An ultra-high throughput multiplexed PCR amplicon capture method
By using composite modified base nucleotide amplification primers and enzyme digestion reactions in multiplex PCR, and constructing sequencing libraries with full-length adapters, the problems of multiplex PCR amplicon quantity and uniformity were solved, achieving efficient ultra-high throughput amplification and low-cost NGS amplicon capture.
Patent Information
- Application Number
- CN202210687838.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Priority Date
- 2022-06-06
- Filing Date
- 2022-06-17
- Publication Date
- 2026-02-13
- Estimated Expiration
- 2042-06-17
AI Technical Summary
Traditional multiplex PCR technology faces problems such as reduced amplification efficiency and poor amplification uniformity when the number of amplicon increases. In particular, the differences in hybridization kinetics between different primer pairs lead to insufficient amplification and reduced product. In addition, traditional methods increase the amount of sample and reagents used.
Amplification primers containing complex modified nucleotide bases are used, combined with primer digestion enzymes, mismatch correction enzymes, and full-length adapters. Multiplex PCR amplification, enzyme digestion, and ligation reactions are employed to improve primer binding specificity and construct sequencing libraries, thereby reducing non-specific amplification products.
It improves the amplification efficiency and uniformity of multiplex PCR amplicon, reduces reagent costs and experimental time, and reduces data waste during sequencing, making it suitable for ultra-high-throughput NGS applications.
Smart Images

Figure CN114958991B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the field of second-generation sequencing, in particular to a method for capturing amplicons based on ultra-high-throughput multiplex PCR, which is particularly suitable for second-generation sequencing applications with a large number of PCR amplicons. BACKGROUND
[0002] High-throughput sequencing technology, also known as next-generation sequencing (NGS) in some literature, is a revolutionary change from traditional sequencing (Sanger sequencing). A single sequencing can determine the sequences of hundreds of thousands to millions of DNA molecules.
[0003] Targeted capture technology in NGS includes probe-based liquid hybridization capture and amplicon-based multiplex PCR capture technology. Multiplex PCR capture, also known as multiplex primer PCR capture, is a PCR reaction in which two or more pairs of primers are added to the same PCR reaction system to amplify multiple nucleic acid fragments. The reaction principle, reaction reagents and operation process are the same as general PCR, but multiplex PCR has great advantages in many applications: 1. Higher throughput (more fragments can be analyzed per reaction well); 2. Lower sample and reagent usage (especially suitable for rare samples, reducing costs).
[0004] With the development of high-throughput sequencing technology in recent years, the demand for the number of primer pairs per reaction has increased continuously in scientific research and clinical applications. A major problem faced by traditional multiplex PCR technology is that the hybridization kinetics of different primer pairs is different. Primer pairs with higher binding efficiency can make more efficient use of PCR reaction reagents, resulting in a decrease in other PCR products. This often leads to some products that should have been amplified not being amplified. This problem has become a major limiting factor for the growth of the number of single-tube amplicons in multiplex PCR. The mainstream solution in the industry is to divide multiple amplicons into multiple tubes for amplification, but this will increase the amount of sample and reagent used. In addition, the traditional multiplex PCR amplicon amplification is not uniform and needs to be adjusted repeatedly. Too many primer pairs in a single tube will cause serious interference. Therefore, it is necessary to develop a method that can increase the number of multiplex PCR single-tube amplicons while ensuring or improving amplification uniformity.
[0005] Patent document CN110592200A discloses a multiplex PCR method for improving amplification specificity and uniformity. The method comprises: extracting genomic DNA from a sample; fragmenting and purifying the extracted genomic DNA; using a plurality of specific primer pairs for PCR amplification reaction with the purified genomic DNA as a template, wherein in the PCR amplification reaction, annealing is performed using a low-to-high differential temperature. The present invention can make the template and the primer quickly bind after DNA fragmentation and purification treatment, and improve the utilization rate of the primer. The amplification primer is allowed to fully bind to the template DNA under a lower annealing temperature mode, and then the annealing temperature is gradually increased to improve the specificity of each primer binding; this significantly improves the amplification specificity and uniformity of multiplex PCR.
[0006] However, there is no super-high-throughput multiplex PCR amplicon capture method as described in the present application. SUMMARY
[0007] The purpose of the present application is to provide a super-high-throughput multiplex PCR amplicon capture method with a large number of single-tube amplification products, good amplification uniformity, and significantly improved amplification efficiency.
[0008] The technical solutions adopted by the present application are as follows:
[0009] A super-high-throughput multiplex PCR amplicon capture method, comprising the following steps:
[0010] 1) using a pool of amplification primers containing digestible complex modifications and a first enzyme mixture to perform multiplex PCR amplification on the sample to be detected, to obtain amplicon products; the amplification primers in the amplification primer pool at least one contains a complex modified base nucleotide, and the modification mode has one or several of the following cases: T base is replaced by U (uracil) modified base, T base is replaced by +T (locked nucleotide thymine) modified base, T base is replaced by 5mC (5 methyl cytosine) modified base, T base is replaced by +A (locked nucleotide adenine) modified base, G base is replaced by 8-oxo G (8-hydroxy deoxyguanosine) modified base, and T base is replaced by I (hypoxanthine) modified base; the first enzyme mixture is QuarTaq HotStart mixture;
[0011] 2) performing an enzyme reaction on the amplicon product with a second enzyme cocktail comprising a primer-digesting enzyme, a mismatch-correcting enzyme and a terminal repair enzyme, including removing excess primer portion on the amplification product with the primer-digesting enzyme, and removing non-specific amplification product with the mismatch-correcting enzyme; the second enzyme cocktail comprises a primer-digesting enzyme, a mismatch-correcting enzyme, T4 polynucleotide kinase, Taq polymerase and QuarPrep terminal repair tailing buffer; the primer-digesting enzyme is selected from one or both of UDG enzyme and FPG enzyme; the mismatch-correcting enzyme is selected from one or several of T7 endonuclease I, T4 endonuclease VII, E coli endonuclease V, Surveror endonuclease and CEL I endonuclease;
[0012] 3) performing a ligation reaction with a full-length adapter comprising Index, a third enzyme solution and a second buffer to directly obtain a sequencing library or to obtain a sequencing library after amplification; the third enzyme solution is DNA ligase.
[0013] Preferably, for any one amplification primer comprising a complex modified base nucleotide, the number of modified bases is any integer between 0 and n, and n represents the total length of the amplification primer.
[0014] Preferably, a full-length adapter comprising Index and a third enzyme solution are used to perform a ligation reaction to directly obtain a sequencing library.
[0015] Preferably, the mismatch-correcting enzyme is used to reduce non-specificity caused by PCR amplification.
[0016] Preferably, the full-length adapter comprising Index is used to replace a universal short adapter to perform a ligation reaction to construct a sequencing library.
[0017] Preferably, the sample to be detected is selected from a prokaryotic or eukaryotic microbial genome, an animal or plant genome or a human genome.
[0018] Preferably, the amplification primer pool comprises primers as shown in SEQ ID NO: 1-262. Preferably, SEQ ID NO: 1 and SEQ ID NO: 2 are a primer pair, SEQ ID NO: 3 and SEQ ID NO: 4 are a primer pair, and so on.
[0019] The application also provides use of the ultrahigh-throughput multiplex PCR amplicon capture method according to any one of the above embodiments in any one of the following aspects: pathogen detection, genetic disease detection, tumor early screening detection, tumor companion diagnosis detection, susceptible gene detection, etc.
[0020] The application has the following beneficial effects:
[0021] (1) The method of the present application is designed to modify the primer portion, each amplification primer contains a complex modified base nucleotide, and the nucleotides of the four bases A, T, C and G are modified and replaced as follows: T base is replaced by U (uracil) modified base, +T (locked nucleotide thymine) modified base, 5mC (5-methylcytosine) modified base or +A (locked nucleotide adenine) modified base, G base is replaced by 8-oxo G (8-hydroxy deoxyguanosine) modified base or I (hypoxanthine) modified base, etc. The number of replacements is between 0 and n, and n represents the total length of the primer. The primer containing modified bases improves the specificity of primer binding and can greatly improve the number of amplification primers in each reaction. It is more suitable for NGS amplicon library construction with ultra-high throughput.
[0022] (2) The partially digested product is used to construct an NGS library by a ligase, which improves the overall uniformity compared to the two-step amplification method.
[0023] (3) The full-length adapter containing Index is used instead of the conventional universal truncated adapter for the ligation reaction, which avoids the waste caused by sequencing data filtering of short amplification products.
[0024] (4) The amplification primer is digested by a primer digestion enzyme, which avoids the sequencing waste of invalid data generated by the amplification primer part during sequencing.
[0025] (5) The mismatch correction enzyme is introduced in the step of partially digesting the primer, which repairs the mismatches of the PCR amplification product and improves the accuracy and specificity of multiplex amplification.
[0026] (6) The method of the present application improves the efficiency of primer amplification, and compared with the method of capturing target fragments by liquid phase probe hybridization, it reduces the steps of hybridization capture, saves the cost of reagents, and greatly shortens the experimental time.
[0027] (7) The present application has wide application value in the fields of pathogen detection, genetic disease detection, tumor companion diagnosis, tumor early screening and genetic detection and scientific research. BRIEF DESCRIPTION OF DRAWINGS
[0028] Figure 1 : Verification of sequencing quality of data.
[0029] Figure 2 : Analysis of fragments after capture by ultra-multiplex amplicon method.
[0030] Figure 3 : Sequencing alignment and capture efficiency of ultra-multiplex amplicon method.
[0031] Figure 4 : Sequencing coverage depth (1x and 100x) of ultra-multiplex amplicon method.
[0032] Figure 5 Uniformity of ultramultiplex amplicon sequencing.
[0033] Figure 6 Comparison of uniformity between supermultiplex amplicon method and conventional two-step PCR capture method.
[0034] Figure 7 Comparison of the effects of error-correcting enzymes in supermultiplex amplicon assays. Error-correcting enzymes can reduce non-specific amplification products. A concentration of 5 U and an incubation time of 15 min produce the best results. T7E1 represents T7 endonuclease I.
[0035] Figure 8 : Graph showing the improvement in the proportion of effective data with full-length Index connector.
[0036] Figure 9 Example of the application of supermultiplex amplicon assay in the detection of neonatal genetic diseases (α-thalassemia SEA). Detailed Implementation
[0037] The following examples are provided to better understand the present invention, but do not limit the invention. Unless otherwise specified, the experimental methods in the following examples are conventional methods. Unless otherwise specified, the experimental materials used in the following examples were purchased from conventional biochemical reagent stores. All quantitative experiments in the following examples were performed in triplicate, and the results were averaged.
[0038] To address the issue of reduced amplification efficiency caused by primer interactions in multiplex PCR mentioned in the background section, this invention provides a method for constructing a high-throughput sequencing library in a typical embodiment. This method includes: performing multiplex PCR amplification on genomic DNA using a first enzyme mixture, a first buffer, and specially designed amplification primers to obtain PCR products; performing enzymatic digestion, primer digestion, mismatch correction, and A-terminal addition on the PCR products using a second enzyme mixture to obtain amplicon products; ligating the amplicon products with a third enzyme solution, a second buffer, and a full-length adapter containing an index to obtain an NGS library; and amplifying the NGS library using a fourth enzyme mixture and P5 / P7 universal primers (optional step).
[0039] In the above-described construction method of the present invention, the genomic DNA refers to the sample to be tested. The sample to be tested can be various prokaryotic or eukaryotic microbial genomes, animal or plant genomes, or human or mouse genomes, etc., with a concentration controlled at approximately 10 ng / μl.
[0040] The present invention will be further described below with reference to specific embodiments.
[0041] Example 1
[0042] This example takes human genomic DNA as experimental material, and the specific experimental steps are as follows:
[0043] 1. Sample preparation: accurately determine the concentration of genomic DNA with Qubit. Dilute the genomic DNA to 10 ng / μl according to the measured concentration for standby.
[0044] 2. The ultra-high-throughput PCR amplicon capture protocol verification experiment uses 131 pairs of amplification primers, covering all exons of BRCA1 and BRCA2, and is divided into two pools for amplification reaction. The sequences of the primers are shown in SEQ ID NO: 1-262. In addition, a new-born genetic disease screening panel containing 4780 pairs (2 pools) of primers is used for ultra-high-throughput protocol verification.
[0045] 3. Specific PCR amplification: PCR amplification is performed using the first enzyme mixture (2x QuarTaq HotStart mixture) and the first buffer (QuarTaq PCR enhancer) and amplification primers to obtain PCR products. The specific reaction system is shown in the following table.
[0046] Component Volume Genomic DNA 2 μl First enzyme mix 10 μl Amplification primer 5 μl First buffer 2 μl Nuclease-free water 1 μl Total 20 μl
[0047] After the system is prepared, the reaction tube is placed in a PCR instrument or other thermal incubation reaction instrument, and the reaction is carried out according to the following program:
[0048]
[0049] 4. Primer digestion and A addition: dilute the PCR product to 50 μl, purify it with 1.5x purification magnetic beads, elute it with 35 μl nuclease-free water, add 9.5 μl second enzyme mixture (T4 polynucleotide kinase, Taq polymerase, FPG enzyme, UDG enzyme, T7 endonuclease I and QuarPrep end repair tailing buffer) to it, and carry out the following reaction:
[0050] Temperature Time 37℃ 10 min 50℃ 10 min 65℃ 5 min 4℃ ∞
[0051] 5. Adapter ligation: take out the third enzyme solution (T4 DNA ligase) and the second buffer (Tris-HCL, MgCl2, DTT, ATP, PEG6000 and 1,2-propanediol mixture), and the index adapter primer, according to the following table, to prepare the reaction system for adapter ligation:
[0052] Component Volume (μl) Product from previous step 44.5 Index full-length adapter 2.5 Third enzyme 10 Second buffer 16 Nuclease-free water 6.9
[0053] Blow and mix, and centrifuge for a moment.
[0054] Place the magnetic beads on a PCR instrument and perform the following procedure. At the same time, remove the magnetic beads and incubate them at room temperature for 30 minutes for later use. Prepare sufficient 80% ethanol with nuclease-free water.
[0055] Step Temperature Time 1 25℃ 15 min 2 4℃ Hold
[0056] The reaction system after ligation was purified using 0.8× magnetic beads, and then washed with 80% ethanol and nuclease-free water to obtain the purified linker fragment.
[0057] 6. Second round of PCR amplification (optional step): PCR enrichment of the adapter fragment is performed using the fourth enzyme mixture (2×QuarTaq HiFi HotStart mixture) and P5 / P7 universal primers to obtain a DNA library. See the table below for details:
[0058] Component Volume (μl) Product from previous step 17 Fourth enzyme mix 25 Universal primer 8 Total 50
[0059] The working concentration of the fourth enzyme mixture is 1×.
[0060] Next, perform PCR amplification according to the PCR procedure in the table below:
[0061]
[0062] Post-PCR purification: After the reaction is complete, remove the PCR tube, centrifuge briefly, collect all liquid at the bottom of the tube, purify with an equal volume of magnetic beads, and then wash with 21 μl of nuclease-free water before unloading.
[0063] 7. Document Quality Inspection: Using The concentration of the library was detected using the dsDNA HS Assay Kit, and the size of the library fragments was detected using a 2100 bioanalyzer, all performed according to the manufacturer's instructions. The first round of specific PCR amplification consisted of 22 cycles, and the second round of PCR amplification consisted of 7 cycles, with a library yield of approximately 150-160 ng.
[0064] 8. Libraries that pass quality control are then sequenced. The sequencing service is outsourced to Beijing Novogene Technology Co., Ltd., using an Illumina gene sequencer in PE150 mode (paired-end sequencing, 150 bases per sequence). Each sample generates 1GB of sequencing data. To ensure library quality before sequencing, library concentration, insert size, and precise molar concentration are required.
[0065] Document detection mainly includes three methods:
[0066] (1) Qubit 2.0 was used to perform preliminary quantification of library concentration;
[0067] (2) Agilent 2100 to detect the integrity of the library DNA fragments and the size of the inserted fragments;
[0068] (3) Q-PCR method to accurately quantify the effective concentration of the library.
[0069] After the library is qualified, different libraries are pooled to flowcell according to the effective concentration and the target data volume requirements, and then sequenced using the Illumina high-throughput sequencing platform (HiSeq / MiSeq) after cBOT clustering.
[0070] 9. For the data returned by the sequencing company, we analyze it according to the standard process, specifically, the following steps:
[0071] (1) Data quality control: if the sequencing error rate is represented by e, and the base quality value of the data measured by the Illumina platform is represented by Qphred, then Qphred = -10log10(e). The simple correspondence between base recognition accuracy and Phred score in Illumina software is shown in the following table:
[0072] Phred score Incorrect base calls Correct base calls Q-score 10 1 / 10 90% Q10 20 1 / 100 99% Q20 30 1 / 1000 99.9% Q30 40 1 / 10000 99.99% Q40
[0073] The sequencing error rate is related to the base quality. According to the characteristics of sequencing technology, the error rate of the front and end of the sequencing fragment will be higher. Generally, Q20≥99%, Q30≥95% represents ideal sequencing quality, where Q20, Q30 respectively represent the percentage of bases with Phred value greater than 20, 30 in the total base. The sequencing quality distribution of the verification data is shown in Figure 1 It can be seen that the Q-score value of all bases is greater than 30, and the sequencing quality of this time meets the analysis requirements. For qualified data, it is also necessary to detect the adapter content to remove the exogenous non-human genomic sequences introduced by the experiment. The adapter detection uses the professional open source bioinformatics software TrimGalore (https: / / www.bioinformatics.babraham.ac.uk / projects / trim_galore / ), which can automatically identify the adapter type (Illumina universal adapter / Nextera transposase adapter / Illumina small RNA adapter, etc.) through the built-in algorithm. By detecting and removing the adapter sequence, we get the processed data clean data, which is used for the next step of analysis.
[0074] (2) Data alignment analysis: In order to further identify clean data, and then evaluate the efficiency of the ultra-multiplex PCR primer amplification, the data needs to be aligned with the human standard reference genome. Specifically, we use the mem algorithm of the open source tool bwa (http: / / bio-bwa.sourceforge.net / bwa.shtml) in the double-end alignment mode, and the alignment object is the human standard reference genome GRCh37 (hg19). The alignment result is in the sam (Sequence Alignment / Map format) format, and the open source tool samtools (http: / / samtools.sourceforge.net / ) is used to sort the results according to the position aligned to the genome, establish an index, and at the same time convert it into a bam (Binary Alignment / Map format) format with a larger file compression ratio, in order to save storage space.
[0075] (3) Alignment result quality control: In general, for the experimental scheme of ultra-multiplex PCR amplicon capture, the following indicators are used to evaluate the amplification efficiency, respectively:
[0076] a. The mapping rate (Mapping Rate) represents the proportion of human data in the pre-processed data, the higher the better;
[0077] b. The capture efficiency (Target Rate) represents the proportion of the expected amplification region of the multiplex primer in the human data, the higher the better;
[0078] c. Coverage (Coverage) represents the actual amplification coverage proportion of the target amplification region, 100% means that each pair of primers has completed amplification;
[0079] d. Uniformity (Uniformity) represents the consistency of the amplification ability of each pair of primers, the higher the uniformity, the better the amplification consistency.
[0080] The sample results of this test are shown in the attached Figures 3-5 It can be seen that the evaluation indicators of this method are ideal, and have very high inter-sample consistency.
[0081] Compared with the most common two-step PCR method on the market, the uniformity is significantly improved. See the attached Figure 6 .
[0082] (4) Variant calling analysis: Based on the generated bam file, the open source tool VarScan (http: / / varscan.sourceforge.net / ) was used to analyze the mutations, and the clear variant site result file was obtained. The result was saved in vcf (variant calling format) format, which contained information such as variant position, variant form, site depth, and variant frequency. Based on the known positive results, the actual detection of the mutation results was shown as follows: Figure 9 The positive site is α-thalassemia SEA, the variant form is Deletion of 20kb from HBA2 to HBA1, which has clear pathogenicity and family heredity, and is consistent with the known clinical sample situation.
[0083] The above-described embodiments are part of the embodiments of the present application, rather than all the embodiments. The detailed description of the embodiments of the present application is not intended to limit the scope of the claimed application, but only represents selected embodiments of the present application. Based on the embodiments in the present application, all other embodiments obtained by those of ordinary skill in the art without creative labor are within the scope of protection of the present application. SEQUENCE LISTING <110> Shanghai Diying Biotechnology Co., Ltd. <120> A high-throughput multiplex PCR amplicon capture method for next-generation sequencing <160> 262 <170> SIPOSequenceListing 1.0 <210> 1 <211> 27 <212> DNA <213> Artificial sequence <400> 1 gtcttcagaa tgccagagat atacagg 27 <210> 2 <211> 28 <212> DNA <213> Artificial sequence <400> 2 aagccatcag tattgtagac aaacacat 28 <210> 3 <211> 23 <212> DNA <213> Artificial sequence <400> 3 gttccctctg cgtgttctca taa 23 <210> 4 <211> 25 <212> DNA <213> Artificial sequence <400> 4 attcctgcac taatgtgttc attct 25 <210> 5 <211> 32 <212> DNA <213> Artificial sequence <400> 5 ttttaaggca gttctagaag aatgaaaact ct 32 <210> 6 <211> 33 <212> DNA <213> Artificial sequence <400> 6 tcatacctgt atagggtatg ctctttgaat aat 33 <210> 7 <211> 30 <212> DNA <213> Artificial sequence <400> 7 tgacattgaa gactgacttt actctttcaa 30 <210> 8 <211> 30 <212> DNA <213> Artificial sequence <400> 8 gctttttgaa gcctttaagg atttttcttg 30 <210> 9 <211> 30 <212> DNA <213> Artificial sequence <400> 9 agaagaagaa aacaaatggt tttaccaagg 30 <210> 10 <211> 30 <212> DNA <213> Artificial sequence <400> 10 ctctaactgc aaacataatg ttttccctlg 30 <210> 11 <211> 20 <212> DNA <213> Artificial sequence <400> 11 aggaggactg cttctagcct 20 <210> 12 <211> 26 <212> DNA <213> Artificial sequence <400> 12 gccaaaagac ttctacagag tgaacc 26 <210> 13 <211> 30 <212> DNA <213> Artificial sequence <400> 13 atcatggaaa atttgtgcat tgttaaggaa 30 <210> 14 <211> 24 <212> DNA <213> Artificial sequence <400> 14 cctctcctct gtcattcttc ctgt 24 <210> 15 <211> 30 <212> DNA <213> Artificial sequence <400> 15 atggacattc taagttatga ggaaacagac 30 <210> 16 <211> 25 <212> DNA <213> Artificial sequence <400> 16 cactttgtcc aaagattcct ttgca 25 <210> 17 <211> 22 <212> DNA <213> Artificial sequence <400> 17 ctgggcagat tctgcaactt tc 22 <210> 18 <211> 30 <212> DNA <213> Artificial sequence <400> 18 aactttgtaa ttcaacattc atcgttgtgt 30 <210> 19 <211> 30 <212> DNA <213> Artificial sequence <400> 19 ttctctaatg ttattacggc taattgtgct 30 <210> 20 <211> 27 <212> DNA <213> Artificial sequence <400> 20 gaggctctag gttttgtcta tcatctc 27 <210> 21 <211> 30 <212> DNA <213> Artificial sequence <400> 21 agggaaacac tcagattaaa gaagatttgt 30 <210> 22 <211> 30 <212> DNA <213> Artificial sequence <400> 22 gcaattcttc tggtttctga tcaaagaaat 30 <210> 23 <211> 27 <212> DNA <213> Artificial sequence <400> 23 acttaccaga tgggacactc taagatt 27 <210> 24 <211> 29 <212> DNA <213> Artificial sequence <400> 24 gacgttgtca ttagttcttt ggtttgtat 29 <210> 25 <211> 29 <212> DNA <213> Artificial sequence <400> 25 tcagaaaact actttgaaac agaagcagt 29 <210> 26 <211> 26 <212> DNA <213> Artificial sequence <400> 26 tgattggcaa cacgaaaggt aaaaat 26 <210> 27 <211> 30 <212> DNA <213> Artificial sequence <400> 27 cgctgatgaa tgtgaaaaat ctaaaaacca 30 <210> 28 <211> 24 <212> DNA <213> Artificial sequence <400> 28 attttctcca tctgggctcc attt 24 <210> 29 <211> 25 <212> DNA <213> Artificial sequence <400> 29 ttcagtgatg gaggaaatgt tggtt 25 <210> 30 <211> 21 <212> DNA <213> Artificial sequence <400> 30 gtggtggctc agctacttga g 21 <210> 31 <211> 27 <212> DNA <213> Artificial sequence <400> 31 gctgatttct gttgtatgct tgtactg 27 <210> 32 <211> 27 <212> DNA <213> Artificial sequence <400> 32 gtaatcggct ctaaagaaac atgatgc 27 <210> 33 <211> 28 <212> DNA <213> Artificial sequence <400> 33 tccaggaaga ctttgtttat agacctca 28 <210> 34 <211> 30 <212> DNA <213> Artificial sequence <400> 34 ctgaaagaga aatgggaaat gagaacattc 30 <210> 35 <211> 30 <212> DNA <213> Artificial sequence <400> 35 tgagctctaa ttttgttgta tttgtcctgt 30 <210> 36 <211> 22 <212> DNA <213> Artificial sequence <400> 36 acttccacac ggttgtgaca tc 22 <210> 37 <211> 28 <212> DNA <213> Artificial sequence <400> 37 gcaataaaac tagtagtgca gataccca 28 <210> 38 <211> 28 <212> DNA <213> Artificial sequence <400> 38 caatgactga tttttaccaa gagtgcaa 28 <210> 39 <211> 27 <212> DNA <213> Artificial sequence <400> 39 aggtcccaaa tggtcttcag aataatc 27 <210> 40 <211> 30 <212> DNA <213> Artificial sequence <400> 40 gctttctgta atcgaaagag ctaaaatgtt 30 <210> 41 <211> 29 <212> DNA <213> Artificial sequence <400> 41 tgatgaatgg ttttatagga acgctatgt 29 <210> 42 <211> 30 <212> DNA <213> Artificial sequence <400> 42 cagttgtgag attatctttt catggctatt 30 <210> 43 <211> 24 <212> DNA <213> Artificial sequence <400> 43 gtttccagca gctgaaattt gtga 24 <210> 44 <211> 30 <212> DNA <213> Artificial sequence <400> 44 acttatctct ttgtggtgtt acatgtgtac 30 <210> 45 <211> 20 <212> DNA <213> Artificial sequence <400> 45 atctgagaaa ccccacagcc 20 <210> 46 <211> 20 <212> DNA <213> Artificial sequence <400> 46 tgtccctccc atcctctgat 20 <210> 47 <211> 28 <212> DNA <213> Artificial sequence <400> 47 tttcaggaag gaatgttccc aatagtag 28 <210> 48 <211> 26 <212> DNA <213> Artificial sequence <400> 48 ccaggctctt agccaaaata ttagca 26 <210> 49 <211> 19 <212> DNA <213> Artificial sequence <400> 49 ccccagagca tcacttggg 19 <210> 50 <211> twenty two <212> DNA <213> Artificial sequence <400> 50 attctgagag gctgctgctt ag 22 <210> 51 <211> 30 <212> DNA <213> Artificial sequence <400> 51 agtgacttgtttaaacagtggaattctaga 30 <210> 52 <211> 28 <212> DNA <213> Artificial sequence <400> 52 gcataccacc catctgtaag ttcaataa 28 <210> 53 <211> twenty three <212> DNA <213> Artificial sequence <400> 53 ccagtggtat gtgggagttt gtt 23 <210> 54 <211> 26 <212> DNA <213> Artificial sequence <400> 54 agatttgtaa atctcagggc aaaggt 26 <210> 55 <211> 29 <212> DNA <213> Artificial sequence <400> 55 gtttattgca ttcttctgtg aaaagaagc 29 <210> 56 <211> 27 <212> DNA <213> Artificial sequence <400> 56 tgctttttgg atcattttca cactgtc 27 <210> 57 <211> 30 <212> DNA <213> Artificial sequence <400> 57 agcctaatct tactagacat gtcttttctt 30 <210> 58 <211> 30 <212> DNA <213> Artificial sequence <400> 58 cgcgttgaag aagtacaaaa tgtcattaat 30 <210> 59 <211> 29 <212> DNA <213> Artificial sequence <400> 59 ttcccatgga aaagaatcaa gatgtatgt 29 <210> 60 <211> 30 <212> DNA <213> Artificial sequence <400> 60 tcctttcatt agctacttgg aagacaaaat 30 <210> 61 <211> 23 <212> DNA <213> Artificial sequence <400> 61 ccattctagg acttgcccct ttc 23 <210> 62 <211> 28 <212> DNA <213> Artificial sequence <400> 62 cagaaaacac agaaaaatct ccagcaaa 28 <210> 63 <211> 27 <212> DNA <213> Artificial sequence <400> 63 gaccagctca caagagaaga aaatact 27 <210> 64 <211> 30 <212> DNA <213> Artificial sequence <400> 64 ggtttctctt atcaacacga ggaagtattt 30 <210> 65 <211> 24 <212> DNA <213> Artificial sequence <400> 65 gcctgtgaat ggtctcaact aacc 24 <210> 66 <211> 28 <212> DNA <213> Artificial sequence <400> 66 gcaagaatgc agtctgtatg agattcaa 28 <210> 67 <211> 23 <212> DNA <213> Artificial sequence <400> 67 tctcagccca gatgacttca aag 23 <210> 68 <211> 30 <212> DNA <213> Artificial sequence <400> 68 gagtcatctg aggagaattc agttcttttt 30 <210> 69 <211> 26 <212> DNA <213> Artificial sequence <400> 69 gggaatcagg ctttactaga agaaca 26 <210> 70 <211> 27 <212> DNA <213> Artificial sequence <400> 70 caatgtggtc tttgcagcta tttactt 27 <210> 71 <211> 28 <212> DNA <213> Artificial sequence <400> 71 cccttcactt cagcaaatttttagatcc 28 <210> 72 <211> 30 <212> DNA <213> Artificial sequence <400> 72 ctggtagctc caactaatca taagagattt 30 <210> 73 <211> 30 <212> DNA <213> Artificial sequence <400> 73 gtgaaagtat ctagcactgt gtatgtatgt 30 <210> 74 <211> 25 <212> DNA <213> Artificial sequence <400> 74 acttccattg aaggaagcttctctt 25 <210> 75 <211> twenty two <212> DNA <213> Artificial sequence <400> 75 ggtacagcag actgtggaat gt 22 <210> 76 <211> 30 <212> DNA <213> Artificial sequence <400> 76 aaagactctg catttttgct gttaattttt 30 <210> 77 <211> 30 <212> DNA <213> Artificial sequence <400> 77 cttcctttat ttcaccatca tctaacaggt 30 <210> 78 <211> 30 <212> DNA <213> Artificial sequence <400> 78 ccaaaattga atgctatgct tagattaggg 30 <210> 79 <211> 26 <212> DNA <213> Artificial sequence <400> 79 tttagtagag acagggtttc tccatt 26 <210> 80 <211> 26 <212> DNA <213> Artificial sequence <400> 80 gcgttgcctt tgtttcttct taattc 26 <210> 81 <211> 26 <212> DNA <213> Artificial sequence <400> 81 ctgtaatgag ctggcatgag tatttg 26 <210> 82 <211> 30 <212> DNA <213> Artificial sequence <400> 82 cacctccaag gtgtatgaag tatgtatttt 30 <210> 83 <211> 30 <212> DNA <213> Artificial sequence <400> 83 caaatagtag atgtgctttt tgatgtctga 30 <210> 84 <211> 29 <212> DNA <213> Artificial sequence <400> 84 ggtttagaga ctttctcaaa ggcttagat 29 <210> 85 <211> 30 <212> DNA <213> Artificial sequence <400> 85 atgacaaaaa tcatctctcc gaaaaacaag 30 <210> 86 <211> 28 <212> DNA <213> Artificial sequence <400> 86 caagttcctc aacgcaaata tcttcatt 28 <210> 87 <211> 27 <212> DNA <213> Artificial sequence <400> 87 atttggagta atgagtccag tttcgtt 27 <210> 88 <211> 26 <212> DNA <213> Artificial sequence <400> 88 agaagaggaa tgtgcaacat tctctg 26 <210> 89 <211> 29 <212> DNA <213> Artificial sequence <400> 89 aaaatcaaag tgtttgttcc aatacagca 29 <210> 90 <211> 23 <212> DNA <213> Artificial sequence <400> 90 caattggtgg cgatggtttt ctc 23 <210> 91 <211> 22 <212> DNA <213> Artificial sequence <400> 91 tcagcttact ccggccaaaa aa 22 <210> 92 <211> 17 <212> DNA <213> Artificial sequence <400> 92 agccgcggca gcgaccc 17 <210> 93 <211> 28 <212> DNA <213> Artificial sequence <400> 93 tatgtgggtt tgcaatttat aaagcagc 28 <210> 94 <211> 30 <212> DNA <213> Artificial sequence <400> 94 tatacaacag aatatacgat ggcctccata 30 <210> 95 <211> 22 <212> DNA <213> Artificial sequence <400> 95 cccatcgtgg gatcttgctt at 22 <210> 96 <211> 30 <212> DNA <213> Artificial sequence <400> 96 aaagctcttc ctttttgaaa gtctgttttt 30 <210> 97 <211> 22 <212> DNA <213> Artificial sequence <400> 97 ctgaagcctc tgaaagtgga ct 22 <210> 98 <211> 23 <212> DNA <213> Artificial sequence <400> 98 catttgcttc aaactgggct gaa 23 <210> 99 <211> 29 <212> DNA <213> Artificial sequence <400> 99 caacaagaca aacaacagtt ggtattagg 29 <210> 100 <211> 29 <212> DNA <213> Artificial sequence <400> 100 tgtcagttca tcatcttcca taaaagctt 29 <210> 101 <211> 30 <212> DNA <213> Artificial sequence <400> 101 tggtattgaa attttagcac tgtaagcaac 30 <210> 102 <211> 30 <212> DNA <213> Artificial sequence <400> 102 ttaaggtcta tccaaaactt tattgccagt 30 <210> 103 <211> 29 <212> DNA <213> Artificial sequence <400> 103 aggatgttaa agctcattca gtcaaagat 29 <210> 104 <211> 25 <212> DNA <213> Artificial sequence <400> 104 aggaacgggc ttggaagaaa ataat 25 <210> 105 <211> 30 <212> DNA <213> Artificial sequence <400> 105 ttttacctca gtcacataat aaggaatgca 30 <210> 106 <211> 24 <212> DNA <213> Artificial sequence <400> 106 ggttctaagc aacactgtga cgta 24 <210> 107 <211> 30 <212> DNA <213> Artificial sequence <400> 107 ataggaaaat accagcttca tagacaaagg 30 <210> 108 <211> 30 <212> DNA <213> Artificial sequence <400> 108 gccacagtag atgctcagta aatatttcta 30 <210> 109 <211> 27 <212> DNA <213> Artificial sequence <400> 109 tgggtgtttt atgcttggtt ctttagt 27 <210> 110 <211> 26 <212> DNA <213> Artificial sequence <400> 110 agagagtcta aaacagcttc tcacct 26 <210> 111 <211> 30 <212> DNA <213> Artificial sequence <400> 111 tgaggaaaca gtggtaaata agagagatga 30 <210> 112 <211> 22 <212> DNA <213> Artificial sequence <400> 112 tcctccttct gtgagcaaac ag 22 <210> 113 <211> 30 <212> DNA <213> Artificial sequence <400> 113 aatactgcta ctctctacag atctttcagt 30 <210> 114 <211> 28 <212> DNA <213> Artificial sequence <400> 114 gccaaatgaa cagacaagta aaagacat 28 <210> 115 <211> 23 <212> DNA <213> Artificial sequence <400> 115 caaaatatgt ggaggcccaa caa 23 <210> 116 <211> 29 <212> DNA <213> Artificial sequence <400> 116 tgttgctatt ctttgtctaa caccaaaaa 29 <210> 117 <211> 24 <212> DNA <213> Artificial sequence <400> 117 gagttgtggc accaaatacg aaac 24 <210> 118 <211> 30 <212> DNA <213> Artificial sequence <400> 118 agtcctagtg gattcactga cagatataaa 30 <210> 119 <211> 29 <212> DNA <213> Artificial sequence <400> 119 gtgacttttg gactttgttt ctttaagga 29 <210> 120 <211> 25 <212> DNA <213> Artificial sequence <400> 120 ccaagggact aattcatggt tgttc 25 <210> 121 <211> 25 <212> DNA <213> Artificial sequence <400> 121 caagctcttt tgtctggttc aacag 25 <210> 122 <211> 30 <212> DNA <213> Artificial sequence <400> 122 tcttataaac tggaaaggtt aagcgtcaat 30 <210> 123 <211> 30 <212> DNA <213> Artificial sequence <400> 123 atgtagtata gggaagcttc ataagtcagt 30 <210> 124 <211> 29 <212> DNA <213> Artificial sequence <400> 124 agcctttttg ggatattaaa tgttctgga 29 <210> 125 <211> 22 <212> DNA <213> Artificial sequence <400> 125 cccattgcag cacaactaag ga 22 <210> 126 <211> 29 <212> DNA <213> Artificial sequence <400> 126 ctaacacact gttcaactct gtgaaaatg 29 <210> 127 <211> 22 <212> DNA <213> Artificial sequence <400> 127 actgtgccca aacactacct tt 22 <210> 128 <211> 29 <212> DNA <213> Artificial sequence <400> 128 ttaaggacaa agttggttct tcagaatca 29 <210> 129 <211> 28 <212> DNA <213> Artificial sequence <400> 129 cccaaagtgt aaagaaatgc agaattct 28 <210> 130 <211> 28 <212> DNA <213> Artificial sequence <400> 130 ggctgaattt tcaatgactg aataaggg 28 <210> 131 <211> 27 <212> DNA <213> Artificial sequence <400> 131 acaggatttg gaaaaacatc agggaat 27 <210> 132 <211> 28 <212> DNA <213> Artificial sequence <400> 132 tttggttcca cttcagatac aaatgagt 28 <210> 133 <211> 30 <212> DNA <213> Artificial sequence <400> 133 gaaaaatatt agtgtcgcca aagagtcatt 30 <210> 134 <211> 29 <212> DNA <213> Artificial sequence <400> 134 caactgggac actttctttc agtattttg 29 <210> 135 <211> 30 <212> DNA <213> Artificial sequence <400> 135 tgataatcac ttcttccatt gcatctttct 30 <210> 136 <211> 29 <212> DNA <213> Artificial sequence <400> 136 atggagattc cataaactaa caagcactt 29 <210> 137 <211> 30 <212> DNA <213> Artificial sequence <400> 137 atgccttaac aaaagtaatc catagtcaag 30 <210> 138 <211> 30 <212> DNA <213> Artificial sequence <400> 138 tgtggagttt taaataggtt tggttcgtaa 30 <210> 139 <211> 28 <212> DNA <213> Artificial sequence <400> 139 tccaatgtaa aagatgcaaa tgcatacc 28 <210> 140 <211> 30 <212> DNA <213> Artificial sequence <400> 140 ggtggcccta cctcaaaattattatta 30 <210> 141 <211> 29 <212> DNA <213> Artificial sequence <400> 141 tggatactta aagccttctg tgtcatttc 29 <210> 142 <211> 28 <212> DNA <213> Artificial sequence <400> 142 cccaaagatc tcatgttaag tggagaaa 28 <210> 143 <211> twenty three <212> DNA <213> Artificial sequence <400> 143 gtaactcaga ctcagcatca gca 23 <210> 144 <211> 27 <212> DNA <213> Artificial sequence <400> 144 aaaactgagg ctctttagct tcttagg 27 <210> 145 <211> 27 <212> DNA <213> Artificial sequence <400> 145 gaacccattt tcaagaactc taccatg 27 <210> 146 <211> 24 <212> DNA <213> Artificial sequence <400> 146 ctgaagctac ctccaaaact gtga 24 <210> 147 <211> 26 <212> DNA <213> Artificial sequence <400> 147 cagccttagc tttttacaca agttgt 26 <210> 148 <211> 29 <212> DNA <213> Artificial sequence <400> 148 gaatagctgt tagacatgct actgttact 29 <210> 149 <211> 24 <212> DNA <213> Artificial sequence <400> 149 ggttttcata cagctagcgg gaaa 24 <210> 150 <211> 30 <212> DNA <213> Artificial sequence <400> 150 accacagtct caatagaaac aaggttttta 30 <210> 151 <211> 28 <212> DNA <213> Artificial sequence <400> 151 ttgtttccta ggcacaataa aagatcga 28 <210> 152 <211> 30 <212> DNA <213> Artificial sequence <400> 152 ggaagtgtta acttcttaac gttagtgtca 30 <210> 153 <211> 30 <212> DNA <213> Artificial sequence <400> 153 gaagataaca aatatactgc tgccagtaga 30 <210> 154 <211> 24 <212> DNA <213> Artificial sequence <400> 154 ttgagctttc gcaacttcca aaaa 24 <210> 155 <211> 30 <212> DNA <213> Artificial sequence <400> 155 ttctgcagag gtacatccaa taagtttatc 30 <210> 156 <211> 30 <212> DNA <213> Artificial sequence <400> 156 tacttgaatc actgccatca aattctaagt 30 <210> 157 <211> 22 <212> DNA <213> Artificial sequence <400> 157 caaatgggca ggactcttag gt 22 <210> 158 <211> 24 <212> DNA <213> Artificial sequence <400> 158 ctgaggcttg ctcagtttct tttg 24 <210> 159 <211> 32 <212> DNA <213> Artificial sequence <400> 159 aactagtttt tgccagtttt ttaaaataac ct 32 <210> 160 <211> 24 <212> DNA <213> Artificial sequence <400> 160 gaaacaaact cccacatacc actg 24 <210> 161 <211> 27 <212> DNA <213> Artificial sequence <400> 161 cctcagatgt tattttccaa gcaggat 27 <210> 162 <211> 30 <212> DNA <213> Artificial sequence <400> 162 gcattcatta tgacatgaag atcagcatct 30 <210> 163 <211> 30 <212> DNA <213> Artificial sequence <400> 163 gggaaggaaa gaattttgct taagatatca 30 <210> 164 <211> 29 <212> DNA <213> Artificial sequence <400> 164 ctcaaagtat ttcattttct tggtgccat 29 <210> 165 <211> 27 <212> DNA <213> Artificial sequence <400> 165 tccagactct gaagaacttt tctcaga 27 <210> 166 <211> 25 <212> DNA <213> Artificial sequence <400> 166 ggttgcttgt ttatcacctg tgtct 25 <210> 167 <211> 30 <212> DNA <213> Artificial sequence <400> 167 aaaagtggaa tacagtgata ctgactttca 30 <210> 168 <211> 28 <212> DNA <213> Artificial sequence <400> 168 tggcaacagc tcaacgtttt tataattt 28 <210> 169 <211> 22 <212> DNA <213> Artificial sequence <400> 169 gcctcgcctc atgtggtttt at 22 <210> 170 <211> 28 <212> DNA <213> Artificial sequence <400> 170 taactagtat tctgagctgt gtgctaga 28 <210> 171 <211> 25 <212> DNA <213> Artificial sequence <400> 171 gggagggaga ctgtgtgtaa tattt 25 <210> 172 <211> 29 <212> DNA <213> Artificial sequence <400> 172 agttcttttg gtcatcaatc tctttctcc 29 <210> 173 <211> 29 <212> DNA <213> Artificial sequence <400> 173 cttctataaa gttaggtgtt tcctgggtt 29 <210> 174 <211> 30 <212> DNA <213> Artificial sequence <400> 174 tcagtcataa cagctcaaag ttgaacttat 30 <210> 175 <211> 24 <212> DNA <213> Artificial sequence <400> 175 gcttttattc tgctcatggc acaa 24 <210> 176 <211> 30 <212> DNA <213> Artificial sequence <400> 176 caacaaaagt gccagtagtc atttcaatat 30 <210> 177 <211> 26 <212> DNA <213> Artificial sequence <400> 177 ggaatctgct gaacaaaagg aacaag 26 <210> 178 <211> 30 <212> DNA <213> Artificial sequence <400> 178 gcattagtag tggattttgc ttctctgata 30 <210> 179 <211> 30 <212> DNA <213> Artificial sequence <400> 179 aaaaataccg aaagaccaaa aatcagaact 30 <210> 180 <211> 30 <212> DNA <213> Artificial sequence <400> 180 cctaaacaat catgtataca gatgatgcct 30 <210> 181 <211> 26 <212> DNA <213> Artificial sequence <400> 181 catttgttaa cttcagctct gggaaa 26 <210> 182 <211> 30 <212> DNA <213> Artificial sequence <400> 182 caaattgata gttgttctag cagtgaagag 30 <210> 183 <211> 30 <212> DNA <213> Artificial sequence <400> 183 aaatctgaaa gagctaacat acagttagca 30 <210> 184 <211> 27 <212> DNA <213> Artificial sequence <400> 184 ctattaggtc cacctcagaa caagatg 27 <210> 185 <211> 30 <212> DNA <213> Artificial sequence <400> 185 aggagaaccc tcaatcaaaa gaaacttatt 30 <210> 186 <211> 28 <212> DNA <213> Artificial sequence <400> 186 tataaagagg tccttgatta ggcacagt 28 <210> 187 <211> 27 <212> DNA <213> Artificial sequence <400> 187 caaccaaagt ctttgttcca cctttta 27 <210> 188 <211> 29 <212> DNA <213> Artificial sequence <400> 188 gaaaggcaaa aattcatcac acaaattgt 29 <210> 189 <211> 27 <212> DNA <213> Artificial sequence <400> 189 tcttcactat tcacctacgt ctagaca 27 <210> 190 <211> 28 <212> DNA <213> Artificial sequence <400> 190 cccaaaacat gaatgttctc aacaagtg 28 <210> 191 <211> 27 <212> DNA <213> Artificial sequence <400> 191 gtgaggtaga ttgtaaagtc aaaggct 27 <210> 192 <211> 26 <212> DNA <213> Artificial sequence <400> 192 aggtgcggta aaatttggat tctgta 26 <210> 193 <211> 30 <212> DNA <213> Artificial sequence <400> 193 aaatatttaa aatgtgccaa gaactgtgct 30 <210> 194 <211> 29 <212> DNA <213> Artificial sequence <400> 194 aaaaatgatg aagtgacagt tccagtagt 29 <210> 195 <211> 30 <212> DNA <213> Artificial sequence <400> 195 gttgttgaat tcagtatcat cctatgtggt 30 <210> 196 <211> 29 <212> DNA <213> Artificial sequence <400> 196 tgccgtatat gattacgtaa tgtaatgct 29 <210> 197 <211> 24 <212> DNA <213> Artificial sequence <400> 197 ccatcatgtg agtcatcaga acct 24 <210> 198 <211> 24 <212> DNA <213> Artificial sequence <400> 198 caacataaca gatgggctgg aagt 24 <210> 199 <211> 28 <212> DNA <213> Artificial sequence <400> 199 gttccctgat ttatcatttc aggagtct 28 <210> 200 <211> 30 <212> DNA <213> Artificial sequence <400> 200 agagttcact ccaaatcagt agagagtaat 30 <210> 201 <211> 24 <212> DNA <213> Artificial sequence <400> 201 cctcccagag ccctcaaatt ataa 24 <210> 202 <211> 27 <212> DNA <213> Artificial sequence <400> 202 cactgtgcga agacttttat gtctact 27 <210> 203 <211> 27 <212> DNA <213> Artificial sequence <400> 203 ccagaaccac catctttcag taatttg 27 <210> 204 <211> twenty two <212> DNA <213> Artificial sequence <400> 204 cttgtttaca gcgatgccaa ca 22 <210> 205 <211> 30 <212> DNA <213> Artificial sequence <400> 205 acgagaataa atcaaaaatt tgccaaacga 30 <210> 206 <211> 30 <212> DNA <213> Artificial sequence <400> 206 tccaatccag acatattttg gttatgttgt 30 <210> 207 <211> 27 <212> DNA <213> Artificial sequence <400> 207 agatgatgtc agcaaaccta agaatgt 27 <210> 208 <211> 22 <212> DNA <213> Artificial sequence <400> 208 ccagtcctgc caatgagaag aa 22 <210> 209 <211> 29 <212> DNA <213> Artificial sequence <400> 209 gcctaccaca aatacaaatt atgaccaag 29 <210> 210 <211> 24 <212> DNA <213> Artificial sequence <400> 210 ttctcttcag gaggaaaagc acag 24 <210> 211 <211> 17 <212> DNA <213> Artificial sequence <400> 211 tgcgtgtgct gcgtgtc 17 <210> 212 <211> 19 <212> DNA <213> Artificial sequence <400> 212 cactaacccg ctccagagg 19 <210> 213 <211> 26 <212> DNA <213> Artificial sequence <400> 213 ttgtgcaaac ttcctgagtt ttcatg 26 <210> 214 <211> 30 <212> DNA <213> Artificial sequence <400> 214 ggttttctac tgttgctgca tcttattttt 30 <210> 215 <211> 29 <212> DNA <213> Artificial sequence <400> 215 cctgcaaaaa taaaaatgca gccattaaa 29 <210> 216 <211> 22 <212> DNA <213> Artificial sequence <400> 216 catccaatgc ctcgtaacaa cc 22 <210> 217 <211> 29 <212> DNA <213> Artificial sequence <400> 217 accagatgac tatcttaaag accacttct 29 <210> 218 <211> 24 <212> DNA <213> Artificial sequence <400> 218 agctttttgc agagcttcag taga 24 <210> 219 <211> 29 <212> DNA <213> Artificial sequence <400> 219 aattcgagtt ccatattgct tatactgct 29 <210> 220 <211> 30 <212> DNA <213> Artificial sequence <400> 220 tcctgaggat tttatcaaga aagcagattt 30 <210> 221 <211> 29 <212> DNA <213> Artificial sequence <400> 221 aagaaaacaa gctagcagaa cattttgtt 29 <210> 222 <211> 29 <212> DNA <213> Artificial sequence <400> 222 caagaaatta gagtcctcag aagagaact 29 <210> 223 <211> 28 <212> DNA <213> Artificial sequence <400> 223 caggcaattc agtaaacgtt aagtgaaa 28 <210> 224 <211> 28 <212> DNA <213> Artificial sequence <400> 224 acaattatca acctcatctg ctctttct 28 <210> 225 <211> 29 <212> DNA <213> Artificial sequence <400> 225 agcttgtgtt gaaattgtaa ataccttgg 29 <210> 226 <211> 27 <212> DNA <213> Artificial sequence <400> 226 gccttttggc taggtgttaa attatgg 27 <210> 227 <211> 24 <212> DNA <213> Artificial sequence <400> 227 ctgactggca tttggttgta cttt 24 <210> 228 <211> 26 <212> DNA <213> Artificial sequence <400> 228 agaatctgct ttcaaaacga aagctg 26 <210> 229 <211> 25 <212> DNA <213> Artificial sequence <400> 229 tgaacctgca gaagaatctg aacat 25 <210> 230 <211> 30 <212> DNA <213> Artificial sequence <400> 230 gtttgcctaa attcctagtt tgtagttctc 30 <210> 231 <211> 25 <212> DNA <213> Artificial sequence <400> 231 gacagtagaa ggactgaaga gtgag 25 <210> 232 <211> 29 <212> DNA <213> Artificial sequence <400> 232 agaatgaatt gacactaatc tctgcttgt 29 <210> 233 <211> 29 <212> DNA <213> Artificial sequence <400> 233 ccttcttccg ataggttttc ccaaatatt 29 <210> 234 <211> 29 <212> DNA <213> Artificial sequence <400> 234 agaaagttaa tgagtggttt tccagaagt 29 <210> 235 <211> 25 <212> DNA <213> Artificial sequence <400> 235 gtagctgtat acgtatggcg tttct 25 <210> 236 <211> 30 <212> DNA <213> Artificial sequence <400> 236 ggatgaggga atacataaaa gttaacacac 30 <210> 237 <211> 22 <212> DNA <213> Artificial sequence <400> 237 gcgttatacc tttgccctga ga 22 <210> 238 <211> 23 <212> DNA <213> Artificial sequence <400> 238 acctcagctc ctagactttc aga 23 <210> 239 <211> 23 <212> DNA <213> Artificial sequence <400> 239 gtgcctggcc tgatacaatt aac 23 <210> 240 <211> 30 <212> DNA <213> Artificial sequence <400> 240 aattcctcct gaattttagt gaataaggct 30 <210> 241 <211> 31 <212> DNA <213> Artificial sequence <400> 241 cataaaactc tttccagaat gttgttaagt c 31 <210> 242 <211> 26 <212> DNA <213> Artificial sequence <400> 242 taccatcttc aacctctgca ttgaaa 26 <210> 243 <211> 25 <212> DNA <213> Artificial sequence <400> 243 tttttggacc taggttgatt gcaga 25 <210> 244 <211> 29 <212> DNA <213> Artificial sequence <400> 244 aaaaacctgt agttcaacta aacagagga 29 <210> 245 <211> 28 <212> DNA <213> Artificial sequence <400> 245 tccaatacct aagtttgaat ccatgctt 28 <210> 246 <211> 23 <212> DNA <213> Artificial sequence <400> 246 caaaggcatc tcaggaacat cac 23 <210> 247 <211> 28 <212> DNA <213> Artificial sequence <400> 247 acataaggtt tttgctgaca ttcagagt 28 <210> 248 <211> 26 <212> DNA <213> Artificial sequence <400> 248 tgctgtgcta aaaatcccac aagtat 26 <210> 249 <211> 30 <212> DNA <213> Artificial sequence <400> 249 aaataaagat gtcagatacc acagcatctt 30 <210> 250 <211> 30 <212> DNA <213> Artificial sequence <400> 250 cctgaattat cactatcaga acaaagcagt 30 <210> 251 <211> 24 <212> DNA <213> Artificial sequence <400> 251 cccagaagct gattctctgt catg 24 <210> 252 <211> 30 <212> DNA <213> Artificial sequence <400> 252 tgctggcattttcatgatca tataaaagac 30 <210> 253 <211> twenty two <212> DNA <213> Artificial sequence <400> 253 ggaagcaggg aagctcttca tc 22 <210> 254 <211> twenty four <212> DNA <213> Artificial sequence <400> 254 tcatgcatct caggtttgtt ctga 24 <210> 255 <211> twenty two <212> DNA <213> Artificial sequence <400> 255 aagagaagct gcaagtcatg gt 22 <210> 256 <211> twenty one <212> DNA <213> Artificial sequence <400> 256 gctcacgacc atttgagacc a 21 <210> 257 <211> twenty four <212> DNA <213> Artificial sequence <400> 257 ccagaatcca aatcaggcct tctt 24 <210> 258 <211> 26 <212> DNA <213> Artificial sequence <400> 258 gctatttcct tgatactgga ctgtca 26 <210> 259 <211> 22 <212> DNA <213> Artificial sequence <400> 259 gctgggagtc cgcctatcat ta 22 <210> 260 <211> 25 <212> DNA <213> Artificial sequence <400> 260 gttctgtttc aaacttgcat gtgga 25 <210> 261 <211> 23 <212> DNA <213> Artificial sequence <400> 261 ggcagagaag acttctgagg cta 23 <210> 262 <211> 23 <212> DNA <213> Artificial sequence <400> 262 cttcatccgg agagtgtagg gta 23
Claims
1. An ultra-high throughput multiplexed PCR amplicon capture method, characterized in that, The super-high-throughput multiplex PCR amplicon capture method comprises the following steps: 1) performing multiplex PCR amplification on the sample to be detected by using an amplification primer pool comprising digestible complex modification and a first enzyme mixture, to obtain amplicon products; the amplification primer in the amplification primer pool comprises at least one complex modified nucleotide, and the modification mode comprises one or more of the following: T base is replaced by uracil modified base, T base is replaced by locked nucleotide thymine modified base, T base is replaced by 5-methylcytosine modified base, T base is replaced by locked nucleotide adenine modified base, G base is replaced by 8-hydroxydeoxyguanosine modified base, and T base is replaced by hypoxanthine modified base; the first enzyme mixture is QuarTaq HotStart mixture; 2) performing enzyme digestion reaction on the amplicon products by using a second enzyme mixture comprising primer digestion enzyme, mismatch correction enzyme and end repair enzyme, which comprises removing the excess primer part of the amplification product by using primer digestion enzyme, and removing non-specific amplification products by using mismatch correction enzyme; the second enzyme mixture comprises primer digestion enzyme, mismatch correction enzyme, T4 polynucleotide kinase, Taq polymerase and QuarPrep end repair tailing buffer; the primer digestion enzyme is selected from one or both of UDG enzyme and FPG enzyme; the mismatch correction enzyme is selected from one or more of T7 endonuclease I, T4 endonuclease VII, E coli endonuclease V, Surveror endonuclease and CEL I endonuclease; 3) performing ligation reaction by using a full-length adapter comprising Index and a third enzyme solution, to directly obtain a sequencing library or to obtain a sequencing library after amplification; the third enzyme solution is DNA ligase; For any amplification primer comprising complex modified base nucleotide, the number of modified bases is any integer between 0 and n, and n represents the total length of the amplification primer; After performing ligation reaction by using a full-length adapter comprising Index and a third enzyme solution, a sequencing library is directly obtained; The mismatch correction enzyme is used to reduce non-specific produced by PCR amplification; The full-length adapter comprising Index is used to replace the universal short adapter to perform ligation reaction and construct a sequencing library; The sample to be detected is selected from prokaryotic or eukaryotic microbial genome, animal or plant genome or human genome; The amplification primer pool comprises the primers shown in SEQ ID NO: 1-262.
Citation Information
Patent Citations
Multiple PCR method for improving amplification specificity and uniformity
CN110592200A
Construction method of lung cancer polygenic variation library
CN106757379A
Compositions and methods for nucleic acid amplification
US20160333340A1