Probe group for detecting copy number of NDUFA1 gene and application thereof
By designing a probe set covering the key regions of the NDUFA1 gene and MLPA technology, the difficulty of detecting NDUFA1 gene copy number variations in existing technologies has been solved, and efficient and accurate NDUFA1 gene copy number detection has been achieved, which is suitable for the preliminary screening of Leigh syndrome.
Patent Information
- Application Number
- CN202510776638.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-06-11
- Publication Date
- 2025-09-05
AI Technical Summary
Existing technologies make it difficult to efficiently and accurately detect copy number variations in the NDUFA1 gene, especially in the design of probes in high-GC and high-repeat regions. Traditional methods such as fluorescent quantitative PCR require condition optimization, which limits the applicability of prenatal diagnosis.
A probe set targeting the NDUFA1 gene was designed, covering exons 1 to 3, two introns, and the 5'UTR and 3'UTR regions. MLPA technology was used to improve specificity and affinity by optimizing the number and length of probe bases. This was combined with whole-genome DNA sample processing and sample analysis units to achieve efficient detection.
It achieves efficient and accurate detection of NDUFA1 gene copy number variation at low DNA sample concentration, improves the specificity and sensitivity of detection, reduces the risk of misdiagnosis and missed diagnosis, and is suitable for the detection of complex gene structures.
Smart Images

Figure CN120591394A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of biotechnology, and in particular to a probe group for detecting the copy number of an NDUFA1 gene and an application thereof. Background Art
[0002] Leigh syndrome (LS) is a rare, highly fatal mitochondrial encephalopathy and a progressive, severe neurodegenerative disorder. Its incidence is approximately 1:32,000 to 1:40,000 births. The clinical symptoms of Leigh syndrome vary, primarily including hypotonia, mental impairment, and developmental delay, typically beginning by age 2. Patients often experience rapid deterioration in response to metabolic challenges, such as infection and prolonged fasting, posing a serious threat to children's health.
[0003] The pathogenic mechanism of the NDUFA1 gene lies in its location on chromosome X (NM_004541). Mutations in the gene typically cause diseases that exhibit an X-linked recessive inheritance pattern. The protein it encodes is a crucial component of mitochondrial complex I (NADH:ubiquinone oxidoreductase), which is composed of 45 subunits, seven of which are encoded by mitochondrial DNA (mtDNA). Complex I is responsible for transferring electrons from NADH to ubiquinone to produce ATP in the electron transport chain. Mutations in the NDUFA1 gene result in functional loss of the encoded MWFE protein, which in turn affects the assembly and stability of Complex I, leading to mitochondrial dysfunction manifested by reduced oxidative phosphorylation efficiency, increased production of reactive oxygen species, and disrupted energy metabolism. These changes ultimately lead to clinical symptoms such as neurodegeneration, muscle weakness, and heart disease, with manifestations being more pronounced in male patients.
[0004] Although the NDUFA1 gene is less than 5 kb in length, detection reagents for copy number variations (CNVs) within this gene have yet to be developed. Traditional validation techniques, such as quantitative PCR (qPCR), often require optimization and face numerous challenges, limiting their applicability as a first-line prenatal diagnostic test.
[0005] Using MLPA (Multiple Ligation-Linked Probe Amplification) technology and in-house designed probes offers significant advantages. MLPA, with its high accuracy and reproducibility, has become a powerful tool for detecting copy number variations and an effective means of validating copy number alterations using next-generation sequencing. Because the three exons of the NDUFA1 gene span a small region, all probes can cover the entire exon region, making MLPA superior to other methods in detecting copy number increases.
[0006] However, probe design is a major challenge in MLPA experiments, especially for regions with high GC content and high repetitive content. Furthermore, fine-tuning the dosage of multiple probes to ensure uniform amplification of each target fragment is crucial for interpreting the results. Summary of the Invention
[0007] To address the shortcomings of existing technologies, the present invention proposes a probe set for detecting NDUFA1 gene copy number and its application. The present invention designs probes targeting exons 1-3, two introns, and the 5'UTR and 3'UTR regions of the NDUFA1 gene. A single experiment can detect deletions and duplications across the entire gene's critical regions, thereby identifying NDUFA1 gene variants associated with Leigh syndrome.
[0008] The present invention provides a probe set for detecting the copy number of the NDUFA1 gene, comprising the following probes: (1) Probe of the upstream non-coding region of the gene, the nucleotide sequence is shown in SEQ ID NO. 1~2; (2) Gene exon 1 probe, the nucleotide sequence is shown in SEQ ID NO. 3~4; (3) Gene intron 2 probe, the nucleotide sequence is shown in SEQ ID NO. 5~6; (4) Gene exon 2 probe, the nucleotide sequence is shown in SEQ ID NO. 7~8; (5) Gene exon 3 probe, the nucleotide sequence is shown in SEQ ID NO. 9~10; (6) Gene No. 1 intron probe, the nucleotide sequence is shown in SEQ ID NO. 11~12; (7) Probe of the downstream non-coding region of the gene, the nucleotide sequence is shown in SEQ ID NO.13~14.
[0009] In some embodiments, the probe set further includes a pair of universal primers, and the nucleotide sequences of the universal primers are shown in SEQ ID NOs. 15-16.
[0010] The present invention also provides a kit for preliminary screening of biological samples for Leigh syndrome, comprising the probe set.
[0011] In some embodiments, the kit further comprises any one or more of the following: (1) Ligase; (2) Ligase reaction buffer; (3) PCR reaction buffer; (4) MLPA buffer; (5) dNTP; (6) Probe buffer.
[0012] In some embodiments, the molar ratio of each probe is SEQ ID NO.1:SEQ ID NO.2:SEQ ID NO.3:SEQ ID NO.4:SEQ ID NO.5:SEQ ID NO.6:SEQ ID NO.7:SEQ ID NO.8:SEQ ID NO.9:SEQ ID NO.10:SEQ ID NO.11:SEQ ID NO.12:SEQ ID NO.13:SEQ ID NO.14: probe buffer = 6:6:7:7:9:9:8:8:7:7:9:9:7:7:1894. The present invention optimizes the ratio by the number of bases, so that the probe has higher specificity and affinity under specific conditions. The ratio is adjusted by calculating the base pairing energy, the length of the probe and the degree of complementarity with the target, thereby improving the binding efficiency and sensitivity of the probe and avoiding nonspecific binding.
[0013] The present invention also provides a system for preliminary screening of biological samples for Leigh syndrome, comprising: a whole genome DNA sample processing unit, for denaturing the whole genome DNA sample, hybridizing it with the probes in the probe set, and finally amplifying the hybridization product to obtain an analysis sample; The sample analysis unit is used to determine whether the analyzed sample is a biological sample with NDUFA1 gene copy number variation and provide a judgment result.
[0014] In some embodiments, the biological sample is any one or more of blood, plasma, serum, urine, sputum, spinal fluid, cerebrospinal fluid, pleural effusion, nipple aspirate, lymph fluid, fluid from the respiratory, intestinal or urogenital systems, tears, saliva, breast milk, fluid from the lymphatic system, semen, internal system fluid of an organ, ascites, tumor cyst fluid, amniotic fluid and biopsy tissue.
[0015] The present invention also provides the use of the probe group in screening or detecting biological samples with NDUFA1 gene copy number variation.
[0016] The present invention also provides the use of the probe group in preparing a product for preliminary screening of Leigh syndrome.
[0017] In summary, compared with the prior art, the present invention achieves the following technical effects: (1) The probe set for detecting the copy number of the NDUFA1 gene provided by the present invention has excellent experimental repeatability and high accuracy. It can perform efficient detection at a minimum DNA sample concentration of 9 ng / μL, ensuring accurate detection of the copy number variation of the NDUFA1 gene.
[0018] (2) The MLPA technology used in the present invention shows extremely high advantages in specificity, sensitivity, repeatability and convenience. Compared with the traditional Q-PCR method, it has advantages in detecting NDUFA1 gene, especially in detecting gene copy number variation and solving complex gene structure problems. It provides an accurate, reliable and efficient detection method, thereby reducing the risk of misdiagnosis and missed diagnosis.
[0019] (3) Compared with traditional detection technologies, the present invention has higher specificity and can distinguish differences in single bases, such as point mutations and subtle changes within genes. It also performs well in terms of sensitivity and repeatability, and can detect subtle changes in gene copy number, including deletions and duplications. Under high sensitivity conditions, the present invention can also provide good stability, and the results obtained under different experimental conditions are highly consistent, which provides a guarantee for the reliability of the test results and can help accurately diagnose NDUFA1 gene mutations associated with Leigh syndrome.
[0020] (4) The present invention designs specific probes for complex gene structures such as the NDUFA1 gene, which can effectively distinguish and detect various parts of the gene, including exons and introns. This overcomes the problem of complex primer design when using qPCR technology to detect large fragments of introns in the NDUFA1 gene, improves detection efficiency, and makes the operation simpler and faster. BRIEF DESCRIPTION OF THE DRAWINGS
[0021] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the following briefly introduces the drawings required for use in the embodiments. It should be understood that the following drawings only illustrate certain embodiments of the present invention and therefore should not be regarded as limiting the scope. For ordinary technicians in this field, other relevant drawings can be obtained based on these drawings without paying any creative work.
[0022] Figure 1 The capillary electrophoresis diagram, capillary electrophoresis peak calculation diagram, and histogram of the normalized capillary detection results of a female positive sample in Example 3 of the present invention are shown; Figure 2 The capillary electrophoresis diagram, capillary electrophoresis peak calculation diagram, and capillary detection result normalized histogram of the female control sample 1 according to Example 3 of the present invention are shown; Figure 3 The capillary electrophoresis diagram, capillary electrophoresis peak calculation diagram, and capillary detection result normalized histogram of the female control sample 2 according to Example 3 of the present invention are shown; Figure 4 The capillary electrophoresis diagram, capillary electrophoresis peak calculation diagram, and capillary detection result normalized histogram of the male control sample 1 of Example 3 of the present invention are shown. DETAILED DESCRIPTION
[0023] In order to enable those skilled in the art to better understand the solutions of the present invention, the technical solutions in the embodiments of the present invention will be clearly and completely described below in conjunction with the accompanying drawings of the embodiments of the present invention. Obviously, the embodiments described are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative efforts should fall within the scope of protection of the present invention.
[0024] The probe design of the present invention comprehensively considers multiple factors to ensure the accuracy and efficiency of detection. First, the difference in probe size should be controlled within 5bp, with 2-3bp being the optimal range, to facilitate the differentiation of amplification products of different probes in MLPA analysis. Second, the probe should be designed to cover the middle region of the exon to more effectively capture and detect variations in the exon, including copy number variations and small insertions or deletions. At the same time, it is necessary to avoid regions with high GC content and high repetitive sequences, as these regions may affect the specificity and amplification efficiency of the probe. In addition, because small fragment sequences of the NDUFA1 gene have high amplification efficiency, it is crucial to adjust the probe concentration to ensure uniform amplification, which is crucial for the accuracy and reproducibility of experimental results. In this experimental system, the fragment length range is 108bp-140bp, so the probe concentration needs to be fine-tuned to optimize amplification efficiency and signal intensity. Through these meticulous design and optimization steps, a highly accurate and efficient probe set is provided.
[0025] Reagents: Hybridization buffer, ligation buffers A and B, ligase, and PCR amplification universal primers were all from MRC-Holland; SALSA MLPA Probemix P200 Reference-1 was used as a reference probe, purchased from Thermo Fisher Scientific, and served as an internal standard to correct for bias caused by amplified product signals during MLPA experiments and in subsequent data analysis; Deionized formamide, SizeStand, and GeneScan™ 500 LIZ™ dye were purchased from Thermo Fisher Scientific.
[0026] Example 1 Probe gene sequence design (1) MLPA hybridization probe set, used for hybridization with DNA library, including probes within exons 1, 2, and 3, introns 1 and 2, and upstream and downstream regions (400 bp to 1000 bp) of the NDUFA1 gene. The sequences of each specific probe are as follows: The forward probe of the upstream non-coding region of the NDUFA1 gene is shown in SEQ ID NO. 1; The reverse probe of the upstream non-coding region of the NDUFA1 gene is shown in SEQ ID NO. 2; The forward probe for exon 1 of the NDUFA1 gene is shown in SEQ ID NO. 3; The reverse probe for exon 1 of the NDUFA1 gene is shown in SEQ ID NO. 4; The forward probe for intron 2 of the NDUFA1 gene is shown in SEQ ID NO. 5; The reverse probe of intron 2 of NDUFA1 gene is shown as SEQ ID NO.6; The forward probe for exon 2 of the NDUFA1 gene is shown in SEQ ID NO. 7; The reverse probe of exon 2 of the NDUFA1 gene is shown in SEQ ID NO.8; The forward probe for exon 3 of the NDUFA1 gene is shown in SEQ ID NO. 9; The reverse probe for exon 3 of the NDUFA1 gene is shown in SEQ ID NO. 10; The forward probe for intron 1 of the NDUFA1 gene is shown in SEQ ID NO. 11; The reverse probe of intron 1 of the NDUFA1 gene is shown in SEQ ID NO. 12; The forward probe of the downstream non-coding region of the NDUFA1 gene is shown in SEQ ID NO. 13; The reverse probe of the downstream non-coding region of the NDUFA1 gene is shown as SEQ ID NO.14.
[0027] The above sequences were all purified by high performance liquid chromatography (HPLC). Among them, SEQ ID NO.1, SEQ ID NO.3, SEQ ID NO.5, SEQ ID NO.7, SEQ ID NO.9, SEQ ID NO.11, and SEQ ID NO.13 had no special modification at the 5' end; among them, SEQ ID NO.2, SEQ ID NO.4, SEQ ID NO.6, SEQ ID NO.8, SEQ ID NO.10, SEQ ID NO.12, and SEQ ID NO.14 had 5'-Phosphorylation modification.
[0028] (2) The universal sequences of amplification primers are as follows, which are used for amplification of the probe set: The universal primer upstream probe is shown as SEQ ID NO.15; the universal primer downstream probe is shown as SEQ ID NO.16.
[0029] The above sequences were purified by high performance liquid chromatography (HPLC) and there was no special modification at the 5' end.
[0030] Example 2 Probe MIX preparation and operation process 1. Custom probe MIX preparation (1) The synthesized probes of SEQ ID NO. 1 to 14 were diluted to 10 μM using TE buffer.
[0031] (2) The first group of probes consists of SEQ ID NO.3, SEQ ID NO.4, SEQ ID NO.9, SEQ ID NO.10, SEQ ID NO.13, and SEQ ID NO.14, mixed in a 1:1 ratio; (3) The second group of probes consists of four probes: SEQ ID NO. 5, SEQ ID NO. 6, SEQ ID NO. 11, and SEQ ID NO. 12, mixed in a 1:1 ratio; (4) The third group of probes consists of a mixture of SEQ ID NO. 1 and SEQ ID NO. 2 in a 1:1 ratio; (5) The fourth group of probes is a mixture of SEQ ID NO. 7 and SEQ ID NO. 8 in a 1:1 ratio; (6) The four groups of probes were mixed and diluted in a ratio of 21:18:6:8:947, namely, the molar ratio of each probe was SEQ ID NO.1:SEQ ID NO.2:SEQ ID NO.3:SEQ ID NO.4:SEQ ID NO.5:SEQ ID NO.6:SEQ ID NO.7:SEQ ID NO.8:SEQ ID NO.9:SEQ ID NO.10:SEQ ID NO.11:SEQ ID NO.12:SEQ ID NO.13:SEQ ID NO.14:TE=6:6:7:7:9:9:8:8:7:7:9:9:7:7:1894, to prepare the self-designed probe MIX.
[0032] 2. Experimental operation process: (1) Take a genomic DNA sample and pre-treat it using a PCR instrument: set the program to 98°C for 5 minutes to achieve DNA denaturation, and then keep it at 25°C to maintain the denatured state.
[0033] (2) Vortex the denatured DNA sample, take 5 μL of sample (pre-diluted to 9-11 ng / μL) and mix it evenly with 1 μL of MLPA buffer and probe mixture (containing 0.5 μL of self-designed probe mixture and 1 μL of p200 probe), and then follow the hybridization procedure, first treat it at 95°C for 1 minute, then keep it at 60°C for 16 to 18 hours, and finally keep it at 20°C.
[0034] (3) Prepare the ligation reaction system using ligase buffer A, ligase buffer B, and ligase-65 enzyme. The specific ratio is: 25 μL water, 3 μL ligase buffer A, 3 μL ligase buffer B, and 1 μL ligase. Set the ligation program in the PCR instrument to maintain at 54°C for 15 minutes, then at 98°C for 5 minutes to inactivate the ligase, and finally maintain at 20°C.
[0035] (4) Prepare the PCR amplification system and perform amplification according to the following procedure: 95°C for 30 seconds, 60°C for 30 seconds, and 72°C for 60 seconds, repeating 29 cycles in total, and finally extending at 72°C for 20 minutes, and then maintaining at 20°C.
[0036] (5) Analyze the PCR amplification products using capillary electrophoresis. First, prepare the electrophoresis working solution by mixing formamide and GeneScan™ 500 LIZ™ in a ratio of 10:0.2. Then, take 10 μL of the prepared working solution and mix it with 1.1 μL of the PCR product for electrophoresis. Use the official Coffalyser analysis software to interpret the electrophoresis results.
[0037] Example 3 Detection stability analysis Interpretation of test results: 1. Graph recognition: The resulting chromatogram typically displays a series of peaks, each representing a specific MLPA probe designed in this protocol. For target gene detection, band 108 corresponds to the upstream noncoding region of the NDUFA1 gene, band 111 to the downstream noncoding region, band 113 to exon 1, band 122 to exon 2, band 135 to intron 1, band 138 to exon 3, and band 141 to the second intron 1. The remaining bands represent internal references for other genes. The peak position (i.e., electrophoretic mobility) corresponds to the expected size of a specific probe, while the peak height or area correlates with the copy number of the probe's target DNA sequence.
[0038] 2. Peak value comparison: Each probe should have a corresponding peak on the spectrum, and normally these peaks should be consistent between the control sample and the test sample. If the peak of a probe is significantly higher or lower in the test sample than in the control sample, it may indicate that the copy number of the target DNA sequence has changed.
[0039] 3. Copy number variation analysis: For each probe, the relative copy number can be calculated by comparing the peak height or area in the test sample with the control sample. If the relative copy number is lower than expected, it may indicate a deletion; if it is higher than expected, it may indicate a duplication.
[0040] 4. Normal and abnormal judgment: Normally, the peak values for all probes should be consistent between the control and test samples, indicating the absence of copy number variation.
[0041] 5. Data standardization: In order to reduce experimental variation and improve the reliability of results, the results are usually standardized, with the peak value of the reference gene as the internal control for normalization, and the normalized values are presented using a histogram.
[0042] 6. Software Analysis: A specialized analysis software (Coffalyser) was used to automate the analysis process. The software can identify peaks, calculate relative copy numbers, and determine copy number variations based on preset thresholds.
[0043] 7. Results: The final results are presented in the form of graphs, including peak plots and histograms. The histogram shows the relative copy number of each probe, which facilitates intuitive comparison and interpretation of the results.
[0044] Take positive samples, female control samples and male control samples for stability analysis: 1. Positive samples ( Figure 1 ): The calculated peak area data for all electrophoretic bands detected are shown in the table. The data were normalized for all reference genes, and the normalized values are presented in a histogram. Interpretation of the normalized results indicates that three exons of this gene are duplicated, and the corresponding bands in the capillary electrophoresis pattern show duplication, indicating copy number variation in these regions.
[0045] 2. Test results of control samples: 2.1 Female control sample 1 ( Figure 2 ) The calculated peak area data for all electrophoretic bands detected are shown in the table. The data were normalized for all reference genes, and the normalized values are presented in a histogram. Interpretation of the normalized results indicates that all relevant bands in the capillary electrophoresis profile appear normal, indicating that no copy number variation was detected in the NDUFA1 gene and its related regions in the positive samples.
[0046] 2.2 Female control sample 2 ( Figure 3 ) The calculated peak area data for all electrophoretic bands detected are shown in the table. The data were normalized for all reference genes, and the normalized values are presented in a histogram. Interpretation of the normalized results indicates that all relevant bands in the capillary electrophoresis profile appear normal, indicating that no copy number variation was detected in the NDUFA1 gene and its related regions in the positive samples.
[0047] 2.3 Male control sample 1 ( Figure 4 ) The calculated peak area data for all electrophoretic bands detected are shown in the table. The normalized values were normalized for all reference genes and presented in histograms. The X chromosome detection results for males were consistent with the actual results. Interpretation of the normalized results indicates that all detected bands were normal and absent on capillary electrophoresis, indicating that no copy number variation was detected in the NDUFA1 gene and its associated regions in these samples.
[0048] Depend on Figures 1 to 4 The results show that the test results in the positive samples showed that the copy number of three exons of the gene was repeated, and the corresponding bands in the capillary electrophoresis pattern were repeated, indicating that copy number variation existed in these regions. The test results of female and male control samples were normal, and no copy number variation was detected. The present invention successfully distinguished the gene copy number variation between positive samples and control samples through capillary electrophoresis patterns and peak area calculation data, and verified it on multiple control samples, demonstrating the accuracy and stability of the experimental method. The reliability of the results was further ensured by normalization processing and histogram presentation. It provides important information for the diagnosis and research of NDUFA1 gene-related diseases.
[0049] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of the present invention should be included in the scope of protection of the present invention.
[0050] Sequence Listing SEQ ID NO.1 GGGTTCCCTAAGGGTTGGAGGCTGCGCTCAAAGATGGCTTGTGCATCGCG SEQ ID NO.2 CTCTTTCTCTGTGTCCAGCTCATAGACAGCTGTCGTCTAGATTGGATCTTGCTGGCAC SEQ ID NO.3 GGGTTCCCTAAGGGTTGGACTTGTTGATTCCAGGACTGGCTACTGCGTACATC SEQ ID NO.4 CACAGGTTCACTAACGGGGGCAAGGTAAGCCGGCTTCTCTAGATTGGATCTTGCTGGCAC SEQ ID NO.5 GGGTTCCCTAAGGGTTGGACTAGAAATCATTACAGGTTATTCTTTAGTGATTATAAAATTTAATCCAATGTATTG SEQ ID NO.6 TTGCAGTTAGAGAAATGTGGGATGTGGAAGCACTCTTTCTAGATTGGATCTTGCTGGCAC SEQ ID NO.7 GGGTTCCCTAAGGGTTGGAGTCTCTTATTTGAAGGAAAAAAGGGTTGCTCATTTTGG SEQ ID NO.8 GTATCACTGGAGTCTGATGGAAAGAGATAGGCGCATCTCTGGTCTAGATTGGATCTTGCTGGCAC SEQ ID NO.9 GGGTTCCCTAAGGGTTGGACATTGATTAAGGAAGCATTTTCCTGATTGATGAAAAAAATAACT SEQ ID NO.10 CAGTTATGGCCATCTACCCCTGCTAGAAGGTTACAGTGTATTATGTAGCATGTCTAGATTGGATCTTGCTGGCAC SEQ ID NO.11 GGGTTCCCTAAGGGTTGGAGAAATCATTACAGGTTATTCTTTAGTGATTATAAAATTTAATCCAATGTATTG SEQ ID NO.12 TTGCAGTTAGAGAAATGTGGGATGTGGAAGCACTCTTTTTAATAACTCTAGATTGGATCTTGCTGGCAC SEQ ID NO.13 GGGTTCCCTAAGGGTTGGACTAGTTCCTTTTCTGAGTGGATCCTACAATG SEQ ID NO.14 TTTAAAATTCCAGTTGGTTAGGTTTGAGCTGAGAGGTCTAGATTGGATCTTGCTGGCAC SEQ ID NO.15 GGGTTCCCTAAGGGTTGGA SEQ ID NO.16 GTGCCAGCAAGATCCAATCTAGA。
Claims
1. A probe set for detecting the copy number of the NDUFA1 gene, characterized in that: The following probes are included: (1) Probe of the upstream non-coding region of the gene, the nucleotide sequence is shown in SEQ ID NO. 1~2; (2) Gene exon 1 probe, the nucleotide sequence is shown in SEQ ID NO. 3~4; (3) Gene intron probe, the nucleotide sequence is shown in SEQ ID NO. 5~6; (4) Gene exon 2 probe, the nucleotide sequence is shown in SEQ ID NO. 7~8; (5) Gene exon 3 probe, the nucleotide sequence is shown in SEQ ID NO. 9~10; (6) Gene No. 1 intron probe, the nucleotide sequence is shown in SEQ ID NO. 11~12; (7) Probe of the downstream non-coding region of the gene, the nucleotide sequence is shown in SEQ ID NO.13~14.
2. The probe set according to claim 1, characterized in that The probe set further includes a pair of universal primers, the nucleotide sequences of the universal primers are shown in SEQ ID NOs. 15-16.
3. A kit for preliminary screening of biological samples for Leigh syndrome, characterized in that: Comprising the probe set according to claim 1.
4. The kit according to claim 3, wherein The kit may further comprise any one or more of the following: (1) Ligase; (2) Ligase reaction buffer; (3) PCR reaction buffer; (4) MLPA buffer; (5) dNTP; (6) Probe buffer.
5. A system for preliminary screening of biological samples for Leigh syndrome, characterized in that include: a whole genome DNA sample processing unit, for denaturing the whole genome DNA sample, hybridizing it with the probes in the probe set, and finally amplifying the hybridization product to obtain an analysis sample; The sample analysis unit is used to determine whether the analyzed sample is a biological sample with NDUFA1 gene copy number variation and provide a judgment result.
6. The system according to claim 5, characterized in that The biological sample is any one or more of blood, plasma, serum, urine, sputum, spinal fluid, cerebrospinal fluid, pleural effusion, nipple aspirate, lymph fluid, fluid from the respiratory, intestinal or urogenital system, tears, saliva, breast milk, fluid from the lymphatic system, semen, internal organ system fluid, ascites, tumor cyst fluid, amniotic fluid and biopsy tissue. 7 . Use of the probe set according to claim 1 in screening or detecting biological samples having NDUFA1 gene copy number variation.
8. Use of the probe group according to claim 1 in preparing a product for preliminary screening of Leigh syndrome.
Citation Information
Patent Citations
High-throughput sequencing detection method for gene copy number and gene mutation based on MLPA
CN105969843A
Whole genome copy number detection chip customized for X chromosome high-density probe
CN106282349A
MLPA detection kit for detection of pathogenic nucleic acids of porcine viral reproductive disorder syndrome
CN109207635A
Method for detecting NDUFAF2 gene copy number based on multiplex ligation probe amplification technology
CN118853869A
Set of specific hybridization probes for determination of changes in human lysosome-associated protein-2 (LAMP2) gene by MLPA method for diagnostics of danone's disease
RU2781084C1