Application of soybean GmPT1 coding gene in resisting soybean mosaic virus disease

Abstract

The invention discloses an application of a soybean GmPT1 coding gene in resisting soybean mosaic virus diseases. The invention discloses application of the soybean inorganic phosphate transporter gene GmPT1 as shown in SEQ ID NO.1 and SEQ ID NO.2 in genetic engineering modification of soybean mosaic virus resistance. The over-expression of the gene can significantly improve the resistance of soybeans to soybean mosaic virus diseases. The soybean inorganic phosphate transporter gene GmPT1 disclosed by the invention can be transformed into soybeans through genetic engineering, and the resistance of the soybeans to soybean mosaic virus diseases is finally regulated and controlled.

Description

Technical Field

[0001] The present invention relates to the application of soybean GmPT1 encoding gene in resistance to soybean mosaic virus disease, belongs to the field of genetic engineering, and specifically to overexpressing soybean GmPT1 in soybean to increase resistance to soybean mosaic virus disease. Background Art

[0002] Soybeans are an important grain and oil crop, providing high-quality vegetable oils and proteins for humans and animals. Throughout their growing season, soybeans are susceptible to a variety of pests and diseases, severely impacting their yield and quality. Among these, soybean mosaic virus (SMV) occurs in nearly all soybean-producing regions worldwide. It is caused by the soybean mosaic virus (SMV). Symptoms of soybeans infected with SMV include yellow mosaic, curling, deformity, and wrinkling of leaves, reduced plant height, fewer branches, and delayed growth. Brown spots appear on seeds, pods are deformed, and the number of pods per plant is reduced. Soybean resistance to SMV is categorized as either infection resistance or spread resistance. Infection resistance refers to the inability of the pathogen to infect the host, a characteristic of qualitative or vertical resistance, an extreme form of resistance. Long-term cultivation of single-resistant material carries the risk of losing resistance. Under high selective pressure, the pathogen's physiological races will develop new mutations, overcoming the resistance of the resistant material and turning the previously resistant material susceptible. Resistance to expansion refers to the ability of a pathogen to successfully infect a host and establish a parasitic relationship, but the host is able to mount a defensive response, secreting antitoxins or inhibiting the replication and spread of the pathogen, thereby reducing pathogen reproduction and minimizing damage. This is considered quantitative or horizontal resistance. Varieties with quantitative resistance do not exert selective pressure on the pathogen, are less likely to lose resistance, and can still achieve good yields during major outbreaks. Currently, breeding soybeans resistant to SMV is the most cost-effective measure for controlling SMV. Discovering disease-resistant genes related to these two resistance mechanisms is crucial for improving soybean resistance to SMV and developing disease-resistant varieties.

[0003] Previous analysis of the SMV-induced soybean transcriptome revealed that GmPT1 strongly responds to induction by the soybean mosaic virus (SMV) strain SC7. GmPT1 encodes an inorganic phosphate transporter, but its role in soybean resistance to SMV has not been reported. Summary of the Invention

[0004] The purpose of the present invention is to disclose the application of soybean inorganic phosphate transporter gene GmPT1 in SMV resistance genetic engineering. This gene can be introduced into soybean as a target gene to regulate soybean resistance to SMV.

[0005] The purpose of the present invention can be achieved through the following technical solutions:

[0006] The soybean inorganic phosphate transporter encoding gene GmPT1 has a nucleotide sequence as shown in SEQ ID NO.1 and an amino acid sequence as shown in SEQ ID NO.2.

[0007] Preferably, the application is to overexpress GmPT1 in soybean to reduce the accumulation of SMV in soybean.

[0008] When using GmPT1 to construct a plant overexpression vector, any enhanced promoter or inducible promoter can be added before its transcription start nucleotide. To facilitate the identification and screening of transgenic plant cells or plants, the plant expression vector used can be processed, such as by adding a selective marker gene (GUS gene, luciferase gene, etc.) to the plant. From the perspective of transgenic plant safety, no selective marker gene can be added, and transformed plants can be screened through adversity.

[0009] After soybeans are transformed by genetic engineering, the soybean inorganic phosphate transporter encoding gene GmPT1 of the present invention is overexpressed to reduce the SMV content in the soybeans.

[0010] The plant overexpression vector carrying the GmPT1 of the present invention can be transformed into plant cells or tissues by conventional biological methods such as Ti plasmid, Ri plasmid, plant virus vector, DNA direct transformation, microinjection, electroporation, Agrobacterium-mediated transformation, and the transformed plant tissues can be cultivated into plants.

[0011] The invention relates to an application of a vector for overexpressing the soybean GmPT1 gene in improving the resistance of soybean to soybean mosaic virus disease.

[0012] The introduction of a vector over-expressing the soybean GmPT1 gene into soybean can reduce the accumulation of SMV in soybean.

[0013] Beneficial effects:

[0014] Soybean GmPT1 is a gene encoding an inorganic phosphate transporter. We found that the GsIFS2 gene in soybean responds to SMV induction, with significantly increased expression and reduced SMV content in overexpressing transgenic soybeans. Therefore, GsIFS2 could be used to develop SMV-resistant soybean varieties. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] Figure 1 The GmPT1 gene responds to soybean mosaic virus SC7 induction. Kefeng No. 1: disease-resistant material, Nannong 1138-2: disease-resistant material. *, ** indicate significance at the 0.05 and 0.01 levels, respectively; ns indicates not significant.

[0016] Figure 2EPSPS test results of GmPT1 gene overexpression transgenic soybean. A. Test results of GmPT1 overexpression transgenic soybean line PT1-4, B. Test results of GmPT1 overexpression transgenic soybean line PT1-8. The first one on the left of the two figures is the control Jack, and the others are GmPT1 overexpression transgenic soybeans.

[0017] Figure 3 Relative expression levels of the GmPT1 gene in overexpressing transgenic soybeans. Jack represents the wild type, and PT1-4 and PT1-8 represent two GmPT1-overexpressing transgenic soybean lines. Data are presented as means ± standard errors (SE) of three biological means. ** indicates significance at the 0.01 level.

[0018] Figure 4 Leaves of GmPT1-overexpressing transgenic soybeans 21 days after inoculation with the SMV-SC7 strain. PBS represents the control, smeared with 0.01 mol / L phosphate buffer. SC7 represents the inoculation with the SMV-SC7 strain. The legend represents 1 cm.

[0019] Figure 5 Expression of the SMV CP protein gene in transgenic soybean lines overexpressing GmPT1. Jack represents the wild type, while PT1-4 and PT1-8 represent two GmPT1-overexpressing transgenic soybean lines. qRT-PCR was used to determine the expression of the SMV CP gene. Data are presented as means ± standard errors (SE) of three biological means. ** indicates significance at the 0.01 level. DETAILED DESCRIPTION

[0020] The present invention will be further described below with reference to the accompanying drawings and embodiments.

[0021] Unless otherwise specified, the methods used in the following examples are all conventional methods.

[0022] Example 1 Induction of the GmPT1 gene in response to soybean mosaic virus SC7 strain

[0023] The susceptible material Nannong 1138-2 and the disease-resistant material Kefeng No. 1 were planted and inoculated with soybean mosaic virus SC7 strain at the true leaf stage. Soybean leaf tissue was collected at 0, 2, 8, and 24 hours after inoculation, ground with a mortar, added to a 1.5 mL EP tube containing lysis solution, and after sufficient shaking, transferred to a 1.5 mL EP tube, and total RNA was extracted (Total RNA Kit, Tiangen, Beijing, China). The quality of total RNA was identified by formaldehyde denaturing gel electrophoresis, and the RNA content was determined by spectrophotometry. Tubulin, which is constitutively expressed in soybean, was used as an internal reference. The primer sequences were F: 5'-GGAGTTCACAGAGGCAGAG-3' and R: 5'-CACTTACGCATCACATAGCA-3'. The obtained total RNA was used as a template and the reverse transcription kit (TaKaRa Primer Script TM RTreagent kit (Japan) was used for reverse transcription to obtain the first-strand cDNA. Real-time RT-PCR was then performed to detect the expression changes of the GmPT1 gene at different time points after the two materials were infected with the virus. The primer sequences were F: TTCTTTGGTGTAAGCAACTGTCATC and R: GCTCTGCTTGTTTTGTCTTTCTTTT. The results showed that the GmPT1 gene responded strongly to the treatment of soybean mosaic virus SC7 strain in both materials ( Figure 1 ).

[0024] Example 2 Gene Engineering Application of Gene GmPT1

[0025] 1) Cloning of wild soybean GmPT1

[0026] Using the mRNA sequence of the Glyma.10G186500 (GmPT1) gene from the soybean reference genome Williams82 in the SoyBase database as a template, specific primers were designed. The primer sequences for amplifying the gene were F: 5'-ATGGCGGGAGGACAACTAGGAG-3' and R: 5'-TTAAACTGGAACCGTCCTAGCA-3'. PCR amplification was performed using cDNA from soybean Kefeng No. 1 leaves as a template. Total RNA extraction and first-strand cDNA reverse transcription were performed as in Example 1. The PCR program was as follows: 35 cycles of pre-denaturation at 95°C for 30 seconds, denaturation at 95°C for 10 seconds, annealing at 60°C for 20 seconds, and extension at 72°C for 30 seconds, followed by a final incubation at 72°C for 5 minutes. The PCR product was cloned into the pUC19-T vector and sequenced to obtain the CDS sequence of the soybean GmPT1 gene, containing the entire coding region (1611 bp). The coding region sequence is shown in SEQ ID NO. 1, and the amino acid sequence is shown in SEQ ID NO. 2.

[0027] 2) Construction of plant expression vector

[0028] The GmPT1 gene sequence was amplified from the PUC19-T recombinant vector using PCR reaction. The amplification primers were: F: 5'-ATGGCGGGAGGACAACTAGGAG-3' and R: 5'-TTAAACTGGAACCGTCCTAGCA-3'. The ligase-independent single-fragment one-step cloning kit ( GsIFS2 was ligated into the plant expression vector D60005 (Da Beinong Group) using the Entry One Step Cloning Kit to generate a recombinant vector containing the GmPT1 gene for plant overexpression. This vector also contains the EPSPS marker gene. The plant transformation vector D60005 contains a strong 2×35S promoter, which strongly drives expression of the target gene GmPT1 in the recipient cells.

[0029] 3) Phenotypic identification

[0030] Two GmPT1-overexpressing transgenic soybean lines were obtained, named PT1-4 and PT1-8. GmPT1-overexpressing transgenic soybeans were planted in a constant temperature and light incubator. After 7 days, leaves were collected and tested for EPSPS strips and GmPT1 gene expression. EPSPS strip test results showed that the GmPT1 gene had been successfully inserted into the transgenic soybeans ( Figure 2 The extraction, reverse transcription and fluorescence quantitative PCR of total RNA were the same as those in Example 1) to detect the expression changes of GmPT1 gene in transgenic soybean. Figure 3 It can be seen that the expression level of GmPT1 in the overexpressing transgenic soybean is significantly higher than that in the wild type (JACK).

[0031] After the first pair of true leaves expanded, wild-type Jack and overexpression lines (PT1-4 and PT1-8) were inoculated with SMV-SC7 virus. Disease development was observed 21 days after inoculation, and the expression of the viral CP gene was measured in leaves. The leaves of wild-type Jack plants showed obvious wrinkling, while the leaves of overexpression lines showed slight wrinkling ( Figure 4 Analysis of viral CP gene expression revealed that the expression levels of SMV-CP genes in both overexpression strains were significantly lower than those in the wild type ( Figure 5 The above results indicate that overexpression of the GmPT1 gene reduced the accumulation of soybean mosaic virus and improved soybean resistance to SMV-SC7. The primer sequences for the CP gene are F: cagatgggcgtggttatga and R: acaatgggtttcagcggata.

Claims

1. Application of soybean inorganic phosphate transporter gene GmPT1 in improving soybean resistance to soybean mosaic virus disease, characterized in that: The nucleotide sequence of the soybean inorganic phosphate transporter gene GmPT1 is shown in SEQ ID NO.

1.

2. The use according to claim 1, characterized in that Overexpression of the soybean inorganic phosphate transporter gene GmPT1 can reduce the SMV content in soybean.

3. Application of overexpression of soybean GmPT1 gene in constructing soybean varieties with resistance to soybean mosaic virus disease.

4. The use according to claim 3, characterized in that Overexpression of the soybean inorganic phosphate transporter gene GmPT1 can reduce the SMV content in soybean.

5. Application of recombinant expression vector overexpressing soybean GmPT1 gene in constructing soybean varieties with resistance to soybean mosaic virus disease.

Images