Genetic all-male tilapia breeding method

Abstract

The application discloses a genetic all-male tilapia breeding method and belongs to the technical field of tilapia breeding. hsd17b1 As a target, a specific sgRNA is designed at the first exon and the second exon of hsd17b1 gene by using a gene editing strategy, a large fragment knockout mutant is constructed through embryo microinjection, a double-target large fragment knockout homozygous F2 generation individual is obtained through hybridization screening, a genetically stable mutant line is successfully constructed, and a homozygous mutant line female fish is subjected to high-temperature treatment at a key window period of sex differentiation, so that the gonad is completely masculinized, and finally, an all-male fry population with genetic sex XX but phenotypic functions all being male is obtained. In the application, the female and male mutants can be fertile, a large number of homozygous mutant female and male parent fishes can be maintained, and homozygous mutant fry can be produced on a large scale, so that the bottleneck that parent fishes cannot be continuously bred due to traditional gene editing is broken through.

Description

Technical Field

[0001] This invention relates to the field of tilapia breeding technology. More specifically, this invention relates to a genetically modified method for breeding all-male tilapia. Background Technology

[0002] Nile tilapia ( Oreochromis niloticus Nile tilapia is a top-quality aquaculture species recommended by the Food and Agriculture Organization of the United Nations (FAO) to countries worldwide. With few bones and rich in omega-3 fatty acids, it is a preferred alternative to overfished fish. China, as the world's largest tilapia producer, has an annual output exceeding 1.6 million tons, generating over US$1 billion in foreign exchange annually. Through the integration of sex-controlled breeding and gene editing technologies, China hopes to build a fully male-dominated, high-yield tilapia farming system, promoting cost reduction and efficiency improvement in aquaculture, while simultaneously contributing to global food security and sustainable development goals. Nile tilapia exhibits a typical XX / XY sex determination pattern, with males growing faster than females. The direction of tilapia sex differentiation is determined by the antagonism between female and male pathway genes. The influence of environmental temperature on tilapia sex determination and differentiation varies significantly among different strains, broadly categorized into temperature-sensitive (ESD) and temperature-insensitive (GSD) types. In temperature-dependent sex determination (TSD) tilapia farming, despite significant advancements in modern breeding techniques, large-scale production of all-male individuals still primarily relies on methyltestosterone-induced sex differentiation regulation. This technique, through precise control of hormone exposure during early fry development, can consistently achieve a male conversion rate of over 95%, and remains the core technology for commercializing all-male tilapia in aquaculture. However, the application of hormone treatment technology has also sparked ongoing discussions within the academic community regarding the biosafety of farmed products and their potential impact on the ecological environment.

[0003] From the perspective of sex-controlled breeding technology, the large-scale production of genetically all-male tilapia is still plagued by two major challenges. First, while gene editing technology can knock out female pathway genes to produce homozygous male tilapia, since all homozygous individuals will develop into males, it is impossible to obtain homozygous female parent fish. Therefore, mass production of all-male fry is not yet possible using gene editing technology. Second, even in temperature-sensitive tilapia, high-temperature exposure increases the male rate to some extent (approximately 70%), but genetically all-male breeding is still not possible. Because tilapia have high reproductive capacity, once mature male and female individuals are available, a large number of fry will be produced. Different batches compete for food resources, resulting in significant differences in individual size and growth within the group, affecting the uniformity of market supply. Summary of the Invention

[0004] The purpose of this invention is to provide a genetic breeding method for all-male tilapia. By integrating gene editing and temperature response mechanisms, it not only ensures the stable inheritance of mutant genotypes (homozygous females and males can reproduce autonomously), but also achieves complete maleification through controllable environmental conditions.

[0005] To achieve these objectives and other advantages according to the present invention, a genetically engineered all-male tilapia breeding method is provided, comprising the following steps:

[0006] CRISPR / Cas9 gene editing was used to target Nile tilapia fertilized eggs. hsd17b1 Gene knockout is performed, and the target sites selected for gene knockout include those located in... hsd17b1 The target 1 on the first exon of the gene and the target 2 on the second exon, the sequence of the target 1 is shown in SEQ ID NO. 1 and the sequence of the target 2 is shown in SEQ ID NO. 2. The fertilized eggs are then hatched, positive individuals are selected and raised to sexual maturity as F0 generation.

[0007] Male fish from the F0 generation positive individuals were mated with wild-type female fish to obtain the F1 generation heterozygous male and female population.

[0008] The F1 generation of heterozygous male and female populations were bred to sexual maturity, self-crossed, and screened to obtain homozygous mutant females in the F2 generation.

[0009] The F2 generation homozygous mutant female fish were bred to sexual maturity, and the sex-reversed individuals in the F2 generation homozygous mutant female fish were hybridized with the non-sex-reversed individuals to obtain the F3 generation homozygous mutant female fish.

[0010] During the sex differentiation window, homozygous mutant female fish of the F3 generation were treated with a high temperature of 35-37℃ to induce complete maleization of their gonads, and finally a population of all-male fry with male phenotype and function was obtained.

[0011] Preferably, when screening positive individuals, the primers used to detect whether the hsd17b1 gene has been successfully knocked out include hsd17b1-detection primer F and hsd17b1-detection primer R, wherein the nucleotide sequence of hsd17b1-detection primer F is shown in SEQ ID NO. 3, and the nucleotide sequence of hsd17b1-detection primer R is shown in SEQ ID NO. 4.

[0012] Preferably, during the sex differentiation window, the F3 generation homozygous mutant female fish are subjected to a high temperature treatment of 35~37℃, specifically including: 36℃ high temperature incubation for 5 to 90 days after hatching, followed by transfer to a 26℃ normal temperature feeding system until adulthood, which can successfully obtain an all-male fry population.

[0013] Preferably, the high-temperature treatment is achieved through a stepped heating process, with the temperature increased in three stages over 24 hours:

[0014] i) Increase the temperature from 26°C to 30°C at a rate of ≤2°C / h and maintain the temperature for 4 hours;

[0015] ii) Continue to increase the temperature to 33°C at a rate of ≤1.5°C / h and maintain it for 8 hours;

[0016] iii) Finally, raise the temperature to 36°C at a rate of ≤1°C / h.

[0017] Preferably, the entire heating process is controlled by a titanium alloy heating rod and a PID temperature control feedback system, with water temperature fluctuations ≤ ±0.3℃;

[0018] Meanwhile, a circulating filtration system is used to maintain dissolved oxygen ≥6 mg / L and ammonia nitrogen concentration ≤0.05 mg / L in the water. Commercial pellet feed with a particle size of 0.2-0.5 mm is fed 4 times a day, and the feeding amount is dynamically adjusted according to 3%-5% of the fish's body weight.

[0019] Preferably, before applying high-temperature treatment during the sex differentiation window, a dynamic monitoring and regulation step of the sex differentiation state is also included, specifically:

[0020] Gene expression detection: Starting 15 days after hatching of the F3 generation homozygous mutant female fish, gonad tissue samples were collected every 5 days. The expression levels of the male pathway marker gene Gsdf and the female pathway marker gene Cyp19a1a were detected by real-time PCR or immunohistochemistry.

[0021] Determination of the initiation phase of temperature treatment: When the expression level of Gsdf continues to rise and reaches more than 0.5 times the expression level of Cyp19a1a, the mutant individual is determined to have entered the critical window period of temperature treatment;

[0022] Dynamic adjustment of high-temperature parameters: a) If ≥5% of individuals in the population reach the critical window period, high-temperature treatment at 35~37℃ will be started immediately; b) If <5% of individuals in the population reach the critical window period, the start time of high-temperature treatment will be delayed until the target is reached; c) After the high-temperature treatment is started, gene expression will be continuously monitored: if the Gsdf / Cyp19a1a expression ratio at any sampling point is <0.5, the duration of high-temperature treatment will be extended by 10~15 days.

[0023] Preferably, the high-temperature treatment adopts a periodic temperature fluctuation pattern, specifically: during the daily high-temperature exposure period, from 8:00 to 18:00, the temperature is maintained at 36℃±0.5℃; during the nighttime recovery period, from 18:00 to 8:00 the next day, the temperature is reduced to 30℃±0.5℃; the temperature fluctuation is achieved through a programmed temperature control system, with a heating / cooling rate ≤1℃ / 10 minutes; the total duration of the periodic treatment is ≥45 days, covering the entire critical window period of sex differentiation.

[0024] Preferably, the dynamic monitoring and control of the temperature treatment start-up time and status further includes:

[0025] Dynamic monitoring at the molecular level: The concentrations of Gsdf and Cyp19a1a proteins in the gonads were detected by tissue observation and immunofluorescence.

[0026] Automated decision-making system: Deploy an array of aquatic biosensors to collect sex hormone metabolite data in real time, combine with AI models to predict the progress of population differentiation, and dynamically trigger high-temperature treatment start commands;

[0027] Group processing mechanism: Based on RFID tags to identify the individual developmental status, the fish fry are grouped and processed in independent temperature-controlled units.

[0028] Among them: For individuals who meet the standard, high-temperature treatment should be initiated immediately if Gsdf / Cyp19a1a ≥ 0.5; for individuals who do not meet the standard, treatment should be delayed and continuous monitoring should be carried out; optimization of high-temperature treatment duration: if Gsdf / Cyp19a1a < 0.5 during high-temperature treatment, the temperature should be increased to 37℃ ± 0.5℃ first, and the treatment should be extended for 5 to 7 days only if the ratio is continuously lower than the threshold, and the treatment should be terminated when the testes are histologically mature or the serum 11-KT > 2 ng / mL.

[0029] Preferably, the step-by-step heating process also includes a water temperature uniformity control step: multiple temperature sensors are evenly distributed in the aquaculture water to monitor the temperature at different points in real time; if the temperature of any sensor deviates from the current stage set value by more than ±0.5℃, or the temperature difference between any two sensors is greater than 1℃, the output power of the titanium alloy heating rod and the water flow rate of the circulating filtration system are automatically adjusted until the temperature at all points returns to the set range.

[0030] Preferably, during high-temperature treatment, water quality parameters are dynamically adjusted based on real-time water temperature, specifically including:

[0031] Oxygen dynamic compensation: Adjust the aeration intensity according to the formula Dissolved oxygen setpoint = 6 + 0.5 × (real-time water temperature - 26) to maintain the dissolved oxygen content in the water body not lower than the setpoint.

[0032] Ammonia nitrogen enhancement control: Start enhanced filtration circulation within 1 hour after feeding to rapidly reduce ammonia nitrogen concentration to ≤0.04mg / L;

[0033] Equipment linkage execution: Based on feedback signals from temperature sensors, dissolved oxygen sensors, and ammonia nitrogen sensors, the operating parameters of the titanium alloy heating rod, aeration equipment, and circulating filtration system are linked and controlled.

[0034] The present invention has at least the following beneficial effects:

[0035] In this invention, both male and female mutant adult fish are fertile, and a large number of fertile homozygous mutant male and female broodstock can be maintained without exogenous hormone treatment. This enables large-scale production of homozygous mutant fry, overcoming the bottleneck of unsustainable parent reproduction caused by traditional gene editing. This is something other sex-linked gene mutations cannot achieve, because sex reversal in mutants often results in a single-sex population, making it impossible to obtain homozygous mutant male and female fish. Furthermore, the elimination of exogenous hormone treatment for broodstock reduces costs in aquaculture.

[0036] This technology, for the first time, integrates CRISPR / Cas9 gene editing with high-temperature stress regulation to establish a controllable all-male fry production system (100% male) in Nile tilapia. Compared with traditional hormone-induced aquaculture, this patent application relies on gene editing and temperature treatment to achieve all-male fry production, ensuring a hormone-free production process and avoiding pollution of the aquatic environment caused by excessive hormone application. Its controllability, operability, and low environmental risk significantly improve aquaculture yield and economic benefits, demonstrating broad application prospects in the sustainable and intensive development of fisheries.

[0037] In summary, the all-male tilapia population obtained by this technology possesses both genetic stability and fertility, providing an efficient solution for the large-scale production of high-growth-performance all-male fry.

[0038] Other advantages, objectives and features of the present invention will become apparent in part from the following description, and in part from those skilled in the art through study and practice of the invention. Attached Figure Description

[0039] Figure 1 for hsd17b1 Schematic diagram of gene target locations. (A and B) hsd17b1Gene structure and mutation target design: The gene consists of six consecutive exons, with each exon domain distinguished by color. The translation start site (ATG) and stop codon (TAA) are marked at opposite ends of the open reading frame. Specific mutation targets were designed in the first two exon regions, with bases marked in red on a purple background representing PAM (Protospacer adjacent motif, NGG / CCN) structures. Target1 and Target2 are the target sequences in the first and second exons of the hsd17b1 gene, respectively. The dashed lines indicate the deletion status of the target sequence, and the values ​​on the right precisely indicate the number of base deletions in each allele. C) Agarose gel electrophoresis detected the mutation status: wild-type contained only an 864 bp band, heterozygotes contained two bands, 864 bp and 370 bp, and homozygotes contained only a 370 bp band. M, DNA Marker DL2000. D) Sanger sequencing revealed a 501 bp in-frame deletion at the target site, along with a 7 bp insertion sequence. WT, Wild type; + / - hsd17b1 + / - ;- / -, hsd17b1 - / - .

[0040] Figure 2 High-temperature treatment can significantly improve hsd17b1 The proportion of homozygous mutant females undergoing sex reversal at 60 days post-hatching. (AC) Wild-type (n=4) hsd17b1 - / - XX (n=15) and hsd17b1 - / - Histological observation of gonadal development in individuals treated with high temperature (n=20). Fluorescent immunohistochemical staining was used to detect the expression and localization of the female pathway marker gene Cyp19a1a (A'-C') and the male pathway marker gene Gsdf (A''-C''). The numbers in the upper right corner indicate the proportion of individuals with this phenotype in the population. Blue indicates nuclear DAPI staining, red indicates Cyp19a1a signal, and green indicates Gsdf signal. WTXX represents wild-type female fish. hsd17b1 - / - XX is hsd17b1 A female fish with a homozygous genetic mutation; hsd17b1 - / - XX +HT represents a mutant female fish treated with high temperature; scale bar: 10μm.

[0041] Figure 3 High-temperature treatment significantly increased hsd17b1 The proportion of sex reversal at different stages of gene development, A) hsd17b1 The proportion of sex reversal at different times after hatching of homozygous mutants; the number in the upper right corner represents the proportion of this phenotype. hsd17b1 - / -XX: Indicates homozygous mutation hsd17b1 Female fish; hsd17b1 - / - XX+HT: Indicates a homozygous mutation treated at 36℃. hsd17b1 Female fish. B) Statistics on the proportion of sex reversal, 1M: represents homozygous mutations at 1 month of age. hsd17b1 Female fish condition; 3M: indicates a homozygous mutation at 3 months of age. hsd17b1 Female fish condition; 4M: indicates a homozygous mutation at 4 months of age. hsd17b1 Female fish condition; 2M+HT: indicates a homozygous mutation in 2-month-old fish treated at 36℃. hsd17b1 Female fish condition; 3M+HT: indicates a homozygous mutation in 3-month-old fish treated at 36℃. hsd17b1 Condition of the female fish.

[0042] Figure 4 : hsd17b1 Fertility analysis of homozygous mutant fish (AD) Histological analysis of gonads in tilapia of different genotypes: wild-type females (n=3) hsd17b1 Homozygous mutant XX ovarian phenotype individuals (n=3) hsd17b1 Homozygous mutant XX testis phenotype individuals (n=3) and wild-type males (n=3). Serum testosterone (T), 17β-estradiol (E2), and 11-ketotestosterone (11-KT) concentrations in adult fish were measured, with three biological replicates per group. Data are expressed as mean ± standard deviation (n=3), and different letters above the error line indicate statistically significant differences in one-way ANOVA combined with Tukey's post-hoc test (P<0.05). Papanicolaou staining was performed, and sperm morphology was observed at 240 days post-hatching (240 dah) for XY+ / + (n=3) and XX- / --T (n=5) sperm; arrows indicate normal sperm. hsd17b1 Schematic diagram of establishing a homozygous mutant line. XX + / + Wild-type female XX; XX - / - -O indicates preservation of ovarian structure hsd17b1 Homozygous mutant XX individuals; XX - / - -T refers to the presence of testicular structure hsd17b1 Homozygous mutant XX individuals; XY + / + Wild-type XY male fish; scale bar: 50μm. Detailed Implementation

[0043] The present invention will now be further described and illustrated in detail with reference to the accompanying drawings. It should be understood that the following embodiments are given for illustrative purposes only and are not intended to limit the scope of the invention. Those skilled in the art can make various modifications and substitutions to the present invention without departing from its spirit and intent. Unless otherwise specified, the experimental methods used in the following embodiments are conventional methods; the materials and reagents used in the following embodiments are commercially available unless otherwise specified.

[0044] 1: Nile tilapia hsd17b1 Construction of homozygous mutant lines

[0045] (1) Experimental materials

[0046] The wild-type (WT) Nile tilapia used in this experiment were obtained from the Key Laboratory of Freshwater Fish Resources and Reproductive Development of the Ministry of Education, Southwest University (Beibei, Chongqing). The experimental subjects were kept in a constant-temperature circulating water system (water temperature 26℃±1, photoperiod 12L:12D).

[0047] (2) Synthetic Nile tilapia hsd17b1 gRNA of genes

[0048] Download tilapia from NCBI (https: / / www.ncbi.nlm.nih.gov / ) hsd17b1 The complete sequence of the gene. hsd17b1 The nucleotide sequence of the gene is shown below:

[0049]

[0050] turn up hsd17b1 Gene exon regions were designed using the CRISPR / gRNA target sequence design website (http: / / zifit.partners.org / ZiFiT / ). hsd17b1 Target sequences. Specific principles and design methods are based on Li Minghui's doctoral dissertation (Li Minghui, 2014). The selected targets include target 1 located in the first exon of the hsd17b1 gene and target 2 located in the second exon.

[0051] The sequence of target 1 is shown in SEQ ID NO. 1: GGCTCCATGGATAAAAAGG;

[0052] The sequence of target 2 is shown in SEQ ID NO. 2: GGATGCAAGAGATAGGATTG;

[0053] The upstream primer for the gRNA is a designed target primer, and the downstream primer is a specific sequence on the gRNA template plasmid. This invention... hsd17b1 The primer sequences for the two target sites designed on the exons and the primer sequences for the gRNA are as follows:

[0054] gRNA-F1: TAATACGACTCACTATAACAGCACTGCCCTTACGCCGGTTTTAGAGCTAGAAATAGC;

[0055] gRNA-F2::TAATACGACTCACTATACAGCTCAAGAATGGTTGCGAGTTTTAGAGCTAGAAATAGC;

[0056] Synthesis of gRNA and Cas9 mRNA

[0057] gRNA synthesis: PCR amplification was performed using designed forward and reverse primers, as follows:

[0058]

[0059] After amplification, gel electrophoresis was performed for 20 minutes, and the target band was cut and recovered for in vitro transcription (entire process without enzymes).

[0060] In vitro transcription, the system is as follows:

[0061]

[0062] After mixing the system thoroughly, centrifuge and incubate at 37 ℃ for 2-3 h. Remove from the system, add 2 μL of DNase I, mix well, and incubate at 37 ℃ for 15 min. Then add 50 μL of anhydrous ethanol and 2 μL of NaAc, mix well, and incubate at -80 ℃ overnight.

[0063] gRNA extraction: On the second day, the reaction mixture was placed in a refrigerated centrifuge at 4 ℃, 12000 rpm, for 30 min, and the supernatant was discarded. The precipitate was washed twice with 75% pre-cooled ethanol, each time at 4 ℃, 12000 rpm, for 10 min. The supernatant was discarded, and the mixture was centrifuged for 2 min. The ethanol was discarded, and the supernatant was aspirated with an enzyme-free pipette tip. The mixture was then placed on a clean bench and left to stand on ice for 10 min. The dried precipitate was colorless and transparent. An appropriate amount of DEPC water was then added to dissolve the precipitated gRNA, and the concentration was measured. The entire process was enzyme-free.

[0064] Cas9 mRNA synthesis:

[0065] Cas9 plasmid linearization, the linearization system is as follows:

[0066]

[0067] (3) Microinjection

[0068] Two targeted gRNAs and Cas9 mRNA, diluted to appropriate concentrations, were injected into single-cell stage parthenogenetic eggs using a SYS-PV830 syringe (WPI, USA) microinjection system. Three control groups were also included: gRNA-only injection group, Cas9 mRNA-only injection group, and no injection group.

[0069] (4) hsd17b1 Screening for knockout positive fish

[0070] Fertilized eggs were incubated under suitable conditions after injection. Three days after incubation, a portion of the eggs were collected into 1.5 ml centrifuge tubes. Genomic DNA was extracted using the phenol / chloroform method. After detecting the DNA concentration and OD value, PCR amplification was performed using specific F and R primers to detect the target band. The cells were then separated by 1.5% agarose gel electrophoresis and recovered from the gel. Subcloning was performed to select positive bacteria for sequencing to determine the activity of CRISPR / Cas9 and gRNA, and whether they successfully knocked out the hsd17b1 gene.

[0071] The detection primer sequences are as follows:

[0072] hsd17b1 - The nucleotide sequence of the detection primer F is shown in SEQ ID NO. 3: ATCTCAAGTGCACGGCTCAA;

[0073] hsd17b1 - The nucleotide sequence of the detection primer R is shown in SEQ ID NO. 4: CTCTGACGCACACAGCCTTA.

[0074] The tail fins of fish 90 days after hatching were harvested, digested, and their genomic DNA was extracted and amplified. hsd17b1 The target band was selected after sequencing. hsd17b1 Knock out positive fish.

[0075] (5) Transmission

[0076] This technical solution employs a three-tiered breeding system to construct a stable genetic makeup. hsd17b1 Homozygous mutant lines: First, select hsd17b1 Knockout-positive males were crossbred with wild-type females to obtain F1 generation heterozygous males and females carrying large knockout mutations; the F1 generation was then self-crossed and bred to sexual maturity to obtain the F2 generation. hsd17b1 Homozygous mutant female fish. Due to the crucial role of this gene in the female estrogen biosynthesis pathway, homozygous mutant female fish exhibit a sex reversal rate of approximately 50% (testis development phenotype) under conventional aquaculture conditions. Ultimately, through targeted mating of sex-reversed individuals (XX♂) with non-reversed individuals (XX♀), genetically consistent females are bred on a large scale. hsd17b1 Homozygous mutant female fish fry were used to achieve stable propagation of the mutant strain.

[0077] 2: High-temperature treatment hsd17b1 Homozygous knockout of female fish to achieve all-male genetic fry

[0078] Select F2 generation hsd17b1 Homozygous mutant XX fry were introduced into a temperature intervention program once they reached the horizontal swimming stage (5-7 days after hatching, capable of sustained horizontal swimming). The rearing container consisted of a 2m×1m×0.8m (length×width×height) glass tank equipped with an independent circulating filtration system and two 1200W titanium alloy heaters connected to a temperature control system. A digital temperature sensor was used to monitor the water temperature in real time. After a 24-hour gradual temperature increase, the temperature was stabilized at 36.0±0.3℃ (temperature fluctuation ≤0.5℃ / h). The fish were fed a compound feed with a protein content ≥40% (particle size 0.2-0.5mm) at 08:00 / 12:00 / 16:00 daily, at a rate of 3%-5% of their body weight. The photoperiod was controlled at a 12L:12D lighting regime (light intensity 500-800 lux). When the fish were continuously treated until 90 days old, the sex ratio was verified using the following methods: 1. Anatomical observation: Thirty fish samples were randomly selected for gonadal tissue sectioning. It was found that at this point, the gonads fully exhibited the male morphology, a significant difference from the homozygous knockout fish that did not undergo high-temperature treatment at the same time, where only a portion of the gonads showed a male morphology. Through the aforementioned precise temperature control system, this was successfully achieved... hsd17b1The complete reversal of the physiological sex of mutant female fish resulted in a physiologically male population with 100% phenotypic consistency (genetic sex XX, physiological sex ♂). This achievement confirms that all-male fish fry production can be achieved through gene editing and temperature treatment, providing an efficient solution for the large-scale production of high-growth-performance all-male fry in aquaculture.

[0079] According to another embodiment of the present invention, a genetic breeding method for all-male tilapia addresses the problem of incomplete sex reversal due to individual differences in the timing of high-temperature treatment by proposing a dynamic monitoring and regulation strategy. Specifically, before the F3 generation homozygous mutant females enter the sex differentiation window, gonadal tissue samples are collected every 5 days starting 15 days after hatching. The expression levels of the male pathway marker gene Gsdf and the female pathway marker gene Cyp19a1a are detected using quantitative real-time PCR. When the expression level of Gsdf is detected to be continuously increased and reaches more than 0.5 times the expression level of Cyp19a1a, the individual is determined to have entered the critical window period of sex differentiation. Subsequently, regulation is carried out according to the synchronicity of population development: if more than 5% of the individuals in the population reach this standard, high-temperature treatment at 35-37℃ is immediately initiated; if the proportion of individuals reaching the standard is less than 5%, the high-temperature treatment is delayed until the proportion of individuals reaching the standard meets the requirements. After the high-temperature treatment is initiated, gene expression levels are monitored every 5 days. If the ratio of Gsdf to Cyp19a1a expression at any sampling point is lower than 0.5, the high-temperature treatment duration is automatically extended by 10 to 15 days to ensure complete sex reversal.

[0080] Traditional high-temperature treatment methods only implement constant temperature treatment within a fixed time window (5-90 days after hatching), without considering individual developmental differences. For example, some individuals with delayed development fail to enter the critical period of sex differentiation within the fixed time period, rendering the high-temperature exposure ineffective, with a sex reversal rate of only 70%-80%. In contrast, this implementation method dynamically captures the individual differentiation status through real-time molecular monitoring, using gene expression ratios as an objective criterion, thus overcoming the limitations of empirical time-series operations. Furthermore, while traditional hormone-induced methods can achieve a 95% male conversion rate, they require continuous feeding of methyltestosterone, posing risks of drug residue pollution in water bodies and food safety hazards. This method, however, relies entirely on gene editing and temperature response mechanisms, requiring no exogenous hormones. While ensuring a 100% all-male phenotype, it eliminates the risk of chemical pollution, aligning with the trend of green aquaculture development.

[0081] According to another embodiment of the present invention, a stepped heating strategy is adopted during the high-temperature treatment stage of F3 generation homozygous mutant female fish to ensure the physiological adaptability of the fry. The specific operation is as follows: First, the temperature of the culture water is stabilized at 26℃ (base water temperature). The heating process is precisely controlled in three stages:

[0082] 1. First stage: Raise the water temperature from 26℃ to 30℃ at a rate not exceeding 2℃ per hour, and maintain it for 4 hours; 2. Second stage: Continue to raise the temperature to 33℃ at a rate not exceeding 1.5℃ per hour, and maintain it for 8 hours; 3. Third stage: Finally raise the temperature to the target temperature of 36℃ at a rate not exceeding 1℃ per hour.

[0083] The entire heating process is controlled by a titanium alloy heater and a PID temperature control feedback system, ensuring that water temperature fluctuations do not exceed ±0.3℃. Simultaneously, the circulating filtration system maintains dissolved oxygen levels ≥6 mg / L and ammonia nitrogen concentrations ≤0.05 mg / L. Slow-release microcapsule feed (0.2-0.5 mm particle size) is administered four times daily, with the feeding amount dynamically adjusted according to 3%-5% of the fish's body weight. This process begins 5 days after hatching and continues until 90 days, after which the fish are raised at room temperature (26℃) until adulthood.

[0084] Current technology directly treats the fish at a constant temperature of 36°C for 5-90 days after hatching, omitting the gradual temperature increase step. Due to the sudden temperature change, the fish fry have a significant stress response (manifested as slow swimming and refusal to eat), resulting in an average survival rate of only 65%-70%, and some individuals experience incomplete sex reversal due to metabolic disorders (the maleification rate is about 85%).

[0085] Advantages of this implementation method: 1. Reduced stress damage: Stepwise temperature increase allows fish fry to gradually adapt to the high-temperature environment, reducing stress symptoms by more than 90% in the experimental group and increasing the survival rate to 92%-95%; 2. Improved sex reversal efficiency: Gradual temperature increase ensures normal differentiation of gonadal cells, and with real-time monitoring, the masculinization rate reaches 100%; 3. High operability: The PID system achieves precise temperature control of ±0.3℃, and combined with dynamic water quality management, it avoids batch-to-batch differences caused by temperature fluctuations or water quality deterioration in traditional constant temperature methods.

[0086] According to another embodiment of the present invention, during the high-temperature treatment phase of the sex differentiation window period in F3 generation homozygous mutant female fish, a periodic temperature fluctuation pattern is adopted: maintaining a high-temperature environment of 36°C from 8:00 to 18:00 daily, and lowering to 30°C for temperature recovery from 18:00 to 8:00 the next day. The temperature rise and fall processes are precisely controlled by a programmed temperature control system, with a rate not exceeding 1°C / 10 minutes, and the water temperature fluctuation is stabilized within ±0.5°C. The circulating water system simultaneously maintains dissolved oxygen ≥6 mg / L and ammonia nitrogen concentration ≤0.05 mg / L, and feeds slow-release microencapsulated feed 4 times daily. This temperature fluctuation treatment lasts for at least 45 days, fully covering the critical sex differentiation window period.

[0087] Advantages of this implementation method: 1. Synergistic physiological rhythm mechanism: High daytime temperature (36℃) enhances the expression of the male pathway gene Gsdf, while low nighttime temperature (30℃) alleviates heat stress and inhibits the rebound of the female pathway gene Cyp19a1a. The dual-pathway synergy ensures a 100% success rate in sex reversal. 2. Breakthrough improvement in survival rate: Nighttime temperature recovery significantly reduces cumulative heat damage, increasing the survival rate of the experimental group to over 95%, a 30 percentage point improvement compared to the isothermal method. 3. Guarantee of functional sperm: The temperature fluctuation pattern maintains normal gonadal cell metabolism, sperm morphology is indistinguishable from wild-type male fish, and the fertilization rate is ≥90%, completely solving the sperm abnormality problem of the traditional isothermal method.

[0088] Example 1

[0089] During the sex differentiation window of homozygous mutant females in the F3 generation, a programmed temperature fluctuation treatment was implemented: a high-temperature environment of 36℃±0.5℃ was maintained from 8:00 to 18:00 daily, and the temperature was lowered to 30℃±0.5℃ from 18:00 to 8:00 the next day to restore the temperature. The temperature rise and fall processes were precisely controlled by a PID temperature control system, with a rate not exceeding 1℃ / 10 minutes. The circulating water system was simultaneously maintained to maintain dissolved oxygen ≥6 mg / L and ammonia nitrogen ≤0.05 mg / L, and slow-release microcapsule feed (particle size 0.2-0.5mm) was administered 4 times daily. This treatment lasted for 60 days, fully covering the critical period of sex differentiation.

[0090] Verification of technical effects: 1. Survival rate: The survival rate of fish fry in the experimental group reached over 95% ( Figure 3 1. Data from the 3M+HT group: No sluggish swimming or refusal to feed was observed; 2. Sex reversal efficiency: Anatomical and histological examinations showed that 100% of individuals exhibited testicular structure in their gonads, and serum testosterone levels were not different from those in wild males; 3. Sperm function: Papanicolaou staining showed that the rate of normal sperm morphology was ≥98% ( Figure 4 (I arrow) fertilization rate ≥90%; 4. No hormone residues: no exogenous hormones were detected in water and fish samples (compared to traditional hormone induction method).

[0091] Comparative Example 1 (Constant Temperature Treatment): The sample was treated at a constant temperature of 36°C for 60 days, with other conditions being the same as those in the Example.

[0092] Defects Analysis: 1. High mortality rate: Due to continuous heat stress, the survival rate of fish fry is only 65-70%; 2. Incomplete sex reversal: About 15% of individuals retain ovarian tissue, and the masculinization rate of the group is only 85%; 3. Sperm malformation: 40% of sperm have abnormal heads or missing flagella, and the fertilization rate is ≤50%; 4. Water quality deterioration: Ammonia nitrogen concentration fluctuates by more than 0.2 mg / L, exacerbating metabolic disorders.

[0093] Comparative Example 2 (Traditional Hormone Induction Method): Wild-type fish fry were fed with a diet containing methyltestosterone (60 mg / kg) for 30 days using conventional methods.

[0094] Defect Analysis: 1. Hormone Residue Risk: Methyltestosterone residue (1.2±0.3 μg / kg) was detected in the liver of fish, which does not meet food safety standards; 2. Environmental Impact: Hormone diffusion (0.8±0.2 μg / L) was detected in the treated water, indicating ecological pollution; 3. Batch Variation: Male conversion rate fluctuates greatly (85%-95%), requiring repeated dosage adjustments; 4. Unsustainable: Each batch requires reprocessing, making it impossible to establish a genetically stable breeding population.

[0095] The data from Example 1 are compared with those from Comparative Examples 1 and 2, as shown in Table 1.

[0096] Table 1: Data Comparison between Example 1 and Comparative Examples 1 and 2

[0097] index Example 1 Comparative Example 1 (Constant Temperature) Comparative Example 2 (Hormone) Survival rate ≥95% 65-70% 90% Maleization ratio 100% 85% 95% Normal sperm rate ≥98% ≤60% 90% Hormone residue Not detected Not detected Detected (1.2 μg / kg) Sustainable breeding of parent plants Supports (F3 generation independent propagation) Not supported Not supported

[0098] Conclusion: The periodic temperature fluctuation pattern, through the synergy of diurnal physiological rhythms (enhancing Gsdf gene expression during the day and alleviating metabolic stress at night), maintains 100% sex reversal efficiency while increasing the survival rate from 70% in the traditional isothermal method to over 95%, and completely avoids the risk of hormone contamination, thus achieving green and sustainable development of all-male seedling production.

[0099] According to another embodiment of the present invention, a method for dynamic monitoring of tilapia sex differentiation based on body fluid biomarkers and AI decision-making includes:

[0100] 1. Sample Collection: Starting from day 15 post-hatching of F3 homozygous mutant females, blood was collected every 48 hours via tail vein (≤10 μL per sample) or non-invasive mucus sampling from the body surface. Blood samples were collected using capillary tubes pre-loaded with anticoagulant, and mucus samples were collected from the gill cover area using sterile swabs. 2. Biomarker Detection: Samples were added to immunochromatographic strips pre-coated with Gsdf / Cyp19a1a antibody, and the colorimetric results were read within 10 minutes; or quantitative detection was performed using a microfluidic chip, with a detection limit of 0.1 ng / mL and an error of ±5%. 3. Data Acquisition and AI Decision-Making: A biosensor array (dissolved oxygen, pH, and ammonia nitrogen sensors linked to a German Sartorius bioreactor system) is deployed in the water to monitor the concentration of sex hormone metabolites such as 11-KT and E2 in real time. Data is uploaded to edge computing devices, and a pre-trained machine learning model (based on 1,200 sets of historical data) predicts the progress of population differentiation: if more than 5% of individuals have a Gsdf / Cyp19a1a ratio ≥ 0.5 (indicating entry into the window period), a high-temperature treatment command is automatically triggered; if the population development dispersion (standard deviation > 0.3) is low, a grouping mechanism is initiated. 4. Grouping and Processing: Each fish is implanted with a micro-RFID tag to link the detection data in real time; individuals that meet the criteria (Gsdf / Cyp19a1a ≥ 0.5) are diverted to a 36℃ high-temperature pool via a smart valve; individuals that do not meet the criteria are temporarily kept in a 26℃ monitoring pool for further observation. 5. High-temperature control optimization: If Gsdf / Cyp19a1a < 0.5 is detected twice consecutively during high-temperature treatment: prioritize raising the temperature to 37℃ ± 0.5℃ (maintain for 3 days); if the ratio still does not recover, extend the treatment for 5 days (maximum total duration ≤ 12 days); when the testicular histological section shows that the proportion of spermatogonia is > 80% or the serum 11-KT is > 2 ng / mL, immediately terminate the high-temperature treatment.

[0101] Existing technologies propose a method for monitoring sex differentiation based on gonadal biopsy: Procedure: Gonadal tissue is dissected and collected every 5 days, then Gsdf / Cyp19a1a is detected by quantitative real-time PCR, and then the window period is determined.

[0102] Problems with existing technologies: 1. Tissue sampling leads to a cumulative mortality rate of 15.3% in juvenile fish (experimental data n=300); 2. Detection takes >24 hours, and the window period determination error is ±3 days; 3. The uniform treatment strategy ignores individual differences, and the male conversion rate of the group is only 91.7%.

[0103] The present invention features the following solutions: 1. Zero-damage monitoring: Using body fluids instead of tissue samples, the survival rate of juvenile fish is >99.8% (experimental statistics n=1,000); 2. Real-time response: The AI ​​system updates predictions every 30 minutes, with an error of <±12 hours during the window period; 3. Individualized treatment: RFID-based group management increases the sex reversal rate to 99.4%; 4. Risk control: The duration of high-temperature exposure is reduced by 50% (maximum 12 days vs. existing technology 25 days), and the growth inhibition rate decreases by 18%. Please refer to Table 2 for experimental results.

[0104] Table 2: Laboratory Comparative Experiments on Freshwater Fish

[0105] index Existing technology (Chen et al.) Invention Solution Juvenile fish mortality rate 15.3% 0.2% Error in window period determination ±3 days ±0.5 days male conversion rate 91.7% 100% Longest number of days of high-temperature treatment 25 days 12 days Average weight loss of adult fish 12.6% 4.1%

[0106] Conclusion: The solution of this invention, through non-invasive detection, AI decision-making, and clustering processing, completely solves the problems of sampling damage, response delay, and asynchronous development in existing technologies while maintaining a 100% male conversion rate, providing reliable technical support for large-scale application.

[0107] According to another embodiment of the present invention, during the stepwise temperature increase process of F3 generation homozygous mutant female fish, water temperature uniformity control is implemented: three temperature sensors are evenly distributed per cubic meter in the breeding pond to monitor the surface, middle and bottom water temperatures in real time. When any sensor temperature deviates from the current stage set value by more than ±0.5℃ (e.g., measured at 29.2℃ or 33.5℃ at the 30℃ stage), or the regional temperature difference is >1℃, the temperature control system is automatically triggered to adjust the output power of the titanium alloy heating rod, while simultaneously increasing the water flow rate of the circulating filtration system by 20%-30%, until the temperature at all monitoring points returns to the set range (e.g., 30℃ ±0.3℃). This operation covers the entire temperature increase process (from 26℃ to 36℃), ensuring that the fry are not subjected to localized heat stress damage.

[0108] Existing technologies rely solely on single-point temperature control, and in actual aquaculture, the temperature difference between the upper and lower layers often reaches 2-3℃ due to water stratification (paragraph

[0045] of the instruction manual). Some fish fry are exposed to low-temperature zones (e.g., the bottom layer is only 31℃ at a target temperature of 33℃), resulting in inhibited gonadal differentiation. Figure 3 The survival rate of the 2M+HT group was only 70%; in high-temperature areas (such as local temperatures reaching 37°C), heat shock was triggered, causing the survival rate of the population to fluctuate by more than 15%.

[0109] Advantages of this implementation method: 1. Elimination of temperature gradient: Multi-point sensing and dynamic feedback suppress regional temperature differences to ≤1℃, and no temperature stress-induced death occurs in the experimental group; 2. Improved stability of sex reversal: The uniform thermal environment ensures synchronous development of all individuals, and with the gene expression monitoring of 6, the masculinization rate is stable at 100%; 3. Strong scalability: Directly integrated into the circulatory system, with additional costs of less than 5%.

[0110] According to another embodiment of the present invention, during the high-temperature treatment stage (including step-by-step heating or periodic fluctuations), dynamic water quality control is implemented as follows: 1. Real-time dissolved oxygen compensation: Based on the water temperature sensor data (T), the aeration intensity is automatically adjusted according to the formula: Dissolved oxygen setpoint = 6 + 0.5 × (T - 26) (e.g., maintaining ≥11 mg / L at 36℃); 2. Ammonia nitrogen peak suppression: Within 1 hour after each feeding of slow-release feed, the enhanced filtration circulation mode is activated to rapidly suppress the ammonia nitrogen concentration to ≤0.04 mg / L (maintaining ≤0.05 mg / L in the normal mode); 3. System linkage execution: Through the dissolved oxygen / ammonia nitrogen sensor signals, the aeration equipment, circulation pump, and biological filter are linked in real time to ensure that the water quality parameters meet the standards within 10 minutes.

[0111] Existing technology has the following drawbacks: Fixed water quality standards (dissolved oxygen ≥ 6 mg / L, ammonia nitrogen ≤ 0.05 mg / L) cannot meet the metabolic needs during high-temperature periods. At a constant temperature of 36℃, dissolved oxygen of 6 mg / L only meets the basic oxygen consumption, while the actual oxygen demand increases by more than 50%; after feeding, ammonia nitrogen spikes to 0.2 mg / L instantly, causing damage to gill tissue.

[0112] Advantages of this implementation method: 1. Precise metabolic support: Dynamic dissolved oxygen compensation meets the peak oxygen consumption during high-temperature periods (e.g., 11 mg / L at 36℃), increasing the sperm normality rate from 60% to 98%; 2. Real-time toxicity control: Ammonia nitrogen ≤0.04 mg / L within 1 hour after feeding, avoiding cumulative damage (no ammonia nitrogen poisoning symptoms were observed in the experimental group); 3. Fully automated operation: Sensor-equipment linkage response speed <5 minutes, reducing water quality fluctuations between batches by 90%.

[0113] Although the present invention has been described in detail above through general description, specific embodiments, and experiments, it will be obvious to those skilled in the art that appropriate modifications or improvements can be made based on the present invention, such as adjusting the target site of the HSD17B1 gene gRNA or reproducing the technology in different tilapia strains. Therefore, all such modifications or improvements made without departing from the core spirit of the present invention should be included within the scope of protection claimed by the present invention.

Claims

1. A method for breeding genetically all-male Oreochromis niloticus, characterized by, The method comprises the following steps: CRISPR / Cas9 gene editing was used to target Nile tilapia fertilized eggs. hsd17b1 Gene knockout is performed, and the target sites selected for gene knockout include those located in... hsd17b1 The target 1 on the first exon of the gene and the target 2 on the second exon, the sequence of the target 1 is shown in SEQ ID NO. 1 and the sequence of the target 2 is shown in SEQ ID NO.

2. The fertilized eggs are then hatched, positive individuals are selected and raised to sexual maturity as F0 generation. The F0 generation positive individuals are selected, and the male fish are mated with wild-type female fish to obtain an F1 generation hybrid male and female population; The F1 generation hybrid male and female population is bred to the sexual maturity stage, and is self-crossed to obtain F2 generation homozygous mutant female fish; The F2 generation homozygous mutant female fish is bred to the sexual maturity stage, and the sex-reversed individuals and the non-sex-reversed individuals in the F2 generation homozygous mutant female fish are cross-bred to obtain F3 generation homozygous mutant female fish; During the gender differentiation window period, the F3 generation homozygous mutant female fish is subjected to high-temperature treatment at 35-37 DEG C to induce complete masculinization of the gonad, and finally a population of all-male fish fry is obtained, which has a phenotype function of male.

2. The method of breeding all-male genetically improved farmed tilapia according to claim 1, wherein, In screening positive individuals, for detecting hsd17b1 Primers for detecting whether the gene is successfully knocked out include hsd17b1 - detection primer F and hsd17b1 - detection primer R, the hsd17b1 The nucleotide sequence of the detection primer F is shown as SEQ ID NO. 3, and the hsd17b1 The nucleotide sequence of the detection primer R is shown as SEQ ID NO.

4.

3. The method of breeding all-male genetically improved farmed tilapia according to claim 1, wherein, During the gender differentiation window period, the F3 generation homozygous mutant female fish is subjected to high-temperature treatment at 35-37 DEG C, which specifically comprises: 36 DEG C high-temperature incubation is performed from 5 days to 90 days after hatching, and then the fish is transferred to a normal-temperature breeding system at 26 DEG C until the fish reaches adulthood, so that a population of all-male fish fry can be successfully obtained.

4. The method of breeding all-male genetically improved farmed tilapia according to claim 1, wherein, The high-temperature treatment is achieved through stepwise temperature increase, and the temperature is increased in three stages within 24 hours: i) the temperature is increased from 26 DEG C to 30 DEG C at a rate of ≤2 DEG C / h and maintained for 4 hours; ii) the temperature is continuously increased to 33 DEG C at a rate of ≤1.5 DEG C / h and maintained for 8 hours; iii) finally, the temperature is increased to 36 DEG C at a rate of ≤1 DEG C / h.

5. The method of breeding all-male genetically improved farmed tilapia according to claim 4, wherein, The temperature increase is controlled by a titanium alloy heating rod and a PID temperature control feedback system, and the water temperature fluctuation is ≤±0.3 DEG C; Meanwhile, a circulating filtration system is used to maintain the water dissolved oxygen ≥6 mg / L and the ammonia nitrogen concentration ≤0.05 mg / L, and commercial granular feed with a particle size of 0.2-0.5 mm is fed to the fish 4 times a day, and the feeding amount is dynamically adjusted according to the fish body weight of 3%-5%.

6. The method of breeding all-male genetically improved farmed tilapia according to claim 1, wherein, Before the high-temperature treatment is applied during the gender differentiation window period, dynamic monitoring and regulation of the gender differentiation state are also included, which specifically comprises: Gene expression detection: from 15 days after the F3 generation homozygous mutant female fish is hatched, the gonadal tissue samples are collected every 5 days, and the expression levels of the male pathway marker gene Gsdf and the female pathway marker gene Cyp19a1a are detected by fluorescence quantitative PCR or immunohistochemical technology; Temperature treatment start-up stage determination: when the Gsdf expression level continuously increases and reaches more than 0.5 times the Cyp19a1a expression level, it is determined that the mutant individual enters the key window period of temperature treatment; Dynamic adjustment of high-temperature parameters: a) if ≥5% of the individuals in the population reach the key window period, the 35-37 DEG C high-temperature treatment is started immediately; b) if <5% of the individuals in the population reach the key window period, the high-temperature treatment start-up time is delayed until the target is reached; c) after the high-temperature treatment is started, the gene expression is continuously monitored: if the Gsdf / Cyp19a1a expression ratio at any sampling point is <0.5, the high-temperature treatment time is extended by 10-15 days.

7. The method of breeding all-male genetically improved farmed tilapia according to claim 1, wherein, The high-temperature treatment adopts a periodic temperature fluctuation mode, specifically: a daily high-temperature exposure period of 8:00-18:00, maintaining 36℃±0.5℃, and a night recovery period of 18:00-8:00 the next day, dropping to 30℃±0.5℃; the temperature fluctuation is achieved through a programmed temperature control system, with an ascending / descending temperature rate ≤1℃ / 10 minutes; the total duration of the periodic treatment is ≥45 days, and covers the entire critical window period of sex differentiation.

8. The method of breeding all-male genetically improved Oreochromis niloticus according to claim 6, wherein, The dynamic monitoring and regulation of the starting time and state of the temperature treatment further includes: Dynamic monitoring at the molecular level: observing the Gsdf and Cyp19a1a protein concentrations in the gonads through histological observation and immunofluorescence detection; Automatic decision system: deploying an array of water body biosensors to collect sex hormone metabolite data in real time, combining AI models to predict population differentiation progress, and dynamically triggering high-temperature treatment start commands; Grouping processing mechanism: based on RFID tag identification of individual development status, diverting fry to independent temperature control units for grouping processing, wherein: for the standard individual group, Gsdf / Cyp19a1a≥0.5 immediately starts high-temperature treatment; for the non-standard individual group, delayed treatment and continuous monitoring; high-temperature duration optimization: if Gsdf / Cyp19a1a<0.5 during high-temperature treatment, preferentially increase the temperature to 37℃±0.5℃, only extend the treatment for 5-7 days when the ratio continues to be below the threshold, and terminate the treatment when the testicular histology is mature or serum 11-KT>2ng / mL.

9. The method of breeding all-male genetically improved farmed tilapia according to claim 4, wherein, In the stepwise temperature rising process, it also includes the water temperature uniformity regulation step: uniformly arranging multiple temperature sensors in the culture water body to monitor the temperature at different points in real time; if the temperature of any sensor deviates from the current stage set value by more than ±0.5℃, or the temperature difference between any two sensors is >1℃, automatically adjust the output power of the titanium alloy heating rod and the water flow rate of the circulating filtration system until the temperature of all points returns to the set range.

10. The method of breeding all-male genetically improved farmed tilapia according to claim 1, wherein, During the high-temperature treatment, the water quality parameters are dynamically regulated according to the real-time water temperature, specifically including: Oxygen dynamic compensation: adjust the aeration intensity according to the formula Dissolved oxygen set value = 6 + 0.5×(real-time water temperature-26) to maintain the water dissolved oxygen content not less than the set value; Ammonia nitrogen intensive control: start intensive filtration circulation within 1 hour after feeding to quickly reduce the ammonia nitrogen concentration to ≤0.04 mg / L; Equipment linkage execution: through the feedback signals of temperature sensors, dissolved oxygen sensors, and ammonia nitrogen sensors, link the operation parameters of titanium alloy heating rods, aeration equipment, and circulating filtration systems.

Images