Nicotiana benthamiana PDS silencing system based on new tea tree virus TVS

Abstract

The invention discloses a nicotiana benthamiana PDS silencing system based on a new tea tree virus TVS. The nicotiana benthamiana PDS silence system comprises a pTVS1 carrier and a pTVS2-MCS2 carrier, and the pTVS1 carrier and the pTVS2-MCS2 carrier are used Virus sequences in the pTVS1 vector and the pTVS2-MCS2 vector are derived from a new tea tree virus TVS. The construction of the new tea tree virus TVS in the nicotiana benthamiana VIGS system is realized for the first time, and the system capable of silencing the nicotiana benthamiana PDS gene is obtained; the silence system constructed by the invention can effectively reduce the expression of nicotiana benthamiana PDS, influence the synthesis of chlorophyll, and make silence leaves present a bleaching phenotype. Establishment of the new tea tree virus TVS in the Ben's tobacco VIGS silence system lays a foundation for establishment of a virus-induced gene silence system, and can also provide a tool for research on physiological and biochemical properties of the virus.

Description

Technical Field

[0001] The present invention relates to the biological field, and in particular to a Nicotiana benthamiana PDS silencing system based on a new tea tree virus TVS. Background Art

[0002] With the continuous deepening of plant functional genomics research, there is an urgent need to develop efficient and simple reverse genetics methods to achieve rapid analysis of plant gene functions. Virus-induced gene silencing (VIGS) technology is an important tool developed in this context. VIGS technology is based on the natural antiviral defense mechanism of plants, especially the post-transcriptional gene silencing (PTGS) process that relies on the RNA interference (RNAi) pathway. By using engineered plant viruses as vectors, target gene fragments are introduced into the plant body, thereby inducing endogenous gene silencing and characterizing the function of the target gene.

[0003] Compared to traditional stable genetic transformation methods, VIGS offers advantages such as ease of use, short turnaround times, the absence of complex transgenic procedures, and a wide range of applications. It is particularly suitable for plant species where genetic transformation systems are underdeveloped or difficult to implement. Consequently, VIGS technology has been widely applied in various fields, including plant biology, crop breeding, and resistance mechanism research. Currently, the main VIGS vectors used in plant research include tobacco rattle virus (TRV), apple latent spherical virus (ALSV), bean pod mottle virus (BPMV), and citrus tatter leaf virus (CTLV).

[0004] Although VIGS technology has many advantages, it still has many limitations and shortcomings in its actual application, which are mainly reflected in the following aspects: the selection of target gene fragments and the insertion site have a significant impact on the silencing efficiency. (1) Unreasonable target sequence design or insertion site may lead to unstable or ineffective silencing effects; (2) Plant growth status and developmental stage also have a significant impact on viral infection and subsequent gene silencing effects. Young plants are usually easier to achieve efficient silencing than mature plants; (3) Many VIGS vectors are prone to genomic instability, recombination or fragment loss in plants, resulting in reduced or inactivated viral copies, thereby reducing silencing efficiency or causing experimental failure; (4) Some VIGS systems may induce non-specific silencing of non-target genes while inducing target gene silencing, resulting in off-target effects, affecting the accuracy and reproducibility of experimental results; (5) Some viral vectors can cause uncontrollable pathological reactions after infecting plants, such as deformity, yellowing, and dwarfing. These phenotypic changes may mask or interfere with the true phenotype caused by target gene silencing, increasing the difficulty of interpreting the results; (6) The host range of each vector is usually limited, and there are large differences between different plant species or varieties, which limits the application of VIGS systems in some important crops or wild plants. Summary of the Invention

[0005] To address the common problems of viral pathogenic side effects, poor host adaptability, and low silencing efficiency in traditional VIGS systems, the present invention uses a method based on high-throughput sequencing (HTS) technology to systematically screen for viral resources that naturally exist in tea plants and do not cause obvious pathological symptoms after infection. This virus, named tea virus S (TVS), is developed as a new VIGS vector and provides a Nicotiana benthamiana PDS silencing system based on the new tea virus TVS.

[0006] The technical solution adopted in the present invention is as follows: A Nicotiana benthamiana PDS silencing system based on tea S virus, comprising a pTVS1 vector and a pTVS2-MCS2 vector, wherein the nucleotide sequence of the pTVS1 vector is shown in SEQ ID NO.6, and the nucleotide sequence of the pTVS2-MCS2 vector is shown in SEQ ID NO.8; Furthermore, the viral sequence in the pTVS1 vector is derived from RNA1 of the tea S virus, and the nucleotide sequence of the RNA1 is shown in SEQ ID NO.1; the viral sequence in the pTVS2-MCS2 vector is derived from RNA2 of the tea S virus, and the nucleotide sequence of the RNA2 is shown in SEQ ID NO.2; Furthermore, the Nicotiana benthamiana PDS silencing system also includes a Nicotiana benthamiana PDS gene; the Nicotiana benthamiana PDS gene is inserted into the pTVS2-MCS2 vector by enzyme digestion and ligation.

[0007] Furthermore, the construction method of the pTVS1 vector comprises the following steps: (1) Total RNA was extracted from tea leaves infected with tea S virus, and then cDNA was obtained by reverse transcription amplification; (2) Using the cDNA obtained by reverse transcription amplification as a template, PCR amplification was performed using the primer pair TTTCATTTGGAGAGGTTTGAAAAGCAACCTGCGAAC and CTCCTCGGAATAATAAGTCAGC to obtain fragment 1-1 (SEQ ID NO. 3); using the cDNA obtained by reverse transcription amplification as a template, PCR amplification was performed using the primer pair GCTGACTTATTATTCCGAG GAG and GCCGACCCGGGGATCAAAGCTTATTCTAAGTGCCAG to obtain fragment 1-2 (SEQ ID NO. 4); (3) The binary vector pXT was double-digested with restriction endonucleases StuI and BamHI to obtain a linearized vector pXT; fragments 1-1 and 1-2 were ligated with the linearized vector pXT under the action of homologous recombinase to obtain a pXT-R1 vector; (4) Using the pXT-R1 vector as a template, PCR amplification was performed using the primer pair AAAAAAAAAAAAAAAAAAAAgatccccgggtcggcatg and AAAGCTTATTCTAAGTGCCAGAACTAAAC. The amplified product was digested with DpnI to remove the plasmid template. The digested product was phosphorylated and self-ligated with T4 DNA ligase to obtain the pTVS1 vector. Furthermore, the construction method of the pTVS2-MCS2 vector comprises the following steps: (1) Total RNA was extracted from tea leaves infected with tea S virus, and then cDNA was obtained by reverse transcription amplification; (2) Using the cDNA obtained by reverse transcription amplification as a template, PCR amplification was performed using primers TTTCATTTGGAGAGGTTTGAAAAGCAATCTGCGAA and GCCGACCCGGGGATCAAAGCTTATTCTAAGTGCCAG to obtain fragment 2 (SEQ ID NO. 5); (3) The binary vector pXT was double-digested with restriction endonucleases StuI and BamHI to obtain a linearized vector pXT; fragment 2 was ligated with the linearized vector pXT under the action of a homologous recombinase to obtain a pXT-R2 vector; (4) Using the pXT-R2 vector as a template, PCR amplification was performed using the primer pair AAAAAAAAAAAAAAAAAAAAgatccccgggtcggcatg and AAAGCTTATTCTAAGTGCCAGAACTAAAC. The amplified product was digested with DpnI to remove the plasmid template. The digested product was phosphorylated and self-ligated with T4 DNA ligase to obtain the pTVS2 vector. (5) Using the pTVS2 vector as a template, PCR amplification was performed using primers ggcctGTTCCTTCCCTCTCTTTCT and TTAACCAACGACAAAAGTATTCTC. The amplified product was digested with DpnI to remove the plasmid template. The digested product was phosphorylated and self-ligated under the action of T4 DNA ligase to obtain the pTVS2-MCS2 vector.

[0008] Application of the Nicotiana benthamiana PDS silencing system in identifying the function of Nicotiana benthamiana PDS gene and silencing Nicotiana benthamiana PDS gene; Furthermore, the application includes the following steps: (1) Designing primer pairs for silencing specific nucleotide fragments of the Nicotiana benthamiana PDS gene, performing PCR amplification using Nicotiana benthamiana cDNA as a template, and inserting the PCR amplification product into the pTVS2-MCS2 vector by enzyme digestion and ligation to obtain the pTVS2-PDSx vector; (2) The pTVS1 vector and the pTVS2-PDSx vector were respectively transformed into Agrobacterium to obtain Agrobacterium containing the pTVS1 vector and Agrobacterium containing the pTVS2-PDSx vector, respectively; (3) Mixing the Agrobacterium culture solution containing the pTVS1 vector and the Agrobacterium culture solution containing the pTVS2-PDSx vector to obtain an infection solution; (4) Injecting the infection solution into the leaves of Nicotiana benthamiana seedlings; continuing to culture the Nicotiana benthamiana seedlings after infection and observing the phenotypic changes of the seedlings; Wherein, the nucleotide sequence of the primer pair is selected from any one of the following: (1) AGGGAAGGAACAGGGGTTGTGAACCCTGTCGG and TGTCGTTGGTTAAGGGTTCACTATGCTAACTACGCTTG; (2) AGGGAAGGAACAGGGAAGCTTTTCCCTGATGA and TGTCGTTGGTTAAGGGTTCACTATGCTAACTACGCTTG; (3) AGGGAAGGAACAGGACCCCAATCAGTCTATGT and TGTCGTTGGTTAAGGGTTCACTATGCTAACTACGCTTG; (4) AGGGAAGGAACAGGGACAGAAAACTGAAGAACAC and TGTCGTTGGTTAAGGGTTCACTATGCTAACTACGCTTG; (5) AGGGAAGGAACAGGGCACTCAACTTTATAAACCC and TGTCGTTGGTTAAGGCTTCAGTTTTCTGTCAAAC.

[0009] The significant advantages of the present invention are: (1) Significantly reduce nonspecific pathological reactions caused by viral infection: By systematically identifying viruses that cause asymptomatic infections in nature through high-throughput sequencing, viruses that are not significantly pathogenic to host plants and can effectively replicate and spread can be screened as VIGS vectors, thereby effectively avoiding interfering phenotypes such as leaf yellowing, deformity, and dwarfing that are common in traditional VIGS systems. This will greatly improve the accuracy and interpretability of phenotypic observations in VIGS experiments.

[0010] (2) Expand applicable plant species and varieties: By screening host-specific viruses, VIGS vectors can be tailored according to the target plant species, improving the compatibility between the vector and the host, and solving the current problem of limited application of VIGS systems in certain crops, wild plants or important genetic materials.

[0011] (3) Enhance the universality and promotion of VIGS technology: Low-pathogenic or non-pathogenic viruses usually remain stable in plants for a longer period of time, which helps maintain the persistence and consistency of the VIGS effect. This effectively avoids silencing interruptions or phenotypic instability caused by premature removal or inactivation of the virus.

[0012] (4) Improve the stability and durability of the VIGS system: Low-pathology viruses grow normally after infection in plants, eliminating the need for complex disease control or growth remediation measures. This simplifies the VIGS experimental process, lowers the experimental threshold and cost, and effectively avoids silencing interruptions or phenotypic instability caused by premature virus removal or inactivation. BRIEF DESCRIPTION OF THE DRAWINGS

[0013] Figure 1 : Full-length structure of TVS virus genome.

[0014] Figure 2 : TVS virus genome segmental amplification.

[0015] Figure 3 : Schematic diagram of the construction of pXT-R1 vector and pXT-R2 vector.

[0016] Figure 4 : Schematic diagram of the construction of pTVS2-MCS2 vector and pTVS2-PDSx vector.

[0017] Figure 5 : NbPDS sequence used for VIGS.

[0018] Figure 6 : Phenotypic changes in Nicotiana benthamiana seedlings after infection with infectious fluid.

[0019] Figure 7 : Detection of TVS virus in Nicotiana benthamiana seedlings after infection with infectious fluid. DETAILED DESCRIPTION

[0020] In order to make the contents of the present invention easier to understand, the technical solutions of the present invention are further described below in conjunction with specific implementation methods, but the present invention is not limited thereto.

[0021] It should be noted that the vectors obtained during the development of the present invention were obtained through various cross-combinations of gene sequences and fragments. The specific acquisition process, which is not described in detail, is a technical secret. Those skilled in the art can also directly synthesize the vectors based on the present disclosure without affecting the implementation of the present invention, but the cost will be increased.

[0022] Example 1: In the early stages of this study, high-throughput sequencing (HTS) technology systematically screened for an RNA virus naturally present in tea plants that does not cause obvious pathological symptoms upon infection. The virus, named tea virus S (TVS), is a bipartite virus comprising TVS-RNA1 and TVS-RNA2. The nucleotide sequence of TVS-RNA 1 is shown in SEQ ID NO. 1, and the nucleotide sequence of TVS-RNA2 is shown in SEQ ID NO. 2.

[0023] 1. Total RNA was extracted from leaves of Yunnan Dali tea [Camellia taliensis (WWSmish) Melchior] infected with TVS virus using the hot phenol method. The specific steps are as follows: (1) In a fume hood, take out 400 μL of water-saturated phenol reagent and preheat it at 80°C; (2) Burn the mortar with a small amount of anhydrous ethanol (if sterilized, burning is not necessary). After cooling slightly, pour liquid nitrogen into the mortar to fully cool it. After cooling, use clean PE gloves to place the leaf sample taken out of the -80℃ freezer or the freshly picked leaf sample into the mortar, add liquid nitrogen, and use a pestle to quickly crush the leaf, adding liquid nitrogen while grinding. After grinding into fine powder, immediately scrape the powder into a 1.5mL centrifuge tube and fill it with about 500μL; (3) Add 400 μL of preheated water-saturated phenol and 400 μL of RNA extraction buffer to the scraped powder, shake for 30 seconds, and let stand at room temperature for 5 minutes; (4) Add 400 μL CHCl3, shake for 30 seconds, let stand at room temperature for 5 minutes, and centrifuge at 12000 rpm for 15 minutes at room temperature; (5) Take 300-400 μL of supernatant and place it in a new 1.5 mL centrifuge tube. Add an equal volume of 4 M LiCl solution, mix well, and let stand at -20°C for more than 4 hours. (6) Centrifuge at 12,000 rpm for 15 min at 4°C and discard the supernatant. Rinse the pellet with 500 μL of pre-cooled 75% ethanol solution and centrifuge at 12,000 rpm for 5 min at 4°C. Discard the supernatant and repeat the above steps once. Pour off the alcohol used in the second rinse and centrifuge briefly. Aspirate the remaining alcohol with a white pipette tip gently to avoid aspirating RNA clumps. (7) Place the centrifuge tube in a fume hood for 5 minutes. After the alcohol has fully evaporated, add 20 μL of ddH2O and store at -20°C.

[0024] 2. The total RNA extracted in the previous step was reverse transcribed and amplified to obtain cDNA (TVS-RNA1 and TVS-RNA2 have the same terminal sequences, so the cDNAs of TVS-RNA1 and TVS-RNA2 can be obtained simultaneously using only the terminal primer 3778R).

[0025] The reaction system is as follows: RNA template 1 μg, end primer 3778R 2 μL, 5× II buffer 4 μL, 0.1 M DTT 2 μL, 10 mM dNTP mix 1 μL, ProtoScript II RT 1 μL, and ddH2O to 20 μL; The reaction conditions were: 42°C for 2 h, 65°C for 20 min.

[0026] 3778R: 5'-AAAGCTTATTCTAAGTGCCAGA-3'; 3. PCR amplification of TVS virus fragments use MAX DNA high-fidelity polymerase (R045A, TaKaRa) was used, using the cDNA obtained above as a template, and PCR amplification was performed using primer pair R1-N1F / R1-3529R to obtain TVS virus fragment 1-1, primer pair R1-3508F / XT-12R to obtain TVS virus fragment 1-2, and primer pair XT-R2-N1F / XT-12R to obtain TVS virus fragment 2; the nucleotide sequence of fragment 1-1 is shown in SEQ ID NO.3, the nucleotide sequence of fragment 1-2 is shown in SEQ ID NO.4, and the nucleotide sequence of fragment 2 is shown in SEQ ID NO.5.

[0027] The reaction system was as follows: PrimeSTAR MAX premix (2×) 25 μL, 10 mM upstream primer 1 μL, 10 mM downstream primer 1 μL, cDNA template 2 μL, and ddH2O added to 20 μL. The reaction conditions were: 94°C for 3 min, 94°C for 30 s, 55°C for 30 s, 72°C for 15-30 s / kb, 72°C for 10 min, and 22°C for 2 min.

[0028] R1-N1F: 5'-TTTCATTTGGAGAGGTTTGAAAAGCAACCTGCGAAC-3'; R1-3529R: 5'-CTCCTCGGAATAATAAGTCAGC-3'; R1-3508F: 5'-GCTGACTTATTATTCCGAGGAG-3'; XT-12R: 5'-GCCGACCCGGGGATCAAAGCTTATTCTAAGTGCCAG-3'; XT-R2-N1F: 5'-TTTCATTTGGAGAGGTTTGAAAAGCAATCTGCGAA-3'.

[0029] 4. Seamless cloning and connection vector: (1) The binary vector pXT (a gift from Professor Tao Xiaorong of Nanjing Agricultural University and disclosed in patent CN202210418050.6) was double-digested with restriction endonucleases StuI (R0187S, NEB) and BamHI (R3136S, NEB), and the large fragment was recovered using a gel recovery kit to obtain the linearized vector pXT.

[0030] (2) Fragment 1-1 and fragment 1-2 were cloned with the linearized vector pXT using a seamless cloning kit The ligation product was transformed into Escherichia coli JM109 competent cells using Ultra One Step Clone Kit (C115, Vazyme), and the transformants were screened by ampicillin resistance, identified and sequenced to obtain the pXT-R1 vector.

[0031] The reaction system was as follows: linearized vector pXT 92.46 ng, fragment 1-170.86 ng, fragment 1-275.74 ng, 2× CloneExpress mix 2.5 μL, and ddH2O to 10 μL; The reaction conditions were: 50°C for 15 min.

[0032] (3) Fragment 2 was ligated with the linearized vector pXT using homologous recombinase, and the ligation product was transformed into Escherichia coli JM109 competent cells. The transformants were screened by ampicillin resistance and identified and sequenced to obtain the pXT-R2 vector.

[0033] The reaction system was as follows: linearized vector pXT 92.46 ng, fragment 2152.3 ng, 2× CloneExpress mix 2.5 μL, and ddH2O added to 10 μL; Reaction conditions: 50℃5min.

[0034] Example 2: Using the pXT-R1 vector as a template, inverse PCR amplification of the Rev-poly(A)-F / Rev-poly(A)-R primers was performed. The PCR product was purified, the plasmid template was removed with DpnI (R0176V, NEB), phosphorylated, and then self-ligated with T4 DNA ligase (2011A, TaKaRa) to obtain a recombinant vector with a specific number of poly(A) residues. Using the pXT-R2 vector as a template, inverse PCR amplification of the Rev-poly(A)-F / Rev-poly(A)-R primers was performed. The PCR product was purified, the plasmid template was removed with DpnI (R0176V, NEB), phosphorylated, and then self-ligated with T4 DNA ligase (2011A, TaKaRa) to obtain a recombinant vector with a specific number of poly(A) residues. Poly(A) residues were successfully added to the pXT-R2 vector, while they were not successfully added to the pXT-R1 vector. The pXT-R2 vector with 20 A bases added was named pTVS2, and the pXT-R1 vector without poly(A) added was named pTVS1. The nucleotide sequence of the pTVS1 vector is shown in SEQ ID NO.6, and the nucleotide sequence of the pTVS2 vector is shown in SEQ ID NO.7. The specific steps are as follows: 1. Use inverse PCR to add a poly(A) tail to the 3' end of TVS When the TVS full-length cDNA clone without poly(A) was used to infect Nicotiana benthamiana, the infection efficiency was unstable. In order to enhance the infection efficiency, poly(A) was added to the 3' end of the TVS genome using inverse PCR. Under the action of MAX DNA high-fidelity polymerase (R045A, TaKaRa), PCR amplification of Rev-poly(A)-F / Rev-poly(A)-R was performed using primers, and the resulting PCR amplification product was recorded as fragment R1A. Using pXT-R2 vector as template, Under the action of MAX DNA high-fidelity polymerase (R045A, TaKaRa), PCR amplification of Rev-poly(A)-F / Rev-poly(A)-R was performed using primers, and the obtained PCR amplification product was recorded as fragment R2A.

[0035] The reaction system was as follows: PrimeSTAR MAX premix (2×) 25 μL, 10 mM upstream primer 1 μL, 10 mM downstream primer 1 μL, template 2 μL, and ddH2O added to 20 μL. The reaction conditions were: 94°C for 3 min, 94°C for 30 s, 55°C for 30 s, 72°C for 15-30 s / kb, 72°C for 10 min, and 22°C for 2 min.

[0036] Rev-poly(A)-F:5'-AAAAAAAAAAAAAAAAAAAAgatccccgggtcggcatg-3' Rev-poly(A)-R:5'-AAAGCTTATTCTAAGTGCCAGAACTAAAC-3' 2. The PCR amplification products from the previous step were purified and treated with endonuclease DpnI to remove the template plasmid.

[0037] The reaction system was as follows: 1 μg of PCR amplification product, 1 μL of DpnI, 5 μL of 10× buffer, and ddH2O added to 50 μL. The reaction conditions were: 37°C for 30 min, 80°C for 20 min.

[0038] 3. Phosphorylate the enzyme digestion products from the previous step separately.

[0039] The reaction system is as follows: 50 μL of enzyme digestion product, 10 μL of 10×T4 PNK buffer, 10 μL of 10 mM ATP, 2 μL of T4PNK, and ddH2O to 100 μL. The reaction conditions were: 37°C for 30 min, 65°C for 20 min.

[0040] 4. Use a multifunctional DNA purification kit (DH103, Biomed Biotechnology Co., Ltd.) to purify the phosphorylation products of the previous step.

[0041] 5. The purified products from the previous step were self-ligated using T4 DNA ligase.

[0042] The reaction system is as follows: T4 DNA ligase 1 μL, 10× buffer 2 μL, purified product 300 ng, and ddH2O added to 20 μL; The reaction conditions were: 16°C for 30 min or 4°C overnight.

[0043] 6. The ligation products from the previous step were transformed into E. coli JM109 competent cells, and the transformants were screened by ampicillin resistance, identified and sequenced to obtain pTVS1 vector and pTVS2 vector, respectively.

[0044] Example 3: pTVS2-MCS2 introduces the five bases GGCCT after the ORF frame stop codon of TVS-RNA2 and contains a single StuI restriction site. Based on the TVS-RNA2 sequence, the primer pairs Rev-3orf-2StuI-F and Rev-R2-3orf-3360R were designed. Using the pTVS2 vector as a template, inverse PCR amplification was performed using MAX DNA high-fidelity polymerase to introduce a StuI restriction site after the ORF frame stop codon of pTVS2. The PCR product was purified and treated with DpnI enzyme to remove the template plasmid. After phosphorylation and purification steps, it was finally self-ligated with T4 DNA ligase to obtain the pTVS2-MCS2 vector; the nucleotide sequence of the pTVS2-MCS2 vector is shown in SEQ ID NO.8. The specific operation method is as follows: 1. Using pTVS2 vector as template, Under the action of MAX DNA high-fidelity polymerase (R045A, TaKaRa), PCR amplification was performed using primers Rev-R2-3orf-2StuI-F / Rev-R2-3orf-3360R to obtain a PCR amplification product.

[0045] The reaction system was as follows: PrimeSTAR MAX premix (2×) 25 μL, 10 mM upstream primer 1 μL, 10 mM downstream primer 1 μL, template 2 μL, and ddH2O added to 20 μL. The reaction conditions were: 94°C for 3 min, 94°C for 30 s, 55°C for 30 s, 72°C for 15-30 s / kb, 72°C for 10 min, and 22°C for 2 min.

[0046] Rev-R2-3orf-2StuI-F:5'-ggcctGTTCCTTCCTCTCTCTTTCT-3' Rev-R2-3orf-3360R:5'-TTAACCAACGACAAAAGTATTCTC-3' 2. Purify the PCR amplification product from the previous step and treat it with endonuclease DpnI to remove the template plasmid.

[0047] The reaction system was as follows: 1 μg of PCR amplification product, 1 μL of DpnI, 5 μL of 10× buffer, and ddH2O added to 50 μL. The reaction conditions were: 37°C for 30 min, 80°C for 20 min.

[0048] 3. Phosphorylate the enzyme digestion product from the previous step.

[0049] The reaction system is as follows: 50 μL of enzyme digestion product, 10 μL of 10×T4 PNK buffer, 10 μL of 10 mM ATP, 2 μL of T4PNK, and ddH2O to 100 μL. The reaction conditions were: 37°C for 30 min, 65°C for 20 min.

[0050] 4. Use a multifunctional DNA purification kit (DH103, Biomed Biotechnology Co., Ltd.) to purify the phosphorylated product from the previous step.

[0051] 5. The purified product from the previous step was self-ligated using T4 DNA ligase.

[0052] The reaction system is as follows: T4 DNA ligase 1 μL, 10× buffer 2 μL, purified product 300 ng, and ddH2O added to 20 μL; The reaction conditions were: 16°C for 30 min or 4°C overnight.

[0053] 6. The ligation product from the previous step was transformed into E. coli JM109 competent cells, and the transformants were screened by ampicillin resistance, identified and sequenced to obtain the pTVS2-MCS2 vector.

[0054] Example 4: Primers were designed based on the NbPDS gene sequence of Nicotiana benthamiana to amplify five different specific nucleotide fragments for silencing the NbPDS gene of Nicotiana benthamiana. These fragments were then ligated into the pTVS2-MCS2 vector to generate the pTVS2-PDSx vector. The specific steps are as follows: 1. Specific primer pairs anti-210F / anti-R, anti-310F / anti iR, anti-410F / anti-R, anti-510F / anti-R, and anti-408F / anti-408R were designed for the Nicotiana benthamiana NbPDS gene (EU165355.1) to obtain different specific nucleotide fragments for silencing the Nicotiana benthamiana NbPDS gene, and homologous sequences and restriction sites at both ends of the linearized vector were added to both ends of the fragments.

[0055] anti-210F: 5'-AGGGAAGGAACAGGGGTTGTGAACCCTGTCGG-3' anti-310F: 5'-AGGGAAGGAACAGGGAAGCTTTTCCCTGATGA-3' anti-410F: 5'-AGGGAAGGAACAGGACCCCAATCAGTCTATGT-3' anti-510F: 5'-AGGGAAGGAACAGGGACAGAAAACTGAAGAACAC-3' anti-R: 5'-TGTCGTTGGTTAAGGGTTCACTATGCTAACTACGCTTG-3' anti-408F: 5'-AGGGAAGGAACAGGGCACTCAACTTTATAAACCC-3' anti-408R: 5'-TGTCGTTGGTTAAGGCTTCAGTTTTCTGTCAAAC-3' 2. Perform high-fidelity PCR amplification of target gene fragments Total RNA was extracted from healthy Nicotiana benthamiana and reverse transcribed into cDNA.

[0056] The reaction system is as follows: 1 μg RNA template, 2 μL 10 mM downstream primer, 5× II buffer 4 μL, 0.1 M DTT 2 μL, 10 mM dNTP mix 1 μL, ProtoScript II RT 1 μL, and ddH2O to 20 μL; The reaction conditions were: 42°C for 2 h, 65°C for 20 min.

[0057] Using the cDNA obtained by reverse transcription as a template, primer pairs anti-210F / anti-R, anti-310F / anti-R, anti-410F / anti-R, anti-510F / anti-R, and anti-408F / anti-408R were used to amplify nucleotide fragments with nucleotide sequences of SEQ ID NO.9, SEQ ID NO.10, SEQ ID NO.11, SEQ ID NO.12, and SEQ ID NO.13, respectively.

[0058] 3. The pTVS2-MCS2 vector was digested with StuI, and then the above five nucleotide fragments of different lengths were ligated with the pTVS2-MCS2 vector digested with StuI using T4 ligase to obtain pTVS2-PDSx vectors: pTVS2-PDS210, pTVS2-PDS310, pTVS2-PDS410, pTVS2-PDS510, and pTVS2-PDS408; pTVS2-PDS210 contained SEQ ID NO.9, pTVS2-PDS310 contained SEQ ID NO.10, pTVS2-PDS410 contained SEQ ID NO.11, pTVS2-PDS510 contained SEQ ID NO.12, and pTVS2-PDS408 contained SEQ ID NO.13.

[0059] Example 5: In the experimental group, five pTVS2-PDSx vectors were transformed into Agrobacterium GV3101, and the pTVS1 vector was transformed into Agrobacterium GV3101. Agrobacterium cultures containing different pTVS2-PDSx vectors were mixed with Agrobacterium cultures containing pTVS1 vectors to prepare infection solutions. An Agrobacterium culture containing the empty vector pXT served as a negative control. A mixture of Agrobacterium cultures containing pTVS1 and pTVS2 served as a positive control. The specific steps are as follows: 1. Preparation of competent Agrobacterium (1) Take out the Agrobacterium GV3101 competent cells at -80°C and freeze-thaw on ice; (2) Streak the plate (LB without resistance) and incubate at 28°C overnight; (3) Pick a single colony and place it in an appropriate volume of LB liquid medium without resistance and culture it at 28°C overnight; (4) The next day, the cells were inoculated into 250 mL of Rif-resistant LB liquid medium at a ratio of 1:100 and cultured at 28°C until OD 600 to around 0.6; (5) Centrifuge the bacterial solution at 4000 rpm for 10 min at 4°C and discard the supernatant; (6) Add 50 mL of 4°C pre-cooled 0.15 M NaCl solution to the bacterial pellet. After the bacterial pellet is completely suspended, place it in an ice bath for 30 min. (7) Centrifuge at 4000 rpm for 10 min at 4°C and discard the supernatant; (8) Add 5 mL of pre-chilled 20 mM CaCl2 to the bacterial pellet and completely suspend the cells. Place on ice for 30 min. (9) Add glycerol to a final concentration of 20% and mix well; (10) Aliquot 100 μL per tube, freeze quickly in liquid nitrogen, and store at -80°C.

[0060] 2. Agrobacterium Transformation (1) Add an appropriate amount of plasmid to the competent cells of Agrobacterium GV3101, stir slowly with a pipette tip, and incubate on ice for 30 minutes.

[0061] (2) Quickly freeze in liquid nitrogen for 1 min, 37°C for 5 min, and ice bath for 2 min.

[0062] (3) Add 1 mL of antibiotic-free LB liquid medium and shake slowly at 28°C for 4–8 h. (4) Spread 200 μL of bacterial solution on a non-resistant LB plate and incubate at 28°C for 48 h; 3. Preparation of Agrobacterium tumefaciens (1) Single colonies were picked and inoculated into LB liquid medium containing 50 μg / mL Kan, 50 μg / mL Rif, 10 mM MES, and 150 μM AS, and cultured and activated at 28°C; (2) The next day, the activated bacterial solution was inoculated into LB liquid medium containing 50 μg / mL Kan, 50 μg / mL Rif, 10 mM MES, and 150 μM AS at a dilution of 1:100, and cultured at 28°C until the OD 600 to 0.6~1.0; (3) Centrifuge the bacterial solution at 3500 rpm for 5 min at room temperature and discard the supernatant. Add an appropriate amount of Agrostalk resuspension buffer (10 mM MgCl2, 10 mM MES, 150 μM AS) to the bacterial pellet, suspend the bacterial cells, and adjust the OD 600 To 0.6-1.0, stand at room temperature away from light for more than 4 hours.

[0063] 4. Infection with Nicotiana benthamiana (1) Injection method was used to infect the leaves of Nicotiana benthamiana seedlings at the four-leaf stage: OD 600Mix equal volumes of pTVS1 Agrobacterium suspension and pTVS2-PDSx Agrobacterium suspension with the same optical density to obtain an infection solution. Use a 1 mL sterile syringe with the needle removed to draw up the infection solution. Gently place the syringe against the underside of a leaf, applying a little force but not damaging the leaf. Inject slowly, filling the leaf with infection solution as much as possible. Try to make fewer than two needle holes per leaf to minimize damage. (2) Seedlings were incubated in the dark for 72 h after infection and then continued to grow under a photoperiod of 20°C (15 h light) / 18°C (9 h dark); (3) After 7 days, a second infection is performed to enhance the silencing effect. The infection method is the same as the first infection.

[0064] 5. Gene silencing detection: (1) Observe the leaves of infected Nicotiana benthamiana seedlings under sunlight to see if they show signs of bleaching. Primer pairs R1-1145F / 1548R and R2-1376F / 1713R were used to detect whether the leaves of infected Nicotiana benthamiana seedlings contained the TVS-RNA1-specific fragment (403 bp) and the TVS-RNA2-specific fragment (337 bp), respectively.

[0065] R1-1145F: 5'-GGATGTATGATTCTGACGAGG-3' R1-1548R:5'-CCTCCAATCCTCAAACACAAG-3' R2-1376F:5'-CCACTCTCCCGACTATTCCAG-3' R2-1713R: 5'-TGGCTTACACCTCAAGTACC-3' (2) Perform Northern blot to confirm viral replication and silencing effects.

[0066] Systemic leaves of Nicotiana benthamiana were collected 15 days after infection and high-molecular-weight RNA was extracted using the hot phenol method for Northern blot analysis, thereby verifying the infectivity of clones at the RNA level. A loading of 5 μg of high-molecular-weight RNA was used. Probes were synthesized using the pTVS1 and pTVS2 plasmids as templates, using the 3' primers R1-6459F / R1-7278R for TVS-RNA1 and R2-3212F / R2-3778R for TVS-RNA2, respectively, using biotin labeling. Probes were identified by agarose gel electrophoresis and then used for hybridization.

[0067] R1-6459F: 5'-GGTTGTCGTTGTTCGTGAC-3' R1-7278R: 5'-AAAGCTTATTCTAAGTGCCAGA-3' R2-3212F: 5'-CACTGCTGCTCTACTTCACG-3' R2-3778R: 5'-AAAGCTTATTCTAAGTGCCAGA-3' (3) Western blot was performed to confirm viral replication and silencing effects.

[0068] Systemic leaves of N. benthamiana were collected 15 days after infection. Total protein was extracted using the crude protein extraction method for Western blot analysis, verifying the infectivity of the full-length cDNA clone at the protein level. Five μL of the denatured protein mixture was loaded onto a 12% SDS-PAGE gel and transferred to a nitrocellulose membrane using a semi-dry transfer method. The primary antibody used was a prepared TVS-LCP polyclonal antiserum at a dilution of 1:10,000. The secondary antibody was a goat anti-rabbit antibody at a dilution of 1:40,000.

[0069] The present invention first infected four-leaf Nicotiana benthamiana plants, followed by a second infection seven days later. Albinism was observed in the experimental group around day 17, with a per-plant albinism rate (number of plants exhibiting albinism divided by total number of inoculated plants * 100%) reaching 90%. The phenotype became even more pronounced thereafter. Both RNA and protein hybridization results showed that TVS-specific fragments were detected in the leaves of the infected Nicotiana benthamiana seedlings, demonstrating that the constructed VIGS vector can successfully infect Nicotiana benthamiana.

[0070] The above description is only a preferred embodiment of the present invention. All equivalent changes and modifications made according to the scope of the patent application of the present invention should fall within the scope of the present invention.

Claims

1. A Nicotiana benthamiana PDS silencing system based on tea S virus, characterized by: The Nicotiana benthamiana PDS silencing system comprises a pTVS1 vector and a pTVS2-MCS2 vector. The nucleotide sequence of the pTVS1 vector is shown in SEQ ID NO.6, and the nucleotide sequence of the pTVS2-MCS2 vector is shown in SEQ ID NO.

8.

2. The Nicotiana benthamiana PDS silencing system according to claim 1, characterized in that: The viral sequence in the pTVS1 vector is derived from RNA1 of tea S virus, namely TVS-RNA1, and the nucleotide sequence of TVS-RNA1 is shown in SEQ ID NO.1; the viral sequence in the pTVS2-MCS2 vector is derived from RNA2 of tea S virus, namely TVS-RNA 2, and the nucleotide sequence of TVS-RNA2 is shown in SEQ ID NO.

2.

3. The Nicotiana benthamiana PDS silencing system according to claim 1, characterized in that: The Nicotiana benthamiana PDS silencing system further comprises a Nicotiana benthamiana PDS gene; the Nicotiana benthamiana PDS gene is inserted into a pTVS2-MCS2 vector by enzyme cutting and ligation.

4. The Nicotiana benthamiana PDS silencing system according to claim 2, characterized in that: The construction method of the pTVS1 vector comprises the following steps: (1) Total RNA was extracted from tea leaves infected with tea S virus, and then cDNA was obtained by reverse transcription amplification; (2) Using the cDNA obtained by reverse transcription amplification as a template, PCR amplification was performed using the primer pair TTTCATTTGGAGAGGTTTGAAAAGCAACCTGCGAAC and CTCCTCGGAATAATAAGTCAGC to obtain a fragment 1-1 with a nucleotide sequence as shown in SEQ ID NO. 3; using the cDNA obtained by reverse transcription amplification as a template, PCR amplification was performed using the primer pair GCTGACT TATTATTCCGAGGAG and GCCGACCCGGGGATCAAAGCTTATTCTAAGTGCCAG to obtain a fragment 1-2 with a nucleotide sequence as shown in SEQ ID NO. 4; (3) The binary vector pXT was double-digested with restriction endonucleases StuI and BamHI to obtain a linearized vector pXT; fragments 1-1 and 1-2 were ligated with the linearized vector pXT under the action of homologous recombinase to obtain a pXT-R1 vector; (4) Using the pXT-R1 vector as a template, PCR amplification was performed using primers AAAAAAAAAAAAAAAAAAAAAagatccccgggtcggcatg and AAAGCTTATTCTAAGTGCCAGAACTAAAC. The amplified product was digested with DpnI to remove the plasmid template. The digested product was phosphorylated and self-ligated under the action of T4 DNA ligase to obtain the pTVS1 vector.

5. The Nicotiana benthamiana PDS silencing system according to claim 2, characterized in that: The construction method of the pTVS2-MCS2 vector comprises the following steps: (1) Total RNA was extracted from tea leaves infected with tea S virus, and then cDNA was obtained by reverse transcription amplification; (2) Using the cDNA obtained by reverse transcription amplification as a template, PCR amplification was performed using primers TTTCATTTGGAGAGGTTTGAAAAGCAATCTGCGAA and GCCGACCCGGGGATCAAAGCTTATTCTAAGTGCCAG to obtain fragment 2 with the nucleotide sequence shown in SEQ ID NO. 5; (3) The binary vector pXT was double-digested with restriction endonucleases StuI and BamHI to obtain a linearized vector pXT; fragment 2 was ligated with the linearized vector pXT under the action of a homologous recombinase to obtain a pXT-R2 vector; (4) Using the pXT-R2 vector as a template, PCR amplification was performed using the primer pair AAAAAAAAAAAAAAAAAAAAgatccccgggtcggcatg and AAAGCTTATTCTAAGTGCCAGAACTAAAC. The amplified product was digested with DpnI to remove the plasmid template. The digested product was phosphorylated and self-ligated with T4 DNA ligase to obtain the pTVS2 vector. (5) Using the pTVS2 vector as a template, PCR amplification was performed using primers ggcctGTTCCTTCCCTCTCTTTCT and TTAACCAACGACAAAAGTATTCTC. The amplified product was digested with DpnI to remove the plasmid template. The digested product was phosphorylated and self-ligated under the action of T4 DNA ligase to obtain the pTVS2-MCS2 vector.

6. Use of the Nicotiana benthamiana PDS silencing system according to claim 1 in identifying the function of Nicotiana benthamiana PDS gene and silencing Nicotiana benthamiana PDS gene.

7. The use according to claim 6, characterized in that: The following steps are involved: (1) Designing primer pairs for silencing specific nucleotide fragments of the Nicotiana benthamiana PDS gene, performing PCR amplification using Nicotiana benthamiana cDNA as a template, and inserting the PCR amplification product into the pTVS2-MCS2 vector by enzyme digestion and ligation to obtain the pTVS2-PDSx vector; (2) The pTVS1 vector and the pTVS2-PDSx vector were respectively transformed into Agrobacterium to obtain Agrobacterium containing the pTVS1 vector and Agrobacterium containing the pTVS2-PDSx vector, respectively; (3) Mixing the Agrobacterium culture solution containing the pTVS1 vector and the Agrobacterium culture solution containing the pTVS2-PDSx vector to obtain an infection solution; (4) Inject the infection solution into the leaves of Nicotiana benthamiana seedlings; continue to culture the Nicotiana benthamiana seedlings after infection and observe the phenotypic changes of the seedlings.

8. The use according to claim 7, characterized in that: The nucleotide sequence of the primer pair is selected from any one of the following: (1) AGGGAAGGAACAGGGGTTGTGAACCCTGTCGG and TGTCGTTGGTTAAGGGTTCACTATGCTAACTACGCTTG; (2) AGGGAAGGAACAGGGAAGCTTTTCCCTGATGA and TGTCGTTGGTTAAGGGTTCACTATGCTAACTACGCTTG; (3) AGGGAAGGAACAGGACCCCAATCAGTCTATGT and TGTCGTTGGTTAAGGGTTCACTATGCTAACTACGCTTG; (4) AGGGAAGGAACAGGGACAGAAAACTGAAGAACAC and TGTCGTTGGTTAAGGGTTCACTATGCTAACTACGCTTG; (5) AGGGAAGGAACAGGGCACTCAACTTTATAAACCC and TGTCGTTGGTTAAGGCTTCAGTTTTCTGTCAAAC.

Images