Conditional multiplex QPCR method

By controlling the difference between denaturation and annealing temperatures using conditional primers and Taqman probes, the problems of signal superposition and cross-reaction in multiplex qPCR were solved, enabling the detection of multiplex DNA fragments with high specificity and high sensitivity.

WO2026007461A1PCT designated stage Publication Date: 2026-01-08SUZHOU HAIMIAO BIOTECH CO LTD
View PDF 8 Cites 0 Cited by

Patent Information

Application Number
PCT/CN2025/083089
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-07-03
Filing Date
2025-03-18
Publication Date
2026-01-08

AI Technical Summary

Technical Problem

In multiplex qPCR, signal superposition and cross-reaction lead to reduced specificity and sensitivity, affecting data accuracy.

Method used

By using conditional primers and Taqman probes, and by controlling the differences in denaturation and annealing temperatures of different DNA samples, combined with specific probes and artificial templates, we can ensure the specific amplification and signal generation of each DNA fragment.

Benefits of technology

It improves the specificity and sensitivity of multiplex qPCR, enabling high-throughput detection of multiple DNA fragments in the same reaction system, reducing false positive signals, and is suitable for multi-sample detection.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN2025083089_08012026_PF_FP_ABST
    Figure CN2025083089_08012026_PF_FP_ABST
Patent Text Reader

Abstract

Provided is a conditional multiplex QPCR method. A QPCR amplification system, for each DNA sample, comprises a set of conditional primers 1 and 2. Forward conditional primers 1 and 2 are paired with a template strand, and reverse conditional primers 1 and 2 are paired with a complementary strand of the template strand. A conditional primer 2 is located downstream of a conditional primer 1, the 5' end of the conditional primer 2 is connected to an amplification primer of a DNA fragment to be detected, and the amplification primer is not paired with an upstream sequence of a binding site between the conditional primer 2 and the template strand. In the method, only when both the conditional primers 1 and 2 are bound to the template strand and the conditional primer 1 extends to the 5' end of the conditional primer 2, the DNA polymerase cleaves the amplification primer of the DNA fragment to be detected, which is free at the 5' end of the conditional primer 2, into an amplification system. The method reduces the possibility of unnecessary pairing between the amplification primer of the DNA fragment to be detected and other different DNA samples, thereby improving the specificity of the amplification reaction.
Need to check novelty before this filing date? Find Prior Art

Description

A conditional multiplex QPCR method TECHNICAL FIELD

[0001] The present application belongs to the technical field of molecular biology, and specifically relates to a conditional multiplex QPCR method, which can specifically detect the expression, mutation, methylation and other states of multiple target genes under a single signaling pathway and application. BACKGROUND

[0002] QPCR (Quantitative Polymerase Chain Reaction), also known as real-time fluorescent quantitative PCR, is a technique for detecting and quantifying DNA molecules. It is an improvement of PCR technology, which quantifies the initial amount of target DNA by monitoring the increase of DNA quantity in PCR reaction in real time. The principle of QPCR is based on the characteristics of fluorescent probes or DNA dyes that bind to PCR products and emit fluorescent signals. QPCR technology is widely used in the fields of molecular biology, medical diagnosis, environmental monitoring, etc. It has the advantages of high sensitivity, high specificity and high speed, and can accurately detect and quantify trace amounts of DNA, so it plays an important role in gene expression analysis, gene mutation detection, pathogen detection, etc.

[0003] Multiplex QPCR is a technique for detecting and quantifying multiple target DNA sequences in the same reaction. It is based on the principle of QPCR, but by introducing multiple different fluorescent probes or DNA dyes, it allows simultaneous monitoring of the amplification of multiple target sequences. Multiplex QPCR is commonly used in the study of complex biological processes, such as gene expression regulation, disease diagnosis, environmental microbiology, etc. In multiplex QPCR, due to the simultaneous amplification of multiple target sequences, signal superposition or cross-reaction may occur, reducing the specificity and sensitivity of QPCR, ultimately affecting the accuracy and interpretation of data.

[0004] DNA denaturation temperature (Tm value) refers to the temperature at which DNA double strands begin to unravel under specific conditions. This temperature is crucial for the stability of DNA double strands. In QPCR reactions, a denaturation step is usually performed at high temperature (usually 95 degrees Celsius) to ensure that the double-stranded structure of the target DNA sequence is completely unraveled, so that the primer can bind to the single-stranded template of the target sequence. Therefore, the melting temperature of different Tm values of DNA double strands can be different, so that different DNA double strands can be melted at different temperatures. SUMMARY

[0005] The present application provides a conditional multiplex QPCR method, which uses conditional primers to improve the targeting of the primers for amplifying the target gene, and uses a specific probe combined with the template strand of the target gene to improve the specificity of the amplification signal of the target gene.

[0006] The specific technical solutions of the present application are as follows:

[0007] A conditional multiplex QPCR method, wherein the amplification system for each DNA sample includes a set of conditional primers 1 and 2, the forward conditional primers 1 and 2 are combined with the template strand, the reverse conditional primers 1 and 2 are combined with the complementary strand of the template strand, the conditional primer 2 is located downstream of the conditional primer 1, the 5' end of the conditional primer 2 is connected to the amplification primer of the DNA fragment to be detected, and the amplification primer is not combined with the upstream sequence of the conditional primer 2 and the template strand.

[0008] The QPCR includes program 1, which obtains the amplification primer of the DNA fragment to be detected conditionally:

[0009] 1) At the denaturation temperature, the DNA sample is denatured to obtain a DNA single-stranded template;

[0010] 2) At the annealing temperature, the conditional primers 1 and 2 are combined with the DNA single-stranded template;

[0011] 3) At the extension temperature, the conditional primer 1 is extended to the conditional primer 2 for amplification, and when the extension reaches the 5' end of the conditional primer 2, the DNA polymerase cuts the 5' end of the conditional primer 2 to release the amplification primer of the DNA fragment to be detected;

[0012] Program 2, amplifying the DNA fragment to be detected:

[0013] 1) At the denaturation temperature, the DNA sample (including the amplification product of program 1) is denatured to obtain a DNA single-stranded template;

[0014] 2) If the DNA sample contains the sequence of the DNA fragment to be detected, the amplification primer is combined with the DNA single-stranded template at the annealing temperature (at this annealing temperature, the conditional primers 1 and 2 in the system are combined with the amplification product of the DNA sample of program 1);

[0015] 3) at the extension temperature, the extension of the amplification primer, and the amplification of the DNA fragment to be detected (at the extension temperature, the amplification product of the conditional primer 1 and 2 on the program 1 DNA sample is further amplified).

[0016] The above technical solution only meets the following conditions: (1) the conditional primer 1 and 2 are both combined with the template strand; (2) the conditional primer 1 is located upstream of the conditional primer 2; (3) the exonuclease activity of the DNA polymerase cuts the amplification primer of the DNA fragment to be detected at the 5' end of the conditional primer 2 into the amplification system. Since the DNA template and the DNA fragment to be detected are in an upstream and downstream relationship of the same sequence (i.e., the same DNA sample), the method reduces the possibility of unnecessary pairing of the amplification primer of the DNA fragment to be detected with other different DNA samples, and improves the specificity of the amplification reaction.

[0017] Further, the QPCR amplification system of the present application further includes an artificial template and a Taqman probe for each DNA fragment to be detected, the Taqman probe is labeled with a reporter group at the 5' end and a quencher group at the 3' end, and the artificial template contains the sequence of the DNA fragment to be detected, and the Taqman probe is specifically paired with the upstream sequence of the sequence of the DNA fragment to be detected of the artificial template;

[0018] The QPCR further comprises program 3, which conditionally generates a detection signal:

[0019] 1) at the denaturation temperature, the obtained DNA fragment to be detected is denatured to obtain a single-stranded DNA fragment to be detected;

[0020] 2) at the annealing temperature, the single-stranded DNA fragment to be detected (as a primer) is combined with the artificial template;

[0021] 3) at the extension temperature, the artificial template strand is amplified by the 3' end of the single-stranded DNA fragment to be detected, and when the extension reaches the 5' end of the fluorescent probe, the DNA polymerase cuts and hydrolyzes the probe, releases the reporter gene, and detects the fluorescent signal.

[0022] In the above technical solution, the Taqman probe is specifically paired with the upstream sequence of the sequence of the DNA fragment to be detected of the artificial template, and only when the single-stranded DNA fragment to be detected is annealed with the artificial template and extended to the 5' end of the Taqman probe, the exonuclease activity of the DNA polymerase hydrolyzes the fluorescent reporter gene of the Taqman probe to generate a fluorescent signal. This method avoids the generation of non-specific fluorescent signals and interference with the detection results, making the detection results more accurate, and also improves the specificity of the method, which can be applied to multiple QPCR with a large number of samples.

[0023] When the method is applied to multiple samples, all DNA samples can be divided into N groups, N is an integer from 2 to 7, all DNA samples in procedure 1 and / or procedure 2 use the same denaturation temperature, different groups of DNA samples use different annealing temperatures, and N annealing temperature steps with a temperature difference of 3-4℃ are formed between different groups.

[0024] In procedure 1 and / or procedure 2, N groups of DNA samples are denatured at a uniform denaturation temperature, and the single strands of N groups of DNA samples are annealed in order from high to low at the annealing temperature steps, combined with primers, and then extended and amplified at a uniform extension temperature.

[0025] When the method is applied to multiple samples, all DNA samples can be divided into N groups, N is an integer from 2 to 7, all DNA samples in procedure 1 and / or procedure 2 use the same denaturation temperature, different groups of DNA samples use different annealing temperatures, and N annealing temperature steps with a temperature difference of 3-4℃ are formed between different groups.

[0026] Alternatively, in procedure 3, N groups of DNA samples are denatured in order from low to high, and the denaturation, annealing and extension of the DNA sample group with the lowest denaturation temperature are completed first, and the denaturation, annealing and extension of the DNA sample group with the highest denaturation temperature are completed last.

[0027] The upper limit of N in the above method depends on the number of intervals of the denaturation temperature and / or the number of intervals of the annealing temperature of each sequence in the QPCR system, i.e. the number of groups is sufficient to ensure that only one group of DNA samples or their DNA fragments is denatured or annealed at a denaturation temperature or annealing temperature.

[0028] Before starting QPCR, all sequences in the QPCR system need to be analyzed, and forward and reverse conditional primers 1 and 2 and DNA fragment amplification primers are designed, and groups are designed according to the differences in denaturation temperature of different DNA samples or DNA fragments, or groups are designed according to the differences in annealing temperature of primers, and the grouping results meet the requirements of the method.

[0029] When designing the above sequences, the following conditions are preferably met:

[0030] (1) The annealing temperature of the conditional primer 2 is higher than that of the conditional primer 1. This ensures that the conditional primer 2 is preferentially combined with the DNA template to the conditional primer 1, so that the DNA fragment primer is successfully cut off by the DNA polymerase.

[0031] (2) The annealing temperature of the artificial template and the probe is higher than the highest annealing temperature of the DNA fragment and the artificial template in the group N.

[0032] (3) The binding sequence of the artificial template and the probe is a sequence that does not exist in the genomic DNA, such as a repeated sequence of AGGC, etc., to ensure that the binding of the artificial template and the probe is not affected by the genomic DNA, thereby reducing the generation of non-specific signals.

[0033] Preferably, the QPCR procedure of the present application comprises the following steps:

[0034] Program 1: All DNA samples are denatured at a uniform denaturation temperature to obtain DNA single-stranded templates, conditional primers 1 and 2 of each DNA sample are combined with the DNA single-stranded templates at a uniform annealing temperature, and the conditional primer 1 is extended and amplified to release the amplification primer of the DNA fragment to be tested at a uniform extension temperature;

[0035] Program 2: The DNA sample and its amplification product of program 1 are denatured at a denaturation temperature to obtain DNA single-stranded templates, and if the DNA sample contains the sequence of the DNA fragment to be tested, the amplification primer is combined with the DNA single-stranded templates at a uniform annealing temperature, and the extension and amplification are performed to obtain the DNA fragment to be tested;

[0036] Program 3: All DNA fragments to be tested are divided into N groups, N is an integer from 2 to 7, and the N groups of DNA fragments to be tested are sequentially subjected to denaturation, annealing and extension from the lowest denaturation temperature group to the highest denaturation temperature group.

[0037] In one specific example of the present application, the QPCR procedure comprises the following steps:

[0038] Program 1:

[0039] a) Denaturation, 95℃-98℃, 5-30 seconds, all double-stranded DNA samples / templates are denatured and dissociated;

[0040] b) Annealing, 50℃-70℃, 10-30 seconds, conditional primers 1 and 2 are annealed;

[0041] c) Extension, 72℃-75℃, 10-30 seconds, conditional primers 1 and 2 are extended and amplified to release the amplification primer of the DNA fragment to be tested;

[0042] Program 2:

[0043] d) Denaturation, 95℃-98℃, 5-30 seconds, all double-stranded DNA samples / templates are denatured and dissociated;

[0044] e) annealing, 50-70℃, 10-30 seconds, annealing of the amplification primer of the DNA fragment to be detected;

[0045] f) extension, 72-75℃, 10-30 seconds, amplification of the DNA fragment to be detected;

[0046] Program 3:

[0047] g1) denaturation, 75℃, 5-30 seconds, denaturation of the first group of DNA fragments to be detected (the lowest denaturation temperature relative to other groups);

[0048] h1) annealing, 72℃, 10-30 seconds;

[0049] i1) extension, 72℃, 10-30 seconds;

[0050] Denaturation, annealing, and extension are performed on each group of DNA fragments to be detected in order of increasing denaturation temperature, until

[0051] g N ) denaturation, 98℃, 5-30 seconds, denaturation of the Nth group of DNA fragments to be detected (the highest denaturation temperature relative to other groups);

[0052] h N ) annealing, 72℃, 10-30 seconds;

[0053] i N ) extension, 72℃, 10-30 seconds;

[0054] The above steps are repeated 40-50 times, and N is the number of groups of DNA samples to be detected, which is an integer from 2 to 7.

[0055] In the method, the sequence of the artificial template paired with the probe is a DNA sequence not possessed by the genomes of all DNA samples.

[0056] Another object of the present application is to provide a conditional multiplex QPCR reagent, wherein the amplification system comprises a set of conditional primers 1 and 2 for each DNA sample, the forward conditional primers 1 and 2 are paired with the template strand, the reverse conditional primers 1 and 2 are paired with the complementary strand of the template strand, the conditional primer 2 is located downstream of the conditional primer 1, the 5' end of the conditional primer 2 is connected to the amplification primer of the DNA fragment to be detected, and the amplification primer is not paired with the sequence upstream of the combination of the conditional primer 2 and the template strand.

[0057] Further, the reagent amplification system further comprises an artificial template and a probe for each DNA fragment to be detected, the probe being labeled with a fluorescent reporter group at the 5' end and a quenching group at the 3' end, and the artificial template comprising the sequence of the DNA fragment to be detected, and the probe specifically pairing with the upstream sequence of the DNA fragment to be detected in the artificial template.

[0058] The reagent further comprises a PCR reaction buffer, magnesium ions, dNTPs and a DNA polymerase. When a large number of DNA fragments need to be detected simultaneously in one reaction system, the effect of avoiding non-specific amplification by only adding the sequence difference of the primer probe is not good due to the large number of added primer probe sequences. The method of the present application relies on the specific binding of conditional primers 1 and 2 to the DNA template, the amplification primer of the DNA fragment to be detected to the template, the DNA fragment to be detected to the artificial template, and the Taqman probe to the artificial template, which can better avoid the non-specific binding caused by a large number of primers and probes. In addition, the method of the present application can regulate the sequence of denaturation and / or annealing according to the difference in sequence denaturation temperature and / or annealing temperature, improve the specificity of single or single group DNA fragment denaturation, annealing and extension, and effectively avoid the signal interference in the detection of different genes in multiplex PCR.

[0059] The specific applications of the present application include but are not limited to the detection of the expression levels of multiple different target gene fragments, the detection of multiple gene mutations, and the detection of multiple abnormal methylation genes. Specifically, the technical means of the present application can detect multiple DNA fragments with different sequences in the same system and in the same fluorescence channel, so the technical means of the present application will be applicable to all multiple gene detection methods using QPCR technology, and there is no requirement for the type of DNA template.

[0060] The application of the present application can be used as a detection reagent for QPCR reaction for simultaneously detecting multiple gene characteristics. The detection reagent includes multiple gene methylation detection, multiple gene mutation detection, multiple gene expression level detection, and multiple disease diagnosis reagent, etc. The diseases include but are not limited to tumors, genetic abnormalities, metabolic abnormalities, and diseases caused by drug-resistant pathogen infections. For example, blood tumors, solid tumors such as colorectal cancer tumors, congenital genetic diseases such as thalassemia, multi-drug resistant tuberculosis complex infections, and human immunodeficiency virus drug-resistant infections, etc.

[0061] Advantages of the present application:

[0062] The application establishes a QPCR detection method for simultaneously detecting multiple target DNA fragments with high specificity, high sensitivity and low cost. The specificity of the QPCR method is significantly improved by using specific binding of a large number of sequence-specific DNA fragments as a precondition for target DNA detection, which effectively avoids false positive signals caused by non-specific binding of primers and probes in multiplex PCR reaction. In the method, the target DNA amplification product has been amplified at its respective denaturation temperature, so that the interference of other amplification products can be well avoided during each fluorescence collection, thereby greatly improving the detection sensitivity. The technical means can realize the detection of multiple genes in the same fluorescence channel of the same reaction system, and high-throughput QPCR can be realized by combining with other technologies such as different fluorescence channels, so that simultaneous detection of a large number of genes in the same PCR reaction tube can be realized. BRIEF DESCRIPTION OF DRAWINGS

[0063] In order to more clearly illustrate the technical solutions of the present application, the drawings required for the embodiments of the present application will be briefly introduced as follows.

[0064] Obviously, the drawings described below are only part of the drawings in the present application, and for those skilled in the art, other drawings can also be obtained from these drawings without creative labor, but these other drawings also belong to the drawings required for the embodiments of the present application.

[0065] Fig. 1 is a principle diagram of the specific multiplex QPCR mechanism of the present application.

[0066] Fig. 2 is a QPCR reaction amplification curve diagram of the feasibility experiment of the specific multiplex QPCR in a single fluorescence channel according to the present application.

[0067] Fig. 3 is a QPCR reaction amplification curve diagram of the feasibility experiment of the specific multiplex QPCR in multiple fluorescence channels according to the present application.

[0068] Fig. 4 is a QPCR reaction amplification curve diagram of the internal reference channel of the specific multiplex QPCR specificity experiment according to the present application.

[0069] Fig. 5 is a QPCR reaction amplification curve diagram of the specific multiplex QPCR specificity experiment according to the present application.

[0070] Fig. 6 is a QPCR reaction amplification curve diagram of the internal reference channel of the traditional QPCR method used as a comparison in the specific multiplex QPCR specificity experiment according to the present application.

[0071] Fig. 7 is a QPCR reaction amplification curve diagram of the traditional QPCR method used as a comparison in the specific multiplex QPCR specificity experiment according to the present application.

[0072] Figure 8 is a QPCR reaction amplification curve of the internal reference channel in the specific multiplex QPCR sensitivity experiment of the present application.

[0073] Figure 9 is a QPCR reaction amplification curve in the specific multiplex QPCR sensitivity experiment of the present application.

[0074] Figure 10 is a QPCR reaction amplification curve of the internal reference channel in the specific multiplex QPCR sensitivity experiment of the present application.

[0075] Figure 11 is a QPCR reaction amplification curve in the specific multiplex QPCR sensitivity experiment of the present application.

[0076] Figure 12 is a comparison of the amplification curve of the traditional QPCR and the conditional primer multiplex QPCR test of the present application.

[0077] Figure 13 is a comparison of the amplification curve of the traditional QPCR and the conditional probe multiplex QPCR test of the present application.

[0078] Figure 14 is a comparison of the amplification curve of the traditional QPCR and the conditional multiplex QPCR test of the present application.

[0079] Figure 15 is a QPCR reaction amplification curve of the internal reference channel in the specific multiplex QPCR real sample detection experiment of the present application.

[0080] Figure 16 is a QPCR reaction amplification curve in the specific multiplex QPCR real sample detection experiment of the present application. DETAILED DESCRIPTION

[0081] In order to make the purpose, technical scheme, beneficial effects and significant progress of the embodiments of the present application more clear, below, the technical scheme in the embodiments of the present application will be clearly and completely described with the aid of the drawings provided in the embodiments of the present application.

[0082] Obviously, all the described embodiments are only part of the embodiments of the present application, not all the embodiments; based on the embodiments in the present application, all other embodiments obtained by those of ordinary skill in the art without creative labor belong to the scope of protection of the present application.

[0083] For those of ordinary skill in the art, the specific meaning of the above-mentioned terms in the present application can be understood according to the specific circumstances.

[0084] The term "forward primer sequence" in the present application refers to the primer on the upstream of the DNA double strand. If used for sequencing, the sequence of the positive strand of DNA is read from 5' to 3' direction.

[0085] The term "reverse primer sequence" in the present application refers to: the reverse primer (downstream primer) is elongated along the positive strand. In vitro amplification of DNA, the double helix is partially or completely open, there is no Okazaki fragment, and it will not be elongated in segments. In theory, both the forward and reverse primers are elongated without interruption, which is different from in vivo DNA self-replication.

[0086] The term "probe" in the present application refers to: a nucleic acid sequence (DNA or RNA) with a detection label and a known sequence, which is complementary to the target gene. The gene probe binds to the target gene through molecular hybridization to produce a hybridization signal, which can display the target gene from the vast genome. According to the hybridization principle, the nucleic acid sequence as a probe must at least meet the following two conditions: ① It should be single-stranded, and if it is double-stranded, it must be denatured first. ② It should have an easily detectable label. It can include the entire gene, or only a part of the gene; it can be DNA itself, or RNA transcribed from it.

[0087] The term "QPCR" in the present application refers to: Real-time Quantitative PCR Detecting System, i.e. real-time fluorescence quantitative nucleic acid amplification detection system, also called real-time quantitative gene amplification fluorescence detection system.

[0088] It should be further noted that the following specific embodiments can be combined with each other, and for the same or similar concepts or processes, they can not be described again in some embodiments.

[0089] The technical solutions of the present application will be described in detail below with specific embodiments.

[0090] Example 1 Evaluation of feasibility, sensitivity and specificity of conditional multiplex PCR

[0091] 1.1 Design and synthesis of sequences for amplification template for feasibility experiment

[0092] In this embodiment, the purpose is to verify the feasibility of the multiplex PCR method described in the present application, therefore in this embodiment, three groups of sequences for detecting target DNA fragments are artificially designed and synthesized, wherein the first group of sequences comprises DNA sample 1 sequence to be detected, forward conditional primer 1-1 sequence, reverse conditional primer 1-1 sequence, forward conditional primer 2-1 sequence, reverse conditional primer 2-1 sequence, artificial template 1 sequence, and conditional probe 1 sequence.

[0093] The DNA sample 1 sequence is:

[0094] The forward conditional primer 1-1 sequence is: ATGGATTTCAACGTCGACTTCAAG;

[0095] Forward conditional primer 2-1 sequence: GGGCCCAGATCACGCCTTGCTTCGGCAAGAACCTCTCGTG;

[0096] Reverse conditional primer 1-1 sequence: GCCGCCATAGAATGCGCT;

[0097] Reverse conditional primer 2-1 sequence: CTGGAAGGTGCGCGACGCCATGGCTTTGCGGGCG;

[0098] Artificial template 1 sequence: AGGCAGGCAGGCAGGCAGGCAGGCAGGCAGGCAGGCAGGCGGGCCCAGATCACGCCTTGCGTCGCGCACCTTCCAG;

[0099] Conditional probe 1 sequence: FAM-GCCTGCCTGCCTGCCTGCCTGCCTGCCTGCCTGCCT-BHQ1.

[0100] The second group of sequences comprises the DNA sample 2 sequence to be detected, the forward conditional primer 1-2 sequence, the reverse conditional primer 1-2 sequence, the forward conditional primer 2-2 sequence, the reverse conditional primer 2-2 sequence, the artificial template 2 sequence, the conditional probe 2-1, and the conditional probe 2-2 sequence.

[0101] The DNA sample 2 sequence is:

[0102] Forward conditional primer 1-2 sequence: GCAAGAACGCGATCTCGG;

[0103] Forward conditional primer 2-2 sequence: AGCAAGTTTCTACAAGAACTGACTGTACGTGCGGGTAGGCCGAGGCG;

[0104] Reverse conditional primer 1-2 sequence: CTGCACGAGGCGAATCCA;

[0105] Reverse conditional primer 2-2 sequence: TTAATAAGCGAGATGTCATCCAGAATAAAGGCCGGTTCTTGGGCGCC;

[0106] The sequence of the artificial template 2 is: TGGCCTTGGCCTTGGCCTTGGCCTTGGCCTTGGCCTTGGCCTTGGCCTAGCAAGTTTCTACAAGAACTGACTGTACGTGCCAAGCAGTTCGGCTTTATTCTGGATGACATCTCGCTTATTA;

[0107] The sequence of the conditional probe 2-1 is: FAM-AGGCCAAGGCCAAGGCCAAGGCCAAGGCCAAGGCCA-BHQ1;

[0108] The sequence of the conditional probe 2-2 is: CY5-AGGCCAAGGCCAAGGCCAAGGCCAAGGCCAAGGCCA-BHQ1;

[0109] The third group of sequences comprises the sequence of the DNA sample 3 to be detected, the sequence of the forward conditional primer 1-3, the sequence of the reverse conditional primer 1-3, the sequence of the forward conditional primer 2-3, the sequence of the reverse conditional primer 2-3, the sequence of the artificial template 3, the sequence of the conditional probe 3-1, the sequence of the conditional probe 3-2.

[0110] The sequence of the DNA sample 3 is: GGTCGCTTGCAGGTAGGTTGAGTCTCTCAGACGTGCTGCTCGAATTTGATAATGTGTATAAGCAATGAACTTACCACGGTACCGCTCTCTCTCGAAGGTTGCTGGACGCAAGGGTTTTCCGCACGTCATATACGCCCGGATTTGGCGCTGGCCTGACCTGCATAAGAACGAGCTATATAAATTATATCACGTCAAGTACTGAGCCTTCGCCTTCGATCTCAAGTGCGACTCGGTGTGCGTGAATCCCTACCACTACGAGCGCGTCGTCTCTCCGGGCATCGATCTGTC;

[0111] The sequence of the forward conditional primer 1-3 is: GGTCGCTTGCAGGTAGGTTG;

[0112] The sequence of the forward conditional primer 2-3 is: CTGACCTGCATAAGAACGAGCTATATAACTCTCAGACGTGCTGCTCGAATTTG;

[0113] The sequence of the reverse conditional primer 1-3 is: AAACCCTTGCGTCCAGCAACC;

[0114] Reverse conditional primer 2-3 sequence: CGAAGGCTCAGTACTTGACGTGATATACGAGAGAGAGCGGTACCGTGGTAAGT;

[0115] Human template 3 sequence: GGTCTGGGGTCTGGGGTCTGGGGTCTGGGGTCTGGGGTCTGGGGTCTGGCTGACCTGCATAAGAACGAGCTATATAAATTATATCACGTCAAGTACTGAGCCTTCG;

[0116] Conditional probe 3-1 sequence: FAM-CCAGACCCCAGACCCCAGACCCCAGACCCCAGACCCCAG-BHQ1;

[0117] Conditional probe 3-2 sequence: ROX-CCAGACCCCAGACCCCAGACCCCAGACCCCAGACCCCAG-BHQ1.

[0118] 1.2 Feasibility experiment method

[0119] The detection method qPCR of the multiplex QPCR of the embodiment is shown in the following Table 1 and Table 2, wherein Sample 1 is DNA sample 1; Sample 2 is DNA sample 2; Sample 3 is DNA sample 3; Sample 4 is a 1:1 mixture of DNA sample 1 and DNA sample 2; Sample 5 is a 1:1:1 mixture of DNA sample 1, DNA sample 2 and DNA sample 3.

[0120] Table 1: Multiplex QPCR experiment reaction system 1 table under the same fluorescence signal channel

[0121] Table 2: Multiplex QPCR experiment reaction system 2 table under different fluorescence signal channels

[0122] The amplification program of the detection method qPCR of the multiplex QPCR of the embodiment is shown in the following Table 3:

[0123] Table 3: PCR amplification program table of multiplex QPCR experiment

[0124] 1.3 Feasibility experiment results

[0125] As shown in FIG. 2, FIG. 3 and Table 4, all amplification curves are normal, in reaction system 1, for Sample 1, Sample 2 and Sample 3, because the added DNA fragment content is the same, the amplification curves of Sample 1, Sample 2 and Sample 3 are similar, nearly fitting, and the CT values of the three samples are also similar, while the amplification fluorescence of multiplex PCR Sample 4 is significantly higher than that of Sample 1-3, and the CT value is smaller, and the amplification fluorescence of multiplex PCR Sample 5 is significantly higher than that of Sample 4, and the CT value is smaller. In order to more clearly illustrate the feasibility of the multiplex QPCR technology described in the application, the corresponding results in reaction system 2 are obtained, for Sample 1, Sample 2 and Sample 3, the FAM, CY5 and ROX three-channel amplification curves are similar, and the CT values are close, while the multiplex PCR Sample 4 only has FAM and CY5 fluorescence channel normal amplification, and the CT value is equivalent, and the multiplex PCR Sample 5 has FAM, CY5 and ROX three channels normal amplification, which further proves the feasibility of the multiplex QPCR technology described in the application.

[0126] Table 4: Multiplex QPCR feasibility test results statistics table

[0127] 1.4 Design and synthesis of amplification template sequence for specific experiment

[0128] In traditional QPCR experiments, specific amplification is mainly achieved by relying on the sequence specificity of primers and probes, but in multiplex PCR, with the increase of the number of primers and probes, it is more likely to produce false positive signals by non-specific amplification. In the QPCR method described in the application, the specific amplification of the target gene depends on the combination of multiple sequence-specific DNA fragments and templates, and there are also strict requirements for DNA amplification products, therefore the QPCR method described in the application can significantly improve the specificity in the QPCR amplification process, and the present embodiment tests the specificity in the QPCR process by designing and synthesizing a plurality of non-specific amplification templates.

[0129] First, the DNA template sequence DNA sample 2 sequence used for normal amplification is synthesized, and the sequence information is as described above.

[0130] A series of DNA template sequences for detecting non-specific binding, including DNA sample 4 sequence, characterized in that the sequence contains the upstream and downstream primer binding sequences of the DNA fragment to be amplified of DNA sample 2 sequence, and the sequence information is:

[0131] DNA sample 5 sequence, characterized in that the sequence contains the forward conditional primer 1 and reverse conditional primer 1 fragment binding sequence of the DNA sample 2 sequence, and the sequence information is as follows:

[0132] DNA sample 6 sequence, characterized in that the sequence contains the forward conditional primer 2 and reverse conditional primer 2 fragment binding sequence of the DNA sample 2 sequence, and the sequence information is as follows:

[0133] DNA sample 7 sequence, characterized in that the sequence contains the forward conditional primer 2, reverse conditional primer 2, forward conditional primer 1 and reverse conditional primer 1 fragment binding sequence of the DNA sample 2 sequence, and the sequence information is as follows:

[0134] DNA sample 8 sequence, characterized in that the sequence contains the forward conditional primer 1 and reverse conditional primer 1 fragment binding sequence of the DNA sample 2 sequence, and also contains the upstream and downstream primer binding sequences of the DNA fragment to be amplified of the DNA sample 2 sequence, and the amplification product of the target gene is the same as the amplification product of the DNA sample 2, and the sequence information is as follows:

[0135] DNA sample 9 sequence, characterized in that the sequence contains the forward conditional primer 2 and reverse conditional primer 2 fragment binding sequence of the DNA sample 2 sequence, and also contains the upstream and downstream primer binding sequences of the DNA fragment to be amplified of the DNA sample 2 sequence, and the amplification product of the target gene is the same as the amplification product of the DNA sample 2, and the sequence information is as follows:

[0136] DNA sample 10 sequence, characterized in that the sequence contains the forward conditional primer 1, reverse conditional primer-, forward conditional primer 2 and reverse conditional primer 2 fragment binding sequence of the DNA sample 2 sequence, and also contains the upstream and downstream primer binding sequences of the DNA fragment to be amplified of the DNA sample 2 sequence, but the amplification product of the target gene to be amplified is longer than the amplification product of the DNA sample 2, and the sequence information is as follows:

[0137] DNA sample 11 sequence, characterized in that the sequence contains the forward conditional primer 1, reverse conditional primer 1, forward conditional primer 2 and reverse conditional primer 2 fragment binding sequence of the DNA sample 2 sequence, and also contains the upstream and downstream primer binding sequences of the DNA fragment to be amplified of the DNA sample 2 sequence, but the amplification product of the target gene to be amplified is shorter than the amplification product of the DNA sample 2, and the sequence information is as follows:

[0138] The sequence information of the forward conditional primer 1-2, the forward conditional primer 2-2, the reverse conditional primer 1-2, the reverse conditional primer 2-2, the artificial template 2 and the conditional probe 2-1 are the same as described above;

[0139] Forward primer F1 for general QPCR amplification of DNA sample 2: AGCAAGTTTCTACAAGAACTGACTGTACGT;

[0140] Reverse primer R1 for general QPCR amplification of DNA sample 2: TGGGCCACCTGCTTCATCT;

[0141] Probe P1 for general QPCR amplification of DNA sample 2: CTTTATTCTGGATGACATCTCGCTTATTAACTTGACC.

[0142] 1.5 Specificity experiment method

[0143] The detection method qPCR of the specificity detection of this embodiment is shown in the following Table 5 and Table 6, wherein Sample 6 is DNA sample 2; Sample 7 is DNA sample 4; Sample 8 is DNA sample 5; Sample 9 is DNA sample 6; Sample 10 is DNA sample 7; Sample 11 is DNA sample 8; Sample 12 is DNA sample 9; Sample 13 is DNA sample 10; and Sample 14 is DNA sample 11.

[0144] Table 5: QPCR reaction system table for specificity detection experiment of target gene amplification

[0145] Table 6: General QPCR reaction system table for specificity detection experiment of target gene amplification

[0146] The qPCR amplification procedure of the specificity detection method of this embodiment is shown in the following Table 7 and Table 8:

[0147] Table 7: PCR amplification procedure table for specificity detection experiment

[0148] Table 8: General QPCR amplification procedure table for specificity detection experiment

[0149] 1.6 Specificity experiment results

[0150] As shown in FIG. 4, FIG. 5, FIG. 6, FIG. 7 and Table 9-10, all amplification curves are normal, for the multiplex QPCR method described in the application, any form of non-specific template cannot be normally amplified except that normal sample Sample 6 can be normally amplified; and for the traditional QPCR, Sample 7, Sample 11, Sample 12, Sample 13, Sample 14 all have obvious non-specific amplification except that Sample 6 can be normally amplified, especially in Sample 13 and Sample 14, the traditional QPCR method cannot correctly distinguish the real length of the target gene, and the multiplex QPCR method described in the application has strict requirements for the length of the target gene, so it can achieve higher specificity. In summary, the multiplex QPCR technology described in the application has good specificity, which will significantly reduce the false positive detection results in the detection of multiple genes.

[0151] Table 9: Specificity detection experiment QPCR reaction internal reference channel result statistical table

[0152] Table 10: QPCR reaction result statistical table of specificity detection experiment

[0153] 1.7 Design and synthesis of amplification template sequence for sensitivity detection

[0154] In the multiplex PCR technology described in the application, the signal release time of multiple genes is different, so theoretically compared with traditional QPCR, the mutual interference between the fluorescence signals of different genes is avoided, therefore the purpose of this embodiment is to confirm whether the multiplex PCR technology described in the application can improve the sensitivity of PCR detection, in this embodiment, the sample is diluted to different degrees and then subjected to QPCR detection, and at the same time compared with ordinary QPCR method.

[0155] First, three groups of required sequences for QPCR amplification described in the application and ordinary QPCR amplification are designed and synthesized, which include DNA sample 1, forward conditional primer 1-1, forward conditional primer 2-1, reverse conditional primer 1-1, reverse conditional primer 2-1, artificial template 2 and conditional probe 1, the sequence information is the same as described above;

[0156] The forward primer F2 for ordinary QPCR amplification of DNA sample 1 is GGGCCCAGATCACGCCTT;

[0157] The reverse primer R2 for ordinary QPCR amplification of DNA sample 1 is AGACCACCTTATCATCTGTCTCTGGCC;

[0158] Probe P2 for common QPCR amplification of DNA sample 1: CGTCGCGCACCTTCCAGTACACCAAAG;

[0159] The second group contains DNA sample 2, forward conditional primer 1-2, forward conditional primer 2-2, reverse conditional primer 1-2, reverse conditional primer 2-2, artificial template 2 and conditional probe 2-1, forward primer F1 and reverse primer R1 and probe P1 for common QPCR amplification of DNA sample 2, the sequence information is the same as described above;

[0160] The third group contains DNA sample 3, forward conditional primer 1-3, forward conditional primer 2-3, reverse conditional primer 1-3, reverse conditional primer 2-3, artificial template 3 and conditional probe 3-1, the sequence information is the same as described above;

[0161] Forward primer F3 for common QPCR amplification of DNA sample 3: CTGACCTGCATAAGAACGAGCTATATAA;

[0162] Reverse primer R3 for common QPCR amplification of DNA sample 3: ACGCACACCGAGTCGCAC;

[0163] Probe P3 for common QPCR amplification of DNA sample 3: TATATCACGTCAAGTACTGAGCCTTCGCCTTCG.

[0164] 1.8 Sensitivity experiment method

[0165] The detection method qPCR of the sensitivity detection of this embodiment is shown in the following Table 11 and Table 12, wherein Sample 15 is a 1:1:1 mixture of DNA sample 1, DNA sample 2 and DNA sample 3; Sample 16 is a 10 -6 diluted product of Sample 16; Sample 17 is a 0.5-fold diluted product of Sample 16; Sample 18 is a 0.5-fold diluted product of Sample 17; Sample 19 is a 0.5-fold diluted product of Sample 18; Sample 20 is a 0.5-fold diluted product of Sample 19; Sample 21 is a 0.5-fold diluted product of Sample 20; Sample 22 is a 0.5-fold diluted product of Sample 21.

[0166] Table 11: QPCR reaction system table for sensitivity detection experiment of target gene amplification

[0167] Table 12: Common QPCR reaction system table for sensitivity detection experiment of target gene amplification

[0168] The amplification procedure of the multiplex QPCR detection method of the present application is shown in Table 3 and Table 8.

[0169] 1.9 Sensitivity experiment results

[0170] As shown in Figures 8, 9, 10, 11 and Tables 13-14, all amplification curves are normal, and there is no significant difference between the multiplex QPCR of the present application and the conventional QPCR for Sample 15, but as the DNA template decreases, the multiplex QPCR of the present application still maintains better detection sensitivity, and for Sample 16, Sample 17, Sample 18, Sample 19, Sample 20, the multiplex PCR method of the present application has better detection results, including lower CT value and higher fluorescence amplification, due to the different gene fluorescence signals interfering with each other at the same temperature. For Sample 21 and Sample 22, the multiplex QPCR detection results of the present application are partially detected, while the conventional QPCR technology cannot be normally detected. In summary, the multiplex QPCR method of the present application has higher detection sensitivity compared with the conventional QPCR method.

[0171] Table 13: Sensitivity detection experiment QPCR reaction internal reference channel result statistical table

[0172] Table 14: Sensitivity detection experiment QPCR reaction result statistical table

[0173] Example 2 Conditional primer multiplex PCR test

[0174] 2.1 Design and synthesis of amplification template sequence for conditional primer multiplex PCR

[0175] The purpose of this embodiment is to verify the multiplex PCR method realized by the conditional primer of the present application, therefore in this embodiment, 10 groups of sequences for detecting target DNA fragments are artificially designed and synthesized, which contain DNA sample 12-21 sequences to be detected, forward conditional primer 1-4-13 sequences, reverse conditional primer 1-4-13 sequences, forward conditional primer 2-4-13 sequences, reverse conditional primer 2-4-13 sequences, detection probe 1-10 sequences, forward primer F4-13 sequences required for ordinary QPCR method detection, reverse primer R4-13 sequences required for ordinary QPCR method detection, and probe P4-13 sequences required for ordinary QPCR method detection.

[0176] In the present embodiment, all the DNA template sequences are partial sequences of the sequence of the template sequence ACTB, and the sequence of ACTB is the sequence of the gene ACTB, and the sequence information is >NC_000007.13: c5570232-5566779 Homo sapiens chromosome 7, GRCh37.p13 Primary Assembly.

[0177] wherein the DNA sample 12 is the nucleotide sequence of the 1st to 240th nucleotide of the sequence of ACTB; the DNA sample 13 is the nucleotide sequence of the 241st to 480th nucleotide of the sequence of ACTB; the DNA sample 14 is the nucleotide sequence of the 481st to 720th nucleotide of the sequence of ACTB; the DNA sample 15 is the nucleotide sequence of the 721st to 960th nucleotide of the sequence of ACTB; the DNA sample 16 is the nucleotide sequence of the 961st to 1200th nucleotide of the sequence of ACTB; the DNA sample 17 is the nucleotide sequence of the 1201st to 1440th nucleotide of the sequence of ACTB; the DNA sample 18 is the nucleotide sequence of the 1441st to 1680th nucleotide of the sequence of ACTB; the DNA sample 19 is the nucleotide sequence of the 1681st to 1920th nucleotide of the sequence of ACTB; the DNA sample 20 is the nucleotide sequence of the 1921st to 2160th nucleotide of the sequence of ACTB; and the DNA sample 21 is the nucleotide sequence of the 2161st to 2400th nucleotide of the sequence of ACTB.

[0178] The sequences of the forward conditional primers 1-4-13 are respectively: accgccgagaccgcgt, agatgggggacaccccac, gctaattgcgcgtgcgc, cggttgggagggggttg, gcgctcgtcgtcgacaac, gggcgtgatggtgggcat, ggtgagtggcccgctacc, ctcgtgtgacaaggccatgag, tgctatccaggctgtgctatcc, gaagctgtgctacgtcgccct.

[0179] The sequences of the reverse conditional primers 1-4-13 are respectively: ggctggccgggcttacc, gccccgagagcggca, agcccaggccgcgg, cgcgttattaccataaaaggcaaac, acgatggaggggaagacgg, cgtgctcgatggggtacttc, gcagaagagagaaccagtgagaaa, taagtgtgctggggtcttgggat, tagatgggcacagtgtgggtg, gccgtcaggcagctcgt.

[0180] Forward conditional primer 2-4-13 sequences are: cgcccgtgcagagccggccccgcgagcacagagc, ggcggagcccccgcagttcggaggcgcgagg, acttcctgcccgagccgcctgggactcaaggcgctaactgc, ctaaggactcggcgcgcggcctggcttcctgccg, agcgggcgggaggcaactccggcatgtgcaaggccg, gcaccacaccttctacaatgagctggtcagaaggattcctatgtgggcg, ggttctatttgctttttcccagatgttctggtggccgcctccc, cgtctggcctggctgtcctggtgtaaagcggccttggagtg, ggctggccgggacctgagtacgcctctggccgtaccactg, ctcttccagccttccttcctgacttcgagcaagagatggccacgg.

[0181] Reverse conditional primer 2-4-13 sequences are: ttccccccccatgcggtgtggacgggcggcgg, gcacgcgcaatggcgcccggagcgcgcctcc, gcgcgcgcacgcaccccgggccccagaacg, cgcgctgtgagccgaggtggtcggaggcgtccccg, cccccaccccggaaacgggggcatcgtcgcccg, gggcctcggtcagcagcgtgaggatgcctctcttgctctg, tagtacctacacccacaacactgtcttagggcgcagctccgggagg, ctcaaacatgatctgtaaggcagagatacacggagtctgttcagacctactgtgcacctac, ctgtagccgcgctcggcccgtcaccggagtccatca, ggtaaccctcatgtcaggcagagctcttctccagggaggagctggaa.

[0182] The sequences of detection probes 1-10 are respectively combined with part of the sequences between the DNA fragments combined by the forward and reverse primers at the end of conditional primer 2, so as to realize probe cleavage and signal acquisition, and the sequence information is respectively: cgtctgggccgcagcggg, aggcccggtgggggctgg, gccgcccgagggtgtggcc, gaagtggccagggcgggggcg, gcgctttctctgcacaggagcctc, gtgtggctcccgaggagcacccc, gctctttttctggtgtttgtctctctgactaggtg, agtggcttccccagtgtgaca, tgactacctcatgaagatcctc, gtgagtggagactgtctcccg.

[0183] The sequences of F4-13 used for general QPCR detection are respectively: cgcccgtgcagagccg, ggcggagcccccg, acttcctgcccgagccgc, ctaaggactcggcgcgc, agcgggcgggaggcaa, gcaccacaccttctacaatgagct, ggttctatttgctttttcccagatg, cgtctggcctggctgtcc, ggctggccgggacctga, ctcttccagccttccttcctg.

[0184] The sequences of R4-13 used for general QPCR detection are respectively: ttccccccccatgcg, gcacgcgcaatggcg, gcgcgcgcacgca, cgcgctgtgagccgagg, ccccccaccccggaaac, gggcctcggtcagcagc, tagtacctacacccacaacactgtcttag, ctcaaacatgatctgtaaggcagagatacac, ctgtagccgcgctcgg, ggtaaccctcatgtcaggcagag.

[0185] The sequences of P4-13 used for general QPCR detection are the same as those of detection probes 1-10.

[0186] 2.2 Conditional primer multiplex PCR test method

[0187] The detection method qPCR of the multiplex QPCR of the present embodiment is shown in the following Table 15 and Table 16, wherein Sample 23 is a 1:1 mixture of an artificially synthesized sequence with the same sequence information as ACTB and human genomic DNA.

[0188] Table 15: Reaction system table of conditional primer multiplex QPCR experiment under the same fluorescence signal channel

[0189] Table 16: Reaction system table of ordinary QPCR experiment under the same fluorescence signal channel

[0190] The detection method of conditional primer multiplex QPCR of the present embodiment is as shown in the following table 17, and the ordinary qPCR amplification program is as shown in the above table 8.

[0191] Table 17: PCR amplification program table of conditional primer multiplex QPCR experiment

[0192] 2.3 Results of conditional primer multiplex PCR experiment

[0193] As shown in FIG. 2, FIG. 3 and table 18, all amplification curves are normal, and compared with conditional primer multiplex PCR, the use of ordinary QPCR method for amplification detection of the 10 target genes shows significantly lower fluorescence amplification and higher CT value, which shows that in the ordinary QCPR method, non-specific amplification will occur to cause interference between the fluorescence signal amplification, and in the conditional primer multiplex QPCR method, the release of fluorescence signal in each cycle depends on the amplification primer of the DNA fragment to be detected produced after the conditional primer amplification, so the binding probability with non-specific amplification template is significantly reduced, and therefore better multiplex PCR effect can be achieved by only adding conditional primer.

[0194] Table 18: Ct value result statistical table of conditional primer multiplex QPCR feasibility detection experiment

[0195] Example 3 Conditional fluorescence signal multiplex PCR test

[0196] 3.1 Design and synthesis of amplification template sequence for conditional fluorescence signal multiplex PCR

[0197] In this embodiment, the purpose is to verify the multiplex PCR method using conditional primers and fluorescence signals according to the present application, therefore in this embodiment, 20 groups of sequences for detecting target DNA fragments are artificially designed and synthesized, which contain DNA sample 12-31 sequences to be detected, forward conditional primer 1-4-23 sequences, reverse conditional primer 1-4-23 sequences, forward conditional primer 2-4-23 sequences, reverse conditional primer 2-4-23 sequences, artificial template 4-23 sequences, conditional probe 4-23 sequences, forward primer F4-23 sequences required for ordinary QPCR method detection, reverse primer R4-23 sequences required for ordinary QPCR method detection, and probe P4-23 sequences required for ordinary QPCR method detection.

[0198] In this embodiment, DNA sample 12-21, forward conditional primer 1-4-13 sequences, reverse conditional primer 1-4-13 sequences, forward conditional primer 2-4-13 sequences, reverse conditional primer 2-4-13 sequences, forward primer F4-13 sequences required for ordinary QPCR method detection, reverse primer R4-13 sequences required for ordinary QPCR method detection, and probe P4-13 sequences required for ordinary QPCR method detection are the same as described in Embodiment 2 above.

[0199] Among them, DNA sample 22-31 are all partial sequences of template sequence B2M sequence, and B2M sequence is the sequence of gene B2M, and the sequence information is >NC_000015.9: 45003715-45010343 Homo sapiens chromosome 15, GRCh37.p13 Primary Assembly.

[0200] Among them, DNA sample 22 is the nucleotide sequence of the 1st to 300th of B2M sequence; DNA sample 23 is the nucleotide sequence of the 301st to 600th of B2M sequence; DNA sample 24 is the nucleotide sequence of the 601st to 900th of B2M sequence; DNA sample 25 is the nucleotide sequence of the 901st to 1200th of B2M sequence; DNA sample 26 is the nucleotide sequence of the 1201st to 1500th of B2M sequence; DNA sample 27 is the nucleotide sequence of the 1501st to 1800th of B2M sequence; DNA sample 28 is the nucleotide sequence of the 1801st to 2100th of B2M sequence; DNA sample 29 is the nucleotide sequence of the 2101st to 2400th of B2M sequence; DNA sample 30 is the nucleotide sequence of the 2401st to 2700th of B2M sequence; DNA sample 31 is the nucleotide sequence of the 2701st to 3000th of B2M sequence.

[0201] Forward conditional primer 1-14~23 sequences are: tggccttagctgtgctcgc, tacttgcccctttcggcg, aagttcgcatgtcctagcacc, taaccagggcttttgcgg, ggcgtggtagcttacgcctgt, aagaagtgaaggtttgtcagtcagg, ttattttgaaaatttccaaagtaatacatgc, tcttagaaaagattacagtgatgctctcac, gtagcactaacacttctcttcattttcaatg, cacatgcattactccatttgatcat.

[0202] Reverse conditional primer 1-14~23 sequences are: tgcagagcgggagaggaa, ctcggcgctctgacgct, gaaaccgctttgtatcacagcc, atgccgcccagtttgct, aggcttcaccatgttggcca, tgtattgccaggtacttagaaagtgct, ccacacacaggtcagaggagg, gcatctgagcttctaataataagaacatattaa, gccaggttgggaatatattgcc, taaatgcatacaagagctggcaa.

[0203] Forward conditional primer 2-14-23 sequences are: attcctgaagctgacagcattcgactctctctttctggcctggaggcta, tctgctgcggctctgcttcagcaggggagacctttggccta, aaacagttatcttccgccatagataacctatgtggggccacaccgtgg, cagatgaagaaactaaggcaccgatgccttttggctgtaattcgtgc, agcgtgggcaacagagcgagcacttagggaggccgaggcg, acaacataaaggataatgtatatatcaccaccagctgtaaaaccattaataaagataatccaagatgg, gagcccaaattcaaacccagcgcatagaccatttctggaagataccacaag, ttgatggggctagtagcctttctcttgccgccttccctcaaacag, tacagcaatcacctgtggatgcttcccacttccccatggatggtc, tctggcatataaaacctcagcagaactgtcccatttgccatagtcctcacc.

[0204] Reverse conditional primer 2-14~23 sequences are: acatctcggcccgaatgctgaccagagcgggagggtaggagag, agctctccagtctaagggaagcagcgacgccctaaactttgtcccga, tgagaggcagaagataaccatagtagttagcattctacaaacgtcgcgtgctg, atttatcccctgtgtaattaagtttcttaaaagaatctcacgcagaaggcaggc, tttgagagacagggtctcgctcggtctcaactacggacctcaagccat, catctaacataaccagcaaataccagtaatgatctctggcgtcctcaacagtcttg, agaggacaagtatcagacaggctggtagaccttcagaggcaatcatcattacatg, ccagatatatctctctagaaacaccctatcatcagggatcagagcacagattcatcctg, acagtgggatttgcgttttaattagttcagaaacagtactttccaaaatgagaggc, ttcttaccaaacaacaaaacctctttatccttaaatggttgagttggacccgat.

[0205] The artificial template 4-23 sequences are respectively: atcgatcgatcgatcgatcgatcgatcgatcgcgcccgtgcagagccgccgtctgggccgcagcggggggcgcatggggggggaa, atcgatcgatcgatcgatcgatcgatcgatcgggcggagcccccgccaggcccggtgggggctggggcgccattgcgcgtgc, atcgatcgatcgatcgatcgatcgatcgatcgacttcctgcccgagccgctggccgcccgagggtgtggccgctgcgtgcgcgcgc, atcgatcgatcgatcgatcgatcgatcgatcgctaaggactcggcgcgccggaagtggccagggcgggggcgacctcggctcacagcgcg, atcgatcgatcgatcgatcgatcgatcgatcgagcgggcgggaggcaagggcgctttctctgcacaggagcctcccggtttccggggtggggg, atcgatcgatcgatcgatcgatcgatcgatcggcaccacaccttctacaatgagctgcgtgtggctcccgaggagcaccccgtgctgctgaccgaggccc, atcgatcgatcgatcgatcgatcgatcgatcgggttctatttgctttttcccagatgagctctttttctggtgtttgtctctctgactaggtgtctaagacagtgttgtgggtgtaggtacta, atcgatcgatcgatcgatcgatcgatcgatcgcgtctggcctggctgtccccagtggcttccccagtgtgacatggtgtatctctgccttacagatcatgtttgag, atcgatcgatcgatcgatcgatcgatcgatcgggctggccgggacctgactgactacctcatgaagatcctcaccgagcgcggctacag, atcgatcgatcgatcgatcgatcgatcgatcgctcttccagccttccttcctgggtgagtggagactgtctcccggctctgcctgacatgagggttacc,gtcagtcagtcagtcagtcagtcagtcagtcaattcctgaagctgacagcattcgggccgagatgt, gtcagtcagtcagtcagtcagtcagtcagtcatctgctgcggctctgcttcccttagactggagagct, gtcagtcagtcagtcagtcagtcagtcagtcaaaacagttatcttccgccatagataactactatggttatcttctgcctctca, gtcagtcagtcagtcagtcagtcagtcagtcacagatgaagaaactaaggcaccgagattttaagaaacttaattacacaggggataaat, gtcagtcagtcagtcagtcagtcagtcagtcaagcgtgggcaacagagcgagaccctgtctctcaaa, gtcagtcagtcagtcagtcagtcagtcagtcaacaacataaaggataatgtatatatcaccaccattactggtatttgctggttatgttagatg, gtcagtcagtcagtcagtcagtcagtcagtcagagcccaaattcaaacccagcctgtctgatacttgtcctct, gtcagtcagtcagtcagtcagtcagtcagtcattgatggggctagtagcctttccttaatgatagggtgtttctagagagatatatctgg, gtcagtcagtcagtcagtcagtcagtcagtcatacagcaatcacctgtggatgctaattaaaacgcaaatcccactgt, gtcagtcagtcagtcagtcagtcagtcagtcatctggcatataaaacctcagcagaaataaagaggttttgttgtttggtaagaa.

[0206] The conditional probes 4-13 all have the sequence: FAM-cgatcgatcgatcgatcgatcgatcgatcgat-MGB.

[0207] The conditional probes 14-23 all have the sequence: FAM-tgactgactgactgactgactgactgactgac-MGB.

[0208] F14~23 sequences for common QPCR detection are: attcctgaagctgacagcattcg, ttgtgaacgcgtggaggg, gacatctttctgtgtgccaagg, cagatgaagaaactaaggcaccg, ctcttgagcttaggcttttgagct, cgctcaccttttcctctggc, ttggaagcttaaataactctccaaaagt, ttgatggggctagtagcctttc, gcctctcattttggaaagtactgtt, ttgccagctcttgtatgcattta.

[0209] R14~23 sequences for common QPCR detection are: gagagtagcgcgagcacagct, agctctccagtctaagggaagcag, tgagaggcagaagataaccatagtagtta, ccgcaaaagccctggtta, tttgagagacagggtctcgctc, catctaacataaccagcaaataccagtaat, agaggacaagtatcagacaggctgg, ggaggctgtggggagaagg, acagtgggatttgcgttttaattag, ttcttaccaaacaacaaaacctctttat.

[0210] P14~23 sequences for common QPCR detection are: ccgagatgtctcgctccgtggc, ccgggtaagcctgtctgctgcgg, cgtcatttaattttgaaaacagttatcttccgcc, cttaattacacaggggataaatggcagcaatcg, gcgccagtgcactccagcgtg, catgatcgaaagcagaatgttttgatcatgag, agccagtaactggttgagcccaaattca, tctagagagatatatctggtcaaggtggcctgg, ggcaatatattcccaacctggctagtttacagc, aattaggtacaaagtcagagaggggtctggcat.

[0211] 3.2 Conditional fluorescent signal multiplex PCR test method

[0212] The detection method qPCR of multiplex QPCR of the present embodiment is shown in the following Table 19 and Table 20, wherein Sample 24 is a 1:1 mixture of artificial synthetic sequence and human genomic DNA with the same sequence information as ACTB and B2M.

[0213] Table 19: Reaction system table of conditional fluorescent signal multiplex QPCR experiment under the same fluorescent signal channel

[0214] Table 20: Reaction system table of ordinary QPCR experiment under the same fluorescent signal channel

[0215] The amplification program of the detection method qPCR of conditional primer multiplex QPCR of the present embodiment is shown in Table 21, and the amplification program of ordinary qPCR is shown in Table 8.

[0216] Table 21: PCR amplification program table of conditional primer multiplex QPCR experiment

[0217] 3.3 Results of conditional fluorescent signal multiplex PCR experiment

[0218] As shown in Figures 2, 3 and Table 22, all amplification curves are normal. Compared with conditional fluorescent signal multiplex PCR, the use of ordinary QPCR method for amplification and detection of the 20 target gene fragments showed significantly lower fluorescence amplification and higher CT value, which indicates that non-specific amplification will occur in ordinary QCPR method, resulting in interference between fluorescence signal amplification. In the conditional primer multiplex QPCR method, the release of fluorescence signal in each cycle depends on the amplification primer produced after the amplification of conditional primer and the correct amplification product, thus significantly improving the specificity of target gene detection. It is shown that the addition of conditional primer and conditional probe can achieve better multiplex PCR effect.

[0219] Table 22: Statistical table of results of conditional probe multiplex QPCR feasibility detection experiment

[0220] Example 4 Conditional multiplex PCR test

[0221] 4.1 Design and synthesis of amplification template sequence for conditional fluorescent signal multiplex PCR

[0222] In this embodiment, the purpose is to verify the multiplex PCR method using conditional primers and fluorescent signals according to the present application, so in this embodiment, 30 groups of sequences for detecting target DNA fragments are artificially designed and synthesized, which include DNA sample 12-41 sequences to be detected, forward conditional primer 1-4-33 sequences, reverse conditional primer 1-4-33 sequences, forward conditional primer 2-4-33 sequences, reverse conditional primer 2-4-33 sequences, artificial template 4-33 sequences, conditional probe 4-33 sequences, forward primer F4-33 sequences required for ordinary QPCR method detection, reverse primer R4-33 sequences required for ordinary QPCR method detection, and probe P4-33 sequences required for ordinary QPCR method detection.

[0223] In this embodiment, DNA sample 12-31, forward conditional primer 1-4-23 sequences, reverse conditional primer 1-4-23 sequences, forward conditional primer 2-4-23 sequences, reverse conditional primer 2-4-23 sequences, artificial template 4-23 sequences, conditional probe-4-23 sequences, forward primer F4-23 sequences required for ordinary QPCR method detection, reverse primer R4-23 sequences required for ordinary QPCR method detection, and probe P4-23 sequences required for ordinary QPCR method detection are the same as described in Embodiment 2 and Embodiment 3 above.

[0224] Among them, DNA samples 32-41 are all partial sequences of GAPDH sequence, and GAPDH sequence is the sequence of gene GAPDH, and the sequence information is >NC_000012.11:6643683-6647537 Homo sapiens chromosome 12, GRCh37.p13 Primary Assembly.

[0225] Among them, DNA sample 32 is the nucleotide sequence from 1st to 300th of GAPDH sequence; DNA sample 33 is the nucleotide sequence from 301st to 600th of GAPDH sequence; DNA sample 34 is the nucleotide sequence from 601st to 900th of GAPDH sequence; DNA sample 35 is the nucleotide sequence from 901st to 1200th of GAPDH sequence; DNA sample 36 is the nucleotide sequence from 1201st to 1500th of GAPDH sequence; DNA sample 37 is the nucleotide sequence from 1501st to 1800th of GAPDH sequence; DNA sample 38 is the nucleotide sequence from 1801st to 2100th of GAPDH sequence; DNA sample 39 is the nucleotide sequence from 2101st to 2400th of GAPDH sequence; DNA sample 40 is the nucleotide sequence from 2401st to 2700th of GAPDH sequence; and DNA sample 41 is the nucleotide sequence from 2701st to 3000th of GAPDH sequence.

[0226] Forward conditional primers 1-24-33 sequences are: ctctgctcctcctgttcgacag, catcgctcagacaccatggg, agatcccgacccggacc, tccgggtgatgcttttcctag, aggattgggtgtctgggcg, tgggcttgccctgtccag, ttaagccaggccagcctg, aagctggtgtgggaggagc, gcgagatccctccaaaatcaa, cgctccctctttctttgcag.

[0227] Reverse conditional primers 1-24-33 sequences are: gccttcaggccgtccctag, tcgtagacgcggttcggg, gcgcactagcatcccgg, gactcagcttctcccggctt, aaggtcagcagctatatttaacctcag, agcccttccaggagaagcg, tccagaatatgtgagcagccctag, ttgccatgggtggaatcata, tgcactcaccccagccttc, cataccatgagtccttccacgat.

[0228] Forward conditional primer 2-24~33 sequences are: actaggcgctcactgttctctccgccgcatcttcttttgcgtcg, ttgcagtcgtatgggggcggtgaaggtcggagtcaacggg, aaggaaatgaatgggcagccggacgctttctttcctttcgcg, agcctagcgttgacccgatctggtaaatcaaagaagtgggtttatgga, aacttggcaaatcaaagccctggaacctgcccttctccccattcc, tatgactgggggtgttgggcactcctgccctttgagtttgatgatg, atcaatgaccccttcattgacctcaagctcaagggagataaaattcaacctcttg, cccttgggtatatggtaaccttgtcctggctgatgggcagcc, ttcgtcatgggtgtgaaccaggcgatgctggcgctgagta, actgaggctcccacctttctcatgcctcctgcaccaccaactg.

[0229] Reverse conditional primer 2-24~33 sequences are: tcggctgcgcggaggcgggtttctctccgcccgt, gcggggaacagctaccctggtcgcagcccagggcc, ttagtcaccggcaggctttcggaggggctcctctgcgaca, tgacatttacagcctggccttccacagccaccacacctctgc, aagaggggaagctgtattttaaccccagggtgcggtgggagatctg, aactgaaggctccagggctggtggggcactgccaccca, ctcaccatgtagcactcaccatgtacattaagagggcgaatgcagcatct, agatggggacaggaccatattgagtaaacctgggggaatacgtgagggtat, ctgatgatcttgaggctgttgtcaggtggtgaagacgccagtggac, agggaggagccagtcttggagttgtcatggatgaccttggccag.

[0230] The sequences of artificial templates 24-33 are: catgcatgcatgcatgcatgcatgcatgcatgactaggcgctcactgttctctccctccgcgcagccga, catgcatgcatgcatgcatgcatgcatgcatgttgcagtcgtatgggggcagggtagctgttccccgc, catgcatgcatgcatgcatgcatgcatgcatgaaggaaatgaatgggcagccgttaggaaagcctgccggtgactaa, catgcatgcatgcatgcatgcatgcatgcatgagcctagcgttgacccgaccccaaaggccaggctgtaaatgtca, catgcatgcatgcatgcatgcatgcatgcatgaacttggcaaatcaaagccctgggactagggggttaaaatacagcttcccctctt, catgcatgcatgcatgcatgcatgcatgcatgtatgactgggggtgttgggcagccctggagccttcagtt, catgcatgcatgcatgcatgcatgcatgcatgatcaatgaccccttcattgacctcaactacatggtgagtgctacatggtgag, catgcatgcatgcatgcatgcatgcatgcatgcccttgggtatatggtaaccttgtgtccctcaatatggtcctgtccccatct, catgcatgcatgcatgcatgcatgcatgcatgttcgtcatgggtgtgaaccatgagaagtatgacaacagcctcaagatcatcag, catgcatgcatgcatgcatgcatgcatgcatgactgaggctcccacctttctcatccaagactggctcctccct.

[0231] The sequences of conditional probes 24-33 are all: FAM-catgcatgcatgcatgcatgcatgcatgcatg-MGB.

[0232] The F24-33 sequences for general QPCR detection are as follows: gaggggaggcgtgtgtgt, cccgaaccgcgtctacg, aaggaaatgaatgggcagcc, tcctgcagcgccgg, ctcccactcctgatttctggaa, gactgtgggtggcagtgcc, ctggtcaccagggctgctt, tgtgctttggggaggcaac, aaagggtcatcatctctgccc, atcgtggaaggactcatggtatg.

[0233] The R24-33 sequences for general QPCR detection are as follows: cggctgcgcggagg, gcggggaacagctaccct, cgcgactccacccatcg, tgacatttacagcctggcctt, aagaggggaagctgtattttaaccc, aactgaaggctccagggctg, ctcaccatgtagcactcaccatgta, agatggggacaggaccatattga, ctgatgatcttgaggctgttgtca, agggaggagccagtcttgga.

[0234] The P24-33 sequences for general QPCR detection are as follows: ccggggccactaggcgctca, ggctccgggtctttgcagtcgtatg, cctgccggtgactaaccctgcgc, ttcccctgccagcctagcgttga, ggcaacttggcaaatcaaagccctg, cgcttctcctggaagggcttcgtatgac, ttgttgccatcaatgaccccttcattg, gtggctcccttgggtatatggtaaccttgt, ccatgttcgtcatgggtgtgaacca, atgggactgaggctcccacctttctc.

[0235] 4.2 Conditional fluorescent signal multiplex PCR test method

[0236] The detection method qPCR of the multiplex QPCR of the present embodiment is shown in the following Table 23 and Table 24, wherein Sample 25 is a 1:1 mixture of an artificially synthesized sequence with the same sequence information as ACTB, B2M, and GAPDH and human genomic DNA.

[0237] Table 23: Reaction system table of conditional fluorescent signal multiplex QPCR experiment under the same fluorescent signal channel

[0238] Table 24: Reaction system table of ordinary QPCR experiment under the same fluorescent signal channel

[0239] The detection method of conditional primer multiplex QPCR of the present embodiment is shown in the following table 25, and the ordinary qPCR amplification program is shown in the above table 8.

[0240] Table 25: PCR amplification program table of conditional fluorescent signal multiplex QPCR experiment

[0241] 4.3 Results of conditional fluorescent signal multiplex PCR experiment

[0242] As shown in FIG. 2, FIG. 3 and table 26, all amplification curves are normal, and compared with conditional multiplex PCR, the amplification curves are abnormal when the 30 target gene fragments are amplified and detected by ordinary QPCR method, and there is no normal amplification curve, which shows that in the amplification of a large number of target gene fragments in ordinary QPCR method, a large number of non-specific amplification will occur, which will interfere with the increase of fluorescence signal, and in the conditional primer multiplex QPCR method, the release of fluorescence signal in each cycle depends on the amplification primer and correct amplification product produced after the amplification of conditional primer, and at the same time, the fluorescence release process of different target gene fragments is separated by temperature gradient, so as to significantly improve the maximum amount of target gene detection, which shows that the addition of conditional primer and conditional probe and the use of temperature gradient can achieve better multiplex PCR effect.

[0243] Table 26: Statistical table of results of conditional fluorescent signal multiplex QPCR detection experiment

[0244] Example 5 Specific multiplex PCR real sample detection based on denaturation temperature difference

[0245] 5.1 Determining the DNA template sequence used in the present embodiment and synthesizing other required sequences

[0246] In this embodiment, real samples will be used for testing to confirm the significant practical value of the multiplex qPCR method described in this invention. The applicability of the method will be analyzed by testing positive samples and mixtures of positive samples from patients infected with different pathogens. The positive samples are nucleic acid samples from patients infected with Xinjiang hemorrhagic fever virus, Marburg virus, or tick-borne pathogens. The nucleic acid sequence information used to detect Xinjiang hemorrhagic fever virus is as follows: CCAAGGCACAGGAGCTTTACAAAAACTCGTCCGCACTTCGTGCACAGGGTGCACAGATTGACACTGCTTTCAGCTCATACTACTGGCTCTACAAGGCCGGCGTGACTCCAGAAACCTTCCCGACTGTCTCACAGTTTCTTTTTGAACTAGGGAAGCAACCAAGGGGTACCAAGAAAATGAAGAAGGCACTCTTGAGCACCCCATTGAAATGGGGGAAGAGGCTTTATGAGCTCTTTGCTGATGATTCTTTCCAGCAGAACAGGATCTACATGCACCCTGCTGTGCTAACAGCCGGCAGAATTAGTGAGATGGGTGTCTGCTTTGGGACAATCCCTGTGGCCAACCCTGATGATGC;

[0247] Forward conditional primer 1-A for detecting Xinjiang hemorrhagic fever virus sequence: CCAAGGCACAGGAGCTTTACA;

[0248] Reverse conditional primer 1-A for detecting Xinjiang hemorrhagic fever virus sequence: CCGGCCTTGTAGAGCCAGTA;

[0249] The sequence information of the forward conditional primer 2-A used to detect the Xinjiang hemorrhagic fever virus sequence is: ATGGGGGAAGAGGCTTTATGAGCGTCCGCACTTCGTGCACAG;

[0250] Reverse conditional primer 2-A for detecting Xinjiang hemorrhagic fever virus sequence: CTGGAAAGAATCATCAGCAAAGAGGCTGAAAGCAGTGTCAATCTGTGCAC;

[0251] Artificial template-A for detecting Xinjiang hemorrhagic fever virus sequence: ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGGAAGAGGCTTTATGAGCTCTTTGCTGATGATTCTTTCCAG.

[0252] Conditional probe A for detecting Xinjiang hemorrhagic fever virus sequence: FAM-GCATGCATGCATGCATGCATGCATGCAT-MGB.

[0253] The sequence information used to detect Marburg virus is as follows:

[0254] Forward conditional primer 1-B for detecting Marburg virus sequence: GGACCCAAGCAGTGATGATGAG;

[0255] Reverse conditional primer 1-B for detecting Marburg virus sequence: GGTGGCATTGTTGATGAAAGC;

[0256] Forward conditional primer 2-B for detecting Marburg virus sequence: CCTCTCTGCACCATTACAAAACACCCTCGCAACATCCGGCTCAGG;

[0257] Reverse conditional primer 2-B for detecting Marburg virus sequence: AGTGATTTGTGCTCTGTGTGTTGTCATTTTGCTTGGTGACCGCATCAGAAG;

[0258] Artificial template for detection of Marburg virus sequence - B: TACGTACGTACGTACGTACGTACGTACGTACGTACGTACGCTCTCTCTGCACCATTACAAAACACCACCAATGACAACACACAGAGCACAATCACT;

[0259] Conditional probe for detection of Marburg virus sequence - B: FAM-CGTACGTACGTACGTACGTACGTACGTA-MGB;

[0260] Sequence information for detection of tick-borne pathogen Bunyavirus: TGCCAGATGTTAGAGATACTGACTTCACTTTGAACAGGCTTTCAGGTTGTTTTGCCAGATACGTATATGACCAATATATGAACTCTGACAGCTCAACCAGGTTGATGATACAAGAGTCCATAAAGAATCCACTAGCAATAGTTAAAGGTGTTAGAGCTGATAACTTCAAGCTCTATATGGCCTTTAGTGCTGGATCTGAGATGTTTTTGGACACATTTGGATTGTTGCCACTAGCAATAACCCTGCGCAGGATTGAATCAGACGATGCACCAGCATCAGTTTTAAACAAAGTCCTCAAACAAAGACTTAGGGGGATGCAGGCTATAGATTGGCAGAAGGATTCAACAGTCAAAGAACTTAAGGACGCAATGGTTGTGGTCAACAGTGTTTCATGGAAGCATTCAAAGATTTCAGATGAATCTATCAACTTCCTGAAGAAAGCTGGTGTTGCTGCCCAAACTCTGAACAAAATCAAAAAGGGTCTGGAATAAGCTTACCAC;

[0261] Forward conditional primer 1-C for detection of tick-borne pathogen sequence: CTGACTTCACTTTGAACAGGCTTTCA;

[0262] Reverse conditional primer 1-C for detection of tick-borne pathogen sequence: GAGCTTGAAGTTATCAGCTCTAACACC;

[0263] Forward conditional primer 2-C for detecting tick-borne pathogen sequence: GGGGGATGCAGGCTATAGATTGGTTTTGCCAGATACGTATATGACCAATATATG

[0264] Reverse conditional primer 2-C for detecting tick-borne pathogen sequence: CACAACCATTGCGTCCTTAAGTTCCTCTTGTATCATCAACCTGGTTGAGCTGTC

[0265] Artificial template-C for detecting tick-borne pathogen sequence: GTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGGGGGATGCAGGCTATAGATTGGCAGAAGGATTCAACAGTCAAAGAACTTAAGGACGCAATGGTTGTG; Conditional probe-C for detecting tick-borne pathogen sequence: FAM-GTACGTACGTACGTACGTACGTACGTAC-MGB.

[0266] 5.2 Experimental methods

[0267] The detection method of the real sample detection of the present example is QPCR, and the reaction system is shown in Table 27 below, wherein Sample 26-29 is a positive patient sample infected with Xinjiang hemorrhagic fever virus; Sample 30-33 is a positive patient sample infected with Marburg virus; Sample 34-37 is a positive patient sample infected with tick-borne pathogen; and Sample 38-41 is a negative sample not infected with any pathogen.

[0268] Table 27: QPCR reaction system table of real sample detection experiment

[0269] The QPCR amplification program of the multiplex QPCR real sample detection method of the present example is as follows:

[0270] Table 28: QPCR amplification program table of real sample detection experiment

[0271] 5.3 Experimental results

[0272] As shown in Figures 15, 16 and Tables 29-30, all amplification curves are normal, all positive samples can be normally detected, and all negative samples are not detected. In summary, the multiplex QPCR method of the present application has excellent specificity, sensitivity and real sample detection effect.

[0273] Table 29: Real sample detection experiment QPCR reaction internal control channel result statistics table

[0274] Table 30: Real sample detection experiment QPCR reaction result statistics table

Claims

1. A conditional multiplex QPCR method, characterized in that: The QPCR amplification system comprises a set of conditional primers 1 and 2 for each DNA sample, the forward conditional primers 1 and 2 are paired with the template strand, the reverse conditional primers 1 and 2 are paired with the complementary strand of the template strand, the conditional primer 2 is downstream of the conditional primer 1, the 5' end of the conditional primer 2 is connected to the amplification primer of the DNA fragment to be detected, and the amplification primer is not paired with the upstream sequence of the conditional primer 2 combined with the template strand; The QPCR comprises: Program 1: 1) DNA sample denaturation at denaturation temperature to obtain DNA single-stranded template; 2) The conditional primers 1 and 2 are combined with the DNA single-stranded template at the annealing temperature; 3) The conditional primer 1 is extended to the conditional primer 2 for amplification at the extension temperature, and when extended to the 5' end of the conditional primer 2, the DNA polymerase cuts the 5' end of the conditional primer 2 to release the amplification primer of the DNA fragment to be detected; Program 2: 1) DNA sample denaturation at denaturation temperature to obtain DNA single-stranded template; 2) If the DNA sample contains the sequence of the DNA fragment to be detected, the amplification primer is combined with the DNA single-stranded template at the annealing temperature; 3) The amplification primer is extended and amplified at the extension temperature to obtain the DNA fragment to be detected.

2. The method of claim 1, wherein The QPCR amplification system further comprises an artificial template and a Taqman probe for each DNA fragment to be detected, the Taqman probe is labeled with a fluorescent reporter group at the 5' end and a quencher group at the 3' end, and the artificial template contains the sequence of the DNA fragment to be detected, and the Taqman probe is specifically paired with the upstream sequence of the sequence of the DNA fragment to be detected of the artificial template; The QPCR further comprises program 3: 1) The obtained DNA fragment to be detected is denatured at the denaturation temperature to obtain a single-stranded DNA fragment to be detected; 2) The single-stranded DNA fragment to be detected is combined with the artificial template at the annealing temperature; 3) The artificial template strand is extended and amplified from the 3' end of the single-stranded DNA fragment to be detected at the extension temperature, and when extended to the 5' end of the probe, the DNA polymerase cuts and hydrolyzes the probe to release the reporter gene and detect the signal.

3. The method of claim 1, wherein All DNA samples are divided into N groups, N is an integer from 2 to 7, all DNA samples in program 1 and / or program 2 are denatured and denatured at the same denaturation temperature, different groups of DNA samples use different annealing temperatures, different groups form N annealing temperature steps with a temperature difference of 3-4℃, and the single-stranded DNA samples in N groups are annealed in order from high to low in the annealing temperature step, and then combined with the primer, and then extended and amplified at a uniform extension temperature.

4. The method of claim 2, wherein All DNA fragments to be detected are divided into N groups, N is an integer from 2 to 7, all DNA fragments to be detected in program 3 are denatured and denatured at a uniform denaturation temperature, different groups of DNA samples use different annealing temperatures, different groups form N annealing temperature steps with a temperature difference of 3-4℃, and the single-stranded DNA fragments to be detected in N groups are annealed in order from high to low in the annealing step, combined with the artificial template, and then extended and amplified at a uniform extension temperature; Alternatively, the N groups of DNA fragments to be detected in the program 3 are sequentially subjected to denaturation, annealing and extension from the lowest denaturation temperature group to the highest denaturation temperature group.

5. The method of claim 1, wherein The annealing temperature of the conditional primer 2 is higher than that of the conditional primer 1.

6. The method according to claim 3 or 4, characterized in that The QPCR program comprises the following steps: Program 1: all DNA samples are denatured to obtain single-stranded DNA templates at a uniform denaturation temperature, the conditional primer 1 and 2 of each DNA sample are combined with the single-stranded DNA template at a uniform annealing temperature, and the conditional primer 1 is extended to the conditional primer 2 at a uniform extension temperature to release the amplification primer of the DNA fragment to be detected; Program 2: the DNA sample and the amplification product in the program 1 are denatured to obtain single-stranded DNA templates at a denaturation temperature, if the DNA sample contains the sequence of the DNA fragment to be detected, the amplification primer is combined with the single-stranded DNA template at a uniform annealing temperature, and the DNA fragment to be detected is obtained by extension and amplification at a uniform extension temperature; Program 3: all DNA fragments to be detected are divided into N groups, N is an integer from 2 to 7, and the N groups of DNA fragments to be detected are sequentially subjected to denaturation, annealing and extension from the lowest denaturation temperature group to the highest denaturation temperature group.

7. The method of claim 6, wherein The QPCR program comprises the following steps: a) denaturation, 95-98℃, 5-30 seconds; b) annealing, 50-70℃, 10-30 seconds; c) extension, 72-75℃, 10-30 seconds; d) denaturation, 95-98℃, 5-30 seconds; e) annealing, 50-70℃, 10-30 seconds; f) extension, 72-75℃, 10-30 seconds; g1) denaturation, 75℃, 5-30 seconds; h1) annealing, 72℃, 10-30 seconds; i1) extension, 72℃, 10-30 seconds; …… g N ) denaturation, 98°C, 5 seconds to 30 seconds; h N ) annealing, 72°C, 10-30 seconds; i N ) extension, 72°C, 10-30 seconds; The above steps are repeated for 40-50 times, and N is the number of groups of DNA samples to be detected, which is an integer from 2 to 7.

8. The method of claim 1, wherein The template combined with the conditional primer 1 and 2 is located in the upstream or downstream part of the DNA fragment to be detected, and does not coincide with the DNA fragment to be detected.

9. The method of claim 2, wherein The sequence paired with the probe in the artificial template is a DNA sequence not possessed by the genome of all DNA samples.

10. A conditional multiplex QPCR reagent characterized by amplification The system comprises a set of conditional primer 1 and 2 for each DNA sample, the forward conditional primer 1 and 2 are paired with the template strand, the reverse conditional primer 1 and 2 are paired with the complementary strand of the template strand, the conditional primer 2 is located downstream of the conditional primer 1, and the 5' end of the conditional primer 2 is connected with the amplification primer of the DNA fragment to be detected.

11. The agent of claim 10, wherein The amplification system further comprises an artificial template and a Taqman probe for each DNA fragment to be detected, the Taqman probe is labeled with a fluorescent reporter group at the 5' end and a quencher group at the 3' end, and the artificial template comprises the sequence of the DNA fragment to be detected, and the Taqman probe is specifically paired with the upstream sequence of the sequence of the DNA fragment to be detected in the artificial template.

Citation Information

Patent Citations

  • Universal multiple PCR (Polymerase Chain Reaction) method

    CN102776172A

  • Folding primer and PCR amplification method thereof

    CN104611434A

  • Multiple QPCR (Quantitative Polymerase Chain Reaction) method based on conditional signal generation

    CN118703605A

  • Conditional multiple QPCR (Quantitative Polymerase Chain Reaction) method

    CN118726554A

  • Method for detecting target nucleic acids using artificial nucleic acid

    KR102678676B1