0097] (j) Equipment: Thermal cycler: "LightCycler (registered trademark) 96 System" (Roche)

[0098] (k) Analysis of Amplification Curves The obtained amplification curves are shown in FIGS. 3 to 5 for each measurement wavelength (Cy5, Red610, or Hex) set in the above-mentioned device (Examples 3 to 5).

[0099] As shown in Figure 3, the shape and rise of the amplification curves for Type 2 and Type 19 variants, detected at the same fluorescence wavelength (Cy5), were characterized by a comparison using the same template amount (10,000 copies / reaction). The Cq value for the Type 2 variant was calculated to be 33.8, while the Cq value for the Type 19 variant was calculated to be 27.7, a difference of more than 5 cycles. Meanwhile, the fluorescence value (RFU) for the Type 2 variant at the 45th cycle was 0.562, and the fluorescence value (RFU) for the Type 19 variant was 0.275, resulting in a Type 2 / Type 19 ratio of 2.0.

[0100] Therefore, when the Cq values ​​obtained in FIG. 3 are taken as the center value and the range is ±2, the Cq value range of the Type 2 variant is 31.8 to 35.8, and the Cq value range of the Type 19 variant is 25.7 to 29.7, and the ranges do not overlap.

[0101] On the other hand, when the range width centered on the fluorescence value (RFU) at the 45th cycle is set to ±30%, the fluorescence value range of the Type 2 variant is 0.393 to 0.731, and the fluorescence value range of the Type 19 variant is 0.193 to 0.358, and the ranges do not overlap.

[0102] In contrast, when the plasmid mix was measured assuming the simultaneous presence of Type 2 and Type 19 variants, the Cq value was calculated to be 27.4, which is within the Cq value range of the Type 19 variant, indicating the presence of the Type 19 variant. The fluorescence value at the 45th cycle was calculated to be 0.562, which is within the fluorescence value range of the Type 2 variant, also indicating the presence of the Type 2 variant. Therefore, it can be said that it is possible to identify a compound heterozygote of Type 2 and Type 19.

[0103] The same is true for Type 3 and Type 4 shown in Figure 4. When comparing the shape and rise of the amplification curves for Type 3 and Type 4 variants detected at the same fluorescence wavelength (Red 610), when the same template amount (10,000 copies / reaction) is used, the Cq value for the Type 3 variant is 28.7, while the Cq value for the Type 4 variant is 35.0, a difference of more than five cycles. Meanwhile, the fluorescence value (RFU) at the 45th cycle for the Type 3 variant was 0.437, while the fluorescence value (RFU) for the Type 4 variant was 1.33, resulting in a Type 4 / Type 3 ratio of 3.0.

[0104] Therefore, with regard to the Cq value range, if the Cq values ​​obtained in FIG. 4 are taken as the center value and the range is ±2, the Cq value range of the Type 3 variant is 26.7 to 30.7, and the Cq value range of the Type 4 variant is 33.0 to 37.0, but these ranges do not overlap.

[0105] On the other hand, when the range width centered on the fluorescence value (RFU) at the 45th cycle is set to ±30%, the fluorescence value range of the Type 3 variant is 0.306 to 0.568, and the fluorescence value range of the Type 4 variant is 0.931 to 1.73, and the ranges do not overlap.

[0106] In contrast, when the plasmid mix was measured assuming the simultaneous presence of Type 3 and Type 4 variants, the Cq value was calculated to be 30.1, which is within the Cq value range of the Type 3 variant, indicating the presence of the Type 3 variant. The fluorescence value at the 45th cycle was calculated to be 1.35, which is within the fluorescence value range of the Type 4 variant, also indicating the presence of the Type 4 variant. Therefore, it can be said that a compound heterozygote of Type 3 and Type 4 can be identified.

[0107] Furthermore, the same is true for Type 1 and Type 5 shown in Figure 5. The shape and rise of the amplification curves for Type 1 and Type 5 variants, which are detected at the same fluorescence wavelength (Hex), are characterized by the difference of more than five cycles when compared using the same template amount (10,000 copies / reaction). The fluorescence value (RFU) at the 45th cycle of the Type 1 variant was 0.480, while the fluorescence value (RFU) of the Type 5 variant was 1.32, resulting in a Type 5 / Type 1 ratio of 2.75.

[0108] Therefore, with regard to the Cq value range, if the Cq value obtained in Figure 5 is taken as the center value and the range is set to ±2, the Cq value range of the Type 1 variant is 27.5 to 29.5, and the Cq value range of the Type 5 variant is 34.5 to 38.5, but these ranges do not overlap.

[0109] On the other hand, when the range width centered on the fluorescence value (RFU) at the 45th cycle is set to ±40%, the fluorescence value range of the Type 1 variant is 0.288 to 0.672, and the fluorescence value range of the Type 5 variant is 0.792 to 1.85, and the ranges do not overlap.

[0110] In contrast, when the plasmid mix was measured assuming the simultaneous presence of Type 1 and Type 5 variants, the Cq value was calculated to be 29.1, which is within the Cq value range of the Type 1 variant, indicating the presence of the Type 1 variant. The fluorescence value at the 45th cycle was calculated to be 1.78, which is within the fluorescence value range of the Type 4 variant, also indicating the presence of the Type 4 variant. Therefore, it can be said that a compound heterozygote of Type 3 and Type 4 can be identified.

[0111] (l) PCR Reagent for Combination (3) A PCR reagent with the following composition was prepared using the PCR buffer and the enzyme "BIOTAQ® HS DNA Polymerase" included in the "Ampdirect® Plus Enzyme Set" manufactured by Shimadzu Corporation. The concentrations of the forward primer for the Type 1 variant and the wild-type primer were set so that the fluorescence value (RFU) at the 45th cycle of the variant and the wild-type were approximately twice that of the wild-type when real-time PCR was terminated midway.

[0112] PCR buffer (Ampdirect (registered trademark) Plus) 0.03 U / μL BIOTAQ (registered trademark) HS DNA polymerase 0.05 μM (final concentration) forward primer for Type 1 variant 0.09 μM (final concentration) forward primer for Type 1 wild type 0.8 μM (final concentration) reverse primer for Type 1 variant 0.6 μM (final concentration) fluorescently labeled probe (2) for Type 1 variant The reverse primer for Type 1 variant was also used as a reverse primer for Type 1 wild type, and the fluorescently labeled probe (2) for Type 1 variant was also used as a fluorescently labeled probe for Type 1 wild type.

[0113] (m) Preparation and measurement of control dried blood filter paper for confirming the reactivity of each variant type: Leukocyte-removed human red blood cell fraction (100%), Type 1 variant type plasmid, Type 1 wild type plasmid (33,333 copies / μL), and for Type 1 heterovariant, a 1:1 premix of variant and wild type plasmid was mixed at a mass ratio of 6:4, and 40 μL of this mixture was impregnated into filter paper and dried. From the dried blood filter paper slices to which each type had been added, a Φ1.5 mm punch was taken and placed in a PCR reaction tube, after which 40 μL of the PCR reagent described in (l) above was added, and the specificity of Type 1 for the variant type and wild type was confirmed by real-time PCR under the following PCR reaction conditions.

[0114] (n) PCR reaction conditions: 1) 95°C: 15 minutes; 2) 95°C: 15 seconds, 63°C: 80 seconds (45 cycles); 3) 37°C: 5 minutes.

[0115] (0) Equipment: Thermal cycler: "LightCycler (registered trademark) 96 System" (Roche)

[0116] (p) Analysis of Amplification Curve The obtained amplification curve is shown in FIG. 6 (Example 6).

[0117] As shown in Figure 6, the amplification using the Type 1 variant plasmid and the Type 1 wild-type plasmid as templates yielded Cq values ​​of 29.5 and 27.7, respectively, with no significant difference. Meanwhile, the fluorescence values ​​(RFU) of the Type 1 variant and wild-type at the 45th cycle were 0.348 and 0.570, respectively. Furthermore, the fluorescence value of the heterovariant was an average of 0.850 at N = 4, and the Type 1 wild-type / variant ratio and Type 1 heterovariant / wild-type ratio were 1.64 and 1.49, respectively. The fluorescence values ​​(RFU) of the heterovariant for four runs were in the range of 0.846 to 0.853, demonstrating very good reproducibility.

[0118] Therefore, when the range width centered on the fluorescence value (RFU) at the 45th cycle is set to ±15%, the fluorescence value ranges of the Type 1 homovariant, wild type, and heterovariant are 0.296 to 0.400, 0.485 to 0.656, and 0.723 to 0.978, respectively, and the ranges do not overlap.

[0119] From the above results, it is possible to distinguish between Type 1 homovariants, Type 1 wild type, and Type 1 heterovariants by setting the range of fluorescence values ​​(RFU) at the 45th cycle.

[0120] (q) PCR Reagent for Combination (4) A PCR reagent with the following composition was prepared using the PCR buffer and the enzyme "BIOTAQ (registered trademark) HS DNA Polymerase" included in the "Ampdirect (registered trademark) Plus Enzyme Set" manufactured by Shimadzu Corporation. Note that the concentration of the Type 5 wild-type primer was set lower than that of the variant primer when real-time PCR was terminated midway.

[0121] PCR buffer (Ampdirect (registered trademark) Plus) 0.03 U / μL BIOTAQ (registered trademark) HS DNA polymerase 0.15 μM (final concentration) forward primer for Type 5 variant (2) 0.025 μM (final concentration) forward primer for Type 5 wild type 0.35 μM (final concentration) reverse primer for Type 5 variant (2) 0.2 μM (final concentration) fluorescently labeled probe for Type 5 variant (3) The reverse primer for Type 5 variant (2) was also used as a reverse primer for Type 5 wild type, and the fluorescently labeled probe for Type 5 variant (3) was also used as a fluorescently labeled probe for Type 5 wild type.

[0122] (r) Preparation and measurement of control dried blood filter paper for confirming the reactivity of each variant type. Leukocyte-depleted human red blood cell fraction (100%), Type 5 variant type plasmid, Type 5 wild type plasmid (33,333 copies / μL), and Type 5 heterovariant plasmid (previously mixed 1:1 variant and wild type) were mixed at a mass ratio of 6:4, and 40 μL of this mixture was impregnated into filter paper and dried. A Φ1.5 mm punch was taken from the dried blood filter paper slice to which each type had been added and placed in a PCR reaction tube, after which 40 μL of the PCR reagent (q) above was added. The specificity of Type 5 variant type and wild type was confirmed by real-time PCR under the following PCR reaction conditions.

[0123] (s) PCR reaction conditions: 1) 95°C: 15 minutes; 2) 95°C: 15 seconds, 63°C: 80 seconds (55 cycles); 3) 37°C: 5 minutes.

[0124] (t) Equipment: Thermal cycler: "LightCycler (registered trademark) 96 System" (Roche)

[0125] (u) Analysis of Amplification Curves The obtained amplification curves are shown in FIG. 7 (Example 7).

[0126] 7, the Cq values ​​for amplification using the Type 5 homovariant plasmid and the Type 5 wild-type plasmid as templates were calculated to be 39.3 and 33.8, respectively, indicating a difference of 5 cycles or more. Meanwhile, the fluorescence values ​​(RFU) for the Type 5 homovariant and wild-type at the 55th cycle were 4.38 and 2.99, respectively, resulting in a Type 5 homovariant / wild-type ratio of 1.46.

[0127] 7 as the center value, the Cq value range of the Type 5 homovariant is 37.3 to 41.3, and the Cq value range of the Type 5 wildtype is 31.8 to 35.8, but these ranges do not overlap. Furthermore, when the range width centered on the fluorescence value (RFU) at the 55th cycle is ±15%, the fluorescence value ranges of the Type 5 homovariant and wildtype are 3.72 to 5.04 and 2.54 to 3.44, respectively, and these ranges do not overlap.

[0128] On the other hand, the Cq value of the Type 5 heterovariant was 35.1, which is within the Cq value range of the wild type, suggesting the presence of a wild type, and the fluorescence value (RFU) at the 55th cycle was 4.30, which is within the fluorescence value range of the homovariant, also suggesting the presence of a variant. Combining these two results makes it possible to distinguish between homovariants, heterovariants, and wild type of Type 5.

[0129] (v) PCR Reagent for Combination (5) A PCR reagent having the following composition was prepared using the PCR buffer and the enzyme "BIOTAQ (registered trademark) HS DNA Polymerase" included in the "Ampdirect (registered trademark) Plus Enzyme Set" manufactured by Shimadzu Corporation. This measurement system was performed by combining the primer set (1) used in Example 4 and the primer set (2) used in Example 6.

[0130] PCR buffer (Ampdirect® Plus) 0.03 U / μL BIOTAQ® HS DNA polymerase 0.05 μM (final concentration) forward primer for Type 1 variant 0.09 μM (final concentration) forward primer for Type 1 wild type 0.8 μM (final concentration) reverse primer for Type 1 variant 0.35 μM (final concentration) forward primer for Type 3 variant 0.35 μM (final concentration) reverse primer for Type 3 variant 0.2 μM (final concentration) forward primer for Type 4 variant 0.2 μM (final concentration) reverse primer for Type 4 variant 0.125 μM (final concentration) forward primer for RNase P 0.125 μM (final concentration) reverse primer for RNase P 0.6 μM (final concentration) fluorescently labeled probe for Type 1 variant (2) 0.035 μM (final concentration) fluorescent-labeled probe for Type 3 variant; 0.15 μM (final concentration) fluorescent-labeled probe for Type 4 variant; 0.04 μM (final concentration) RNase P detection probe. The reverse primer for Type 1 variant was also used as a reverse primer for Type 1 wild-type, and the fluorescent-labeled probe (2) for Type 1 variant was also used as a fluorescent-labeled probe for Type 1 wild-type.

[0131] (w) Preparation and measurement of control dried blood spots for confirming reactivity of each variant type The dried blood spots prepared in Examples 4 and 6 were used in this measurement in the same manner.

[0132] (x) PCR reaction conditions: 1) 95°C: 15 minutes; 2) 95°C: 15 seconds, 63°C: 80 seconds (45 cycles); 3) 37°C: 5 minutes.

[0133] (y) Equipment: Thermal cycler: "LightCycler (registered trademark) 96 System" (Roche)

[0134] (z) Analysis of Amplification Curves The obtained amplification curves are shown in FIGS. 8 and 9 (Example 8).

[0135] The amplification curves for each type of Type 1 shown in Figure 8 were similar to those shown in Figure 6 in Example 6. The amplification curves for Type 3 and Type 4 measured at the same time, shown in Figure 9, were similar to those shown in Figure 4 in Example 4. This confirmed that it was possible to combine primer set (1) and primer set (2).

[0136] In this way, it was confirmed that by using the discrimination method of the present disclosure, it is possible to distinguish between each variant, compound variants, and even wild type variants when measuring using the same fluorescent wavelength.

Claims

1. A method for distinguishing target nucleic acids, comprising the steps (a) below, and the steps (b) to (c) below and / or (d) to (e) below, wherein two or more target nucleic acids contained in a sample are distinguished by simultaneous multiplex real-time PCR. (a) contacting the sample with a primer set and a fluorescently labeled probe to amplify the target nucleic acid in the sample; (b) creating an amplification curve using step (a) and obtaining a Ct value from a set threshold; (c) comparing the Ct value set for each target nucleic acid with the Ct value obtained in step (b); and (d) creating an amplification curve using step (a) and obtaining a fluorescence value within a set number of cycles. (e) A step of comparing the fluorescence value within the number of cycles set for each of the target nucleic acids with the fluorescence value obtained in the step (d).

2. The method of claim 1, wherein the primer set comprises two or more primer sets (1) each consisting of one type of forward primer and one type of reverse primer, and / or one or more primer sets (2) each comprising two or more types of at least one of the forward primer and the reverse primer and one or more types of the other.

3. The method of claim 2, wherein two or more of the primer sets (1) are used as the primer sets, and two or more fluorescently labeled probes labeled with the same fluorescent label are used as the fluorescently labeled probes.

4. The method of claim 2, wherein one or more of the primer sets (2) are used as the primer sets, and one or more fluorescently labeled probes are used as the fluorescently labeled probes.

5. The method according to any one of claims 1 to 4, wherein step (a) is carried out in the same container.

6. A method for distinguishing between any of claims 1 to 5, wherein the fluorescently labeled probes are designed to sandwich each of the target nucleic acids.

7. A discrimination method according to any one of claims 1 to 6, wherein when setting the Ct value for each target nucleic acid in step (c), the difference between the center values ​​of each Ct value range for the same template amount is 5 or more, and the Ct value ranges do not overlap.

8. A discrimination method according to any one of claims 1 to 7, wherein in step (e), when setting the fluorescence values ​​within the number of cycles set for each target nucleic acid, the ratio of the center values ​​of each fluorescence value range is 1.4 times or more, and the fluorescence value ranges for the set number of cycles do not overlap.

9. A method for distinguishing between two or more target nucleic acids according to any one of claims 1 to 8, wherein the two or more target nucleic acids comprise at least one type selected from the group consisting of a combination of different gene variants selected from deletion mutations, insertion mutations, and point mutations, and a combination of a first gene variant and a wild type of the first gene variant.

10. A method for determining whether or not a blood sample is present in the blood sample, wherein the sample used in step (a) is a piece of blood on a filter paper that has been soaked in blood and then dried, and the piece is used directly without any pretreatment.

11. A discrimination method according to any one of claims 1 to 10, wherein the fluorescently labeled probe has a fluorescent substance moiety and a quencher moiety, and contains a partial sequence complementary to a template for a nucleic acid amplification reaction, and the amplified target nucleic acid is detected by detecting fluorescence generated by irradiating the fluorescent substance moiety with excitation light.

Citation Information

Patent Citations

  • Method for detecting target nucleic acid using dried blood filter paper piece

    WO2021167058A1