Application of ALDH1A1 gene in prevention and treatment of mitochondrial dysfunction and liver injury
By downregulating the expression of ALDH1A1 gene and using substances such as siRNA to inhibit mitophagy and lipid deposition, the problems of mitochondrial dysfunction and liver damage were solved, and the protection effect of liver cells was achieved.
Patent Information
- Application Number
- CN202510718131.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-30
- Publication Date
- 2025-09-02
AI Technical Summary
There is a lack of effective means in the prior art to regulate the ALDH1A1 gene to prevent and treat mitochondrial dysfunction and liver damage, especially liver cell damage caused by mitochondrial autophagy and lipid deposition.
By downregulating the expression of the ALDH1A1 gene, using substances such as siRNA, shRNA, lncRNA or circRNA to interfere with the expression of the ALDH1A1 gene, inhibit mitophagy, reduce lipid deposition in liver cells, and construct a hepatocyte injury model for research and development of targeted therapeutic drugs.
Downregulating ALDH1A1 gene expression improves mitochondrial function, reduces lipid deposition, protects liver cells, and prevents liver damage caused by lipid deposition, providing an effective strategy to prevent and treat mitochondrial dysfunction and liver damage.
Smart Images

Figure CN120571017A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of molecular biology, and in particular to the application of the ALDH1A1 gene in preventing and treating mitochondrial dysfunction and liver damage. Background Art
[0002] Mitochondria, double-membrane organelles evolved from engulfed α-proteobacteria, are considered the powerhouses of the cell. Mitochondria are composed of an outer membrane, an inner membrane, an intermembrane space, and a matrix. Mitochondria regulate a range of important physiological and biochemical cellular processes. Beyond ATP production, mitochondria play a number of key roles in cellular function and signaling. Therefore, damage to mitochondrial structure or dysfunction can contribute to disease.
[0003] Autophagy is an important metabolic process within cells that maintains the stability of the internal cellular environment and the integrity of its functions under both basal and stress conditions. Autophagy contributes to the clearance or turnover of long-lived or misfolded proteins, insoluble protein aggregates, invading microorganisms, and damaged or excessive organelles. Mitochondria, as the most important energy organelles, participate in ATP production and are involved in calcium homeostasis, oxidative stress response, and apoptosis. Dysfunctional or damaged mitochondria can lead to serious consequences, even leading to cell death. Therefore, maintaining mitochondrial homeostasis is crucial for cellular function. Accumulating evidence indicates that mitochondrial autophagy plays an important role in regulating liver homeostasis. Dysfunctional mitochondrial autophagy can aggravate oxidative stress and inflammatory responses in hepatocytes, leading to liver damage.
[0004] Retinaldehyde dehydrogenase 1 (RALDH1) is a cytoplasmic enzyme encoded by the retinal dehydrogenase 1 family member A1 (ALDH1A1) gene. RALDH1 is responsible for the irreversible oxidation of retinal (Rald) to retinoic acid (RA), thereby regulating the intracellular concentration of RA. RA regulates gene expression by activating nuclear receptors (such as RARs and RXRs), influencing various physiological processes, including development, immunity, and metabolism. However, there are currently no reports on the role of ALDH1A1 in regulating mitochondrial dysfunction and liver damage. Summary of the Invention
[0005] In response to the above-mentioned prior art, the present invention aims to provide the use of the ALDH1A1 gene in preventing and treating mitochondrial dysfunction and liver damage. The present invention has discovered that downregulating ALDH1A1 expression can improve mitochondrial function, prevent excessive mitochondrial autophagy, reduce lipid deposition in hepatocytes, and thus protect against liver damage caused by lipid deposition.
[0006] To achieve the above object, the present invention adopts the following technical solutions:
[0007] The first aspect of the present invention provides the use of the ALDH1A1 gene as a target in any one of the following (1)-(3):
[0008] (1) preparing drugs for inhibiting mitochondrial autophagy;
[0009] (2) Preparation of drugs for preventing and treating liver damage;
[0010] (3) Construction of a hepatocyte injury model;
[0011] The ALDH1A1 gene is a DNA molecule as shown in the following i) or ii):
[0012] i) the nucleotide sequence is the DNA molecule shown in SEQ ID NO.1;
[0013] ii) A DNA molecule encoding the amino acid sequence shown in SEQ ID NO. 2 except i).
[0014] The second aspect of the present invention provides the use of ALDH1A1 protein as a target in the following (1) or (2):
[0015] (1) preparing drugs for inhibiting mitochondrial autophagy;
[0016] (2) Preparation of drugs for preventing and treating liver damage;
[0017] The amino acid sequence of the ALDH1A1 protein is shown in SEQ ID NO.2.
[0018] The third aspect of the present invention provides a substance for downregulating ALDH1A1 gene expression, as described in (1) or (2):
[0019] (1) preparing drugs for inhibiting mitochondrial autophagy;
[0020] (2) Prepare drugs for preventing and treating liver damage.
[0021] In the above applications, the substances that downregulate ALDH1A1 gene expression include: small interfering RNA (siRNA), shRNA, long non-coding RNA (lncRNA) and circular RNA (circRNA), etc. These substances can act as interfering fragments to form complexes with proteins, bind to RNA, cut off RNA and cause RNA degradation, thereby achieving the purpose of preventing gene expression.
[0022] Preferably, the substance that downregulates ALDH1A1 gene expression is shRNA, and its nucleotide sequence is shown in SEQ ID NO.3.
[0023] A fourth aspect of the present invention provides a method for constructing a hepatocyte injury model, comprising the following steps:
[0024] An expression vector containing the ALDH1A1 gene is introduced into hepatocytes to overexpress the ALDH1A1 gene in the hepatocytes.
[0025] Preferably, the hepatocytes are NCTC1469 cell lines.
[0026] The present invention overexpresses the ALDH1A1 gene in hepatocytes, causing excessive lipid deposition in the cells and resulting in hepatocyte damage. The hepatocyte injury model constructed using the present invention can be used to study the molecular mechanisms of hepatocyte damage and develop targeted therapeutic drugs for liver damage.
[0027] Beneficial effects of the present invention:
[0028] The present invention found that overexpression of the ALDH1A1 gene can disrupt the structure and function of mitochondria, accelerate mitochondrial autophagy, and promote lipid deposition in hepatocytes, thereby causing hepatocyte damage; while downregulating the expression of the ALDH1A1 gene can improve the structure and function of mitochondria, reduce lipid deposition in hepatocytes, and thus play a protective role against hepatocyte damage caused by lipid deposition. BRIEF DESCRIPTION OF THE DRAWINGS
[0029] Figure 1 :The mitochondrial structures under different treatments were observed using transmission electron microscopy. Scale bar: 1 μm.
[0030] Figure 2 MPTP assay reflects the permeability of the mitochondrial permeability transition pore. CoCl2 quenches the green fluorescence produced by calcein, indicating increased permeability of the mitochondrial transition pore. Scale bar: 200 μm.
[0031] Figure 3 :MMP detection reflects the changes in mitochondrial membrane potential under different treatments. A decrease in membrane potential indicates impaired mitochondrial function.
[0032] Figure 4 : QPCR was used to detect the expression of key genes in the tricarboxylic acid cycle under different treatments. Changes in their expression can indirectly reflect changes in mitochondrial function.
[0033] Figure 5 Detection of changes in cellular reactive oxygen species (ROS) levels under different treatments. These changes indirectly reflect the level of mitochondrial damage. Scale bar: 200 μm.
[0034] Figure 6 The expression changes of Drp1, a key protein in mitochondrial fission, were detected under different treatments.
[0035] Figure 7Colocalization of Drp1 with mitochondria was examined under different treatments. Increased colocalization reflects enhanced recruitment of Drp1 to mitochondria. Scale bar: 200 μm.
[0036] Figure 8 :The expression of proteins related to the mitophagy pathway was detected under different treatments. The changes in expression reflect the changes in the mitophagy process.
[0037] Figure 9 :Detection of triglyceride deposition in cells under different treatments
[0038] Figure 10 : Detection of changes in the deposition of neutral lipid droplets (green fluorescence) in cells under different treatments. Scale bar: 200 μm.
[0039] Figure 11 Phenotypic information (body size, weight, and liver mass, AC) was measured for different mice. Serum biochemical markers reflecting metabolic changes and damage were measured (D). Oil red O and hematoxylin and eosin staining revealed changes in liver fat metabolism (E). Transmission electron microscopy revealed changes in mitochondrial structure (F). Scale bar: 2 μm. DETAILED DESCRIPTION
[0040] It should be noted that the following detailed descriptions are illustrative and intended to provide further explanation of the present application. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art to which the present application belongs.
[0041] In order to enable those skilled in the art to more clearly understand the technical solution of the present application, the technical solution of the present application will be described in detail below with reference to specific embodiments.
[0042] The test materials used in the examples of the present invention are all conventional test materials in the field and can be purchased through commercial channels. Experimental methods without detailed conditions were carried out in accordance with conventional test methods or the operating instructions recommended by the supplier.
[0043] The PsicoR vector was purchased from AddgeneP.
[0044] The cell culture medium formula for NCTC1469 is as follows:
[0045]
[0046] All the above reagents were purchased from Gibco.
[0047] Example 1: Construction of ALDH1A1 gene interference fragment and ALDH1A1 gene recombinant expression vector
[0048] 1. Construction of ALDH1A1 gene interference fragment:
[0049] Based on the mRNA sequence of Mus musculus (housemouse) ALDH1A1 (GenBank: NM_001361503.1) published by NCBI, an ALDH1A1 gene interference fragment was designed. The nucleotide sequence is shown in SEQ ID NO. 3 and is as follows:
[0050] shALDH1A1: 5′-TTTCGAGTGTGGATTTAGT-3′.
[0051] The ALDH1A1 gene interference fragment sequence was synthesized by Sangon Biotech (Shanghai) Co., Ltd. The PsicoR vector was double-digested with Hpa I and Xho I. The ALDH1A1 gene interference fragment was annealed and ligated into the digested PsicoR vector (hereinafter referred to as sh-Ctrl). Plasmid extraction was performed using a plasmid extraction kit from Kangwei Century Co., Ltd. The recombinant plasmid was sequenced and verified by Sangon Biotech (Shanghai) Co., Ltd., resulting in the construction of the ALDH1A1 gene knockdown plasmid shALDH1A1 (hereinafter referred to as sh-AL).
[0052] 2. Construction of ALDH1A1 gene recombinant expression vector:
[0053] Based on the NCBI-published Mus musculus (house mouse) ALDH1A1 mRNA sequence, primers were designed to amplify the CDS region of the ALDH1A1 gene (the nucleotide sequence of the CDS region is shown in SEQ ID NO. 1) using NheI and BamHI restriction enzymes. The pcDNA3.1 vector was double-digested with NheI and BamHI, and the CDS region of the ALDH1A1 gene was ligated into the digested pcDNA3.1 vector (hereinafter referred to as Vec). Plasmid extraction was performed using a plasmid extraction kit from Kangwei Century Co., Ltd. The recombinant plasmid was verified by sequencing and synthesized by Sangon Biotech (Shanghai) Co., Ltd., resulting in the construction of the ALDH1A1 gene overexpression plasmid mALDH1A1 (hereinafter referred to as mAL).
[0054] Example 2: Effects of the ALDH1A1 gene on mitochondrial function and hepatocyte damage
[0055] 1. Test method:
[0056] (1) Overexpression of ALDH1A1 gene or downregulation of ALDH1A1 gene expression in mouse hepatocytes:
[0057] When normal mouse hepatocytes (NCTC1469) grow to 70% to 80% of the bottom of a 6-well plate culture dish / confocal dish, start plasmid transfection; replace the preheated fresh culture medium 1 hour before transfection, and then place it in a CO2 incubator, and then prepare the transfection working solution; dilute the target gene plasmid mAL (or sh-AL) and the negative control plasmid Vec (or sh-Ctrl) with normal saline according to the usage ratio in the instructions (see the Vigofect reagent instructions of Vigofect Biotechnology (Beijing) Co., Ltd. for details) to prepare 40 μL of plasmid solution; add 0.8 μL of VigoFect transfection reagent to 39.2 μL of normal saline to obtain a volume of 40 μL of transfection reagent dilution solution, let it stand at room temperature for 5 minutes, then add the transfection reagent dilution solution dropwise to the above-prepared plasmid solution, gently mix, and let it stand at room temperature for 15 minutes to obtain the transfection working solution; add the working solution dropwise to the 6-well plate / confocal dish, mix it by cross method, and place it in an incubator for 24 hours.
[0058] When the transfected target gene plasmid is shALDH1A1, it downregulates the expression of the ALDH1A1 gene in mouse hepatocytes; its negative control plasmid is sh-Ctrl.
[0059] When the transfected target gene plasmid is mALDH1A1, it actually overexpresses the ALDH1A1 gene in mouse hepatocytes; its negative control plasmid is Vec.
[0060] (2) Detect the effects of overexpression or downregulation of the ALDH1A1 gene on mitochondrial structure and function:
[0061] ① Transmission electron microscopy observation:
[0062] The cell pellets after transfection with shALDH1A1 plasmid and mALDH1A1 plasmid were collected by centrifugation, prepared for transmission electron microscopy, and then observed under a transmission electron microscope for image analysis.
[0063] ② Mitochondrial permeability transition pore (MPTP) detection:
[0064] Preparation of Calcein AM staining solution: 4 μL of Calcein AM (1000X) and 400 μL of chaotropic agent (100X) were added to 4 ml of assay buffer and mixed.
[0065] Preparation of fluorescence quenching solution: Add CoCl2 (100X) to the Calcein AM staining solution to make the final concentration 1X and mix well.
[0066] Aspirate the culture medium and wash the cells 1-2 times with PBS. Add an appropriate volume of Calcein AM staining solution and fluorescence quenching solution, gently shaking to evenly coat all cells with the dye. Incubate at 37°C in the dark for 30-45 minutes.
[0067] After incubation, replace the culture medium with fresh, preheated 37°C medium and incubate at 37°C for an additional 30 minutes in the dark to ensure that intracellular esterases fully hydrolyze Calcein AM to generate green fluorescent Calcein. Aspirate the culture medium, wash the cells 2-3 times with PBS, then add detection buffer and observe under a fluorescence microscope.
[0068] ③ Mitochondrial membrane potential (MMP) detection:
[0069] Prepare JC-1 working solution: 1 ml of JC-1 working solution is required per well of a 6-well plate. Dispense an appropriate amount of JC-1 (200X) and dilute it with 8 ml of ultrapure water for every 50 μl of JC-1 (200X). Vortex vigorously to thoroughly dissolve and mix the JC-1. Then, add 2 ml of JC-1 staining buffer (5X) and mix thoroughly to prepare the JC-1 working solution.
[0070] Aspirate the culture medium, wash the cells once with PBS or other appropriate solution, and add 1 ml of cell culture medium. The cell culture medium may contain serum and phenol red.
[0071] Add 1 ml of JC-1 staining solution, mix thoroughly, and incubate in a cell culture incubator at 37°C for 20 minutes.
[0072] During the incubation period, prepare an appropriate amount of JC-1 staining buffer (1X) by adding 4 ml of distilled water to every 1 ml of JC-1 staining buffer (5X) and place it in an ice bath.
[0073] After incubation at 37°C, the supernatant was removed and the cells were washed twice with JC-1 staining buffer (1X).
[0074] Add 2 ml of cell culture medium and observe under a fluorescence microscope.
[0075] ④Reactive oxygen species (ROS) determination:
[0076] The culture medium was aspirated, and the cells were washed with DPBS. The ROS probe was diluted with serum-free culture medium to a concentration of 10 μM. The cells were incubated in the dark at 37°C for 30 min, and mixed twice during the process.
[0077] (3) Detecting the effects of overexpression or downregulation of the ALDH1A1 gene on mitochondrial autophagy
[0078] ① Western Blot detection of the expression of key protein Drp1:
[0079] The cell pellets after transfection with shALDH1A1 plasmid and mALDH1A1 plasmid were collected by centrifugation, and the expression of the key protein Drp1 was detected by Western Blot.
[0080] ②Immunofluorescence staining:
[0081] Prepare the punching solution: dilute 10 μL of Triton X-100 with 10 mL of PBS to a working concentration of 0.1% and store at room temperature. Prepare the blocking solution: weigh 0.3 g of BSA powder using an electronic balance and add it to 10 mL of PBS to make a working concentration of 3% blocking solution. Store at -20°C until needed.
[0082] The specific steps of the experiment are as follows: the cells were cultured on a cell slide in a 24-well plate. After the iPS cell line clones grew to an appropriate density and size, the ESM was removed and the cells were washed once with DPBS. 4% paraformaldehyde solution was slowly added along the wall of the dish and fixed overnight at 4°C. The fixative was removed and the cells were washed three times with DPBS, each time for 5 minutes. The prepared 0.1% TritonX-100 solution was added and the cells were punched at room temperature for 15 minutes. The punching solution was removed and the cells were washed twice with DPBS, each time for 5 minutes. 3% BSA solution was added and the cells were blocked at room temperature at 4°C overnight. The primary antibody was stained with an appropriate amount of 3% Dilute with BSA solution and incubate at room temperature for 90 minutes; after the reaction is complete, discard the primary antibody and wash with DPBS three times, each time for 5 minutes; add the corresponding secondary antibody diluted in blocking solution at an appropriate ratio and react at room temperature for 1 hour; after the reaction is complete, discard the secondary antibody and wash with DPBS twice, each time for 5 minutes; add diluted nuclear staining solution DPAI and let it stand at room temperature for 5-10 minutes; remove DPAI and wash with DPBS once; add new DPBS, wrap the culture dish with tin foil and store it at 4℃ in the dark; use a laser confocal microscope or fluorescence microscope to scan and photograph the sample.
[0083] (4) Detect the effect of overexpression or downregulation of ALDH1A1 gene on hepatocyte lipid deposition
[0084] ①Triglyceride determination:
[0085] Collect the culture medium of the 6-well plate into a 15 ml centrifuge tube, wash the cells once with DPBS, add 400 μL of trypsin, and place in a cell culture incubator at 37°C for digestion for 2 minutes. Observe under a microscope. Digest until the cells are loose and detached from the bottom of the dish. Add an equal amount of collected culture medium to terminate digestion, then transfer to a 15 ml centrifuge tube and centrifuge at 1,000 rpm for 5 minutes. After aspirating the supernatant, add 1 mL of DPBS to resuspend and wash, and centrifuge at 1,000 rpm for 5 minutes to obtain a cell sample.
[0086] Lysis buffer (Triton X-100, 1-2%) was used to lyse the cell samples for 30-40 minutes, and the lysed liquid was directly measured without centrifugation.
[0087] The detection operation is as follows:
[0088]
[0089] The plate was shaken to mix, incubated at 37°C for 10 minutes, and the absorbance of each well was measured by microplate reader at a wavelength of 500 nm.
[0090] Dilute the 2 mg / ml protein standard with DPBS to 0, 0.2, 0.5, 1, and 2 mg / ml. After dilution, bring the volume to 10 μL. Remove 10 μL of the sample supernatant for later use. Prepare an appropriate amount of BCA working solution (Solution A:Solution B = 50:1, prepared immediately before use). Add 50 μL of BCA working solution to each tube, vortex to mix, and let stand at room temperature until the solution turns purple.
[0091] The concentration of protein standards was determined using a NanoDrop assay. Three replicates were set for each protein standard concentration. A standard curve was created based on the OD values of the protein standards. The actual concentration of the target protein was determined by running the sample. The triglyceride concentration of the sample was then calculated by correcting the sample absorbance and protein concentration using a formula.
[0092] ②BODIPY staining:
[0093] Remove the culture medium from the confocal dish, add 0.5 mL of DPBS for washing, and dilute the BODIPY staining solution with serum-free medium to a final concentration of 2.5 μM in a total volume of 1 mL. Add the diluted BODIPY staining solution to the confocal dish and incubate in a cell culture incubator at 37°C for 15 minutes. Rinse the cells twice with 0.5 mL of DPBS and remove the staining solution. Stain with 500 μL of DAPI for 5 minutes and wash three times with PBS for 5 minutes each. After completing the above steps, observe using a confocal microscope.
[0094] 2. Test results:
[0095] (1) Effects of overexpression or downregulation of ALDH1A1 gene on mitochondrial structure and function:
[0096] Through transmission electron microscopy observation, we found that upregulating the expression of the ALDH1A1 gene would cause mitochondrial swelling ( Figure 1 At the same time, fluorescence microscopy revealed an increase in the opening of the mitochondrial permeability transition pore (MPTP) in cells with upregulated ALDH1A1 gene expression, indicating that the structure of the mitochondria was damaged ( Figure 2).
[0097] We tested the mitochondrial membrane potential and the results showed that upregulating the expression of ALDH1A1 gene would reduce the mitochondrial membrane potential, while downregulating the expression of ALDH1A1 gene would increase the mitochondrial membrane potential ( Figure 3 ). Fluorescence quantitative PCR results showed that upregulating the expression of the ALDH1A1 gene reduced the expression of proteins involved in the mitochondrial tricarboxylic acid cycle, while downregulating the expression of the ALDH1A1 gene could achieve a certain rescue effect ( Figure 4 The results of reactive oxygen species staining showed that upregulating the expression of the ALDH1A1 gene would lead to the accumulation of ROS in cells ( Figure 5 These results suggest that upregulating ALDH1A1 expression affects mitochondrial function, whereas downregulating ALDH1A1 helps mitochondria perform their functions.
[0098] (2) Effects of overexpression or downregulation of ALDH1A1 gene on mitochondrial autophagy
[0099] By detecting protein expression, it was found that upregulating ALDH1A1 can promote the expression of the key mitochondrial protein Drp1, while inhibiting the expression of ALDH1A1 will inhibit the expression of Drp1 ( Figure 6 Immunofluorescence showed that increased ALDH1A1 expression promoted the colocalization of Drp1 with mitochondria ( Figure 7 The above results indicate that upregulating the expression of ALDH1A1 can promote mitochondrial fission.
[0100] Increased mitochondrial fission induces the occurrence of mitochondrial autophagy. By detecting protein expression, it was found that upregulating the expression of ALDH1A1 can promote the expression of AMPKα, PINK1 and Parkin proteins, while inhibiting the expression of ALDH1A1 will reduce the expression of these proteins ( Figure 8 The results showed that ALDH1A1 could activate PINK1-Parkin-mediated mitophagy.
[0101] (3) Effects of overexpression or downregulation of the ALDH1A1 gene on hepatocyte lipid deposition
[0102] Triglyceride measurements were performed on cell samples with different ALDH1A1 expression levels to determine the effect of ALDH1A1 on lipid deposition in hepatocytes. Western Blot results showed that the introduction of ALDH1A1 knockdown or overexpression vectors into the NCTC1469 cell line could achieve the effect of influencing ALDH1A1 expression. ALDH1A1 gene expression helps reduce triglyceride deposition in hepatocytes, while upregulating ALDH1A1 gene expression promotes triglyceride deposition in hepatocytes ( Figure 9), BODIPY staining results also showed that downregulating the expression of ALDH1A1 gene can reduce the deposition of neutral lipid droplets in hepatocytes, while upregulating the expression of ALDH1A1 can promote the deposition of neutral lipid droplets in hepatocytes ( Figure 10 These results suggest that ALDH1A1 gene expression affects lipid deposition in hepatocytes.
[0103] Example 3: Knockout mouse model verifies the protective effect of ALDH1A1 deficiency on high-fat diet-induced liver damage
[0104] 1. Materials and methods
[0105] (1) Experimental animals:
[0106] Male C57BL / 6 wild-type mice (ALDH1A1 + / + ) and ALDH1A1 heterozygous knockout mice (ALDH1A1 - / + ), weighing 20 g-30 g, aged 6-8 weeks, were purchased from Saiye (Suzhou) Biotechnology Co., Ltd. (Suzhou, Jiangsu, China).
[0107] The gRNA target sequences used to construct ALDH1A1 gene heterozygous knockout mice are as follows:
[0108] gRNA-A1 (forward strand matching the gene): TTAGTGATTGGGTGATCGCCTGG;
[0109] gRNA-A2 (matching gene reverse strand): TGGTTAAATCTCGTGCCGTGTGG.
[0110] (2) Test materials:
[0111] High-fat feed was purchased from Synergy Biotechnology, product number XTHF60-1.
[0112] (3) Test method:
[0113] All animals and experiments were performed in accordance with the Guide for the Care and Use of Laboratory Animals. + / + ) and ALDH1A1 heterozygous knockout mice (ALDH1A1 - / + All animals were housed in an SPF-rated environment with suitable temperature and humidity. They had free access to food and drinking water, a normal daylight cycle, and free access to food and water. Bedding was kept dry. After 18 weeks of high-fat diet feeding, samples were collected for serum and liver tissue analysis and observation.
[0114] 2. Test results:
[0115] ALDH1A1- / + The body weight and liver weight of the mice were not significantly different from those of wild-type mice ( Figure 11 A, B). WT mice (ALDH1A1 + / + ) have lighter livers with fat deposits; ALDH1A1 - / + The liver of mice is relatively darker in color ( Figure 11 C). Serum biochemical indicators suggest ALDH1A1 - / + The mice showed improved lipid metabolism, increased insulin sensitivity, and reduced liver cell damage. Figure 11 Oil red O staining and HE staining of liver tissue showed that ALDH1A1 - / + Mice have healthier lipid metabolism than WT mice ( Figure 11 E); Electron microscopic observation of liver tissue showed that ALDH1A1 - / + The morphology of mouse liver cell mitochondria is more complete ( Figure 11 F), tending towards a normal metabolic state.
[0116] The above description is merely a preferred embodiment of the present application and is not intended to limit the present application. Various modifications and variations are possible for those skilled in the art. Any modifications, equivalent substitutions, or improvements made within the spirit and principles of the present application shall be included within the scope of protection of the present application.
Claims
1. Use of the ALDH1A1 gene as a target in any of the following (1)-(3): (1) preparing drugs for inhibiting mitochondrial autophagy; (2) Preparation of drugs for preventing and treating liver damage; (3) Construction of a hepatocyte injury model; The ALDH1A1 gene is a DNA molecule as shown in the following i) or ii): i) the nucleotide sequence is the DNA molecule shown in SEQ ID NO.1; ii) A DNA molecule encoding the amino acid sequence shown in SEQ ID NO. 2 except i).
2. Use of ALDH1A1 protein as a target in the following (1) or (2): (1) preparing drugs for inhibiting mitochondrial autophagy; (2) Preparation of drugs for preventing and treating liver damage; The amino acid sequence of the ALDH1A1 protein is shown in SEQ ID NO.
2.
3. The substance that downregulates ALDH1A1 gene expression is used as described in (1) or (2): (1) preparing drugs for inhibiting mitochondrial autophagy; (2) Prepare drugs for preventing and treating liver damage.
4. The use according to claim 3, characterized in that The substance that downregulates ALDH1A1 gene expression includes: small interfering RNA, shRNA, long non-coding RNA and / or circular RNA.
5. The use according to claim 4, characterized in that The substance that downregulates ALDH1A1 gene expression is shRNA, and its nucleotide sequence is shown in SEQ ID NO.
3.
6. A method for constructing a hepatocyte injury model, characterized in that: The following steps are involved: An expression vector containing the ALDH1A1 gene is introduced into hepatocytes to overexpress the ALDH1A1 gene in the hepatocytes.
7. The construction method according to claim 6, characterized in that: The hepatocytes are NCTC1469 cell lines.