Fusion type adeno-associated virus and application thereof

Abstract

The invention relates to the field of biological medicines, and discloses a fused adeno-associated virus and application thereof in ear diseases and ophthalmic diseases. The fusion adeno-associated virus comprises a fusion peptide fragment formed by fusing peptide fragments of serotype AAV1, 2, 6 and 7 or a variant of the fusion peptide fragment, can efficiently transduce hair cells and / or supporting cells in a cochlea, promote regeneration of internal hair cells and help to recover hearing, can also efficiently infect an RPE layer, and is used for treating ophthalmic diseases. As a safe vector, the fused adeno-associated virus has a wide application prospect in treatment of ear diseases or ophthalmic diseases.

Description

[0001] This application is a divisional application of the Chinese invention patent application with the application date of April 12, 2022, application number 202210383577X, and invention name “A fusion adeno-associated virus and its application”. Technical Field

[0002] The present invention relates to the field of biomedicine, and relates to a fusion-type adeno-associated virus and its application, and in particular to its application in the prevention and / or treatment of ear diseases and / or eye diseases. Background Art

[0003] There are approximately 7,000 known human diseases, of which approximately 80% are caused by genetic disorders. Genetic disorders affect over 300 million people worldwide. Current chemotherapy and protein therapies can treat fewer than 500 human diseases and are generally ineffective against diseases caused by genetic disorders, necessitating the development of new drugs and treatment options.

[0004] Gene therapy is an emerging treatment approach that delivers functional genes into patients to counteract or replace dysfunctional genes, thereby curing diseases without the need for chemotherapy, radiation therapy, or surgery. Gene therapy introduces genetic material into target cells via viral or non-viral vectors, treating or preventing disease by correcting or supplementing defective genes. The therapeutic effects can be long-lasting, without the need for repeated intervention. Gene therapy can be achieved through either ex vivo or in vivo strategies. Ex vivo gene therapy involves harvesting target cells from the patient, genetically modifying them, and then returning them to the patient's body; in vivo gene therapy involves delivering genetic material directly to the patient's target organ or tissue. Various types of gene delivery strategies have been used to treat a variety of diseases, including cancer, blindness, immune and neuronal diseases.

[0005] Viral vectors are the most commonly used gene therapy delivery vehicles due to their high efficiency in cell entry and introduction of genetic material. Commonly used vectors include adenovirus, retrovirus, lentivirus, and adeno-associated virus (AAV). Currently, AAV vectors have achieved excellent results in in vivo gene therapy clinical trials, while retroviral and lentiviral vectors are the preferred vectors in in vitro gene therapy clinical trials. The primary factors contributing to AAV's success as a therapeutic gene delivery vehicle are its low immunogenicity and lack of pathogenicity. Multiple marketed drug approvals and ongoing clinical trials have demonstrated that AAV vectors have become one of the leading gene delivery tools for gene therapy. In 2012, Glybera became the first AAV therapy approved in Europe for the treatment of lipoprotein lipase deficiency. The launch of these drugs clearly demonstrated the safety and efficacy of AAV-based therapies. Subsequently, Luxturna for the treatment of Leber congenital amaurosis and Zolgensma for the treatment of spinal muscular atrophy (SMA) received approval from the US Food and Drug Administration (FDA) in 2017 and 2019, respectively. Current clinical research focuses on treating monogenic diseases through gene replacement, gene silencing, or gene editing. In addition to its potential applications in treating a variety of diseases, including cancer, blindness, immune and neuronal disorders, AAV also holds promise for vaccine development. While AAV possesses low immunogenicity and pathogenicity, and AAV-based gene therapy has achieved remarkable success, up to 50% of patients are currently excluded from this treatment approach due to pre-existing neutralizing antibodies against the native AAV capsid protein. To circumvent this immune barrier, AAV capsids can be engineered to evade pre-existing neutralizing antibodies or to temporarily eliminate neutralizing antibodies before treatment. Engineering AAV capsids not only evades neutralizing antibodies but also allows AAV to target specific tissue and cell types, enabling precision therapy. Directed evolution is a powerful tool for modifying AAV capsids. In principle, directed evolution uses high-throughput techniques to introduce mutations into genes and their encoded proteins, mimicking natural evolution to significantly accelerate protein diversification and selection. This approach involves three basic steps: establishing a sequence-diverse library of the target gene, screening the protein repertoire encoded by the mutant gene library, and amplifying the gene sequence encoding the desired trait. These three steps constitute a single round of directed evolution, which can be repeated over multiple rounds until a specific gene / protein with improved properties is obtained.

[0006] However, the current use of adeno-associated viruses as vectors for auditory system gene therapy still has disadvantages such as poor tissue specificity and low infection efficiency. For example, adeno-associated virus vectors are known to infect supporting cells as well as hair cells. Supporting cells and hair cells express different pathogenic genes, and this non-specific infection of vectors has adverse effects on disease treatment. Therefore, to achieve precision gene therapy, new, efficient and specific recombinant adeno-associated virus vectors are needed. Summary of the Invention

[0007] The purpose of the present invention is to overcome the defects of the prior art and propose to transform an emerging new adeno-associated virus vector that can efficiently and specifically deliver genes in tissues such as the cochlea and the retina of the eye for use in gene therapy. The present invention infects the mouse cochlea with the modified new adeno-associated virus vector in vivo, which can mediate the expression of the target gene specifically in the cochlear supporting cells, thereby specifically marking or manipulating the supporting cells. The new adeno-associated virus has broad application value and market prospects in the structural and functional analysis of cochlear supporting cells, the establishment of disease models and gene therapy. At the same time, the virus was injected into the mouse eyeball through the vitreous body and found that the viral vector has better infection characteristics than the currently available vectors, and also has broad application value and market prospects in the structural and functional analysis of ophthalmic cells, the establishment of disease models and gene therapy.

[0008] One of the objects of the present invention is to provide a fusion adeno-associated virus AAV-WM01 capsid protein, which comprises a fusion peptide segment of peptide segments of serotypes AAV1, 2, 6 and 7 or a variant thereof.

[0009] Another object of the present invention is to provide a nucleic acid encoding the fusion-type adeno-associated virus AAV-WM01 capsid protein as described above.

[0010] Another object of the present invention is to provide a construct comprising the nucleic acid as described above.

[0011] Another object of the present invention is to provide a host cell, which comprises the construct as described above or has the exogenous nucleic acid as described above integrated into its genome, or the host cell comprises the fusion-type adeno-associated virus AAV-WM01 as described above.

[0012] Another object of the present invention is to provide a fusion-type adeno-associated virus AAV-WM01, the capsid structure of which contains the fusion-type adeno-associated virus AAV-WM01 capsid protein as described in any one of the above items.

[0013] Host cells transformed with the fusion-type adeno-associated virus as described above were used.

[0014] Another object of the present invention is to provide a fusion-type adeno-associated virus vector system, comprising a packaging plasmid, wherein the packaging plasmid comprises the nucleic acid or nucleic acid fragment as described above.

[0015] Another object of the present invention is to provide a fusion-type adeno-associated virus, which is obtained by viral packaging of the fusion-type adeno-associated virus vector system described above.

[0016] Another object of the present invention is to provide a pharmaceutical composition comprising the fusion-type adeno-associated virus as described in any one of the above items and a pharmaceutically acceptable excipient.

[0017] Another object of the present invention is to provide the use of the above-mentioned fusion adeno-associated virus AAV-WM01 capsid protein, nucleic acid, construct, fusion adeno-associated virus, host cell, fusion adeno-associated virus vector system, pharmaceutical composition or conjugate in the preparation of drugs for treating diseases; preferably, use in the preparation of drugs for gene therapy diseases.

[0018] Compared with the prior art, the present invention has the following advantages and beneficial effects: (1) It provides a novel adeno-associated virus vector AAV-WM01 that is specific for supporting cells and can mediate the expression of target genes specifically in supporting cells of the cochlea of ​​newborn mice; (2) It provides a novel adeno-associated virus vector AAV-WM01 that can mediate the expression of target genes specifically in inner hair cells of the cochlea of ​​adult mice; (3) It provides a novel adeno-associated virus vector AAV-WM01 that can mediate the expression of target genes specifically in the RPE layer of the retina of adult mice; (4) The novel adeno-associated virus vector AAV-WM01 is more flexible, safer, more convenient to use and less expensive than traditional transgenic methods; (5) The novel specific adeno-associated virus vector AAV-WM01 makes it possible to develop gene therapies for the precise treatment of ear and eye-related diseases. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 . In vivo screening process of DNA family shuffling libraries.

[0020] Figure 2 . Computer-simulated structure diagram of AAV-WM01.

[0021] Figure 3 a. Shows immunostaining of EGFP and the hair cell marker Myo7a 14 days after AAV-ie and AAV-WM01 were injected into the cochlea of ​​newborn mice. Images were taken at the hair cell level.

[0022] Figure 3b. Shows immunostaining of cochlear tissue from neonatal mice 14 days after AAV-ie and AAV-WM01 were injected into the cochlea. Immunostaining of cochlear tissue for green fluorescent protein (EGFP) and the hair cell marker protein Myo7a was performed after dissection. Images were taken at the supporting cell level.

[0023] Figure 3 c. Shows the Figure 3 a, Data statistics of hair cells and Dieters cells in 3b.

[0024] Figure 4 a. Shows immunostaining of the hair cell-specific marker protein Myo7a in cochlear tissue removed 14 days after AAV-WM01 was injected into the cochlea of ​​newborn mice and in cochlear tissue removed 14 days later, as well as in cochlear tissue dissected from normal mice.

[0025] Figure 4 b. Shows the Figure 4 a Statistical results of outer hair cells and inner hair cells.

[0026] Figure 5 a. Shows immunostaining of green fluorescent protein (EGFP) and hair cell-specific marker protein Myo7a after AAV-ie and AAV-WM01 were injected into the cochlea of ​​adult mice and the cochlear tissue was removed and dissected 14 days later.

[0027] Figure 5 b. Shows the Figure 5 a Statistical results of outer hair cells.

[0028] Figure 5 c. Shows the Figure 5 Data statistics of inner hair cells in a.

[0029] Figure 6 a. Shows immunostaining of the hair cell-specific marker protein Myo7a in cochlear tissue removed 14 days after AAV-WM01 was injected into the cochlea of ​​adult mice, and in cochlear tissue dissected from normal mice.

[0030] Figure 6 b. Shows the Figure 6 a Statistical results of outer hair cells and inner hair cells.

[0031] Figure 7 . AAV-WM01-CMV-EGFP infection of the RPE layer of the eyeball. DETAILED DESCRIPTION

[0032] The following describes the embodiments of the present invention through specific examples. Those skilled in the art will readily understand the other advantages and benefits of the present invention from the disclosure herein. The present invention may also be implemented or applied through various other specific embodiments, and the details in this specification may be modified or altered based on different viewpoints and applications without departing from the spirit of the present invention.

[0033] The present invention provides a fusion-type adeno-associated virus AAV-WM01 capsid protein, which comprises a peptide segment (fusion peptide segment or chimeric peptide segment) formed by fusion of peptide segments of serotypes AAV1, 2, 6 and 7, or a variant thereof.

[0034] In some preferred embodiments, in the fusion adeno-associated virus AAV-WM01 capsid protein, the fusion peptide segment comprises a first peptide segment, a second peptide segment, a third peptide segment, a fourth peptide segment and a fifth peptide segment connected in sequence; the first peptide segment comprises a peptide segment from AAV1, the second peptide segment comprises a peptide segment from AAV7, the third peptide segment comprises a peptide segment from AAV2, the fourth peptide segment comes from a peptide segment containing AAV1, and the fifth peptide segment comes from a peptide segment containing AAV6. Preferably, the first peptide segment comprises an amino acid fragment from position 1 to position 262 of SEQ ID No. 2 (SEQ ID NO. 3), the second peptide segment comprises an amino acid fragment from position 263 to position 325 of SEQ ID No. 2 (SEQ ID NO. 4), the third peptide segment comprises an amino acid fragment from position 326 to position 417 of SEQ ID No. 2 (SEQ ID NO. 5), the fourth peptide segment comprises an amino acid fragment from position 418 to position 583 of SEQ ID No. 2 (SEQ ID NO. 6), the fifth peptide segment comprises an amino acid fragment from position 584 to position 736 of SEQ ID No. 2 (SEQ ID NO. 7), and the fusion adeno-associated virus AAV-WM01 capsid protein comprises an S430I mutation.

[0035] SEQ ID No. 3 Met Ala Ala Asp Gly Tyr Leu Pro Asp Trp Leu Glu Asp Asn Leu Ser GluGly Ile Arg Glu Trp Trp Asp Leu Lys Pro Gly Ala Pro Lys Pro Lys Ala Asn GlnGln Lys Gln Asp Asp Gly Arg Gly Leu Val Leu Pro Gly Tyr Lys Tyr Leu Gly ProPhe Asn Gly Leu Asp Lys Gly Glu Pro Val Asn Ala Ala Asp Ala Ala Ala Leu GluHis Asp Lys Ala Tyr Asp Gln Gln Leu Lys Ala Gly Asp Asn Pro Tyr Leu Arg TyrAsn His Ala Asp Ala Glu Phe Gln Glu Arg Leu Gln Glu Asp Thr Ser Phe Gly GlyAsn Leu Gly Arg Ala Val Phe Gln Ala Lys Lys Arg Val Leu Glu Pro Leu Gly LeuVal Glu Glu Gly Ala Lys Thr Ala Pro Gly Lys Lys Arg Pro Val Glu Gln Ser ProGln Glu Pro Asp Ser Ser Ser Gly Ile Gly Lys Thr Gly Gln Gln Pro Ala Lys LysArg Leu Asn Phe Gly Gln Thr Gly Asp Ser Glu Ser Val Pro Asp Pro Gln Pro LeuGly Glu Pro Pro Ala Thr Pro Ala Ala Val Gly Pro Thr Thr Met Ala Ser Gly GlyGly Ala Pro Met Ala Asp Asn Asn Glu Gly Ala Asp Gly Val Gly Asn Ala Ser GlyAsn Trp His Cys Asp Ser Thr Trp Leu Gly Asp Arg Val Ile Thr Thr Ser Thr ArgThr Trp Ala Leu Pro Thr Tyr AsnAsn His Leu Tyr Lys Gln Ile Ser Ser SEQ ID No.4 Glu Thr Ala Gly Ser Thr Asn Asp Asn Thr Tyr Phe Gly Tyr Ser Thr ProTrp Gly Tyr Phe Asp Phe Asn Arg Phe His Cys His Phe Ser Pro Arg Asp Trp GlnArg Leu Ile Asn Asn Asn Trp Gly Phe Arg Pro Lys Lys Leu Arg Phe Lys Leu PheAsn Ile Gln Val Lys Glu Val Thr SEQ ID No.5 Gln Asn Asp Gly Thr Thr Thr Ile Ala Asn Asn Leu Thr Ser Thr Val GlnVal Phe Thr Asp Ser Glu Tyr Gln Leu Pro Tyr Val Leu Gly Ser Ala His Gln GlyCys Leu Pro Pro Phe Pro Ala Asp Val Phe Met Val Pro Gln Tyr Gly Tyr Leu ThrLeu Asn Asn Gly Ser Gln Ala Val Gly Arg Ser Ser Phe Tyr Cys Leu Glu Tyr PhePro Ser Gln Met Leu Arg Thr Gly Asn Asn Phe Thr Phe Ser Tyr Thr Phe Glu SEQ ID No.6 Glu Val Pro Phe His Ser Ser Tyr Ala His Ser Gln Ile Leu Asp Arg LeuMet Asn Pro Leu Ile Asp Gln Tyr Leu Tyr Tyr Leu Asn Arg Thr Gln Asn Gln SerGly Ser Ala Gln Asn Lys Asp Leu Leu Phe Ser Arg Gly Ser Pro Ala Gly Met SerVal Gln Pro Lys Asn Trp Leu Pro Gly Pro Cys Tyr Arg Gln Gln Arg Val Ser LysThr Lys Thr Asp Asn Asn Asn Ser Asn Phe Thr Trp Thr Gly Ala Ser Lys Tyr AsnLeu Asn Gly Arg Glu Ser Ile Ile Asn Pro Gly Thr Ala Met Ala Ser His Lys AspAsp Glu Asp Lys Phe Phe Pro Met Ser Gly Val Met Ile Phe Gly Lys Glu Ser AlaGly Ala Ser Asn Thr Ala Leu Asp Asn Val Met Ile Thr Asp Glu Glu Glu Ile LysAla Thr Asn Pro Val Ala Thr Glu Arg Phe Gly Thr Val Ala Val Asn SEQ ID No.7 Leu Gln Ser Ser Ser Thr Asp Pro Ala Thr Gly Asp Val His Val Met GlyAla Leu Pro Gly Met Val Trp Gln Asp Arg Asp Val Tyr Leu Gln Gly Pro Ile TrpAla Lys Ile Pro His Thr Asp Gly His Phe His Pro Ser Pro Leu Met Gly Gly PheGly Leu Lys His Pro Pro Pro Gln Ile Leu Ile Lys Asn Pro Val Pro Ala AsnPro Pro Ala Glu Phe Ser Ala Thr Lys Phe Ala Ser Phe Ile Thr Gln Tyr Ser ThrGly Gln Val Ser Val Glu Ile Glu Trp Glu Leu Gln Lys Glu Asn Ser Lys Arg TrpAsn Pro Glu Val Gln Tyr Thr Ser Asn Tyr Ala Lys Ser Ala Asn Val Asp Phe ThrVal Asp Asn Asn Gly Leu Tyr Thr Glu Pro Arg Pro Ile Gly Thr Arg Tyr Leu ThrArg Pro Leu* In the fusion-type adeno-associated virus AAV-WM01 capsid protein of the present invention, the peptide segments are directly fused to each other.

[0036] In the fusion adeno-associated virus capsid protein of the present invention, the peptide segments of the serotypes AAV1 and AAV6 assemble into the protrusions of the three-fold symmetry axis of the capsid protein; the peptide segments of the serotypes AAV2, 6, and 7 assemble into the channels of the five-fold symmetry axis of the capsid protein; the peptide segment of the serotype AAV6 forms a depression at the two-fold symmetry axis of the capsid protein, and the computer simulation structure diagram thereof is shown as follows Figure 2 shown.

[0037] Under an electron microscope, the nucleocapsid of an adeno-associated virus generally appears nearly circular. This nearly circular capsid is actually a closed, icosahedral, hollow capsid composed of multiple protein capsomeres, which encapsulates the genomic nucleic acid.

[0038] An icosahedral structure contains three types of rotational symmetry: 3-fold, 2-fold, and 5-fold symmetry. Specifically, this symmetrical structure has a 3-fold axis of symmetry passing through the centers of two opposing faces of the virus particle. The capsomeres rotate 120° around the 3-fold axis three times to form triangular faces. There are also 2-fold axes of symmetry (edges), where the capsomeres rotate 180° around the 2-fold axis twice to form two intersecting triangular faces. There is also a 5-fold axis of symmetry passing through two opposing vertices. The capsomeres rotate 72° around the 5-fold axis five times to form a pentamer. Thus, an icosahedral capsid consists of 20 equilateral triangular faces, where every two faces intersect to form an edge, for a total of 30 edges. Every five faces meet to form 12 vertices.

[0039] In some preferred embodiments, the capsid protein comprises: a) the amino acid sequence shown in SEQ ID No. 2; b) a polypeptide fragment having a sequence identity of more than 90% with SEQ ID No. 2 and having the function of the amino acid sequence defined in a).

[0040] Specifically, the polypeptide fragment in b) refers to: a polypeptide fragment obtained by substituting, deleting or adding one or more (specifically 1-50, 1-30, 1-20, 1-10, 1-5, 1-3, 1, 2, or 3) amino acids to the amino acid sequence as shown in SEQ ID No. 2, or by adding one or more (specifically 1-50, 1-30, 1-20, 1-10, 1-5, 1-3, 1, 2, or 3) amino acids to the N-terminus and / or C-terminus, and having the function of the polypeptide fragment as shown in SEQ ID No. 2. The amino acid sequence in b) may have a sequence identity of 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% or more with SEQ ID No. 2.

[0041] In some preferred embodiments, the nucleic acid sequence of the gene encoding the capsid protein is shown as SEQ ID No. 1.

[0042] The present invention also provides a nucleic acid encoding the fusion-type adeno-associated virus AAV-WM01 capsid protein as described above.

[0043] The present invention also provides a construct comprising the aforementioned nucleic acid. The construct can generally be obtained by inserting the aforementioned nucleic acid into a suitable expression vector. A person skilled in the art can select a suitable expression vector.

[0044] The present invention also provides a host cell, which comprises the above construct or the above nucleic acid integrated into the genome, or the host cell comprises the fusion-type adeno-associated virus AAV-WM01 as described in any one of the above items.

[0045] Representative examples of suitable host cells include mammalian cells (such as CHO or COS), plant cells, human cells (human embryonic kidney cells such as HEK293FT), bacterial cells (such as Escherichia coli, Streptomyces, and Salmonella typhimurium), fungal cells (such as yeast), and insect cells (such as Sf9). Those skilled in the art will be able to select a suitable host based on the teachings herein. Preferably, the host cell is an animal cell, and more preferably, a human cell. The host cell can be a cultured cell or a primary cell, i.e., one directly isolated from an organism (such as a human). The host cell can be an adherent cell or a suspended cell, i.e., a cell grown in suspension.

[0046] The present invention also provides a fusion-type adeno-associated virus AAV-WM01, wherein the fusion-type adeno-associated virus contains the fusion-type adeno-associated virus AAV-WM01 capsid protein as described in any one of the above items.

[0047] Furthermore, the fusion adeno-associated virus AAV-WM01 also includes a heterologous nucleotide sequence encoding a target product, and the heterologous nucleotide sequence encoding the target product can be wrapped and carried by various capsid proteins. The above-mentioned heterologous nucleotide sequence encoding the target product can usually be a construct, and the construct can usually contain a nucleic acid encoding the target product. The construct can usually be obtained by inserting the nucleic acid encoding the target product into a suitable expression vector. Those skilled in the art can select a suitable expression vector. For example, the above-mentioned expression vector can include but is not limited to pAAV-CAG, pAAV-TRE, pAAV-EF1a, pAAV-GFAP promoter, pAAV-Lgr5 promoter, pAAV-Sox2 promoter expression vectors, etc. In the present invention, when the fusion adeno-associated virus AAV-WM01 encodes a heterologous nucleotide sequence of a target product, the fusion adeno-associated virus AAV-WM01 contains a capsid, and the viral vector carries a transgene encoding a gene product, and the transgene is regulated by a regulatory sequence that directs its expression in a host cell; in some preferred embodiments, the amino acid sequence of the capsid protein is as shown in SEQ ID NO: 2.

[0048] Furthermore, the target product may be a nucleic acid or a protein, wherein the nucleic acid includes but is not limited to small guide RNA (sgRNA), interfering RNA (RNAi), etc., and the protein encoding gene includes but is not limited to Prestin and Atoh1.

[0049] The fusion adeno-associated virus AAV-WM01 can be used as a vector material to introduce exogenous genes into the cells of the subject. Compared with adeno-associated viruses such as AAV-ie, the fusion adeno-associated virus AAV-WM01 can specifically infect the supporting cells of young individuals and specifically infect the inner hair cells of adult individuals.

[0050] The present invention also provides an engineered host cell transformed with the fusion-type adeno-associated virus described above. The engineered host cell comprises the fusion-type adeno-associated virus described above. The host cell can be a eukaryotic cell and / or a prokaryotic cell.

[0051] Representative examples of suitable host cells include mammalian cells (such as CHO or COS), plant cells, human cells (human embryonic kidney cells such as HEK293FT), bacterial cells (such as Escherichia coli, Streptomyces, and Salmonella typhimurium), fungal cells (such as yeast), and insect cells (such as Sf9). Those skilled in the art will be able to select a suitable host based on the teachings herein. Preferably, the host cell is an animal cell, and more preferably, a human cell. The host cell can be a cultured cell or a primary cell, i.e., one directly isolated from an organism (such as a human). The host cell can be an adherent cell or a suspended cell, i.e., a cell grown in suspension.

[0052] The present invention also provides a fusion-type adeno-associated virus vector system, which comprises a packaging plasmid, and the packaging plasmid comprises the nucleic acid or nucleic acid fragment described above.

[0053] Furthermore, the packaging plasmid further comprises a rep gene segment of an adeno-associated virus, wherein the rep gene segment comprises an intron, and the intron comprises a transcription termination sequence.

[0054] Furthermore, the adeno-associated virus vector system also includes an expression plasmid, which contains a heterologous nucleotide encoding a target product. Furthermore, the target product can be a nucleic acid or a protein, wherein the nucleic acid includes but is not limited to a small guide RNA (sgRNA), an interfering RNA (RNAi), etc., and the protein encoding gene includes but is not limited to Prestin and Atoh1.

[0055] Furthermore, the adeno-associated virus vector system also includes a helper virus plasmid or helper virus.

[0056] Furthermore, the adeno-associated virus vector system also includes a host cell.

[0057] The present invention introduces the packaging plasmid, expression plasmid, and helper virus plasmid into a host cell, where all of the nucleic acid sequences are integrated into the host cell to produce the fusion-type adeno-associated virus. In some embodiments, all of the nucleic acid sequences are integrated together at a single locus within the host cell genome. In some embodiments, the nucleic acid sequences encoding the various genes are present as separate expression cassettes, which prevent any risk of recombination to form a replication-competent virus; the nucleic acid sequences encoding the rep and cap genes are present in the same expression cassette.

[0058] The present invention also provides a fusion-type adeno-associated virus, which is obtained by viral packaging of the fusion-type adeno-associated virus vector system described above.

[0059] The present invention also provides a pharmaceutical composition comprising the fusion-type adeno-associated virus described above and a pharmaceutically acceptable excipient. The fusion-type adeno-associated virus or pharmaceutical composition provided herein can be administered via a suitable route, such as injection into the cochlea, eye, muscle, nervous system, or circulatory system. A person skilled in the art can select an appropriate dosage based on the route of administration.

[0060] The excipients may include various excipients and diluents. These excipients themselves are not essential active ingredients and are not excessively toxic after administration. Suitable excipients should be familiar to those skilled in the art. Acceptable carriers include, for example, sterile water or physiological saline, stabilizers, excipients, antioxidants (such as ascorbic acid), buffers (such as phosphoric acid, citric acid, and other organic acids), preservatives, surfactants (such as PEG and Tween), chelating agents (such as EDTA), and adhesives. Furthermore, the formulation may contain other low molecular weight polypeptides; proteins such as serum albumin, gelatin, or immunoglobulins; amino acids such as glycine, glutamine, asparagine, arginine, and lysine; sugars or carbohydrates such as polysaccharides and monosaccharides; and sugar alcohols such as mannitol and sorbitol. When preparing aqueous solutions for injection, such as physiological saline, isotonic solutions containing glucose or other auxiliary drugs, such as D-sorbitol, D-mannose, D-mannitol, sodium chloride, appropriate solubilizers such as alcohols (ethanol, etc.), polyols (propylene glycol, PEG, etc.), nonionic surfactants (Tween 80, HCO-50), etc. can be used in combination.

[0061] In the pharmaceutical composition provided herein, the fusion-type adeno-associated virus AAV-WM01 may be a single active ingredient, or may be combined with one or more other active ingredients useful for treating hearing loss or ophthalmic diseases to form a combination preparation. The other active ingredients may be various other drugs that can be used to treat hearing loss or ophthalmic diseases. The content of the active ingredient in the composition is generally a safe and effective amount, which should be adjustable by those skilled in the art. For example, the dosage of the fusion adeno-associated virus AAV-WM01 and the active ingredient of the pharmaceutical composition generally depends on the patient's weight, the type of application, the condition and severity of the disease. For example, the dosage of the bifunctional compound as an active ingredient can generally be 1-1000 mg / kg / day, 1-3 mg / kg / day, 3-5 mg / kg / day, 5-10 mg / kg / day, 10-20 mg / kg / day, 20-30 mg / kg / day, 30-40 mg / kg / day, 40-60 mg / kg / day, 60-80 mg / kg / day, 80-100 mg / kg / day, 100-200 mg / kg / day, 200-500 mg / kg / day, or greater than 500 mg / kg / day.

[0062] The present invention also provides a conjugate, which includes the fusion adeno-associated virus AAV-WM01 or the linked biologically active polypeptide as described above.

[0063] The present invention also provides the use of the above-mentioned fusion adeno-associated virus AAV-WM01 capsid protein, nucleic acid, construct, fusion adeno-associated virus AAV-WM01, host cell, fusion adeno-associated virus vector system, pharmaceutical composition or conjugate in the preparation of drugs for preventing and / or treating diseases; preferably, the use in the preparation of drugs for preventing and / or gene therapy of diseases; the diseases include but are not limited to one or more of hearing impairment diseases, ophthalmic diseases, inflammation, tumors, metabolic diseases, pain, neurodegenerative inflammatory diseases, etc.

[0064] The hearing impairment disease is selected from hearing loss, deafness, and tinnitus.

[0065] The ophthalmic diseases include, but are not limited to, dry AMD, wet AMD, or choroidal neovascularization (CNV); for example, they may be selected from age-related macular degeneration (AMD), choroidal neovascularization (CNV), choroidal neovascular membrane (CNVM), cystoid macular edema (CME), epiretinal membrane (ERM), and macular hole; myopia-related choroidal neovascularization, angioid streaks, retinal detachment, diabetic retinopathy, diabetic macular edema (DME), atrophic lesions of the retinal pigment epithelium (RPE), hypertrophic lesions of the retinal pigment epithelium (RPE), retinal vein occlusion, choroidal retinal vein occlusion, macular edema; corneal angiogenesis due to hypoxia, pterygium conjunctiva, subretinal edema, and intraretinal edema; macular edema due to retinal vein occlusion, retinitis pigmentosa, Stargardt's disease, Glaucoma, inflammatory diseases, cataract, refractory abnormal phenomenon, keratoconus, retinopathy of prematurity, angiogenesis of the anterior part of the eye, corneal angiogenesis after keratitis, one or more in corneal transplantation or keratoplasty.In some preferred embodiments, described ophthalmic disease refers to RPE layer related disease, namely can be by virus infection RPE layer, can realize the gene therapy of ophthalmic disease.

[0066] The inflammation is selected from skin inflammation, vascular inflammation, allergic reaction, autoimmune disease, fibrosis, scleroderma or transplant rejection; the autoimmune disease is selected from one or more of rheumatoid arthritis, systemic sclerosis, systemic lupus erythematosus, Sjögren's syndrome-like, polymyositis, etc.

[0067] The cancer is selected from lymphoma, hematologic malignancy or solid tumor; specifically selected from adrenocortical carcinoma, bladder urothelial carcinoma, breast cancer, cervical squamous cell carcinoma, endocervical adenocarcinoma, bile duct cancer, colon adenocarcinoma, lymphoid tumors, diffuse large B-cell lymphoma, esophageal cancer, glioblastoma multiforme, head and neck squamous cell carcinoma, renal chromophobe cell carcinoma, renal clear cell carcinoma, renal papillary cell carcinoma, acute myeloid leukemia, low-grade glioma of the brain, hepatocellular carcinoma, lung adenocarcinoma, lung squamous cell carcinoma, mesothelial cell carcinoma, ovariectomy, ovarian cancer, ovarian cancer, leukemia, hepatocellular carcinoma, pulmonary adenocarcinoma, pulmonary squamous cell carcinoma, mesothelial cell carcinoma, ovarian cancer, esophageal cancer, glioma multiforme, head and neck squamous cell carcinoma, renal chromophobe cell carcinoma, renal clear cell carcinoma, renal papillary cell carcinoma, acute myeloid leukemia, low-grade glioma of the brain, hepatocellular carcinoma, lung adenocarcinoma, lung squamous cell carcinoma, mesothelial cell carcinoma, ovariectomy, ovarian cancer, esophageal ... One or more of ovarian cancer, pancreatic cancer, pheochromocytoma and paraganglioma, prostate cancer, rectal cancer, malignant sarcoma, melanoma, gastric cancer, testicular germ cell tumor, thyroid cancer, thymic cancer, endometrial cancer, uterine sarcoma, uveal melanoma, multiple myeloma, acute lymphoblastic leukemia, chronic lymphoblastic leukemia, chronic myeloid leukemia, T cell lymphoma, B cell lymphoma tumor cells; preferably, the tumor is one or more of colorectal cancer and / or melanocytoma, etc.

[0068] The metabolic disease is selected from diabetes, including type I and type II diabetes and diseases and conditions related to diabetes; the metabolic disease includes but is not limited to one or more of atherosclerosis, cardiovascular disease, nephropathy, neuropathy, retinopathy, β-cell dysfunction, dyslipidemia, hyperglycemia, insulin resistance, chronic obstructive pulmonary disease, etc.

[0069] In some more preferred embodiments, the gene therapy is for the treatment of hearing impairment. The fusion adeno-associated virus or pharmaceutical composition can achieve the treatment of hearing impairment by delivering the target product to the hair cells and / or supporting cells of an individual.

[0070] When the fusion-type adeno-associated virus AAV-WM01, host cell, vector system, pharmaceutical composition, or conjugate of the present invention is used to deliver a product of interest to hair cells and / or supporting cells of an individual, the delivery of the product of interest can be for non-diagnostic or therapeutic purposes, for example, in vitro, to isolated hair cells and / or supporting cells. The hair cells typically include outer hair cells and / or inner hair cells; preferably, the hair cells are inner hair cells of an adult individual.

[0071] Furthermore, the target product is a nucleic acid or a protein, and the nucleic acid can be a small guide RNA (sgRNA), interfering RNA (RNAi), etc.

[0072] In the present invention, the hearing impairment disease may be caused by cochlear damage caused by environmental factors. Therefore, the present invention also provides the use of the above-mentioned fusion-type adeno-associated virus in a drug for treating hearing impairment diseases caused by environmental factors in an individual.

[0073] Furthermore, the hearing impairment disease is a disease related to hair cells and / or supporting cells. In some preferred embodiments, for young individuals, the hearing impairment disease is preferably a disease related to supporting cells. In some preferred embodiments, for adult individuals, the hearing impairment disease is preferably a disease related to inner hair cells. In some preferred embodiments, the hearing impairment disease is prevented or treated by inducing inner hair cell regeneration. In another preferred embodiment, the hearing impairment disease is prevented or treated by overexpressing Wnt2b and Atoh1 to induce inner hair cell regeneration.

[0074] Furthermore, the hearing impairment disease is a disease related to gene defects, environmental damage or aging. For example, it can be a disease caused by gene mutation, etc., or a disease caused by noise or drugs, or a disease caused by aging.

[0075] Furthermore, hearing impairment diseases may be diseases related to cell damage, etc., specifically cochlear hair cell damage, supporting cell damage, etc., more specifically cochlear hair cell damage caused by gene mutation, supporting cell damage caused by gene mutation, etc., cell damage caused by noise, cell damage caused by drugs, or cell damage caused by aging.

[0076] Furthermore, the fusion adeno-associated virus is used as a vector for delivering the target product.

[0077] The present invention also provides a method for treating hearing impairment, comprising administering to a subject in need thereof an effective amount of the fusion-type adeno-associated virus, host cell, vector system, pharmaceutical composition, or conjugate of the present invention. Generally, a physician can determine the actual dosage most suitable for an individual patient, and the dosage will vary depending on the age, weight, and response of the specific individual.

[0078] In the present invention, the fusion-type adeno-associated virus, host cell, vector system, or pharmaceutical composition of the present invention can be administered to a patient. A person skilled in the art can determine the appropriate administration method and dosage.

[0079] The delivery of one or more therapeutic genes via the fusion adeno-associated virus of the present invention can be used alone or in combination with other treatment methods or therapeutic components.

[0080] The fusion-type adeno-associated viruses of the present invention are used to infect cells, thereby delivering genes and / or linked (e.g., but not limited to, covalently linked) biologically active polypeptides to the cells. Thus, the present invention provides a method for delivering a transgene to a cell, wherein the method involves infecting the cell by introducing one or more fusion-type adeno-associated viruses or conjugates of the present invention into the cell, wherein the fusion-type adeno-associated viruses or conjugates comprise one or more transgenes.

[0081] The present invention also provides a method for producing a stable fusion adeno-associated virus vector production cell line, comprising: (a) introducing a fusion adeno-associated viral vector as defined herein into a culture of mammalian host cells; and (b) selecting within the culture mammalian host cells that have the nucleic acid sequence encoded on the vector integrated into an endogenous chromosome of the mammalian host cell.

[0082] The AAV vector production cell is a mammalian cell. In some embodiments, the mammalian cell is selected from HEK293 cells, CHO cells, Jurkat cells, K562 cells, PerC6 cells, HeLa cells or derivatives thereof. In some embodiments, the mammalian host cell is a HEK293 cell, or is derived from a HEK293 cell. In some embodiments, the HEK293 cell is a HEK293T cell.

[0083] The genomic sequences of various serotypes of AAV, as well as the sequences of native ITRs, Rep proteins, and capsid proteins, are known in the art. Such sequences can be found in the literature or in public databases such as GenBank. The disclosures thereof are incorporated herein by reference for AAV nucleic acid and amino acid sequences.

[0084] In the compounds of the present invention and their uses, when the fusion-type adeno-associated virus is used in combination with other therapeutic agents, the active compound is co-administered with the other therapeutic agent. "Co-administered" means administered simultaneously in the same formulation or in two different formulations via the same or different routes, or administered sequentially via the same or different routes. "Sequential" administration means that there is a time difference of seconds, minutes, hours, or days between the administration of two or more different compounds.

[0085] In certain embodiments, the fusion-type adeno-associated viruses and methods of the present invention can be used to prevent hearing loss and can be administered as a preventive treatment before hearing loss or after a period of time after exposure to an environment that is susceptible to hearing loss.

[0086] Unless otherwise defined, all technical and scientific terms used herein have the same meanings as commonly understood by one skilled in the art.

[0087] The term "vector" refers to a macromolecule or a combination of macromolecules that contains or is associated with a polypeptide and can be used to mediate the delivery of the polypeptide to a cell. Illustrative vectors include, for example, plasmids, viral vectors, liposomes or other gene delivery vectors.

[0088] The term "AAV" is an abbreviation for adeno-associated virus and may be used to refer to the virus itself or its derivatives.

[0089] The term "recombinant AAV vector" refers to an AAV vector containing a heterologous polynucleotide sequence, typically a sequence of interest for genetic transformation of cells. Generally, the heterologous polynucleotide is flanked by at least one, and typically two, AAV inverted terminal repeats (ITRs).

[0090] The term "AAV virus" or "AAV viral particle" or "AAV vector particle" refers to a viral particle of an AAV vector comprising at least one AAV capsid protein and an encapsidated polynucleotide.

[0091] The term "packaging" refers to the series of intracellular processes that result in the assembly and encapsulation of AAV particles.

[0092] The terms AAV "rep" and "cap" genes refer to polynucleotide sequences encoding the replication and packaging proteins of adeno-associated virus. As used herein, AAV rep and cap refer to AAV "packaging genes."

[0093] The term "helper virus" of AAV refers to a virus that enables AAV to be replicated and packaged by mammalian cells. Various such AAV helper viruses are known in the art, including adenovirus, herpes virus, and pox virus (eg, vaccinia).

[0094] The term "infectious" virus or virus particle is one that contains a polynucleotide component capable of delivering the virus to cells tropistic for that virus species. The term does not necessarily imply that the virus has any replication capability.

[0095] The term "producer cell" refers to a cell line that has the AAV packaging genes (rep and cap genes), required helper viral genes, and the DNA genome of the recombinant AAV vector (e.g., the transgene of interest flanked by two AAV inverted terminal repeats (ITRs)) stably integrated into the host cell genome.

[0096] The terms "include", "comprising", etc. should be understood as having an inclusive meaning rather than an exclusive or exhaustive meaning; that is, the meaning is "including but not limited to".

[0097] The term "subject" generally includes humans, non-human primates, such as mammals, dogs, cats, horses, sheep, pigs, cows, etc., who can benefit from treatment using the formulation, kit or combination formulation.

[0098] The term "therapeutically effective amount" generally refers to an amount that can achieve the effect of treating the diseases listed above after an appropriate administration period.

[0099] The terms "therapeutic" and "prophylactic" should be understood in their broadest sense. The term "therapeutic" does not necessarily imply that a mammal undergoes treatment until full recovery. Similarly, "prophylactic" does not necessarily mean that a subject will not ultimately contract a disease condition. Thus, treatment and prophylaxis include alleviating the symptoms of a particular condition or preventing or reducing the risk of a particular condition developing. The term "prophylaxis" can be understood to mean reducing the severity of an episode of a particular condition. Treatment can also include reducing the severity of an existing condition or the frequency of acute episodes.

[0100] In the present invention, the subject or individual undergoing therapeutic or preventive treatment is preferably a mammal, such as, but not limited to, a human, a primate, livestock (e.g., sheep, cattle, horses, donkeys, pigs), a pet (e.g., dogs, cats), a laboratory animal (e.g., mice, rabbits, rats, guinea pigs, hamsters), or a captive wild animal (e.g., foxes, deer). The subject is preferably a primate. Most preferably, the subject is a human.

[0101] Before further describing the specific embodiments of the present invention, it should be understood that the scope of protection of the present invention is not limited to the specific specific embodiments described below; it should also be understood that the terms used in the examples of the present invention are for describing specific specific embodiments rather than for limiting the scope of protection of the present invention; in the present specification and claims, unless otherwise expressly stated herein, the singular forms "a", "an" and "the" include plural forms.

[0102] When the embodiments provide numerical ranges, it should be understood that, unless otherwise specified in the present invention, both endpoints of each numerical range and any numerical value between the two endpoints may be selected. Unless otherwise defined, all technical and scientific terms used in the present invention have the same meaning as those generally understood by those skilled in the art. In addition to the specific methods, equipment, and materials used in the embodiments, according to the understanding of the prior art by those skilled in the art and the description of the present invention, any methods, equipment, and materials of the prior art similar or equivalent to the methods, equipment, and materials described in the embodiments of the present invention may also be used to implement the present invention.

[0103] Unless otherwise indicated, the experimental methods, detection methods, and preparation methods disclosed herein all employ conventional techniques in molecular biology, biochemistry, chromatin structure and analysis, analytical chemistry, cell culture, recombinant DNA technology, and related fields, which are well described in the existing literature.

[0104] Example 1. Acquisition of a novel adeno-associated virus AAV-WM01 a. Construction of DNA family shuffling library Capsid sequences from 13 AAV serotypes (AAV1-13) found in humans and non-human primates were used as parental sequences for DNA family shuffling. A total of 4 μg of parental capsid sequences was mixed in an equimolar ratio for DNA family shuffling. The intact parental capsid sequences were randomly fragmented into fragments of varying lengths by treatment with 0.04 U of DNase I at 25°C for 30 seconds. DNA fragments sized 100-500 bp were recovered and purified, and 500 ng was used for primer-free PCR to extend the complete chimeric capsid sequences. After sufficient chimeric capsid sequences were amplified, the chimeric capsid sequences were recombined into a library vector containing the AAV2 Rep gene and terminal repeats. The recombinant product was electroporated into competent cells, and a portion of the bacterial culture was plated. Colonies grown on the plates were counted and identified by sequencing to determine diversity. The remaining bacterial culture was inoculated into 500 mL of culture medium and cultured overnight at 37°C. The plasmid isolated the following day constituted the DNA family shuffling library plasmid. In vivo screening process of DNA family shuffling library Figure 1 shown.

[0105] b. Packaging of DNA Family Shuffling Library Viruses The resulting DNA family shuffling library plasmid and the adenoviral helper plasmid pHelper were co-transfected into HEK-293T cells at appropriate amounts. The pHelper plasmid (the complete plasmid sequence is the same as that shown in SEQ ID NO. 12 of AAV-IE patent document CN110437317A) was transfected with only 20 ng of the DNA family shuffling library plasmid per 15 cm dish of cells.

[0106] 72 hours after transfection, the culture medium was collected, and 48 hours later, the cells and culture medium were collected. AAV was released by lysing the cells with 110 mM citrate buffer (pH 4.2). After centrifugation, the virus-containing supernatant was neutralized with one-fifth volume of 2M HEPES, and then polyethylene glycol 8000 and 500 mM sodium chloride were added to a final concentration of 8%. The virus was precipitated overnight at 4°C. After centrifugation, the pellet was resuspended in PBS containing 2 mM Mg2+ and benzonase was added to a final concentration of 100 U / mL for nucleic acid digestion at 37°C for at least 1 hour. The virus suspension was purified by ultracentrifugation using iodixanol density gradients (15%, 25%, 40%, and 60%). Viral titer was then determined by qPCR using primers specific for the AAV2 Rep gene (WPRE-F: GTCAGGCAACGTGGCGTGGTGTG (SEQ ID NO. 8); WPRE-R: GGCGATGAGTTCCGCCGTGGC (SEQ ID NO. 9)).

[0107] c. In vivo screening By injecting into the mouse cochlea in vivo, new adeno-associated viruses that can efficiently infect cochlear cells were screened.

[0108] Approximately 1E+10~11vg of library virus is injected into the cochlea of ​​mice 2-3 days old through the round window. 7-10 days after the injection, the mice are euthanized and the cochlea is collected. At this time, the AAV in the library virus that can infect cochlear cells enters the cells, while the AAV that fails to infect cells is cleared by the immune system and circulatory system. Therefore, the present invention can recover the capsid gene of AAV that infects cells from the total DNA of tissue cells. The total tissue DNA is extracted with Trizol, and the capsid gene of AAV is recovered from the total DNA using PCR to complete an in vivo screening of the AAV library. The fragment obtained by PCR is cloned into the library vector to obtain the next round of library plasmid, which is then packaged into virus again. The in vivo screening process can be repeated. After 3-5 rounds of screening, the capsid gene of the recovered AAV is subjected to third-generation sequencing. In this way, information on the capsid genes of some AAV mutants enriched in cochlear cells is obtained, among which some mutant AAVs with high abundance can theoretically efficiently transduce cochlear cells. Among them, the AAV-WM01 obtained as shown in SEQ ID NO.1 is one of the high-abundance mutants.

[0109] Sequencing results showed that AAV-WM01 is a chimera of AAV1, 2, 6, and 7 and contains an S430I mutation. By aligning the amino acid sequences of its parental serotypes, residues in its VP3 region were used to generate a 3D homology model of the AAV-WM01 capsid. Both the inner surface (B) and outer surface (C) of the capsid showed the presence of fragments from the four parental AAV capsids, indicating that the three-fold symmetry axis protrusion of AAV-WM01 is composed of AAV1 and AAV6, AAV2, 6, and 7 assemble into a five-fold symmetry axis channel, and AAV6 forms a depression at the two-fold symmetry axis ( Figure 2 The sequence of the coding gene of AAV-WM01 is shown in SEQ ID No. 1, and the amino acid sequence is shown in SEQ ID No. 2. The computer-simulated structure of AAV-WM01 is shown in Figure 2 shown.

[0110] SEQ ID No.1 SEQ ID No.2 Met Ala Ala Asp Gly Tyr Leu Pro Asp Trp Leu Glu Asp Asn Leu Ser GluGly Ile Arg Glu Trp Trp Asp Leu Lys Pro Gly Ala Pro Lys Pro Lys Ala Asn GlnGln Lys Gln Asp Asp Gly Arg Gly Leu Val Leu Pro Gly Tyr Lys Tyr Leu Gly ProPhe Asn Gly Leu Asp Lys Gly Glu Pro Val Asn Ala Ala Asp Ala Ala Ala Leu GluHis Asp Lys Ala Tyr Asp Gln Gln Leu Lys Ala Gly Asp Asn Pro Tyr Leu Arg TyrAsn His Ala Asp Ala Glu Phe Gln Glu Arg Leu Gln Glu Asp Thr Ser Phe Gly GlyAsn Leu Gly Arg Ala Val Phe Gln Ala Lys Lys Arg Val Leu Glu Pro Leu Gly LeuVal Glu Glu Gly Ala Lys Thr Ala Pro Gly Lys Lys Arg Pro Val Glu Gln Ser ProGln Glu Pro Asp Ser Ser Ser Gly Ile Gly Lys Thr Gly Gln Gln Pro Ala Lys LysArg Leu Asn Phe Gly Gln Thr Gly Asp Ser Glu Ser Val Pro Asp Pro Gln Pro LeuGly Glu Pro Pro Ala Thr Pro Ala Ala Val Gly Pro Thr Thr Met Ala Ser Gly GlyGly Ala Pro Met Ala Asp Asn Asn Glu Gly Ala Asp Gly Val Gly Asn Ala Ser GlyAsn Trp His Cys Asp Ser Thr Trp Leu Gly Asp Arg Val Ile Thr Thr Ser Thr ArgThr Trp Ala Leu Pro Thr Tyr AsnAsn His Leu Tyr Lys Gln Ile Ser Ser Glu ThrAla Gly Ser Thr Asn Asp Asn Thr Tyr Phe Gly Tyr Ser Thr Pro Trp Gly Tyr PheAsp Phe Asn Arg Phe His Cys His Phe Ser Pro Arg Asp Trp Gln Arg Leu Ile AsnAsn Asn Trp Gly Phe Arg Pro Lys Lys Leu Arg Phe Lys Leu Phe Asn Ile Gln ValLys Glu Val Thr Gln Asn Asp Gly Thr Thr Thr Ile Ala Asn Asn Leu Thr Ser ThrVal Gln Val Phe Thr Asp Ser Glu Tyr Gln Leu Pro Tyr Val Leu Gly Ser Ala HisGln Gly Cys Leu Pro Pro Phe Pro Ala Asp Val Phe Met Val Pro Gln Tyr Gly TyrLeu Thr Leu Asn Asn Gly Ser Gln Ala Val Gly Arg Ser Ser Phe Tyr Cys Leu GluTyr Phe Pro Ser Gln Met Leu Arg Thr Gly Asn Asn Phe Thr Phe Ser Tyr Thr PheGlu Glu Val Pro Phe His Ser Ser Tyr Ala His Ser Gln Ile Leu Asp Arg Leu MetAsn Pro Leu Ile Asp Gln Tyr Leu Tyr Tyr Leu Asn Arg Thr Gln Asn Gln Ser GlySer Ala Gln Asn Lys Asp Leu Leu Phe Ser Arg Gly Ser Pro Ala Gly Met Ser ValGln Pro Lys Asn Trp Leu Pro Gly Pro Cys Tyr Arg Gln Gln Arg Val Ser Lys ThrLys Thr Asp Asn Asn Asn Ser Asn Phe Thr Trp Thr Gly AlaSer Lys Tyr Asn LeuAsn Gly Arg Glu Ser Ile Ile Asn Pro Gly Thr Ala Met Ala Ser His Lys Asp AspGlu Asp Lys Phe Phe Pro Met Ser Gly Val Met Ile Phe Gly Lys Glu Ser Ala GlyAla Ser Asn Thr Ala Leu Asp Asn Val Met Ile Thr Asp Glu Glu Glu Ile Lys AlaThr Asn Pro Val Ala Thr Glu Arg Phe Gly Thr Val Ala Val Asn Leu Gln Ser SerSer Thr Asp Pro Ala Thr Gly Asp Val His Val Met Gly Ala Leu Pro Gly Met ValTrp Gln Asp Arg Asp Val Tyr Leu Gln Gly Pro Ile Trp Ala Lys Ile Pro His ThrAsp Gly His Phe His Pro Ser Pro Leu Met Gly Gly Phe Gly Leu Lys His Pro ProPro Gln Ile Leu Ile Lys Asn Thr Pro Val Pro Ala Asn Pro Pro Ala Glu Phe SerAla Thr Lys Phe Ala Ser Phe Ile Thr Gln Tyr Ser Thr Gly Gln Val Ser Val GluIle Glu Trp Glu Leu Gln Lys Glu Asn Ser Lys Arg Trp Asn Pro Glu Val Gln TyrThr Ser Asn Tyr Ala Lys Ser Ala Asn Val Asp Phe Thr Val Asp Asn Asn Gly LeuTyr Glu Pro Arg Pro Ile Gly Thr Arg Tyr Leu Thr Arg Pro Leu* Example 2 In vivo verification of the novel adeno-associated virus AAV-WM01-CMV-EGFP in the auditory system 2.1 Construction of AAV-WM01-CMV-EGFP The AAV-WM01 coding gene sequence obtained from the above sequencing results was synthesized by Suzhou Jinweizhi Biotechnology Co., Ltd. to obtain the AAV-WM01 Rep-Cap plasmid, namely pAAV-WM01. The obtained AAV-WM01 Rep-Cap plasmid pAAV-WM01, a genomic plasmid expressing green fluorescent protein (EGFP) pAAV-CMV-EGFP, and pHelper plasmid were co-transfected into HEK-293T cells in appropriate amounts. The AAV virus was purified by iodide dialkanol gradient ultracentrifugation. The virus titer was measured to be an appropriate concentration of 1E+12-1E+13 GC / mL and stored at -80°C until use.

[0111] 2.2 Infectious characteristics of adeno-associated virus (AAV)-WM01-CMV-EGFP in neonatal mice The same titer of AAV-ie and AAV-WM01-CMV-EGFP was injected into the cochlea of ​​C57BL / 6J mice 2-3 days after birth through the round window. After the virus was fully infected and expressed EGFP after 10-14 days, the mice were killed by cervical vertebrae removal, and the cochlea of ​​the injected ear was removed and placed in 4% paraformaldehyde and fixed at room temperature for 2 hours. Washed three times with PBS for 5 minutes each time. Then decalcified with 0.5 mM EDTA and soaked at room temperature for 2 hours to soften the cochlea. The basement membrane was dissected with an ophthalmic scalpel under a stereomicroscope. The hair cells were labeled with anti-Myo7a antibodies by immunofluorescence staining to make cochlear samples. It was imaged by laser confocal scanning microscopy, and the virus-infected cells expressed green fluorescent protein in their cell nuclei. The excitation light wavelengths were 488nm and 647nm, respectively. The results of the in vivo detection are as follows. Figure 3 a, as shown in 3b. Figure 3 a is a cochlear flat mount at the hair cell level after injection of AAV-ie and AAV-WM01-CMV-EGFP viruses; Figure 3 b is a cochlear flattening image of the supporting cell layer of the cochlea injected with AAV-ie and AAV-WM01-CMV-EGFP viruses; the purple color shows Myo7a, a marker protein of hair cells, and the green color shows the fluorescent protein expressed by virus-infected cells. Figure 3 c shows the statistical data of AAV-ie and AAV-WM01-CMV-EGFP viruses targeting hair cells and Dieters cells (a type of supporting cell). The results show that AAV-WM01-CMV-EGFP specifically infects supporting cells in the cochlea of ​​young mice, but not hair cells. Dieters cells are considered the supporting cells with the greatest regenerative potential, so AAV-WM01 has great potential for gene therapy in supporting cells and hair cell regeneration.

[0112] 2.3 Safety of AAV-WM01-CMV-EGFP in neonatal mice AAV-WM01-CMV-EGFP was injected into the cochlea of ​​C57BL / 6J mice 2-3 days after birth through the round window. After the virus was fully expressed for 10-14 days, the mice were killed by cervical vertebrae removal, and the cochlea of ​​the injected ear was removed. At the same time, the cochlea of ​​C57BL / 6J mice of the same age was taken as a control. The cochlea was placed in 4% paraformaldehyde and fixed at room temperature for 2 hours. Washed three times with PBS, 5 minutes each time. Then decalcified with 0.5 mM EDTA and soaked at room temperature for 2 hours to soften the cochlea. The basement membrane was dissected with an ophthalmic scalpel under a stereomicroscope. The hair cells were labeled with anti-Myo7a antibodies by immunofluorescence staining to make a cochlear sample. It was imaged by laser confocal scanning microscopy. The virus-infected cells expressed green fluorescent protein in their nuclei. The results of the in vivo detection are as follows. Figure 4 Statistical results showed that the number and morphology of cochlear cells in mice injected with AAV-WM01 virus were consistent with those in normal mice, indicating that AAV-WM01 virus was not toxic to newborn mice.

[0113] 2.4 Infectious properties of adeno-associated virus (AAV)-WM01-CMV-EGFP in adult mice AAV-ie and AAV-WM01-CMV-EGFP were injected into the cochlea of ​​30-day-old C57BL / 6J mice through the posterior semicircular canal. After 10-14 days of full infection and expression of EGFP by the virus, the mice were killed by cervical vertebrae removal, and the cochlea of ​​the injected ear was removed and placed in 4% paraformaldehyde and fixed at room temperature for 2 hours. Washed three times with PBS for 5 minutes each time. Then decalcified with 0.5 mM EDTA and soaked overnight at room temperature to soften the cochlea. The basement membrane was dissected with an ophthalmic scalpel under a stereomicroscope. By immunofluorescence staining, anti-Myo7a antibodies were used to label hair cells and prepare cochlear samples. It was imaged by laser confocal scanning microscopy, and the virus-infected cells expressed green fluorescent protein in their cell nuclei. The excitation light wavelengths were 488nm and 647nm, respectively. The results of the in vivo detection are as follows. Figure 5 As shown in a. This figure is a cochlear plan view of the cochlea injected with AAV-ie and AAV-WM01-CMV-EGFP viruses. Purple shows a hair cell marker protein Myo7a, and green shows the fluorescent protein expressed by virus-infected cells. The results show that AAV-WM01 specifically infects inner hair cells in the cochlea of ​​adult mice, but has no infection characteristics for outer hair cells. Statistical results show that the infection rate of AAV-WM01 on outer hair cells of adult mice is 0.33%±0.333, and the infection rate of AAV-ie on outer hair cells of adult mice is 56.33%±1.202. Figure 5 As shown in b; the infection rate of AAV-WM01 on the inner hair cells of adult mice is 98.67%±0.667, and the infection rate of AAV-ie on the inner hair cells of adult mice is 100%±0. Figure 5 c. AAV-WM01 is highly efficient and specific for infecting inner hair cells in the cochlea of ​​adult mice and can be used for gene therapy of inner hair cells.

[0114] 2.5 Safety of AAV-WM01-CMV-EGFP in Adult Mice AAV-WM01-CMV-EGFP was injected into the cochlea of ​​30-day-old C57BL / 6J mice through the round window. After the virus was fully expressed for 10-14 days, the mice were killed by cervical vertebrae removal, and the cochlea of ​​the injected ear was removed. At the same time, the cochlea of ​​C57BL / 6J mice of the same age was taken as a control. The cochlea was placed in 4% paraformaldehyde and fixed at room temperature for 2 hours. Washed three times with PBS, 5 minutes each time. Then decalcified with 0.5 mM EDTA and soaked at room temperature for 2 hours to soften the cochlea. The basement membrane was dissected with an ophthalmic scalpel under a stereomicroscope. The hair cells were labeled with anti-Myo7a antibodies by immunofluorescence staining to make a cochlear sample. It was imaged by laser confocal scanning microscopy. The virus-infected cells expressed green fluorescent protein in their nuclei. The results of the in vivo detection are as follows Figure 6 Statistical results showed that the number and morphology of cochlear cells in mice injected with AAV-WM01 virus were consistent with those in normal mice, indicating that AAV-WM01 virus is not toxic to adult mice.

[0115] Example 3 In vivo verification of adeno-associated virus AAV-WM01-CMV-EGFP in the visual system Place an anesthetized adult mouse under a microscope and apply 1-2 drops of tropicamide eye drops to the eyeball to dilate the pupil. Hold the eyeball with a pair of elbow forceps in your left hand, lift it from the optic disc and fix it. Hold a 1ml syringe or glass needle in your right hand to puncture the cornea to reduce intraocular pressure. Gently wipe away the fluid around the eye with a tissue. Hold the eyeball with a pair of forceps in your left hand and hold a glass needle with 2μl of virus in your right hand. Insert the needle at a 50° angle between the posterior edge of the cornea and the plane of the iris. Slowly inject the adeno-associated virus AAV-WM01-CMV-EGFP constructed in 2.1 of Example 2, with a titer of 1.5E13 gc / ml. After the injection, leave the glass needle for 30 seconds before slowly withdrawing it. After applying erythromycin ointment to the wound, place the mouse in a cage in a 41°C water bath to keep it warm. After the mouse wakes up, move it to the mouse room for breeding. After 10 days, remove the eye cup. Sacrifice the mouse by spinal dislocation. After removing the eyeball, puncture the cornea with a 1ml syringe to release the aqueous humor. The eyeball was placed in a small culture dish filled with PBS solution and dissected under a microscope. The cornea was clamped with pointed forceps, and ophthalmic scissors were inserted into the wound of the cornea to cut the cornea circumferentially. The lens was removed with forceps, and the optic nerve was retained about 2mm. The eye cup was fixed in 4% PFA for 12 hours at 4°C. The fixed eye cup was dehydrated in 30% sucrose for 12 hours at 4°C. After frozen sectioning, sections with better results and intact tissue were selected for staining under a fluorescence microscope. Immunofluorescence results showed that AAV-WM01 can infect the RPE layer. The results of in vivo detection are as follows. Figure 7 This image shows a retinal section injected with AAV-WM01-CMV-EGFP. Green represents the fluorescent protein expressed by the virus, while blue represents the cell nucleus. These results demonstrate that AAV-WM01-CMV-EGFP has a high level of infection in the retinal RPE layer, suggesting its potential for ophthalmic gene therapy.

[0116] In summary, the fusion adeno-associated virus AAV-WM01 of the present invention and its use in the prevention and / or treatment of ear diseases or eye diseases effectively overcome the various shortcomings of the existing technology and have high industrial utilization value.

[0117] The above examples are intended to illustrate the embodiments disclosed herein and are not to be construed as limiting the present invention. In addition, the various modifications listed herein and variations of the methods and compositions in the invention will be apparent to those skilled in the art without departing from the scope and spirit of the present invention. Although the present invention has been specifically described in conjunction with various specific preferred embodiments of the present invention, it should be understood that the present invention should not be limited to these specific embodiments. In fact, various modifications apparent to those skilled in the art as described above to obtain the invention should be included within the scope of the present invention.

Claims

1. A fusion-type adeno-associated virus AAV-WM01 capsid protein, characterized in that: The capsid protein comprises a fusion peptide segment of peptide segments of serotypes AAV1, 2, 6 and 7 or variants thereof.

2. The fusion-type adeno-associated virus AAV-WM01 capsid protein according to claim 1, characterized in that The fusion peptide segment comprises a first peptide segment, a second peptide segment, a third peptide segment, a fourth peptide segment and a fifth peptide segment connected in sequence; the first peptide segment comprises a peptide segment from AAV1, the second peptide segment comprises a peptide segment from AAV7, the third peptide segment comprises a peptide segment from AAV2, the fourth peptide segment comes from a peptide segment containing AAV1, and the fifth peptide segment comes from a peptide segment containing AAV6.

3. The fusion-type adeno-associated virus AAV-WM01 capsid protein according to claim 1, characterized in that The first peptide segment comprises the amino acid fragment shown in SEQ ID No. 3, the second peptide segment comprises the amino acid fragment shown in SEQ ID No. 4, the third peptide segment comprises the amino acid fragment shown in SEQ ID No. 5, the fourth peptide segment comprises the amino acid fragment shown in SEQ ID No. 6, and the fifth peptide segment comprises the amino acid fragment shown in SEQ ID No.

7.

4. The fusion-type adeno-associated virus AAV-WM01 capsid protein according to claim 1, characterized in that Include at least one of the following: 1) The peptide segments of the serotypes AAV1 and AAV6 are assembled into the three-fold symmetric axis protrusions of the capsid protein; 2) The peptide segments of serotypes AAV2, 6, and 7 are assembled into a channel of the five-fold symmetry axis of the capsid protein; 3) The peptide segment of the serotype AAV6 forms a depression at the two-fold symmetry axis of the capsid protein.

5. The fusion-type adeno-associated virus AAV-WM01 capsid protein according to claim 1, characterized in that The capsid protein comprises: a) the amino acid sequence shown in SEQ ID No. 2; b) a polypeptide fragment having a sequence identity of more than 90% with SEQ ID No. 2 and having the function of the amino acid sequence defined in a).

6. A nucleic acid, characterized in that The nucleic acid encodes the fusion adeno-associated virus AAV-WM01 capsid protein according to any one of claims 1 to 5.

7. A construct comprising the nucleic acid according to claim 6.

8. A host cell, characterized in that The host cell comprises the construct according to claim 7 or the exogenous nucleic acid according to claim 6 integrated into the genome, or the host cell comprises the fusion-type adeno-associated virus AAV-WM01 according to any one of claims 1 to 5.

9. A fusion-type adeno-associated virus AAV-WM01, characterized in that: The capsid structure of the fusion adeno-associated virus AAV-WM01 contains the fusion adeno-associated virus AAV-WM01 capsid protein according to any one of claims 1 to 5.

10. The fusion-type adeno-associated virus AAV-WM01 according to claim 9, characterized in that The fusion adeno-associated virus further includes a heterologous nucleotide sequence encoding a target product; preferably, the target product is a nucleic acid or a protein; further, the nucleic acid includes but is not limited to a small guide RNA and an interfering RNA.

11. A host cell transformed with the fusion-type adeno-associated virus AAV-WM01 according to claim 9 or 10.

12. A fusion adeno-associated virus vector system, characterized in that: The method comprises a packaging plasmid, wherein the packaging plasmid comprises the nucleic acid according to claim 6.

13. The fusion adeno-associated virus vector system according to claim 12, wherein: The packaging plasmid also contains the rep gene segment of adeno-associated virus.

14. The fusion adeno-associated virus vector system according to claim 12, characterized in that: The adeno-associated virus vector system further includes an expression plasmid, which contains heterologous nucleotides responsible for encoding a target product; preferably, the target product is a nucleic acid or a protein; further, the nucleic acid includes but is not limited to a small guide RNA and an interfering RNA.

15. The fusion adeno-associated virus vector system according to any one of claims 12 to 14, characterized in that: The adeno-associated virus vector system further includes a helper virus plasmid or a helper virus, and the adeno-associated virus vector system further includes a host cell.

16. A fusion adeno-associated virus AAV-WM01, obtained by viral packaging of the fusion adeno-associated virus vector system according to any one of claims 12 to 15.

17. A pharmaceutical composition or conjugate, characterized in that: The pharmaceutical composition comprises the fusion adeno-associated virus AAV-WM01 as described in any one of claims 9, 10 or 16 and a pharmaceutically acceptable excipient; the conjugate comprises the fusion adeno-associated virus AAV-WM01 as described in any one of claims 9, 10 or 16 and a biologically active polypeptide connected thereto.

18. Use of the fusion adeno-associated virus AAV-WM01 capsid protein according to any one of claims 1 to 5, or the nucleic acid according to claim 6, or the construct according to claim 6, the fusion adeno-associated virus AAV-WM01 according to claim 9, 10 or 16, or the host cell according to claim 8 or 11, the fusion adeno-associated virus vector system according to any one of claims 12 to 15, or the pharmaceutical composition or conjugate according to claim 17 in the preparation of a medicament for treating a disease.

19. The use according to claim 18, characterized in that Include at least one of the following: 1) The disease is one or more selected from the group consisting of hearing impairment, ophthalmic diseases, inflammation, tumors, metabolic diseases, pain, and neurodegenerative inflammatory diseases; 2) The drug is used to prevent and / or treat a disease; 3) The drug is used for gene therapy of diseases.

20. The use according to claim 19, characterized in that Include at least one of the following: 1) The hearing impairment disease refers to a hearing impairment disease related to cochlear supporting cells in young individuals; 2) The hearing impairment disease refers to a hearing impairment disease related to the inner hair cells of the cochlea in adult individuals; 3) The drug is used to induce inner hair cell regeneration; 4) The ophthalmic disease is a disease related to the RPE layer; 5) The hearing impairment is caused by cochlear damage; 6) The hearing impairment disease is a disease related to cell damage; 7) The hearing impairment disease is a related disease caused by a gene defect; 8) The hearing impairment disease is a related disease caused by environmental factors; the environmental factors are selected from noise or ototoxic drugs; 9) The hearing impairment disease is a related disease caused by aging.

Images