A methyltransferase cicomt10 mutant, preparation method, biomaterial and application

By mutating amino acid positions 164 and 238 of the CicOMT10 enzyme, mutants N179A and T316A were constructed, which solved the problem of low catalytic efficiency of methyltransferase and achieved the effect of highly efficient catalysis of sennaol to hesperidin.

CN120591230BActive Publication Date: 2025-11-25FOSHAN GOLDEN HEALTH TECH CO LTD +1
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202510907125.0
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-07-02
Publication Date
2025-11-25
Estimated Expiration
2045-07-02

AI Technical Summary

Technical Problem

Existing methyltransferases have limited catalytic efficiency, making it difficult to meet the needs of industrial production.

Method used

By gene editing, mutations were made at amino acid positions 164 and 238 of the CicOMT10 enzyme to construct mutants N179A and T316A, which enhanced the enzyme's hydrophobicity and catalytic efficiency.

Benefits of technology

The mutant significantly improved the catalytic efficiency of methyltransferase, enabling it to efficiently catalyze the conversion of sennaol to hesperidin.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120591230B_ABST
    Figure CN120591230B_ABST
Patent Text Reader

Abstract

The present application relates to a kind of methyltransferase CicOMT10 mutant, preparation method, biological material and application.The methyltransferase mutant is mutated with the amino acid sequence such as SEQ ID NO:1 CicOMT10 enzyme, and the mutation includes: the asparagine of 179th is mutated to alanine;And / or, the threonine of 316th is mutated to alanine.The methyltransferase mutant of the present application can efficiently convert eriodictyol into hesperetin.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the technical field of mutation or genetic engineering, specifically to a methyltransferase CicOMT10 mutant, its preparation method, biomaterial, and applications. Background Technology

[0002] Methylation modifications in natural products come in various types, and methylation can significantly improve the water solubility, stability, and bioactivity of natural products. It is also a key step in the formation of many important natural products and is an important source of medicinal natural products.

[0003] Hesperetin is a natural flavonoid compound mainly derived from the peel and young fruit of citrus plants (such as sweet oranges and lemons) in the Rutaceae family. It can be produced through the hydrolysis of hesperidin. Its biological activities are extensive, including: antioxidant (scavenging superoxide nitrite ions), anti-inflammatory (inhibiting inflammatory mediators such as TNF-α and IL-6, with stronger effects than hesperidin), lipid-lowering (inhibiting cholesterol-producing enzymes), cardiovascular protection (reducing vascular permeability and preventing thrombosis), and anti-tumor (inhibiting gene mutations). In the pharmaceutical field, it is used in stomachic, expectorant drugs, and as an adjunct to anti-tumor treatment; in the food industry, it is added to beverages as a natural antioxidant (such as the American health supplement "Vitality 50"); and in cosmetics (such as Clarins night cream), its antioxidant properties are used to delay aging. Industrial production mostly uses an aqueous phase method, extracting hesperidin through high-temperature hydrolysis. In recent years, microbial synthesis technology has improved efficiency. Research focuses on functional development (such as chronic disease prevention and treatment) and formulation optimization (microencapsulation to improve absorption), promoting its innovative applications in functional foods and pharmaceuticals. Biological catalytic methylation modification is mainly carried out by methyltransferase catalysis; however, the catalytic efficiency of methyltransferase is limited, resulting in low production efficiency. Summary of the Invention

[0004] The purpose of this invention is to overcome the shortcomings of the prior art and provide a methyltransferase CicOMT10 mutant, its preparation method, biomaterial, and application.

[0005] To achieve the above objectives, the technical solution adopted by the present invention is as follows:

[0006] In a first aspect, the present invention provides a CicOMT10 mutant methyltransferase, wherein the CicOMT10 mutant is mutant N179A or mutant T316A; mutant N179A is obtained by mutating asparagine at position 179 of the CicOMT10 enzyme as shown in SEQ ID NO. 1 to alanine, and mutant T316A is obtained by mutating threonine at position 316 of the CicOMT10 enzyme as shown in SEQ ID NO. 1 to alanine.

[0007] Natural methyltransferases exhibit insufficient activity, and their reaction environments often fail to meet the optimal conditions for natural enzymes. With the increasing maturity of molecular biology, genetic engineering, and other related technologies, editing and modifying protein sequences can enhance the understanding of enzyme catalytic mechanisms and guide enzyme design. Therefore, this invention utilizes bioinformatics techniques such as protein-substrate molecular docking and mutational free energy prediction to construct a mutant library of methyltransferases, providing a high-activity methyltransferase mutant to address the problem of insufficient methyltransferase activity.

[0008] This invention selects amino acids at positions 164 and 238 of the CitOMT enzyme active pocket and mutates them to alanine, which has a strong hydrophobic side chain and weak steric hindrance, thereby significantly improving the catalytic efficiency of methyltransferase.

[0009] Preferably, the amino acid sequence of the mutant N179A is shown in SEQ ID NO:3.

[0010] Preferably, the amino acid sequence of the mutant T316A is shown in SEQ ID NO:5.

[0011] In a second aspect, the present invention provides a biomaterial for the methyltransferase CicOMT10 mutant described in the first aspect, said biomaterial comprising any one of B1)-B6):

[0012] B1) A nucleic acid molecule encoding a CicOMT10 mutant of any one of claims 1-3;

[0013] B2) An expression cassette containing the nucleic acid molecule described in B1);

[0014] B3) A recombinant vector containing the nucleic acid molecule described in B1) and / or the expression cassette described in B2);

[0015] B4) Recombinant microorganisms, wherein the recombinant microorganisms contain the nucleic acid molecule described in B1), the expression cassette described in B2), and / or the recombinant vector described in B3);

[0016] B5) Recombinant cells containing the nucleic acid molecule described in B1), the expression cassette described in B2), and / or the recombinant vector described in B3).

[0017] Preferably, the nucleic acid molecule described in B1) includes any one of the following encoding genes:

[0018] The nucleotide sequence encoding the mutant N179A gene is shown in SEQ ID NO:4;

[0019] The nucleotide sequence encoding the mutant T316A gene is shown in SEQ ID NO:6.

[0020] Thirdly, the present invention provides a method for preparing the CicOMT10 mutant of the methyltransferase described in the first aspect, characterized by comprising the following steps:

[0021] S1. The encoding gene of the CicOMT10 enzyme is ligated into the vector plasmid to obtain the recombinant plasmid;

[0022] S2. Design and use site-directed mutagenesis primers to amplify the full-length plasmid using the recombinant plasmid as a template, and digest it with enzymes to obtain the mutant product; wherein the site-directed mutagenesis primers are used to perform targeted mutations at at least one of the asparagine at position 179 and the threonine at position 316 of the CicOMT10 enzyme.

[0023] S3. The mutant product was transformed into the host cell, and the host cell expression was screened and induced to obtain the CicOMT10 mutant methyltransferase.

[0024] Preferably, the nucleotide sequence of the gene encoding the CicOMT10 enzyme is shown in SEQ ID NO:2.

[0025] Preferably, in step S2, the nucleotide sequence of the primer set used for mutating asparagine to alanine at position 179 of the CicOMT10 enzyme is shown in SEQ ID NO: 7-8; and / or,

[0026] The nucleotide sequence of the primer set used to mutate threonine at position 316 of the CicOMT10 enzyme to alanine is shown in SEQ ID NO: 9-10.

[0027] Preferably, the vector plasmid is pET28a plasmid, and the host cell is Escherichia coli.

[0028] Fourthly, the present invention provides the application of the methyltransferase CicOMT10 mutant from the first aspect in the preparation of hesperidin.

[0029] Preferably, the methyltransferase CicOMT10 mutant is used to catalyze the conversion of sennaol to hesperidin.

[0030] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0031] The present invention provides a methyltransferase mutant, which, based on the CicOMT10 enzyme, mutates the amino acid at position 179 or 316 to alanine, which has a strong hydrophobic side chain and weak steric hindrance, and can convert sennaol into hesperidin, while significantly improving the catalytic efficiency of the methyltransferase. Attached Figure Description

[0032] Figure 1 This is a schematic diagram illustrating the conversion of sennaol to hypersennaol.

[0033] Figure 2 This is a simulation diagram of the docking of CitOMT enzyme with senna and SAM.

[0034] Figure 3 A comparison of the catalytic efficiency of CitOMT enzyme wild-type and mutant in whole-cell catalytic conversion of sennaol to high sennaol.

[0035] Figure 4 HPLC results of whole-cell catalytic conversion of sennaol to high sennaol by wild-type and mutant CitOMT enzymes. Detailed Implementation

[0036] The present invention will now be further described with reference to the accompanying drawings and specific embodiments. Experimental methods in the following embodiments that do not specify specific conditions are generally performed under conventional experimental conditions or as recommended by the manufacturer. Unless otherwise specified, all reaction reagents involved in the embodiments can be purchased commercially. Molecular biology experimental methods not specifically described in this embodiment can be referred to *Molecular Cloning: A Laboratory Manual*. Example 1

[0037] In this embodiment, Alphafold3 was used to simulate the three-dimensional structure of wild-type methyltransferase and molecular docking was performed with the substrate. Through molecular docking, the conformational relationship between the enzyme and the substrate was accurately predicted, relevant mutation targets were efficiently obtained, and key mutants were screened out by using Pythia to predict the mutational free energy.

[0038] Referring to the glycosyl transfer mechanism of sennaol to hesperidin, such as Figure 1 As shown.

[0039] A three-dimensional structural model of the CicOMT10 enzyme was constructed, and molecular docking was performed with its substrates senna and S-adenosylmethionine. The results are as follows: Figure 2 As shown, both succinyl methionine and S-adenosylmethionine (SAM) are located within the active pocket of the CicOMT10 enzyme. The methyl group of SAM is close to succinyl methionine, approximately 3 Å apart. The asparagine at position 179 of this enzyme is located within the succinyl methionine substrate pocket; mutating it to alanine reduces steric hindrance between the substrate and the enzyme and increases the volume of the catalytic pocket, thereby improving catalytic efficiency. Simultaneously, the threonine at position 316 is located in the outer channel of the pocket; mutating it to alanine increases the channel volume, improves hydrophobicity, and further enhances catalytic efficiency. Example 2

[0040] Construction of plasmid pET28a-CicOMT10

[0041] The following steps were taken to construct a vector containing the methyltransferase sequence of citrus peel:

[0042] The methyltransferase gene with a nucleotide sequence such as SEQ ID NO:2 was ligated to the pET-28a plasmid to obtain the plasmid pET28a-CicOMT10; this plasmid was then transformed into Escherichia coli BL21(DE3).

[0043] The resulting recombinant strain was named BL21(DE3) / pET28a-CicOMT10. This recombinase strain was used to express the CicOMT10 enzyme with the amino acid sequence shown in SEQ ID NO:1. Example 3

[0044] Construction of pET28a-CicOMT10 mutant strain

[0045] 1. Construction of mutant enzyme vectors via whole plasmid PCR

[0046] Step 1) Extract a small amount of plasmid pET28a-CicOMT10 obtained in Example 2;

[0047] Step 2) Design mutation primers. Primers consist of a 15bp overlap region and a 15bp extension region, with the mutation site designed in the overlap region. The mutation sites include single-point mutations in Asn179 and Thr316.

[0048] Step 3) Use plasmid pET28a-CicOMT10 as a template for whole-plasmid PCR amplification. The PCR system is shown in Table 1.

[0049] Table 1. PCR amplification system of whole plasmids

[0050] 2×PrimeSTAR® Max DNA Polymerase 12.5μL pET-28a-CicOMT10 plasmid 1μL Primer-F 0.5μL Primer-R 0.5μL <![CDATA[ddH2O]]> 25μL

[0051] The primers Primer-F and Primer-R are upstream and downstream PCR primers designed according to different mutation sites. Specific primer information is shown in Table 2.

[0052] Table 2 Primers for PCR amplification of single-point mutation full plasmid

[0053] Primer name Sequence (5'-3') (underlined gene is the mutant gene) SEQ ID NO. N179A-F GAATGCAGCCGATTACCATGGCAAAGATCTAAGATT 7 N179A-R GGTAATCGGCTGCATTCATCCCATAGGCCTTG 8 T316A-F GGAAAGTGCCTGCAAAATGATGAAGTTTGCCG 9 T316A-R TTTTGCAGGCACTTTCCATTGCATCATTGAAAA 10

[0054] Primer pairs N179A-F and N179A-R were used to obtain the mutant enzyme N179A. The amino acid sequence of the mutant N179A is SEQ ID NO:3, and the nucleotide sequence is SEQ ID NO:4.

[0055] Primer pairs T316A-F and T316A-R were used to obtain mutant T316A, whose amino acid sequence is SEQ ID NO:5 and nucleotide sequence is SEQ ID NO:6.

[0056] PCR amplification program: pre-denaturation 98℃ for 5 min; cycling settings: denaturation 98℃ for 15 s, annealing 62℃ for 30 s, extension 72℃ for 1.5 min, 30 cycles; final extension 72℃ for 10 min; after the reaction, the PCR products were recovered using the kit.

[0057] Step 4) Removing template DNA by enzyme digestion: The recovered PCR product is then digested with enzymes. The enzyme digestion system is shown in Table 3.

[0058] Table 3 Enzyme digestion system for whole plasmid PCR products

[0059] QuickCut DpnⅠ 1μL PCR products ≤1μg 10×QuickCut Buffer 3μL <![CDATA[ddH2O]]> Add to 30μL

[0060] The above enzyme digestion system was placed in a metal bath at 37°C for 1 hour for digestion. After the reaction, the enzyme digestion products were recovered using a kit.

[0061] 2. Sequencing to verify whether the mutant enzyme strain was successfully constructed.

[0062] The enzyme digestion products were transformed into Escherichia coli BL21(DE3) competent cells and cultured overnight at 37°C with the cells inverted. Positive transformants were selected for sequencing verification, and mutant enzyme expression strains BL21(DE3) / pET-28a-CicOMT10-N179A and BL21(DE3) / pET-28a-CicOMT10-T316A were successfully obtained. Example 4

[0063] Determination of the whole-cell reaction catalytic efficiency of CicOMT10 and its mutant enzyme

[0064] 1. Enzyme protein induction of CicOMT10 and its mutant recombinant strains

[0065] The strains BL21(DE3) / pET-28a-CicOMT10-N179A and BL21(DE3) / pET-28a-CicOMT10-T316A obtained in Example 3 were activated by streaking on LB agar plates containing Kan (100 μg / mL). After overnight incubation at 37°C with inverted incubation, a single colony was picked and inoculated into 1 mL of LB liquid medium containing Kan, and cultured at 37°C with shaking at 200 rpm for 12-16 h. The overnight culture seed culture was inoculated into 100 mL of fresh LB liquid medium containing Kan at an inoculation rate of 1%, and cultured at 37°C with shaking at 200 rpm for 2-3 h until the OD600 reached 0.6-0.8. Then, IPTG was added to a final concentration of 0.1 mM, and the culture was incubated at 20°C with shaking at 150 rpm for 18 h to induce protein expression.

[0066] 2. Whole-cell reaction of CicOMT10 and its mutant enzyme

[0067] After protein induction, the cells were collected by centrifugation at 8000 rpm for 5 min at 4℃. The wet weight of the cells was weighed and the corresponding stock solution concentrations were prepared as shown in the table below. At the same time, the stock solution concentrations of sennaol, Tris-HCl (pH 7.5) and SAM were also prepared.

[0068] The reaction system was prepared according to Table 4 below, and the reaction conditions were: 30℃, 200rpm, 2h.

[0069] All samples were tested in triplicate. After 24 hours, 500 μL of DMSO solution was added to terminate the reaction. The mixture was then stirred at 12,000 rpm for 1 minute. The supernatant was collected, filtered, and analyzed by HPLC.

[0070] Table 4 Reaction System

[0071] reagents Mother liquor Final concentration 500μL system Sacred herbol 20mM 1mM 25μL CicOMT10 bacterial liquid 50mg / mL 5mg / mL 50μL SAM 200mM 2.5mM- 6.25μl Tris-HCl buffer pH 7.5 Supplement 500μl

[0072] 3. Detection method for hesperidin

[0073] HPLC was used for the quantitative analysis of hesperidin, and the chromatographic conditions are as follows:

[0074] High performance liquid chromatograph: Agilent 1100 Series.

[0075] Column: Diamonsil® 5 μm C18 (250 mm x 4.6 mm x 5 μm).

[0076] Detector: VWD detector, detection wavelength 290nm.

[0077] Mobile phase ratio and elution conditions: flow rate 1 mL / min; column temperature 30 °C; injection volume 10 μL; gradient elution system as shown in Table 5:

[0078] Table 5 HPLC elution system

[0079] time A% (acetonitrile) B% (acetic acid) 0min 34 66 20min 34 66

[0080] 4. Results Analysis

[0081] like Figure 3 and Figure 4 As shown, when using senna as a substrate for whole-cell catalysis, the whole-cell catalytic efficiency of BL21(DE3) / pET-28a-CicOMT10-N179A is 1.88 times that of the wild-type strain (BL21(DE3) / pET-28a-CicOMT10-WT).

[0082] The whole-cell catalytic efficiency of BL21(DE3) / pET-28a-CicOMT10-T316A is 2.26 times that of the wild-type strain.

[0083] According to the test results, mutants N179A and T316A have a greater affinity for sennaol and can effectively bind to the substrate for catalytic action, thereby improving the catalytic efficiency of sennaol's specific conversion to hesperidin.

[0084] In summary, this invention synthesized mutants N179A and T316A through genetic engineering, and then experimentally verified that they have a greater affinity for sennaol and can effectively bind to the substrate for catalytic action, improving the catalytic efficiency of sennaol specifically converting to hesperidin, which can be used for the preparation of hesperidin.

[0085] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit the scope of protection of the present invention. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can be made to the technical solutions of the present invention without departing from the essence and scope of the technical solutions of the present invention.

Claims

1. A methyltransferase CicOMT10 mutant, characterized in that, The methyltransferase CicOMT10 mutant is mutant N179A or mutant T316A; mutant N179A is obtained by mutating asparagine at position 179 of the CicOMT10 enzyme as shown in SEQ ID NO.1 to alanine, and mutant T316A is obtained by mutating threonine at position 316 of the CicOMT10 enzyme as shown in SEQ ID NO.1 to alanine.

2. The CicOMT10 mutant methyltransferase as described in claim 1, characterized in that, The amino acid sequence of the mutant N179A is shown in SEQ ID NO:

3.

3. The CicOMT10 mutant methyltransferase as described in claim 1, characterized in that, The amino acid sequence of the mutant T316A is shown in SEQ ID NO:

5.

4. A biomaterial for producing the CicOMT10 mutant methyltransferase according to any one of claims 1-3, characterized in that, The biomaterial includes any one of B1)-B6) below: B1) A nucleic acid molecule encoding a CicOMT10 mutant of any one of claims 1-3; B2) An expression cassette containing the nucleic acid molecule described in B1); B3) A recombinant vector containing the nucleic acid molecule described in B1) or the expression cassette described in B2); B4) Recombinant microorganisms, wherein the recombinant microorganisms contain the nucleic acid molecule described in B1), the expression cassette described in B2), or the recombinant vector described in B3); B5) Recombinant cells containing the nucleic acid molecule described in B1), the expression cassette described in B2), or the recombinant vector described in B3).

5. The biomaterial as described in claim 4, characterized in that, B1) The nucleic acid molecule described is any one of the following encoding genes: The nucleotide sequence encoding the mutant N179A gene is shown in SEQ ID NO:4; The nucleotide sequence encoding the mutant T316A gene is shown in SEQ ID NO:

6.

6. A method for preparing the CicOMT10 mutant methyltransferase according to any one of claims 1-3, characterized in that, Includes the following steps: S1. The encoding gene of the CicOMT10 enzyme is ligated into the vector plasmid to obtain the recombinant plasmid; S2. Design and use site-directed mutagenesis primers to amplify the full-length plasmid using the recombinant plasmid as a template, and then digest it with enzymes to obtain the mutant product. The site-directed mutagenesis primer is used to perform a directed mutation at at least one site in the CicOMT10 enzyme, either asparagine at position 179 or threonine at position 316. S3. The mutant product is transformed into host cells, and the host cells are screened and induced to express the methyltransferase CicOMT10 mutant; the nucleotide sequence of the gene encoding the CicOMT10 enzyme is shown in SEQ ID NO:

2.

7. The method for preparing the CicOMT10 mutant methyltransferase as described in claim 6, characterized in that, In step S2, the nucleotide sequence of the primer set used for mutating asparagine to alanine at position 179 of the CicOMT10 enzyme is shown in SEQ ID NO: 7-8; and / or, The nucleotide sequence of the primer set used to mutate threonine at position 316 of the CicOMT10 enzyme to alanine is shown in SEQ ID NO:9-10.

8. The use of the methyltransferase CicOMT10 mutant according to any one of claims 1-3 in the preparation of hesperidin, characterized in that, The CicOMT10 mutant methyltransferase is used to catalyze the conversion of sennaol to hesperidin.

Citation Information

Patent Citations

  • Spray-dried dispersions, formulations, and polymorphs of (s)-5-amino-3-(4-((5-fluoro-2-methoxybenzamido)methyl)phenyl)-1-(1,1,1-trifluoropropan-2-yl)-1h-pyrazole-4-carboxamide

    CA3224985A1

  • Rhamnose glycosyl transferase mutant and application of rhamnose glycosyl transferase mutant in preparation of NHDC

    CN118652868A