DNA truncated cone-based miRNA electrochemical detection method, composition and kit
By fixing DNA truncated cone nanostructures at the electrode interface and combining signal probes with enzymatic signal amplification, the complexity and expensive equipment problems of existing miRNA detection technology are solved, and highly sensitive miRNA quantitative analysis is achieved, which is suitable for instant detection.
Patent Information
- Application Number
- CN202510744789.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-06-05
- Publication Date
- 2025-09-05
AI Technical Summary
Existing miRNA detection technologies have problems such as complex primer design, strict laboratory conditions, long time consumption and expensive equipment. In addition, electrochemical detection has not yet fully utilized the DNA nanostructure on the electrode surface and constant temperature signal amplification technology for real-time detection.
DNA truncated cone nanostructures are fixed at the electrode interface, and quantitative analysis of miRNA is achieved through signal probe capture and enzymatic signal amplification.
It achieves high-sensitivity miRNA detection without the need for reverse transcription or PCR amplification, providing an immediate and reliable detection method with anti-interference ability and efficient signal response.
Smart Images

Figure CN120591383A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of miRNA detection, and in particular to a miRNA electrochemical detection method, composition and kit based on DNA truncated cones. Background Art
[0002] MicroRNAs (miRNAs) are a class of endogenous noncoding RNAs that play a crucial role in regulating gene expression. Mainstream technologies employ fluorescently labeled nucleic acid probes, which offer high sensitivity and good biocompatibility. Quantitative reverse transcription-PCR (qRT-PCR) combines reverse transcription with real-time fluorescence quantitative PCR to amplify cDNA and monitor the accumulation of amplified products in real time through fluorescence signals, ultimately enabling quantitative analysis of the initial RNA. Loop-mediated isothermal amplification (LAMP) utilizes Bst DNA polymerase (with strong strand displacement activity) and multiple pairs of specific primers (usually 4-6) to efficiently amplify target sequences at a specific constant temperature. However, these technologies each have their own drawbacks. For example, primer design rules for qRT-PCR and LAMP are relatively complex, and the amplification process requires rigorous laboratory conditions, time-consuming reverse transcription reactions, and expensive equipment and reagents. With the emerging development of DNA nanotechnology, numerous DNA nanostructures have emerged with high stability and controllable target recognition capabilities in biological environments. Electrochemical techniques, on the other hand, also show great potential for point-of-care (POC) miRNA detection, including ease of miniaturization and compatibility with various signal amplification methods. Therefore, constructing a specific DNA nanostructure on the electrode surface and combining it with constant temperature signal amplification technology can provide a new solution for the detection of miRNA. Summary of the Invention
[0003] The present invention addresses the shortcomings of the prior art by providing a method, composition, and kit for electrochemical detection of miRNAs based on DNA truncations. This method immobilizes nucleic acid nanostructures at the electrode interface and provides a reaction environment for enzymatic signal amplification, enabling quantitative analysis of target sequences.
[0004] To achieve the above objectives, the present invention adopts the following technical solutions: In a first aspect, the present invention provides a method for electrochemical detection of miRNA based on DNA truncations, the method comprising:
[0005] Three single-stranded DNA probes (TPF1, TPF2, and TPF3) containing partially complementary sequences are mixed and assembled into a three-dimensional DNA scaffold. The bottom fragment of the three-dimensional DNA scaffold is then fixed with the single-stranded DNA probe (TPF4) to obtain a DNA truncated cone. After the DNA truncated cone is modified on an electrode, the resulting modified electrode is mixed and incubated with a sample containing a target miRNA in the presence of a double-stranded specific nuclease. The modified electrode is then mixed and incubated with a signal probe and removed. Finally, the modified electrode is subjected to electrochemical analysis to determine the target miRNA content in the sample.
[0006] Among them, DNA truncations can capture signal probes modified with electrochemical markers through hybridization between complementary sequences, thereby enhancing the electrochemical signal; when the target miRNA is present, the DNA truncations will disintegrate under the action of double-stranded specific nucleases to release the signal probes captured thereon, resulting in a weakening of the electrochemical signal, thereby achieving quantitative analysis of the target miRNA through the reduction of the electrochemical signal.
[0007] Preferably, the signal probe is completely complementary or partially complementary to the sequence of at least one of the three sides of the triangular sequence at the top of the DNA truncated cone, thereby being able to be captured by the triangular sequence at the top of the DNA truncated cone.
[0008] Preferably, the signal probe includes one, two or three of S1, S2 and S3.
[0009] Preferably, the signal probes include three types: S1, S2, and S3, each of which is completely complementary or partially complementary to the sequence of one of the three sides of the triangular sequence at the top of the DNA truncated cone, so that the three signal probes can be captured respectively by the three sides of the triangular sequence at the top of the DNA truncated cone through hybridization between complementary sequences.
[0010] Preferably, the 5' ends of TPF1, TPF2 and TPF3 are all modified with a thiol group, and the thiol group is located at the vertex of the triangle at the bottom of the DNA truncated cone.
[0011] Preferably, the electrochemical marker modified on the signal probe is methylene blue or ferrocene, G4 / hemin, etc.
[0012] Preferably, the target miRNA is miR-21, and the sequence is: UAGCUUAUCAGACUGAUGUUGA;
[0013] The sequence of TPF1 is:
[0014] SH-(CH2)6-TCGTAGGCATCATCAAATTGTCAACATGTCATGGATT;
[0015] The sequence of TPF2 is:
[0016] SH-(CH2)6-CGTCGTCCGAAATCCATGACCAGTCTGGACCGATTTA;
[0017] The sequence of TPF3 is:
[0018] SH-(CH2)6-GTCCCGGGTATAAATCGGTCATAAGCTCAATTTGATG;
[0019] The sequence of TPF4 is: ATGCCTACGATCGGACGACGTACCCGGGAC;
[0020] The sequence of S1 is: ATGTTGATTTTTT-MB;
[0021] The sequence of S2 is: CAGACTGTTTTTT-MB;
[0022] The sequence of S3 is: AGCTTATTTTTTT-MB.
[0023] Preferably, the miRNA electrochemical detection method based on DNA truncations comprises the following steps:
[0024] S1. Assembling DNA truncated cones:
[0025] Tris(2-carboxyethyl)phosphine and magnesium chloride are added to a Tris-HCl buffer to obtain a preparation solution, DNA probes TPF1, TPF2, TPF3, and TPF4 are mixed in the preparation solution at equal concentrations, and the mixture is heated to 95° C. and maintained for 2-10 minutes to obtain a DNA truncated cone solution;
[0026] S2. Preparation of modified electrode:
[0027] The gold electrode is pretreated and placed in a DNA truncated cone solution for incubation, and then taken out and washed to obtain a modified electrode;
[0028] S3. Electrochemical test:
[0029] Double-stranded specific nuclease is added to the sample containing the target miRNA, mixed evenly to obtain a test solution, and then the modified electrode is placed in the test solution and incubated at 40-60°C for 45-180 minutes. After removing the modified electrode, it is placed in a signal probe solution containing the same concentration of signal probes S1, S2, and S3 and continued to incubate. After removal, electrochemical testing is performed to obtain the content of the target miRNA in the sample through electrochemical signal analysis.
[0030] In a second aspect, the present invention provides a miRNA electrochemical detection composition based on DNA truncations, comprising the DNA probes TPF1, TPF2, TPF3, TPF4 as described above, and one, two, or three of the signal probes S1, S2, and S3.
[0031] The third aspect of the present invention provides a DNA truncated miRNA electrochemical detection kit, comprising the composition as described above and a double-stranded specific nuclease.
[0032] The beneficial effects of the present invention are:
[0033] The present invention provides a miRNA electrochemical detection method, composition and kit based on DNA truncations. In the present invention, a DNA truncated cone nanostructure is designed at the electrode interface, which can provide excellent spatial orientation for subsequent reactions and has anti-interference performance. First, the DNA truncated cone can capture three signal probes (S1, S2, S3) through hybridization between complementary sequences, outputting a strong electrochemical signal; at the same time, the DNA truncated cone can also trigger a target miRNA-induced reaction in the presence of double-stranded specific nuclease (DSN), degrading the single-stranded DNA structure at the top; as the three-dimensional DNA nanostructure disintegrates, the three signal probes cannot be fixed, thereby weakening the electrochemical response; quantitative analysis of the target miRNA can be achieved through the reduction of the electrochemical signal.
[0034] The electrochemical technology used in the present invention, such as square wave voltammetry, performs highly sensitive quantitative analysis of miRNA without the need for reverse transcription or PCR amplification. The reaction is efficient and highly sensitive, opening up a new path for reproducible and reliable point-of-care (POC) detection of miRNA. BRIEF DESCRIPTION OF THE DRAWINGS
[0035] Figure 1 It is a schematic diagram of the reaction principle of the present invention;
[0036] Figure 2 Nyquist plots and cyclic voltammetry curves of different electrodes;
[0037] Figure 3 The following are the analytical performance test results of the method in Example 1. DETAILED DESCRIPTION
[0038] The present invention is further described in detail below with reference to the embodiments so that those skilled in the art can implement the invention with reference to the description.
[0039] It should be understood that terms such as “having”, “including” and “comprising” used herein do not preclude the existence or addition of one or more other elements or combinations thereof.
[0040] Unless otherwise specified, the experimental methods used in the following examples are conventional methods. Materials and reagents used in the following examples are commercially available unless otherwise specified. In the following examples, where specific conditions are not specified, the experiments were conducted under conventional conditions or those recommended by the manufacturer. Reagents and instruments used, where the manufacturer is not specified, are commercially available conventional products.
[0041] The present invention provides a method for electrochemical detection of miRNA based on DNA truncations, the method comprising:
[0042] Three single-stranded DNA probes (TPF1, TPF2, and TPF3) containing partially complementary sequences are mixed and assembled into a three-dimensional DNA scaffold. The bottom fragment of the three-dimensional DNA scaffold is then fixed with the single-stranded DNA probe (TPF4) to obtain a DNA truncated cone. After the DNA truncated cone is modified on an electrode, the resulting modified electrode is mixed and incubated with a sample containing a target miRNA in the presence of a double-stranded specific nuclease. The modified electrode is then mixed and incubated with a signal probe and removed. Finally, the modified electrode is subjected to electrochemical analysis to determine the target miRNA content in the sample.
[0043] Among them, DNA truncations can capture signal probes modified with electrochemical markers through hybridization between complementary sequences, thereby enhancing the electrochemical signal; when the target miRNA is present, the DNA truncations will disintegrate under the action of double-stranded specific nucleases to release the signal probes captured thereon, resulting in a weakening of the electrochemical signal, thereby achieving quantitative analysis of the target miRNA through the reduction of the electrochemical signal.
[0044] The signal probe is completely complementary or partially complementary to the sequence of at least one of the three sides of the triangular sequence at the top of the DNA truncated cone nanostructure, and thus can be captured by the triangular sequence at the top of the DNA truncated cone nanostructure.
[0045] The signal probes include one, two or three of S1, S2 and S3.
[0046] In a preferred embodiment, the signal probes include three types: S1, S2, and S3. Each signal probe is completely complementary or partially complementary to the sequence of one of the three sides of the triangular sequence at the top of the DNA truncated cone, so that the three signal probes can be captured respectively by the three sides of the triangular sequence at the top of the DNA truncated cone through hybridization between complementary sequences.
[0047] In a preferred embodiment, the 5' ends of TPF1, TPF2, and TPF3 are all modified with a thiol group, and the thiol group is located at the vertex of the triangle at the bottom of the DNA truncated cone.
[0048] In a preferred embodiment, the electrochemical label modified on the signal probe is methylene blue.
[0049] The reaction principle of the present invention is as follows Figure 1 As shown in the figure. The three single-stranded DNA probes (TPF1, TPF2, and TPF3) contain partially complementary sequences to each other, so they can hybridize with each other through simple mixing to form a basic three-dimensional DNA scaffold. The subsequently introduced TPF4 chain will fix the bottom fragment, making the DNA truncated cone nanostructure more stable. On the other hand, the thiol groups modified at the 5' ends of the three chains TPF1, TPF2, and TPF3 are located at the vertices of the bottom triangle. Therefore, the DNA truncated cone with multiple anchoring points can be firmly modified on the gold electrode via gold-sulfur covalent bonds. Next, three more independent DNA chains (S1, S2, and S3) are introduced, all of which are labeled with methylene blue (MB) as an electrochemical substance. The DNA truncated cone can capture these signal probes and improve molecular recognition efficiency and anti-interference ability, thereby generating a higher electrochemical response. However, when the target miRNA is present in the system, the miRNA will form a DNA / RNA hybrid with the single-stranded region at the top of the DNA truncated cone. This double-stranded region can be recognized by double-stranded specific nuclease (DSN), which cuts the DNA chain and releases the miRNA to participate in subsequent reaction cycles, causing multiple DNA truncated cones to disintegrate. Because they have lost the top triangle sequence used to fix the signal probe, the electrochemical response will be significantly weakened, and the degree of weakening is related to the initial concentration of the target miRNA.
[0050] The above is the overall concept of the present invention. Detailed embodiments and comparative examples are provided below to further illustrate the present invention.
[0051] Example 1
[0052] A method for electrochemical detection of miRNA based on DNA truncations, comprising the following steps:
[0053] S1. Assembling DNA truncated cones:
[0054] 10 mM tris(2-carboxyethyl)phosphine (TCEP) and 50 mM magnesium chloride (MgCl2) were added to 10 mM Tris-HCl buffer (pH 8.0) to obtain a preparation solution. DNA probes TPF1, TPF2, TPF3, and TPF4 were mixed at equal concentrations (concentration was 3.2 μM) in the preparation solution, and the mixture was heated to 95°C and maintained for 5 minutes to obtain a DNA truncated cone solution.
[0055] S2. Preparation of modified electrode:
[0056] A 3 mm diameter gold electrode was immersed in a piranha solution (98 wt% concentrated sulfuric acid: 30 w% hydrogen peroxide volume ratio = 3:1) for 5 minutes to remove adsorbents on the electrode surface, and then rinsed with double distilled water. Next, the electrode surface was carefully polished to a mirror finish using P3000 silicon carbide sandpaper, 1 μm, 0.3 μm, and 0.05 μm alumina polishing solutions. The electrode was then ultrasonically treated in ethanol and water for 5 minutes to completely remove residual alumina powder. The pretreated gold electrode was soaked in 50% nitric acid for 30 minutes and then electrochemically cleaned with 0.5 M sulfuric acid solution to further remove any residual impurities. After drying with nitrogen, the gold electrode was incubated in a DNA truncated cone solution for 8 hours to fix it on the electrode surface, and then rinsed with double distilled water to remove unadsorbed DNA nanostructures to obtain a modified electrode;
[0057] S3. miRNA-mediated DSN cleavage reaction and DNA nanostructure transformation:
[0058] A series of target miRNA solutions with varying concentrations were prepared using 10mM Tris-HCl buffer (pH 7.5). These solutions were then mixed with double-stranded specific nuclease (DSN) to a final concentration of 5U / mL. The DNA-truncate electrode was then placed in this mixed solution and incubated at 50°C for 90 minutes. Following the incubation, the electrode was rinsed and placed in a mixed solution of signal probes S1, S2, and S3 (all at a final concentration of 1.2μM).
[0059] S4. Electrochemical test:
[0060] After removing the modified electrode, an electrochemical test is performed to obtain the content of the target miRNA in the sample through electrochemical signal analysis.
[0061] Electrochemical measurements (cyclic voltammetry, electrochemical impedance spectroscopy, and square-wave voltammetry) were performed using a conventional three-electrode system consisting of a saturated calomel reference electrode, a platinum wire auxiliary electrode, and a DNA-modified gold working electrode. For cyclic voltammetry and electrochemical impedance spectroscopy, a 5 mM potassium ferrocyanide / potassium ferrocyanide solution containing 1 M potassium chloride was used as the electrolyte. For square-wave voltammetry, a 20 mM Tris-HCl buffer (pH 7.4) containing 150 mM sodium chloride and 5 mM magnesium chloride was used as the electrolyte. Specific parameters were as follows: for electrochemical impedance spectroscopy, the bias potential was 0.215 V, the amplitude was 5 mV, and the frequency range was 1 to 100,000 Hz. For cyclic voltammetry, the scan range was 0.6 to -0.1 V, and the scan rate was 0.1 V / s. For square-wave voltammetry, the modulation amplitude was 25 mV, the step potential was 4 mV, and the frequency was 70 Hz.
[0062] In this embodiment, the target miRNA is miR-21. The specific sequences of the target miRNA, DNA probe, signal probe, and mismatch sequence used subsequently are shown in Table 1 below:
[0063] Table 1
[0064]
[0065]
[0066] Reference Figure 2 , are the Nyquist plots and cyclic voltammetry curves of different electrodes. In the figure, (a) Nyquist plots of bare electrode (Bareelectrode), DNA truncated cone modified electrode (DNATPF), electrode treated with S1 / 2 / 3 probe (DNATPF+S1 / 2 / 3), and electrode after miRNA / DSN reaction (DNA TPF+miRNA+S1 / 2 / 3); (b) cyclic voltammetry curves of the corresponding electrodes. Figure 2 a shows the Nyquist plots of the electrode in the presence or absence of miRNA / DSN after the electrode was modified with DNA truncated cones and probes S1 / 2 / 3 (indicating that the electrode was modified with S1, S2, and S3). Compared with the bare gold electrode, after the modification of DNA truncated cones, the DNA monolayer and [Fe(CN)6] 3- / 4- Due to the repulsion between the electrochemical substances, an obvious semicircular area appears. Since the top single-stranded DNA triangle contains partially complementary sequences of probes S1, S2, and S3, the semicircular area of the Nyquist diagram becomes larger after the introduction of these three probes. However, miRNA / DSN treatment can digest the capture sequence, resulting in a decrease in the DNA density on the electrode. At the same time, probes S1, S2, and S3 cannot be fixed. Therefore, the semicircular area of the corresponding spectrum is smaller than the semicircular area of the DNA truncated cone modified electrode. The peak intensity of the cyclic voltammogram can also reflect the degree of obstruction of the modified electrode to the electroactive substance. Figure 2 As shown in b, a pair of clear cyclic voltammetric peaks can be observed at the bare electrode. As the DNA truncated cone and probes S1, S2, and S3 are gradually modified, the peak intensity decreases. In the presence of miRNA and DSN, the DNA truncated cone nanostructure disintegrates, the negative charge of the electrode interface decreases, and the [Fe(CN)6] 3- / 4- The repulsive effect is weakened, resulting in an increase in the peak current.
[0067] Reference Figure 3, which are the analytical performance test results of the method of Example 1, in which (a) the square wave voltammogram obtained by analyzing different concentrations of miRNA based on this method; (b) the linear relationship between the peak current and the logarithm of the miRNA concentration; (c) the selective analysis of target miRNA and mismatch sequences; (d) the electrochemical response of this method to detect different levels of miR-21 in PBS buffer and serum samples.
[0068] In order to investigate the analytical performance of the proposed method, a series of standard miR-21 solutions were prepared in Example 1 to trigger the DSN digestion reaction and the disintegration of the DNA truncated cone. The corresponding square wave voltammetry curves are shown in Figure 1. Figure 3 As shown in a. In the absence of target miR-21, the peak current reaches the maximum value. As the concentration of miR-21 increases, the peak intensity gradually decreases, indicating that the fixed signal probe gradually decreases. The peak current shows a good linear correlation with the logarithm of the miR-21 concentration ( Figure 3 b). The fitting equation is as follows:
[0069] y=–9.392–1.191x(n=4, R 2 =0.992)
[0070] Where y is the peak current (μA) and x represents the logarithm of the miR-21 concentration (M). The calculated detection limit is 0.03fM. The linear range of this method is quite wide, and the sensitivity is comparable to or higher than that of most previously reported methods. Subsequently, the selectivity of this method was tested by analyzing the results of six mismatch sequences. Single-base or double-base mismatch sequences were designed and synthesized and introduced into the electrochemical system under the same experimental conditions. Figure 3 As shown in Figure c, the current response at -0.3V in the case of mismatch is negligible compared to the target miR-21. Therefore, the method shows high selectivity and can successfully distinguish the target sequence from the single-base mismatch sequence. In addition, the standard miR-21 solution was spiked into three independent serum samples (Serum 1, 2, and 3), and the square wave voltammetry peaks were compared with the results in phosphate buffer (PBS). The data were consistent, indicating that the complex biological environment does not interfere with the electrochemical sensing interface ( Figure 3 d).
[0071] Although the embodiments of the present invention have been disclosed above, they are not limited to the applications listed in the description and implementation methods. They can be fully applied to various fields suitable for the present invention. For those familiar with the art, additional modifications can be easily implemented. Therefore, without departing from the general concept defined by the claims and the scope of equivalents, the present invention is not limited to specific details.
Claims
1. A method for electrochemical detection of miRNA based on DNA truncations, characterized in that: The method includes: Three single-stranded DNA probes (TPF1, TPF2, and TPF3) containing partially complementary sequences are mixed and assembled into a three-dimensional DNA scaffold. The bottom fragment of the three-dimensional DNA scaffold is then fixed with the single-stranded DNA probe (TPF4) to obtain a DNA truncated cone. After the DNA truncated cone is modified on an electrode, the resulting modified electrode is mixed and incubated with a sample containing a target miRNA in the presence of a double-stranded specific nuclease. The modified electrode is then mixed and incubated with a signal probe and removed. Finally, the modified electrode is subjected to electrochemical analysis to determine the target miRNA content in the sample. Among them, DNA truncations can capture signal probes modified with electrochemical markers through hybridization between complementary sequences, thereby enhancing the electrochemical signal; when the target miRNA is present, the DNA truncations will disintegrate under the action of double-stranded specific nucleases to release the signal probes captured thereon, resulting in a weakening of the electrochemical signal, thereby achieving quantitative analysis of the target miRNA through the reduction of the electrochemical signal.
2. The method for electrochemical detection of miRNA based on DNA truncations according to claim 1, wherein: in, The signal probe is completely complementary or partially complementary to the sequence of at least one of the three sides of the triangular sequence at the top of the DNA truncated cone, and thus can be captured by the triangular sequence at the top of the DNA truncated cone.
3. The method for electrochemical detection of miRNA based on DNA truncations according to claim 2, wherein: in, The signal probe includes one, two or three of S1, S2 and S3.
4. The method for electrochemical detection of miRNA based on DNA truncations according to claim 3, wherein: in, There are three types of signal probes: S1, S2, and S3. Each signal probe is completely complementary or partially complementary to the sequence of one of the three sides of the triangular sequence at the top of the DNA truncated cone, so that the three signal probes can be captured respectively by the three sides of the triangular sequence at the top of the DNA truncated cone through hybridization between complementary sequences.
5. The method for electrochemical detection of miRNA based on DNA truncations according to claim 4, characterized in that: The 5' ends of TPF1, TPF2, and TPF3 are all modified with a thiol group, and the thiol group is located at the vertex of the triangle at the bottom of the DNA truncated cone.
6. The method for electrochemical detection of miRNA based on DNA truncations according to claim 5, characterized in that: The electrochemical markers modified on the signal probe are methylene blue, ferrocene, G4 / hemin, etc.
7. The method for electrochemical detection of miRNA based on DNA truncations according to claim 6, characterized in that: in, The target miRNA is miR-21, and the sequence is: UAGCUUAUCAGACUGAUGUUGA; The sequence of TPF1 is: SH-(CH2)6-TCGTAGGCATCATCAAATTGTCAACATGTCATGGATT; The sequence of TPF2 is: SH-(CH2)6-CGTCGTCCGAAATCCATGACCAGTCTGGACCGATTTA; The sequence of TPF3 is: SH-(CH2)6-GTCCCGGGTATAAATCGGTCATAAGCTCAATTTGATG; The sequence of TPF4 is: ATGCCTACGATCGGACGACGTACCCGGGAC; The sequence of S1 is: ATGTTGATTTTTT-MB; The sequence of S2 is: CAGACTGTTTTTT-MB; The sequence of S3 is: AGCTTATTTTTTT-MB.
8. The method for electrochemical detection of miRNA based on DNA truncations according to claim 1, wherein: The method comprises the following steps: S1. Assembling DNA truncated cones: Tris(2-carboxyethyl)phosphine and magnesium chloride are added to a Tris-HCl buffer to obtain a preparation solution, DNA probes TPF1, TPF2, TPF3, and TPF4 are mixed in the preparation solution at equal concentrations, and the mixture is heated to 95° C. and maintained for 2-10 minutes to obtain a DNA truncated cone solution; S2. Preparation of modified electrode: The gold electrode is pretreated and placed in a DNA truncated cone solution for incubation, and then taken out and washed to obtain a modified electrode; S3. Electrochemical test: Double-stranded specific nuclease is added to the sample containing the target miRNA, mixed evenly to obtain a test solution, and then the modified electrode is placed in the test solution and incubated at 40-60°C for 45-180 minutes. After removing the modified electrode, it is placed in a signal probe solution containing the same concentration of signal probes S1, S2, and S3 and continued to incubate. After removal, electrochemical testing is performed to obtain the content of the target miRNA in the sample through electrochemical signal analysis.
9. A miRNA electrochemical detection composition based on DNA truncations, characterized in that: The method comprises the DNA probes as described in any one of claims 1 to 8: TPF1, TPF2, TPF3, TPF4, and one, two or three of the signal probes S1, S2 and S3.
10. A miRNA electrochemical detection kit based on DNA truncations, characterized in that: The method comprises the composition according to claim 9 and a double-stranded specific nuclease.