Adeno-associated virus and its use in promoting maturation of an arteriovenous fistula

By constructing an EGR2 adeno-associated virus vector and injecting it into a mouse model, the problem of high failure rate of arteriovenous fistula maturation was solved, and early preventive promotion and maturation of fistulas were achieved.

CN120574787BActive Publication Date: 2025-11-18XIEHE HOSPITAL ATTACHED TO TONGJI MEDICAL COLLEGE HUAZHONG SCI & TECH UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511075584.3
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-08-01
Publication Date
2025-11-18
Estimated Expiration
2045-08-01

AI Technical Summary

Technical Problem

In existing technologies, the initial maturation failure rate of arteriovenous fistulas is high, and there is a lack of effective early preventive drug interventions, which makes poorly maturing fistulas prone to complications such as puncture injury, aneurysm formation, and thrombosis.

Method used

An adeno-associated virus vector was constructed, and the EGR2 gene was inserted into the adeno-associated virus vector and injected into a mouse model to promote the maturation of arteriovenous fistulas and enhance the outward remodeling of the fistula vein outflow tract.

Benefits of technology

The application of EGR2 adeno-associated virus significantly promoted the maturation of arteriovenous fistulas, enhanced the thickening of the fistula vein wall and the expansion of the lumen, improved the maturation rate of fistulas, and reduced the occurrence of complications.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure FT_3
    Figure FT_3
Patent Text Reader

Abstract

The application discloses an adeno-associated virus and application thereof in promoting arteriovenous fistula maturation, and belongs to the technical field of biotechnology. The adeno-associated virus is constructed by the following steps: (1) inserting an EGR2 gene with a sequence as shown in SEQ ID NO. 1 into an adeno-associated virus vector pAV-CMV-C-3Flag-P2A-GFP plasmid to obtain a packaging plasmid; (2) mixing transfection reagents, the packaging plasmid, a carrier plasmid, an auxiliary plasmid and a packaging cell line; the carrier plasmid is the pAV-CMV-C-3Flag-P2A-GFP plasmid; and (3) collecting cell culture supernatant to obtain the adeno-associated virus. By injecting the above-mentioned EGR2 adeno-associated virus, the outflow tract outward remodeling of the fistula vein is enhanced, and the arteriovenous fistula maturation is promoted.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, and in particular relates to an adeno-associated virus and its application in promoting the maturation of arteriovenous fistulas. Background Technology

[0002] The increasing prevalence of chronic kidney disease worldwide has led to a gradual increase in patients with end-stage renal diseases (ESRD) requiring long-term hemodialysis. Arteriovenous fistulas (AVFs), as the primary and optimal access route for hemodialysis, are considered the "lifeline" for ESRD patients. AVF functional maturity is defined as the ability to provide dialysis prescriptions with at least two-thirds of the required punctures within four consecutive weeks, while also meeting the requirements of an AVF diameter >5mm and a blood flow rate >500mL / min. However, studies have shown that the primary maturation failure rate of AVFs is as high as 60%. Poorly matured AVFs are highly susceptible to complications such as puncture injury, aneurysm formation, and thrombosis, and may even be rendered unusable. Therefore, improving the primary maturation rate of AVFs is a significant challenge for clinicians in the field of hemodialysis.

[0003] AVF maturation is an adaptive remodeling process. The outflow tract of the fistula vein needs sufficient outward remodeling to thicken the vessel wall and enlarge the lumen to accommodate the increased blood flow. Currently, clinically applied techniques to promote AVF maturation mainly include physical intervention and surgical intervention, while research on drug application is limited. Physical intervention methods include functional exercises and tourniquet application, and infrared irradiation. Surgical intervention techniques include collateral vein ligation and balloon dilation. Related drugs, such as anticoagulants, are mainly used to reduce thrombosis after long-term use, and local medications such as Hirudoid are used to improve vascular elasticity and reduce scarring. These techniques address existing problems (such as stenosis or collateral shunts) and lack early preventative interventions, resulting in lagging drug development. Seeking new therapeutic targets from the mechanism of AVF maturation and developing adeno-associated viruses targeting therapeutic targets to provide direct therapeutic effects may promote AVF maturation.

[0004] Early growth response protein 2 (EGR2), also known as Krox20, is a transcription factor with a zinc finger structure that exhibits high evolutionary stability and conservation. Various extracellular signals, including growth factors, cytokines, hypoxia, and mechanical forces, can induce aberrant EGR2 expression. EGR2 exerts its gene regulatory role by binding to a conserved DNA domain containing the GCGGGGGGGG structure via three C2H2 zinc fingers. In recent years, the roles of EGR2 in AVF intimal hyperplasia, stem cell differentiation into smooth muscle-like cells, and dysfunction of diabetes-associated vascular smooth muscle cells (VSMCs) have been reported. Studies have shown that RNA-seq analysis of AVF fistula veins in ESRD patients and mice confirms that EGR2 is a key gene for vascular remodeling and cell proliferation. Summary of the Invention

[0005] This invention provides a method for constructing adeno-associated virus, comprising the following steps:

[0006] (1) Insert the EGR2 gene with the sequence shown in SEQ ID NO.1 into the adeno-associated virus vector pAV-CMV-C-3Flag-P2A-GFP plasmid to obtain the packaging plasmid;

[0007] (2) Mix the transfection reagent, packaging plasmid, vector plasmid, helper plasmid and packaging cell line; the vector plasmid is pAV-CMV-C-3Flag-P2A-GFP plasmid;

[0008] (3) Collect the cell culture supernatant to obtain adeno-associated virus.

[0009] In one embodiment of the present invention, the kozak sequence GCCACC is added before the sequence shown in SEQ ID NO.1 in step (1).

[0010] In one embodiment of the present invention, the EGR2 gene and the adeno-associated virus vector in step (1) are ligated after double enzyme digestion.

[0011] In one embodiment of the present invention, the double restriction sites are AsisI and MluI.

[0012] In one embodiment of the present invention, the helper plasmid in step (2) is pAd-Helper.

[0013] In one embodiment of the present invention, the packaging cell line in step (2) is HEK293 cells, HEK293T cells or HEK-293FT cells.

[0014] In one embodiment of the present invention, step (3) is followed by step (4) to purify the cell culture supernatant with adeno-associated virus.

[0015] The present invention also provides an adeno-associated virus constructed by the above-described construction method.

[0016] This invention also provides the application of the above-mentioned adeno-associated virus in the preparation of mature products that promote arteriovenous fistulas.

[0017] In one embodiment of the present invention, the product is a drug.

[0018] Compared with the prior art, the present invention has the following beneficial effects:

[0019] This invention enhances the outward remodeling of the fistula venous outflow tract and promotes the maturation of arteriovenous fistulas by injecting EGR2 adeno-associated virus. Attached Figure Description

[0020] Figure 1 The results of successful CKD modeling in Example 1 are shown in Figure A, where A is the result of serum creatinine detection and B is the result of Masson staining of mouse kidney sections.

[0021] Figure 2A The results are obtained from HE staining of the outflow tract veins of AVF mice after adeno-associated virus intervention in Example 1.

[0022] Figure 2B In Example 1 Figure 2A The corresponding test results for pipe wall thickness.

[0023] Figure 2C In Example 1 Figure 2A The corresponding test results for the lumen diameter.

[0024] Figure 2D These are representative images of fluorescent staining of MYH11 and α-SMA marker molecules in the outflow tract veins of AVF mice after adeno-associated virus intervention in Example 1.

[0025] Figure 2E This is a representative image of the fluorescent staining of EGR2 and α-SMA, a marker molecule of differentiated VSMCs, in the outflow tract veins of AVF mice after adeno-associated virus intervention in Example 1.

[0026] Figure 3A These are representative images of EGR2 and differentiation marker molecules from Western blot analysis of VSMCs after in vitro TGF-β1 intervention in Example 1.

[0027] Figure 3B In Example 1 Figure 3A The corresponding statistical results are shown in the graph.

[0028] Figure 4A This is a representative western blot image of EGR2 and the differentiation phenotype marker α-SMA after EGR2 plasmid intervention in VSMCs in Example 1.

[0029] Figure 4B In Example 1 Figure 4A The corresponding statistical chart.

[0030] Figure 4C This is a graph showing the cell viability of VSMCs after EGR2 plasmid intervention in VSMCs in Example 1, as displayed by the CCK8 assay.

[0031] Figure 4D These are representative images of each group after EGR2 plasmid intervention in VSMCs in Example 1, showing Edu fluorescence staining.

[0032] Figure 4E In Example 1 Figure 4D The corresponding statistical chart. Detailed Implementation

[0033] Example 1

[0034] I. Application of EGR2 adeno-associated virus in mice

[0035] (1) Establishing a mouse model of chronic kidney disease

[0036] Wild-type male C57BL / 6J mice aged 6-8 weeks were housed in an animal facility for 1-2 weeks prior to surgery, given routine maintenance diet and drinking water. Before modeling, the mice were randomly divided into two groups: a sham operation group (sham group) and a left renal superior pole artery ligation + right nephrectomy model group (chronic kidney disease CKD group). Blood samples were collected from the orbital vein 28 days after surgery to measure serum creatinine levels. Kidney samples were perfused and collected for Masson staining analysis. C57BL / 6J mice with elevated serum creatinine and renal fibrosis were considered to be chronic kidney disease mice and used for subsequent experiments.

[0037] 1) The procedure for the left superior renal artery ligation + right nephrectomy model group (CKD group) is explained:

[0038] Wild-type male C57BL / 6J mice aged 6-8 weeks were housed in an animal facility for 1-2 weeks prior to surgery, receiving routine maintenance feed and drinking water. Before modeling, the mice were randomly divided into two groups: a sham operation group (sham group) and a left renal superior pole artery ligation + single nephrectomy model group (CKD group). Mice were fasted for 8-12 hours before surgery. Routine instruments were prepared before surgery, including a stereomicroscope, a cold light source, 4-0 and 8-0 sterile suture needles with sutures, straight surgical forceps, curved surgical forceps, surgical scissors, and a needle holder. Mice were generally anesthetized by intraperitoneal injection of 0.5% sodium pentobarbital at a dose of 14 μL / g. The mouse was fixed in a supine position on a sterilized surgical board. The skin around the linea alba was carefully prepared and disinfected with povidone-iodine. After disinfection, a 4-5 cm incision was made along the linea alba, extending from below the xiphoid process to the bladder. The subcutaneous muscles and fascia were then incised to expose the left kidney. The superior polar artery of the left kidney was freed and ligated in the middle segment using 8-0 sterile silk sutures. The upper two-thirds of the left kidney was observed to have turned purplish-black due to ischemia. The right kidney was then exposed, and the right ureter was freed. The middle segment of the ureter was grasped with surgical forceps, and the ureter was ligated twice at both ends near the renal pelvis using 4-0 sterile silk sutures, with the ureter cut in the middle. The fascia surrounding the right renal pedicle was gently peeled away with forceps to free the pedicle. The pedicle was then ligated twice at both ends using 4-0 sterile silk sutures, with the pedicle cut in the middle. The renal capsule was torn open with forceps, and the right kidney was carefully peeled out and removed, taking care not to remove the adrenal gland. Hemostasis was achieved by applying pressure to the renal pedicle with a cotton swab, and the incision was sutured layer by layer. In the sham-operated group, only the left renal superior pole artery was dissected without ligation, and the right kidney was not removed; all other procedures were the same. Mice were observed to awaken 1-3 hours post-operation and gradually resumed normal activity. Blood samples were collected from the orbital vein 28 days after modeling, and kidney samples were also collected.

[0039] 2) Explanation of serum creatinine and renal fibrosis results:

[0040] Compared to the Sham group, the CKD group showed significantly higher serum creatinine and significantly increased collagen deposition in the kidney tissue.

[0041] 3) Animal testing data for the Sham group and CKD group, as follows: Figure 1 As shown.

[0042] (2) Establishing a mouse AVF model (AVF surgery)

[0043] One week after CKD modeling, mice were randomly divided into groups for experiments. One group was the control group (CKD+GFP AAV group, receiving a single tail vein injection of 5×10⁻⁶ ppm). 11 vg / animal GFP control adeno-associated virus), model group (AVF+GFP AAV group, 5×10 vg / animal tail vein injection once) 11vg / animal GFP control adeno-associated virus, AVF surgery performed 28 days later), treatment group (AVF+EGR2 AAV group, 5×10 vg / animal tail vein injection). 11 Vg / animal EGR2 adeno-associated virus (AVF) was administered, with 6 animals per group. Twenty-eight days after AVF, perfusion samples were collected for histological staining analysis to assess the maturity of the outflow venous tract.

[0044] 1) Instructions for the procedure of abdominal aorta-inferior vena cava puncture (AVF surgery) in mice:

[0045] (1) Intraperitoneal injection of 0.5% sodium pentobarbital for anesthesia (14 μL / g).

[0046] (2) Use a razor and depilatory cream to remove neck hair, and apply petroleum jelly to the eyes to prevent dryness.

[0047] (3) Fix the mouse in a supine position on the heating pad with medical tape. First, disinfect the skin of the mouse neck with 1% iodine disinfectant, and then disinfect with 75% alcohol.

[0048] (4) Place the fixed mouse under a dissecting microscope with its head facing away from the operator.

[0049] (5) Make an incision about 4 cm long at the linea alba using ophthalmic scissors.

[0050] (6) Bluntly dissect and expose the abdominal aorta and inferior vena cava, electrocoagulate or ligate other tributaries, and avoid traction or damage to the inferior vena cava.

[0051] (7) Gently dissect the abdominal aorta from the left renal artery to the bifurcation above the bladder. During this process, keep the inferior vena cava moist by dripping saline solution onto its surface, and be careful not to pull on the inferior vena cava.

[0052] (8) Use a microvascular clamp to close the proximal end of the free abdominal aorta near the left renal artery to block blood flow.

[0053] (9) Using a needle holder, bend the 25G needle to 120° and hold the needle bevel upwards. At the distal end of the abdominal aorta, near the bifurcation and the linea alba, insert the needle into the inferior vena cava at a 30° angle. Be careful to adjust the angle of the needle and do not penetrate the inferior vena cava. After confirming that the bevel of the needle has completely entered the inferior vena cava and that there is venous blood flowing out from the other end of the needle, release the vascular clamp. At this time, if the blood in the inferior vena cava is pink and pulsatilely dilated, the fistula is patent. Quickly withdraw the needle and use a cotton swab to stop the bleeding for about 45 seconds. Be careful to use moderate force to achieve the hemostasis effect without compressing the puncture fistula.

[0054] (10) Suture the abdominal skin continuously with 4-0 sutures. Disinfect with 1% povidone-iodine solution.

[0055] (11) Administer 0.8 mL of physiological saline subcutaneously. Place the mouse on a heating pad and return it to the animal room after it recovers. Regularly observe the mouse's survival status and for any abdominal bleeding.

[0056] (12) On day 28 after AVF modeling, mice were anesthetized with 0.5% sodium pentobarbital (14 μL / g). After fixation, they were placed under a dissecting microscope with their heads facing away from the surgeon.

[0057] (13) Open the abdominal incision and observe the patency of the AVF and whether there is thrombosis, occlusion, or blood clot compression.

[0058] (14) Carefully separate the arteriovenous fistula from the surrounding tissues and free the arteriovenous fistula.

[0059] (15) Open the mouse's thoracic cavity with scissors to expose the heart, cut open the right atrial appendage, and then perfuse the left ventricle with physiological saline until the outflow tract vein turns white and no blood flows out of the right atrial appendage. The perfusion flow rate is 80-100 mL. After that, perfuse with 4% paraformaldehyde at a flow rate of 80-100 mL.

[0060] (16) The outflowing vein and abdominal aorta were simultaneously severed near the anastomosis. After the specimen was removed, it was quickly fixed with 4% paraformaldehyde. After 24 h of fixation, the specimen was subjected to gradient dehydration. After dehydration, it was embedded in paraffin and the section thickness was 3 μm. Sections with the same number were taken from each specimen for HE and immunofluorescence staining.

[0061] 2) Explanation of the AVF mouse model infected by tail vein injection of adeno-associated virus:

[0062] a. Construction of adeno-associated virus:

[0063] 1. The core sequence of the mouse EGR2 gene (SEQ ID NO.1) was screened and synthesized. The kozak sequence GCCACC was added before ATG, and the C-terminus was fused with a 3Flag protein tag. The sequence SEQ ID NO.1 is as follows:

[0064] ATGGACCCAGGTCTCATTCCTATGATCCCAGACTATCCTGGATTTTTTCCATCTCCGTGCCAGAGAGATCCACACGGTGCTGCTGGCCCAGATCGAAAGCCGTTTCCCTGTCCTCTGGACTCCCTGCGAGTGCCCCCTCCACTCACGCCACTCTCTACCATCCGTAATTT TACTCTGGGGGGTCCCGGTGCTGGAGTCACGGGACCAGGAGCAAGTGGAGGTGGTGAGGGACCTCGGCTGCCTGGCAGTGGGTCTGCAGCAGTGACTGCCACCCCTTATAATCCGCACCACCTGCCATTGCGGCCCATCCTGCGACCTCGAAAGTACCCTAACAGGCCCAG CAAAACGCCAGTGCACGAAAGGCCCTATCCCTGCCCAGCAGAAGGTTGTGATAGGAGGTTCTCACGCTCTGATGAGCTGACCAGGCACATCCGAATCCACACGGGCCACAAGCCCTTCCAGTGTCGGATCTGCATGCGAAACTTCAGCCGAAGTGACCACCTTACTACTCA CATCCGAACCCACACCGGGGAGAAGCCCTTTGCCTGTGACTATTGTGGCCGCAAGTTTGCCAGGAGTGACGAAAGGAAGCGCCACACCAAGATCCACCTTCGGCAGAAGGAACGGAAGAGCAGTGCTCCCTCTGCACCTCCATCTGCCCAGTCTTCAGCCTCTGGTCCTGG

[0065] 2. Enzyme digestion and ligation:

[0066] The plasmid containing the core sequence of the mouse EGR2 gene was digested with enzymes. The enzyme digestion system is as follows:

[0067] Reaction solution composition volume DNA fragment (0.1 μg / μL) 10µL 10× Buffer 3µL AsisI 1µL MluI 1µL <![CDATA[ddH2O]]> 15µL Total 30µL

[0068] After adding and mixing the sample, incubate at 37℃ for 1 hour for enzyme digestion. After the reaction, detect the size of the target band by 1% agarose gel electrophoresis and recover the target fragment using a gel recovery kit. The adeno-associated virus vector pAV-CMV-C-3Flag-P2A-GFP plasmid (manufacturer: Shandong Weizhen Biotechnology, catalog number: AV88004) was digested with the following enzyme digestion system, and then the vector was recovered by gel extraction.

[0069] Reaction solution composition volume Carrier (0.5 μg / μL) 4µL 10× Buffer 5µL AsisI 1.5µL MluI 1.5µL <![CDATA[ddH2O]]> 38µL Total 50µL

[0070] 3. Connection

[0071] The recovered target gene fragment was ligated into the pAV-CMV-C-3Flag-P2A-GFP vector, which had undergone the same double enzyme digestion. The ligation system is as follows:

[0072] Element volume Target fragment 2-6μL Carrier fragment 2-4μL 10×T4 Buffer 1μL T4 DNA ligase (10 U / μL) 1μL Total 10μL

[0073] After mixing, centrifuge briefly and connect at 22°C for 1 hour.

[0074] 4. Transformation

[0075] The ligation product was transformed into E. coli DH5α competent cells and screened on LB plates with the corresponding resistance.

[0076] The specific steps of the transformation:

[0077] (1) Take out the prepared DH5a competent cells from -80℃ and place them in an ice bath.

[0078] (2) After the DH5a competent cells thaw, take 5 μL of the ligation product into 20 μL of DH5a competent cells, mix thoroughly, and let stand in an ice bath for 15 minutes.

[0079] (3) Place the centrifuge tube in a 42°C water bath for 40 seconds (do not shake the centrifuge tube during this time), then quickly transfer it to an ice bath and let it stand for 2 minutes.

[0080] (4) Add 200 μL of sterile LB medium (without antibiotics) to the centrifuge tube, mix well, and place in a shaker at 37°C and 220 rpm for 1 hour. The purpose is to express the relevant resistance marker gene on the plasmid and revive the bacteria.

[0081] (5) Spread onto a plate of solid culture medium with the corresponding resistance.

[0082] (6) Incubate overnight in a 37°C incubator.

[0083] 5. Sequencing: After selecting single colonies for culture, plasmids are extracted, enzyme digestion is performed to identify positive clones, and sequencing is used for verification. Once the plasmids are verified, they are extracted and used for downstream experiments.

[0084] 6. Prepare HEK293T cells: Separate HEK293T cells one day in advance. During packaging, the cell density should reach 85%-90%, with uniform cell distribution and good cell condition. Virus packaging steps:

[0085] (1) Change the medium for cells one to two hours before transfection to serum-free DMEM medium (1% HEPES and 1% P / S).

[0086] (2) Prepare the packaging mix: the ratio of transfection reagent: packaging plasmid: vector plasmid: helper plasmid = 15:2:2:1. Let it stand at room temperature for 30 minutes. The packaging plasmid refers to the plasmid used to transform DH5α competent cells. The vector plasmid is pAV-CMV-C-3Flag-P2A-GFP. Both the transfection reagent and the helper plasmid are commercially available.

[0087] (3) Add the above-mentioned liquid after standing to HEK293T cells and label them. Shake well after adding.

[0088] (4) After culturing the cells in a 37°C, 5% CO2 incubator for 72 hours, blow the cells up and collect them together with the culture medium into a 50ml centrifuge tube. Centrifuge to separate the cell pellet and supernatant.

[0089] (5) Transfer the culture medium supernatant to a new tube, precipitate with PGE8000 overnight (add 2.33g NaCl + 8.5g PEG8000 per 100mL), centrifuge at 3500g and 4℃ for 30 minutes the next day, remove the supernatant, and resuspend with PBS + 0.001% PF68.

[0090] (6) Resuspend the cell pellet in PBS + 0.001% PF68, freeze and thaw once, add 5M NaCl, and vortex to mix.

[0091] (7) Mix the resuspended solution of (5) with the resuspended solution of (6), shake and mix well, and then sonicate until it is no longer viscous. During sonication, the probe should be cleaned with 84% alcohol, 75% alcohol and water in sequence between different samples. Sonicate for 30 seconds and stop for 5-10 seconds. Depending on the viscosity of the sample, sonicate AMPL30% 3-4 times and AMPL20% once.

[0092] (8) Centrifuge 3500g of the sonicated liquid for 30 minutes and collect the supernatant.

[0093] 7. Purification: Iodixanol density gradient centrifugation.

[0094] (1) Prepare different concentrations of iodixanol.

[0095] (2) Take a superposition tube and add different concentrations of iodixanol layer by layer. Add the higher concentration first and then the lower concentration. When adding different concentrations of iodixanol, push it in slowly to avoid mixing the high concentration layer with the low concentration layer.

[0096] (3) Add the prepared virus solution to the top layer.

[0097] (4) Purify the virus by ultracentrifugation.

[0098] 8. Concentrated

[0099] (1) After centrifugation, collect the virus.

[0100] (2) The collected liquid is placed in an ultrafiltration tube to concentrate the virus.

[0101] (3) After repeatedly blowing and aspirating the remaining liquid in the ultrafiltration tube into the virus storage tube, replenish it with virus storage solution to the volume required by the contract, and mark the name and date.

[0102] (4) Take 10 μl of virus solution for titer and specificity testing.

[0103] (5) The virus solution was aspirated and used to infect HEK293 cells in a 96-well plate. Fluorescence was observed 24 h and 48 h after infection.

[0104] 9. Titer and Specificity Detection: Once the viral titer and specificity meet the usage standards, the virus can be used for subsequent experiments.

[0105] b. Wild-type C57BL / 6J male mice aged 6-8 weeks were housed in an animal facility for 1-2 weeks prior to surgery, given a standard maintenance diet and drinking water. CKD modeling was first performed as before, followed by randomization into a control group (CKD+GFP AAV group, receiving a single tail vein injection of 5×10⁻⁵ ppm). 11 vg / animal GFP control adeno-associated virus), model group (AVF+GFP AAV group, 5×10 vg / animal tail vein injection once) 11 vg / animal GFP control adeno-associated virus, AVF surgery performed 28 days later), treatment group (AVF+EGR2 AAV group, 5×10 vg / animal tail vein injection). 11 (EGR2 adeno-associated virus, vg / mouse, AVF surgery performed 28 days later). Mice should be fasted for 8-12 hours before tail vein injection. Prepare a tail vein injection device, mouse restraint, 1 mL insulin syringe, sterile saline, 75% alcohol, iodine, cotton swabs, and cotton balls before surgery. Guide the mouse into the restraint and fix it in place. Place the restraint on the tail vein injection device, straighten the tail vein, and wipe the base of the tail downwards 3-5 times with a 75% alcohol cotton ball. Simultaneously, identify the tail vein under infrared light. Draw a calculated amount of virus suspension. Fix the tail vein with the left hand to keep it straight, and hold the syringe with the needle bevel facing upwards, inserting it parallel to the tail vein. When blood return is seen in the syringe, inject the virus suspension. The sign that the virus suspension has entered the tail vein is: no resistance during injection, and clear fluid visible in the tail vein. If the injection resistance increases or the tail vein boundary is unclear, the virus suspension has not entered the tail vein. The needle can be removed and reinserted above the original injection site. After injection, stop the bleeding with a cotton swab. Return the animal to its cage and continue rearing. AVF modeling should begin 28 days after viral infection.

[0106] 3) Explanation of the results regarding the thickness and diameter of the outflow tract vessels of the arteriovenous fistula:

[0107] Blood vessel diameter: The measurement site is the inferior vena cava, 2 mm from the puncture site near the heart. Each animal was measured 6 times, and the average value was taken.

[0108] Blood vessel wall diameter: The measurement site is the inferior vena cava 2 mm proximal to the heart at the puncture site. Each animal was measured 6 times and the average value was taken.

[0109] 4) Explanation of the diameter and wall thickness of the outflow tract veins and the results of immunofluorescence:

[0110] Compared with the control group, the model group mice showed thickened fistula vein walls, enlarged lumen, co-expression of VSMC markers MYH11 and α-SMA, and enhanced EGR2 and α-SMA; compared with the model group, the treatment group mice showed further increased fistula vein wall thickness, further enlarged lumen diameter, co-expression of VSMC markers MYH11 and α-SMA, and further enhanced EGR2 and α-SMA.

[0111] Animal test data from the control group, model group, and treatment group are as follows: Figures 2A-2E As shown.

[0112] II. Cellular level detection of EGR2 expression and phenotypic changes in vascular smooth muscle cells under classical TGF-β1 stimulation

[0113] Mouse vascular smooth muscle cells (VSMCs) were treated with 5 ng / mL TGF-β1 for 12, 24, and 48 hours, and the VSMC lysates were then subjected to Western blotting. The results showed that TGF-β1 treatment increased the expression of EGR2 protein in VSMCs in a time-dependent manner, with statistically significant differences. This was accompanied by upregulation of the expression of VSMC differentiation phenotypic markers MYH11, α-SMA, CNN1, and SM22α proteins. (See details...) Figure 3A , 3B .

[0114] III. Cellular level detection of the effects of EGR2 overexpression on vascular smooth muscle cell phenotype and proliferation.

[0115] To investigate the association between EGR2 and TGF-β1-induced differentiation phenotype and proliferation capacity of VSMCs, VSMCs were transfected with the EGR2 plasmid to overexpress EGR2. Cells were divided into four groups: pcDNA 3.1 group, EGR2 OE group, TGF-β1+pcDNA3.1 group, and TGF-β1+EGR2 OE group. Western blot analysis was used to detect the expression of EGR2 and the differentiation phenotype marker α-SMA protein in VSMCs. The results showed that compared with the pcDNA 3.1 group, the expression of EGR2 and α-SMA proteins was upregulated in the TGF-β1+pcDNA3.1 group. Compared with the TGF-β1+pcDNA 3.1 group, the expression of EGR2 and α-SMA proteins was further increased in the TGF-β1+EGR2 OE group, and the differences were statistically significant. The proliferation of VSMCs was detected by CCK8 and Edu fluorescence. The results showed that the proliferation capacity of VSMCs in the TGF-β1+pcDNA 3.1 group was increased compared with that in the TGF-β1+pcDNA 3.1 group; and the proliferation capacity of VSMCs in the TGF-β1+EGR2 OE group was further enhanced compared with that in the TGF-β1+pcDNA 3.1 group. The differences were statistically significant.

[0116] (1) Explanation of the experimental procedures for CCK8:

[0117] VSMCs were transfected with pcDNA3.1(+) and EGR2 plasmids, respectively, and seeded in 96-well plates (4×10⁶) 24 hours later. 3 -1×10 5 Cells per well were cultured for 48 hours under normal conditions and with TGF-β1 (5 ng / mL), respectively. 10 μL of CCK8 solution was added to each well, and the cells were incubated for another 0.5–4 hours. The absorbance at 450 nm was measured using a microplate reader. Within a certain range, the number of viable cells was directly proportional to the absorbance. Each experimental group had at least three replicates, and the average value was taken.

[0118] (2) Instructions for Edu fluorescent staining procedure:

[0119] VSMCs were transfected with pcDNA3.1 and EGR2 plasmids, respectively, and seeded in 96-well plates (4 × 10⁶ wells) 24 hours later. 3 -1×10 5 Cells were cultured at 100 cells / well for 48 hours under normal conditions and with TGF-β1 (5 ng / mL). Then, following the instructions of the EdU cell proliferation kit, EdU was used to detect newly synthesized DNA in the cells. Double labeling with nuclear markers (DAPI) was also possible to detect cell proliferation, and the results were observed under a fluorescence microscope.

[0120] Data from each cell group after EGR2 plasmid intervention are as follows: Figures 4A-4E As shown.

[0121] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. A method for constructing an adeno-associated virus, characterized in that, Includes the following steps: (1) Insert the EGR2 gene with the sequence shown in SEQ ID NO.1 into the adeno-associated virus vector pAV-CMV-C-3Flag-P2A-GFP plasmid to obtain the packaging plasmid; (2) Mix the transfection reagent, packaging plasmid, vector plasmid, helper plasmid and packaging cell line; the vector plasmid is pAV-CMV-C-3Flag-P2A-GFP plasmid; (3) Collect the cell culture supernatant to obtain adeno-associated virus.

2. The construction method according to claim 1, characterized in that, In step (1), the kozak sequence GCCACC is added before the sequence shown in SEQ ID NO.

1.

3. The construction method according to claim 2, characterized in that, In step (1), the EGR2 gene and the adeno-associated virus vector are ligated after double enzyme digestion.

4. The construction method according to claim 3, characterized in that, The double restriction sites are AsisI and MluI.

5. The construction method according to claim 4, characterized in that, In step (2), the helper plasmid is pAd-Helper.

6. The construction method according to claim 5, characterized in that, In step (2), the packaged cell line is HEK293 cells, HEK293T cells, or HEK-293FT cells.

7. The construction method according to claim 6, characterized in that, Step (3) is followed by step (4) to purify the cell culture supernatant with adeno-associated virus.

8. Adeno-associated virus constructed by the construction method according to any one of claims 1-7.

9. The use of the adeno-associated virus according to claim 8 in the preparation of a mature product for promoting arteriovenous fistula.

10. The application according to claim 9, characterized in that, The product is a medicine.