Mutant gene of gm15262 gene and application thereof

Abstract

The invention discloses a mutant gene of a gm15262 gene and application of the mutant gene, and belongs to the technical field of molecular biology and medicine. The CDS sequence of the mutant gene of the gm15262 gene is shown as SEQ ID NO.1, and compared with the CDS sequence of a normal human source gm15262 gene, the CDS sequence of the mutant gene of the gm15262 gene is subjected to c.C338T (p.P113L) mutation. A male sterility animal model can be constructed by enabling corresponding sites of the animal gm15262 gene to be subjected to same mutation, when the animal model is a mouse model, a male sterility mouse model can be obtained by enabling the gm15262 gene of a mouse to be subjected to c.C305T (p.P102L) mutation, and the mouse model is used for accurately simulating pathogenic mutation of human genetic diseases. And a key experimental platform is provided for development of gene therapy, targeted drug screening and germ cell editing research. The invention has important significance in diagnosis and treatment of male infertility.

Description

Technical Field

[0001] The invention belongs to the field of molecular biology and medical technology, and particularly relates to a mutant gene of the gm15262 gene and an application thereof. Background Art

[0002] According to a new report released by the World Health Organization (WHO) in 2023, approximately 17.5% of adults (approximately one-sixth of the global population) experience infertility, with 50% of infertility attributable to men. A study published in November 2022 found that sperm counts have declined by 62% over the past 50 years. Male infertility can be caused by a variety of factors: psychological or physical factors leading to erectile dysfunction and ejaculatory disorders; genetic factors leading to conditions such as cryptorchidism, anorchia, congenital absence of the vas deferens, and hormone insensitivity syndrome; and abnormal spermatogenesis caused by chromatin abnormalities or gene mutations. Furthermore, environmental factors and lifestyle can affect sperm quality, leading to infertility. Genetic factors (gene mutations) account for a significant proportion of gametogenesis disorders. Exploring genetic mechanisms has revealed that the precise completion of gametogenesis is crucial for the stable transmission of genetic information. Summary of the Invention

[0003] The present invention aims to provide a mutant gene of the GM15262 gene and its use. It also aims to provide the use of the GM15262 gene and / or the GM15262 protein in the preparation of a product for diagnosing idiopathic male infertility. The present invention can clearly diagnose idiopathic male infertility and has important implications for the diagnosis and treatment of male infertility.

[0004] In a first aspect of the present invention, a mutant gene of the gm15262 gene is provided, whose CDS sequence is shown in SEQ ID NO. 1. The CDS sequence of the mutant gene has a c.C338T mutation compared to the CDS sequence of the normal human gm15262 gene shown in SEQ ID NO. 2, that is, the protein encoded by the mutant gene has a p.P113L mutation compared to the protein encoded by the normal human gm15262 gene.

[0005] In the second aspect of the present invention, the use of the mutant gene of the gm15262 gene in constructing a male sterile animal model is provided. The male sterile animal model can be obtained by causing the corresponding sites of the animal gm15262 gene to undergo the same mutation.

[0006] In a third aspect of the present invention, a method for constructing a male infertile mouse model is provided. The method comprises causing a c.C305T (p.P102L) mutation in the gm15262 gene of the mouse (corresponding to the c.C338T (p.P113L) mutation in the human gm15262 gene) to obtain male mice with the gm15262 gene c.C305T (p.P102L), thereby obtaining a male infertile mouse model.

[0007] Furthermore, the method for causing the c.C305T (p.P102L) mutation in the gm15262 gene of mice is the CRISPR / Cas9 gene editing method.

[0008] Furthermore, the sequences of the sgRNA and donor used to induce the c.C305T (p.P102L) mutation in the mouse gm15262 gene are as follows: sgRNA1:AAGATTCAACTCTAGCCCATTGG (SEQ ID NO.3), sgRNA2:TATCTAGTCCAGATTCTTTTATGG (SEQ ID NO.4), donor: GAAGATGAGGAGGAGGAGGATTGTGAAGAAAATCTTCCAGAAAACTTAAAAAGATTCAACTCTAGCCCATTAGCTCTCCTCCGATTAACCAAAAGAAGACGATCATCTAGTCCAGATTCTTTTATAGTTCGTATACTAAAATAGAAATCTATGTTCTCATTGGACTATATTCCTTTT (SEQ ID NO. 5).

[0009] Furthermore, the method for constructing a male infertility mouse model includes the following steps: microinjecting transcribed Cas9 mRNA, sgRNA, and donor fragments into the pronuclei and cytoplasm of fertilized C57BL / 6 mouse eggs, then transplanting the fertilized eggs into the uterus of a pseudopregnant C57BL / 6 female mouse to obtain F0 generation mice. F0 generation positive mice are mated with wild-type C57BL / 6J mice to obtain F1 generation mice with a stable genotype. Male mice harboring the c.C305T (p.P102L) mutation in the gm15262 gene are selected from the F1 generation mice to obtain a male infertility mouse model.

[0010] In a fourth aspect of the present invention, the use of the gm15262 gene in constructing a male sterile animal model is provided. The male sterile animal model can be obtained by knocking out the gm15262 gene to inactivate its function.

[0011] In a fifth aspect of the present invention, provided is the use of the gm15262 gene and / or GM15262 protein in the preparation of a product for diagnosing idiopathic male infertility.

[0012] Furthermore, the product for diagnosing idiopathic male infertility includes: a product for detecting gm15262 gene abnormalities; or / and a product for detecting abnormal GM15262 protein expression.

[0013] Furthermore, the gm15262 gene abnormality includes: single or multiple base sequence deletions, insertions or substitutions in the gene sequence. Furthermore, the gm15262 gene abnormality includes the gm15262 gene c.C338T mutation.

[0014] Furthermore, the product for detecting gm15262 gene abnormality includes primers for detecting gm15262 gene.

[0015] Furthermore, the abnormal expression of GM15262 protein includes: premature termination of GM15262 protein expression, or amino acid deletion, insertion or substitution in important functional domains of GM15262 protein. Furthermore, the abnormal expression of GM15262 protein includes the p.P113L mutation of GM15262 protein.

[0016] Furthermore, the abnormal expression of the GM15262 protein can be detected by an antibody that specifically binds to the GM15262 protein.

[0017] In a sixth aspect of the present invention, provided is the use of an antibody against GM15262 protein in the preparation of a product for diagnosing idiopathic male infertility. In a seventh aspect of the present invention, there is provided use of a primer pair for detecting abnormalities in the gm15262 gene in the preparation of a product for diagnosing idiopathic male infertility.

[0018] Compared with the existing technology, the present invention has the following advantages and beneficial effects: By integrating clinical data analysis with conservation analysis and animal model verification, the present invention has found mutation sites associated with the gm15262 gene that can cause male infertility. In the field of reproductive medicine, point mutation mouse models provide a key experimental platform for the development of gene therapy, targeted drug screening, and germ cell editing research by accurately simulating the pathogenic mutations of human genetic diseases. They help to analyze mutation mechanisms, promote personalized treatment, and lay a scientific foundation for strategies to block the vertical transmission of genetic diseases. The present invention provides highly specific diagnostic markers and gene therapy targets for male infertility, significantly improving the clinical translation efficiency and precision intervention potential of pathogenic site research. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 This is the phenotype of mice with the c.C305T point mutation in the gm15262 gene.

[0020] Figure 1 A: Conservation analysis of the GM15262 protein encoded by the gm15262 gene in humans and mice; Figure 1 B: Testicular morphology of mice with the c.C305T point mutation of the gm15262 gene; Figure 1 C: Testicular tissue section of mice with the c.C305T point mutation in the gm15262 gene.

[0021] Figure 2 This is the phenotype of gm15262 knockout mice.

[0022] Figure 2 A: Testicular morphology of gm15262 knockout mice; Figure 2 B: WB verified that GM15262 protein was not expressed in gm15262 knockout mice; Figure 2 C: Testicular tissue sections of gm15262 knockout mice; Figure 2 D: Immunofluorescence analysis confirmed that GM15262 protein was not expressed in gm15262 knockout mice. DETAILED DESCRIPTION

[0023] The present invention will be described in detail below with reference to the embodiments, and the advantages and various effects of the present invention will be more clearly presented. It should be understood by those skilled in the art that these embodiments are for illustrating the present invention, not for limiting the present invention.

[0024] Throughout this specification, unless otherwise specified, the terms used herein should be understood as having the same meaning as commonly used in the art. Therefore, unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. In the event of any conflict, the present specification shall take precedence. Unless otherwise specified, various raw materials, reagents, instruments and equipment used in the present invention can be purchased from the market or obtained through existing methods.

[0025] Example 1 Discovery of a Mutated Pathogenic Gene Related to the gm15262 Gene 1. Obtain biological samples Male patient: no family history of transgender disease. Clinical phenotype: idiopathic male infertility.

[0026] 2. DNA Extraction Genomic DNA from peripheral blood mononuclear cells was extracted using a DNA extraction kit.

[0027] 3. Library construction and sequencing Genomic DNA was randomly fragmented and sheared into fragments of 180–280 bp using a Covaris fragmentor. Libraries were prepared using the Bioruptor UCD-200 (Diagenode), the KAPA Library Preparation Kit (Kapa Biosystems, #KR0453), and the SureSelect XT2 Target Enrichment System (Agilent). DNA libraries were sequenced using the Illumina NovaSeq platform, and downstream analysis was performed using the Illumina Sequence Control Software (SCS). Variants were retained only when the read depth was greater than or equal to 10. High-quality reads were aligned to the USCS human genome (build 37.1 version hg19) using the Burrows-Wheeler alignment tool.

[0028] The Genome Analysis Toolkit (GATK) and ANNOVAR were used for variant calling and annotation. Variant frequencies were initially determined in gnomeAD and Exome Aggregation Consotium (ExAC) to remove common single nucleotide polymorphisms (SNPs). Only nonsynonymous, splice, and frameshift variants with a minor allele frequency (MAF) <0.5% or absent in population databases were selected for further evaluation.

[0029] 4. Patient screening and gene mutation confirmation: A total of 10 point mutations associated with gm15262 were screened from 126 patients with non-obstructive male infertility. By analyzing these mutation types and comparing mouse and human protein sequences, the key mutation site c.C338T (p.P113L) located in a highly conserved functional domain was identified.

[0030] 5. Construction of mice carrying the c.C305T (p.P102L) point mutation in the mouse gm15262 gene After analysis ( Figure 1 A), The c.C305T (p.P102L) mutation in the mouse gm15262 gene corresponds to the c.C338T (p.P113L) mutation in the human gm15262 gene.

[0031] The mouse gm15262 gene c.C305T (p.P102L) point mutation mice were constructed, and the Donor sequence of the designed gRNA is shown below.

[0032]

[0033] The gRNA sequence was linked to the pUC57 plasmid vector, and after the plasmid was sequenced and verified to be correct, universal amplification primers were used to amplify the sgRNA nucleotide sequence. Finally, the PCR product was used as a template for in vitro transcription to obtain the microinjection RNA of sgRNA1 and sgRNA2.

[0034] Donor sequence: GAAGATGAGGAGGAGGAGGATTGTGAAGAAAATCTTCCAGAAAACTTAAAAAGATTCAACTCTAGCCCATTAGCTCTCCTCCGATTAACCAAAAGAAGACGATCATCTAGTCCAGATTCTTTTATAGTTCGTATACTAAAATAGAAATCTATGTTCTCATTGGACTATATTCCTTTT (SEQ ID NO. 5).

[0035] The transcribed Cas9, sgRNA and donor were microinjected into the pronucleus and cytoplasm of C57BL / 6 mouse fertilized eggs, and then the fertilized eggs were transplanted into the uterus of pseudo-pregnant C57BL / 6 female mice and waited for the birth of F0 generation mice.

[0036] After the F0 generation mice are born, the tails are identified. The primers for tail identification are as follows: SEQ ID NO.6:GATGACAATGGAGCTGATGGAG, SEQ ID NO. 7: CACAGCTGGGGTTAATTGCTCA.

[0037] Mice with positive tail genotype identification were mated with wild-type C57BL / 6J mice to obtain F1 mice with a stable genotype. Tail DNA from F1 mice identified as positive by PCR was extracted and sequenced. The sequencing results were aligned with the sequence shown in SEQ ID NO. 8 using Snapgene 4.1.9. If the results were identical to SEQ ID NO. 8, mice harboring the c.C338T point mutation in the gm15262 gene were successfully constructed.

[0038] The resulting F1 male mice were then mated with wild-type female mice, and no female pregnancies were observed through natural mating. Because the gm15262 gene is located on the X chromosome, male mice with the point mutation are unable to produce offspring, making it impossible to obtain homozygous female mice through mating.

[0039] 6. Phenotype of the mouse model with the c.C338T point mutation in the gm15262 gene (1) Dissect the F1 mice and observe the testicles and epididymis. After arranging them neatly, use a ruler to measure the changes in testicular size and analyze them.

[0040] (2) Take one side of the testis of each mouse and perform paraffin sectioning. Fix it with fixative and then embed it in paraffin. Slice the embedded tissue and dewax it.

[0041] (3) Perform HE staining on the paraffin sections and seal the sections; observe the changes in the number of sperm in the seminiferous tubules and perform analysis.

[0042] The results are as follows Figure 1 As shown in Figures B and C, mice harboring the c.C338T (P102L) point mutation in the gm15262 gene exhibited smaller testes. Testicular tissue sections revealed abnormal seminiferous tubules and no sperm production. This suggests that the c.C338T (P102L) point mutation in the gm15262 gene plays a crucial role in the function of the GM15262 protein.

[0043] Example 2 1. Construction of gm15262 gene knockout mice Using CRISPR / Cas9 technology and the principle of homologous recombination, we can knock out the target gene. The designed sgRNA sequence is as follows.

[0044] sgRNA1:GAGATAAACGCCTCAGCTTCAGG (SEQ ID NO.9), sgRNA2: GTTTATGGCTTAGGGTATCCTGG (SEQ ID NO. 10).

[0045] In the constructed gm15262 gene knockout mouse, exons 4 to 9 of the gm15262 gene were knocked out, and the protein it encoded underwent a frameshift mutation after amino acid position 117, resulting in premature termination of protein translation.

[0046] 2. Materials Testicular and epididymal tissues were collected from normal mice and gm15262 knockout mice. The following tests were performed: testicular size measurement and weighing, testicular tissue fixation, sectioning, and histological staining, and protein localization was determined by immunofluorescence. The procedures were as follows: (1) Dissect out the complete mouse testicles and epididymal tissues; after arranging them neatly, use a ruler to measure the changes in testicular size and analyze them.

[0047] (2) Take one side of the testis of each mouse and perform paraffin sectioning. Fix it with fixative and then embed it in paraffin. Slice the embedded tissue and dewax it.

[0048] (3) Perform HE staining on the paraffin sections and seal the sections; observe the changes in the number of sperm in the seminiferous tubules and perform analysis.

[0049] (4) Total protein was extracted from the unilateral testis of mice, and protein expression levels were detected by Western Blot; 3. Results Analysis (1) Figure 2 A shows that the testicle size and weight of gm15262 gene knockout mice are significantly smaller than those of normal mice.

[0050] (2) Figure 2 B and D show that GM15262 protein is not expressed in the testicular tissue of gm15262 gene knockout mice.

[0051] (3) Figure 2 C HE staining of mouse testicular tissue sections showed that there were no mature sperm in the testes of gm15262 gene knockout mice.

[0052] 4. Experimental Conclusion Knockout of the gm15262 gene leads to abnormal spermatogenesis in the mouse testis, no sperm production, and infertility.

[0053] Example 3 Detection of the gm15262 gene sequence in the genome 1. Materials 200 μL of peripheral blood was collected from patients with idiopathic male infertility.

[0054] 2. Extracting blood tissue genome A blood gene extraction kit (brand: TIANGEN, product number: DP304) was used. The specific operations were performed according to the instructions. After collection, the DNA solution was stored at -20°C or -80°C.

[0055] 3. Send the patient's peripheral blood genomic DNA solution to a sequencing company for whole genome sequencing, and compare the sequencing results with the human gm15262 gene.

[0056] 4. Analyze the gm15262 gene sequence in the genome (1) There is no mutation in the exon sequence of the gm15262 gene, which confirms that idiopathic male infertility is not related to the gm15262 gene. Other gene mutations need to be analyzed or other causes should be considered.

[0057] (2) Mutation of the promoter or enhancer sequence of the gm15262 gene If a base mutation occurs in the promoter or enhancer sequence of the gm15262 gene, and the expression of the encoded protein does not change, it can be determined that idiopathic male infertility is not related to the gm15262 gene.

[0058] If a base mutation occurs in the promoter or enhancer sequence of the gm15262 gene, it will eventually lead to a significant decrease in the expression level of the gm15262 protein, and it can be determined that idiopathic male infertility is related to the gm15262 gene.

[0059] (3) There are base deletions or insertions in the gm15262 gene coding sequence Non-integer triple deletions or insertions in the exon sequence of the gm15262 gene will inevitably affect the encoded protein, thus idiopathic male infertility is associated with gm15262. Triple deletions or insertions can result in the deletion or insertion of additional amino acid residues in the encoded protein, and if the altered sites occur in important functional domains, this can lead to reduced GM15262 activity. Further confirmation of the encoded protein sequence is required, with specific reference to protein expression and functional verification.

[0060] (4) Base substitutions exist in the coding sequence of the gm15262 gene If a synonymous mutation occurs in the base sequence of the gm15262 gene exon (the type of encoded amino acid is not changed after the base replacement), the final encoded protein will not change, so idiopathic male infertility is not related to the gm15262 gene.

[0061] If nonsense mutations occur in the exon sequences of the gm15262 gene (base substitutions that cause premature termination of protein translation), ultimately affecting the activity and function of the GM15262 protein, male infertility is associated with the gm15262 gene. During whole-genome sequencing analysis, it is also necessary to analyze genomic sequences associated with other reported cases of idiopathic male infertility. If a patient has mutations in other reported related genes, multiple genetic variants may be considered as contributing to the above-mentioned diseases.

[0062] Example 4 Detection of GM15262 Encoded Protein Expression Level 1. Obtain tissue Reproductive organ tissue for idiopathic male infertility is obtained through tissue puncture (requires professional medical personnel).

[0063] 2. Prepare protein samples (1) 100 μL RIPA lysis buffer (brand: Beyotime, catalog number: P0013K) was added to a final concentration of 1× protease inhibitor cocktail (brand: Roche, catalog number: 11836145001). The tissue was lysed by grinding on ice 40 times, shaking on a shaker at 4°C for 30 minutes, and then centrifuged at 12,000 g for 10 minutes at 4°C to obtain the supernatant.

[0064] (2) Determine protein concentration using the BCA assay (Brand: Beyotime, Product No.: P0012).

[0065] (3) Add 5× SDS-PAGE protein loading buffer (Brand: Abclonal, Catalog Number: RM00001), mix, boil in water for 10 minutes, and then cool on ice.

[0066] 3. Western Blot Detection of Protein Expression Levels 4. Data calculation Protein quantification was performed using the BCA assay. GAPDH (its content in different cells varies little and is unaffected by changes in the target protein) was used as an internal reference protein for relative quantification of GM15262 protein (the ratio of GM15262 protein to the internal reference protein was used as the quantitative value). Normal testes served as the control group. Images of the different samples were grayscale processed using ImageJ software, and grayscale values ​​or grayscale areas were calculated.

[0067] 5. Results Analysis (1) There is no difference (location, content) between the test group and the control group: This indicates that the expression level of GM15262 protein in male infertility patients is no different from that in normal people. At the same time, if the gene sequence is correct, the possibility of GM15262 abnormality causing male infertility can be further ruled out.

[0068] (2) Changes in the position of the GM15262 protein band in the test group: Combined with the GM15262 gene sequence information, this indicates that the GM15262 protein terminated prematurely, or a new sequence was added due to the loss of the stop codon caused by the insertion of bases; if this is not accompanied by an increase in expression, it suggests that the protein function may not be affected. If the protein expression level increases, it suggests that the mutation has caused the protein function to be impaired; however, whether the protein function is specifically affected requires further confirmation by protein interaction experiments (CO-IP or GST poll-down).

[0069] (3) Increased GM15262 protein content in the test group indicates decreased GM15262 protein activity. Combined with GM15262 gene sequence information (functional domain mutation) and protein interaction experiments (decreased protein binding), the possibility of diagnosing GM15262-induced male infertility can be increased.

[0070] The above embodiments are only used to help illustrate the present invention. The implementation methods of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be considered as equivalent replacement methods and are included in the scope of protection of the present invention.

Claims

1. A mutant gene of the gm15262 gene, characterized in that: The CDS sequence of the mutant gene is shown in SEQ ID NO.

1.

2. Use of the mutant gene of the gm15262 gene according to claim 1 in constructing a male infertility animal model.

3. A method for constructing a male infertility mouse model, characterized by: The construction method is to cause c.C305T in the gm15262 gene of the mouse to obtain a male infertile mouse model.

4. The method for constructing a male infertility mouse model according to claim 3, wherein: The method used to cause the c.C305T mutation in the mouse gm15262 gene is the CRISPR / Cas9 gene editing method.

5. The method for constructing a male infertility mouse model according to claim 4, wherein: The sequences of the sgRNA and donor used to induce the c.C305T mutation in the mouse gm15262 gene are as follows: sgRNA1:AAGATTCAACTCTAGCCCATTGG, sgRNA2:TATCTAGTCCAGATTCTTTTATGG, donor: GAAGATGAGGAGGAGGAGGATTGTGAAGAAAATCTTCCAGAAAACTTAAAAAGATTCAACTCTAGCCCATTAGCTCTCCTCCGATTAACCAAAAGAAGACGATCATCTAGTCCAGATTCTTTTATAGTTCGTATACTAAAATAGAAATCTATGTTCTCATTGGACTATATTCCTTTT.

6. The method for constructing a male infertility mouse model according to claim 5, wherein: The method includes the following steps: microinjecting the transcribed Cas9 mRNA, sgRNA and donor fragment into the pronucleus and cytoplasm of C57BL / 6 mouse fertilized eggs, then transplanting the fertilized eggs into the uterus of pseudo-pregnant C57BL / 6 female mice to obtain F0 generation mice; mating the F0 generation positive mice with C57BL / 6J wild-type mice to obtain F1 generation mice with a stable genotype; and screening male mice with a c.C305T mutation in the gm15262 gene from the F1 generation mice to obtain a male infertile mouse model.

7. Use of the gm15262 gene in constructing a male sterility animal model, characterized in that: A male infertility animal model was obtained by knocking out the gm15262 gene to inactivate its function.

8. Use of the gm15262 gene and / or GM15262 protein in the preparation of a product for diagnosing idiopathic male infertility.

9. The use according to claim 8, characterized in that: The products for diagnosing idiopathic male infertility include: products for detecting gm15262 gene abnormalities; or / and products for detecting abnormal GM15262 protein expression.

10. Use of a reagent for detecting the gm15262 gene or GM15262 protein in the preparation of a product for diagnosing idiopathic male infertility.

Images