Method for inhibiting animal RNA virus replication by using RaCas13b editing technology

Abstract

The invention relates to a Cas13b protein and application of the Cas13b protein in inhibiting viruses in eukaryotic cells, and belongs to the technical field of biology. The Cas13b protein is derived from riemerella anatipestifer, and the amino acid sequence of the Cas13b protein is as shown in SEQ ID NO. 1. The Cas13b protein has the advantages that the Cas13b protein is derived from riemerella anatipestifer; on the basis, a method for inhibiting an avian influenza virus (AIV), a porcine epidemic diarrhea virus (PEDV), a porcine transmissible gastroenteritis virus (TGEV), a porcine delta coronavirus (PDCoV) and a porcine reproductive and respiratory syndrome virus (PRRSV) in eukaryotic cells is utilized by the RaCas13b.

Description

Technical Field

[0001] The present invention belongs to the fields of gene technology and virology. More specifically, the present invention relates to a method for inhibiting the replication of H9N2 subtype avian influenza virus (AIV), porcine epidemic diarrhea virus (PEDV), porcine transmissible gastroenteritis virus (TGEV), porcine deltacoronavirus (PDCoV), and porcine reproductive and respiratory syndrome virus (PRRSV) by using Riemerella anatipestifer Cas13b (RaCas13b) gene interference technology. Background Art

[0002] In today's increasingly globalized world, RNA viruses, with their unique biological properties, have become a significant threat to public health that cannot be ignored. Numerous RNA viruses currently pose a threat to the veterinary field, including AIV, PEDV, TGEV, PDCoV, and PRRSV. The spread of these RNA viruses in animal populations not only severely harms the livestock industry but also poses a potential risk to human health through cross-species transmission. Furthermore, RNA viruses are highly mutable, making their prevention and control challenging. Therefore, the exploration of novel antiviral strategies is crucial.

[0003] In this context, the CRISPR-Cas system, as a bacterial immune system that defends against external viruses by targeting nucleotide information, has opened up new avenues for antiviral research with its unique nucleic acid targeting capabilities. Although the current application of CRISPR technology is mainly concentrated in the field of DNA editing based on Cas9 and Cas12, these tools have shown great potential in gene therapy, disease model construction, etc., but their irreversibility and potential off-target effects limit their application in certain fields, especially in antiviral strategies that require fine regulation and avoid genetic changes. In comparison, operations on RNA are reversible and can interfere with the transcription level without affecting genetic information. This is also one of the potentials of Cas13 targeted RNA cleavage. Summary of the Invention

[0004] The object of the present invention is to provide a CRISPR-Cas13b system that can be used to knock down mRNA in eukaryotic cells.

[0005] Another object of the present invention is to use RaCas13b of Riemerella anatipestifer to establish multiple inhibition methods targeting RNA viruses such as AIV, PEDV, TGEV, PDCoV and PRRSV, providing new means for new antiviral strategies for animal RNA viruses.

[0006] In order to achieve the purpose of the present invention, the technical solution adopted by the present invention is:

[0007] Provided is a type VI-B CRISPR-Cas13b system in Riemerella anatipestifer, comprising a RaCas13b protein and a CRISPR RNA. The activity and knockdown specificity of RaCas13b in eukaryotic cells are verified by cleaving eGFP mRNA with RaCas13b and crRNA. The nucleocapsid protein mRNAs of AIV, PEDV, TGEV, PDCoV, and PRRSV are cleaved with RaCas13b and crRNA, and efficient crRNA is screened. The replication of AIV is inhibited by co-transfecting RaCas13b and crRNA into MDCK cells. The replication of PEDV, TGEV, and PDCoV is inhibited by co-transfecting RaCas13b and crRNA into IPI-2I cells. The replication of PRRSV is inhibited by co-transfecting RaCas13b and crRNA into MARC-145 cells.

[0008] The present invention has the following advantages and beneficial effects:

[0009] (1) This invention utilizes the CRISPR-Cas system of Riemerella anatipestifer for the first time, providing a new option for gene editing tools;

[0010] (2) The present invention characterizes the mRNA cleavage ability of RaCas13b in eukaryotic cells and finds that the targeted cleavage of RaCas13b is highly specific;

[0011] (3) The present invention established a targeted inhibition method for AIV, PEDV, TEGV, PDCoV and PRRSV using RaCas13b, successfully inhibiting the replication of RNA viruses in cells, and has good application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0012] Figure 1 Schematic diagram of the construction of plasmids related to knockdown of eGFP in mammalian cells by RaCas13b

[0013] Figure 2 Schematic diagram of the process and results of knocking down eGFP in mammalian cells using RaCas13b

[0014] Figure 3 Schematic diagram of the process and results of knocking down eGFP in HD11 cells using RaCas13b

[0015] Figure 4 Assessing the bystander cleavage activity of RaCas13b in mammalian cells using a dual-fluorescence reporter plasmid

[0016] Figure 5Targeted knockdown of H9N2 AIV NP protein and PRRSV N protein by RaCas13b

[0017] Figure 6 Targeted knockdown of nucleocapsid proteins of three porcine enteric coronaviruses by RaCas13b

[0018] Figure 7 Using RaCas13b to inhibit the replication of five animal RNA viruses in cells DETAILED DESCRIPTION

[0019] Example 1

[0020] In this example, a RaCas13b expression plasmid, a crRNA plasmid, and a fluorescent reporter plasmid were constructed to inhibit RaCas13b mRNA in eukaryotic cells.

[0021] 1. Construction of pEF1a-RaCas13b

[0022] The specific operations are as follows:

[0023] The RaCas13b CDS region (3285 bp) was amplified using the RA-YM genome as a template using the upstream primer GACGTACGGCCACCATGGAAAAACCTTTACTACCG and the downstream primer GTAGGATCCAATTTGAGATTTAACAATTTCGC. The target fragment was 3308 bp in length. Reverse amplification was also performed using pLenti-EF1a-3×HA using the upstream primer CATGGTGGCCGTACGTCACGACACCTGAAATG and the downstream primer CTCAAATTGGATCCTACCCATACGATGTTCCAG. The target fragment was 9306 bp in length. The target fragment was identified by agarose gel electrophoresis and recovered. The pEF1a-RaCas13b vector was obtained by homologous recombination. The homologous recombination reaction was performed using 2× MultiF Seamless Mix (Abclonal, RK21020). For specific reaction systems and conditions, refer to the reagent instructions.

[0024] 2. Construction of eGFP-mCherry dual fluorescence reporter plasmid

[0025] Using pCAGGS-HA as the backbone, eGFP and mCherry sequences were inserted, where the eGFP promoter is CAGGS promoter; the mCherry promoter is CMV promoter, and the CMV promoter sequence was synthesized by the company.

[0026] 3. Construction of pU6-crRNA (eGFP) targeting eGFP

[0027] The specific operations are as follows:

[0028] First, the pU6-crRNA empty plasmid map was designed. The crRNA transcription promoter was U6, and the plasmid was synthesized by Gene Synthesis Company, Qingke Bio. The U6 sequence is: GAGGGCCTATTTCCCATGATTCCTTCATATTTGCATATACGATACAAGGCTGTTAGAGAGATAATTAGAATTAATTTGACTGTAAACACAAAGATATTAGTACAAAATACGTGACGTAGAAAGTAATAATTTCTTGGGTAGTTTGCAGTTTTAAAATTATGTTTTAAAATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCGATTTCTTGGCTTTATATATCTTGTGGAAAGGAC.

[0029] Design CRISPR RNA targeting the exogenous gene eGFP according to the following principles:

[0030] a) The length of the crRNA spacer sequence is 30 base sequences;

[0031] b) The crRNA spacer sequence is reverse complementary to the positive strand of the eGFP gene;

[0032] c) The direct repeat sequence of crRNA is GTTGGGACTGCTCTCAGTTTAGCTCACAACTTTGTTGTCGTTTTCAGCAGAGTTCGTGAATGCATAACATTTGAAGGGTATTCACAAC;

[0033] Homologous arm sequences for homologous recombination were added to both ends of the crRNA. A gene synthesis company was commissioned to synthesize different SPACER oligos, which were then ligated into the reverse-amplified pU6-crRNA vector via homologous recombination. The upstream primer was GGTGTTTCGTCCTTTCCACAAG, and the downstream primer was GTTGGGACTGCTCTCACTTTG. After sequencing, positive clones were saved as pU6-crRNA(eGFP). To test in avian cells, the promoter was adjusted in this example, replacing the U6 promoter with chU6. A gene synthesis company was commissioned to synthesize the plasmid, which was named pChU6-crRNA(eGFP).

[0034] Example 2

[0035] This example determines the targeted cleavage ability and bystander cleavage activity of RaCas13b described in the present invention in eukaryotic cells through interference experiments.

[0036] 1. Materials: Plasmids constructed in Example 1, HEK293T, IPI-2I, and HD11 cells.

[0037] 2. Verification method: This example constructs a eukaryotic verification system for the intervention inhibition ability of the RaCas13b protein described in the present invention to verify its cleavage effect and trans-cleavage activity.

[0038] The specific operations are as follows:

[0039] (1) Remove the frozen HEK-293T and IPI-2I cells from the liquid nitrogen tank and place them in 42°C warm water for rapid thawing. Then, pipette the cells from the cryotube into a centrifuge tube, centrifuge at 8000 r / min for 10 min, resuspend and wash with 2 mL PBS, and repeat twice. The washed cells are then resuspended in 8 mL DMEM+10% FBS+antibody cell culture medium and transferred to a T25 flask, which is then cultured in a 37°C 5% CO2 constant temperature incubator. HD11 cells are revived and cultured in R / MINI-1640 containing 10% FBS.

[0040] (2) 24 h before transfection, HEK-293T or IPI-2I cells with good morphology and vigorous growth were cultured at a rate of approximately 1×10 5 The cells were seeded into a 24-well cell culture plate at a volume of 100 cells / well and cultured in a 37°C CO2 incubator. When the cells grew to 60-80% monolayer, the medium was changed with DMEM+10% FBS-free medium and transfection was performed 2 hours later.

[0041] (3) 400 ng pEF1a-RaCas13b, 1600 ng pU6-crRNA (eGFP), and 1000 ng pCAG-eGFP were co-transfected into HEK-293T cells. After 24 h, the cells were observed under a fluorescence microscope and samples were collected for Western Blot analysis.

[0042] For wider application, the targeted inhibition effect of RaCas13b was further evaluated in the chicken macrophage cell line HD11: pChU6-crRNA (eGFP), pEF1a-RaCas13b and pCAG-eGFP were co-transfected into HD11, and observed under a fluorescence microscope after 24 hours, and samples were collected for Western Blot detection.

[0043] The results are as follows Figure 2 、 3As shown, it can be seen that all crRNAs can knock down eGFP with RaCas13b.

[0044] (4) Detect the number of different fluorescent cells using flow cytometry. Since other Cas13 proteins have been reported to have bystander cleavage activity in targeted knockdown applications in eukaryotic cells, the bystander cleavage activity of RaCas13b in eukaryotic cells was also evaluated in this example. pU6-crRNA (eGFP), pEF1a-RaCas13b, and eGFP-mCherry were co-transfected into HEK-293T cells. After 24 hours, the cells were digested from the 24-well plate and filtered through a 200-mesh nylon mesh before being tested on the flow cytometer.

[0045] The results are as follows Figure 4 As shown, it can be seen that RaCas13b has good specificity for eGFP knockdown and has no significant effect on non-target mCherry.

[0046] Example 3

[0047] This example evaluates the efficiency of crRNA knockdown for the nucleocapsid proteins of AIV, PEDV, TGEV, PDCoV, and PRRSV.

[0048] 1. Construction of pEnCMV-mCherry-N protein reporter plasmid

[0049] The NP protein gene was amplified using H9N2 AIV cDNA as a template, and the nucleocapsid protein gene was amplified using PEDV, TGEV, PDCoV, and PRRSV cDNA as templates. These fragments were recovered using a purification kit. The recovered fragments were then digested with pEnCMV-mCherry-Flag using BamH I and Xho I, respectively. The digested products were then recovered by agarose gel electrophoresis and reconstructed using T4 ligase.

[0050] 2. Construction of pU6-crRNA (N) Plasmid Targeting Nucleocapsid Protein

[0051] Refer to the pU6-crRNA design and construction principles for eGFP in Example 1.

[0052] The promoter of the AIV crRNA vector was adjusted and constructed using pChU6-crRNA as the backbone.

[0053] 3. Evaluation of RaCas13b’s targeted knockdown of H9N2 AIV, PEDV, TGEV, PDCoV, and PRRSV nucleocapsid proteins

[0054] Reference Example 2 verifies the intervention inhibition experiment of RaCas13b.

[0055] In this example, 400 ng of pEF1a-RaCas13b, 1600 ng of pU6-crRNA (eGFP), and 1000 ng of pEnCMV-mCherry-N were co-transfected into cells. After 24 hours, mCherry fluorescence levels were observed using a fluorescence microscope. N protein knockdown experiments for PEDV, TGEV, PDCoV, and PRRSV were performed in HEK-293T and IPI-2I cell lines, while NP protein knockdown experiments for H9N2AIV were performed in the HD11 cell line.

[0056] The results are as follows Figure 5 、 6 shown.

[0057] Example 4

[0058] This example tests the ability of RaCas13b to inhibit the proliferation of AIV, PRRSV, PEDV, TGEV, and PDCoV.

[0059] 1. Materials: plasmids constructed in Examples 1 and 2, IPI-2I, MARC-145, and MDCK cells.

[0060] 2. Verification method: This example verifies the ability of the RaCas13b protein described in the present invention to inhibit the proliferation of AIV, PEDV, TGEV, PDCoV and PRRSV in cells.

[0061] The specific operations are as follows:

[0062] (1) Remove IPI-2I, marc-145, and MDCK cells from the liquid nitrogen tank and place them in 42°C warm water for rapid thawing. Then, pipette the cells from the cryotube into a centrifuge tube, centrifuge at 8000 r / min for 10 min, resuspend and wash with 2 mL PBS, and repeat twice. Then, resuspend the washed cells in 8 mL DMEM+10% FBS+double antibody cell culture medium and transfer them to a T25 flask, which is then placed in a 37°C 5% CO2 constant temperature incubator for culture.

[0063] (2) 24 h before transfection, cells with good morphology and vigorous growth were cultured at a rate of approximately 1×10 5 The cells were seeded into a 24-well cell culture plate at a volume of 100 cells / well and cultured in a 37°C CO2 incubator. When the cells grew to 60-80% monolayer, the medium was changed with DMEM+10% FBS-free medium and transfection was performed 2 hours later.

[0064] (3) pU6-crRNA (N) targeting PEDV, TEGV, and PRRSV was co-transfected with pEF1a-RaCas13b into IPI-2I cells; pU6-crRNA (N) targeting PRRSV was co-transfected with pEF1a-RaCas13b into marc-145 cells; pChU6-crRNA (NP) targeting AIV was co-transfected with pCAG-RaCas13b into MDCK cells. The above co-transfection systems were all carried out according to the ratio of 600 ng pEF1a-RaCas13b to 2400 ng pU6-crRNA. 24 h after transfection, the cells were washed three times with DMEM high glucose medium, and then 0.5 mL of DMEM containing 1 µg / mL trypsin was added to each well, and the virus solution was added with MOI = 0.01. Incubate at 37℃ 5% CO2 incubator for 1 h for virus adsorption. PEDV, TGEV, and PDCoV were inoculated into IPI-2I cells, PRRSV into MARC-145 cells, and AIV into MDCK cells. After 1 hour, the culture medium was discarded and replaced with fresh DMEM containing 1 µg / mL trypsin in each well. After 24-48 hours, the supernatant was collected or a cell sample was added with lysis buffer for RNA extraction, which was then analyzed by qPCR.

[0065] The results are as follows Figure 7 As shown, RaCas13b and crRNA can inhibit the proliferation of AIV, PRRSV, PEDV, TGEV and PDCoV in cells.

[0066] The above examples are only used to illustrate the technical method of the present invention and are not intended to limit the same. Therefore, the present invention also protects modifications or improvements that do not deviate from the spirit of the present invention.

[0067] The amino acid sequence of RaCas13b is shown below:

[0068] SEQ NO.1

[0069]

Claims

1. A Cas13b protein, characterized in that It is derived from Riemerella anatipestifer, and the Cas13 protein is RaCas13b, wherein the amino acid sequence is shown in SEQ ID NO.

1.

2. A reporter system and plasmid for testing the target cleavage ability of Cas13b protein in eukaryotic cells 3. The reporter system and plasmid according to claim 2, characterized in that 1 Cas13b expression vector, 1 expression vector containing the target protein linked to mCherry and 1 crRNA vector.

4. crRNA vector as claimed in claim 3, characterised in that In applications targeting avian influenza virus, the chU6 promoter is used for expression, and in applications targeting porcine epidemic diarrhea virus, porcine transmissible gastroenteritis virus, porcine deltacoronavirus, and porcine reproductive and respiratory syndrome virus, the U6 promoter is used for expression.

5. A method for inhibiting avian influenza virus, porcine epidemic diarrhea virus, porcine transmissible gastroenteritis virus, porcine deltacoronavirus and porcine reproductive and respiratory syndrome virus, characterized in that The crRNA vector described in claim 3 is combined with the Cas13b expression vector to achieve cutting of the target RNA guided by crRNA, thereby inhibiting the replication and proliferation of avian influenza virus, porcine epidemic diarrhea virus, porcine transmissible gastroenteritis virus, porcine delta coronavirus and porcine reproductive and respiratory syndrome virus in cells.

Images