Method for identifying litchi kernel size trait and detection primer set

Abstract

The present application relates to the technical field of molecular biology, and particularly provides a lychee kernel size trait identification method and a detection primer set.The primer set comprises primers with nucleotide sequences as shown in SEQ ID NO. 1~SEQ ID NO. 3.The primer set provided by the present application can be used to identify lychee kernel size, and selectively breeding can be carried out according to environmental adaptability.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology and relates to a litchi kernel size trait identification method and a detection primer set. Background Art

[0002] litchi( Litchi chinensis Sonn., belonging to the Sapindaceae family, is an important evergreen fruit crop grown in tropical and subtropical regions worldwide. Litchi has a history of over 3,500 years in China, making it the largest producer, with major growing areas located in Guangdong, Guangxi, Fujian, Hainan, and Yunnan provinces. To date, researchers have conducted in-depth molecular studies on numerous traits, including fruit size, seed development, fruit shedding, regulation of pericarp color, and flowering. Seed development and size are particularly important for lychee fruit quality. Small-seed lychees are preferred by consumers due to their high edible content. However, traditional lychee breeding methods primarily rely on phenotypic selection, which can lead to long breeding cycles and low efficiency. Molecular marker-assisted breeding technology enables early selection using molecular markers closely linked to target traits, significantly improving breeding efficiency and shortening the breeding cycle.

[0003] While researchers have investigated the molecular mechanisms underlying litchi traits such as fruit size and seed development, relatively little research has focused on molecular markers for litchi pit size, leading to a lack of stable and efficient molecular markers for assisted breeding. Block segregant analysis (BSA-seq) is a rapid method for identifying genetic markers associated with target traits. It has been successfully applied to QTL mapping for traits such as seed size in various crops, but its application in the development of molecular markers for litchi pit size has been limited. Therefore, developing molecular markers closely associated with litchi pit size is crucial for advancing marker-assisted breeding in litchi. Summary of the Invention

[0004] The purpose of the present invention is to overcome the deficiencies of the prior art, provide an InDel molecular marker related to litchi kernel size, as well as primers and methods for detecting the marker, and further provide its application in litchi molecular marker-assisted breeding.

[0005] To achieve the above object, the present invention adopts the following technical solutions:

[0006] In a first aspect, the present invention provides an InDel marker significantly associated with litchi kernel size. This marker is located at locus 25585686 on chromosome 5 of the litchi reference genome (GeneBank: GCA_019925255.1). This marker is homozygous for the "GAAAA / GAAAA" genotype in litchi with a scorched kernel, and heterozygous for the "G- -- -- / GAAAA" genotype in litchi with a large kernel.

[0007] A second aspect of the present invention provides a primer set for detecting the size of litchi kernels, comprising an upstream primer having a nucleotide sequence as shown in SEQ ID NO. 1, a downstream primer having a nucleotide sequence as shown in SEQ ID NO. 2, and a FAM fluorescent-labeled primer having a nucleotide sequence as shown in SEQ ID NO. 3.

[0008] The third aspect of the present invention provides the use of the primer in at least one of the following aspects:

[0009] (1) Detect the size of litchi kernel;

[0010] (2) Early prediction of litchi kernel size phenotype;

[0011] (3) Molecular marker-assisted breeding of litchi.

[0012] A fourth aspect of the present invention provides a method for detecting the size of a litchi pit, comprising the following steps:

[0013] a. Extract genomic DNA of the material to be analyzed using the CTAB method: Extract genomic DNA of the litchi germplasm material to be tested;

[0014] b. PCR amplification reaction: using the DNA obtained in step a as a template, perform PCR amplification using the above primer set to obtain an amplified fluorescently labeled product;

[0015] c. Detection of PCR amplification products: 5 μL of PCR amplification product was electrophoresed on a 2% agarose gel containing Super Red nucleic acid dye in 1× TAE buffer at 120 V for 25 min. The gel run results were photographed and recorded using a gel imaging system.

[0016] d. Genotype detection of PCR amplification products: The fluorescent-labeled PCR amplification products were subjected to capillary electrophoresis, and different genotypes were distinguished based on the size and position of the bands: the macronucleus had both 296 bp and 300 bp bands, and the genotype was G- - - - / GAAAA; the focal nucleus had only a 300 bp band, and the genotype was GAAAA / GAAAA.

[0017] Furthermore, the PCR amplification reaction system is: 15 μL, including 1.0 μL 50 ng / ul genomic DNA, 7.5 μL 2×Taq PCR Mix, 0.2 μL 1 μM upstream primer, 1.2 μL 1 μM downstream primer, 1.2 μL 1 μM FAM fluorescent labeled primer, and 3.9 μL ddH2O.

[0018] Furthermore, the PCR amplification program was as follows: pre-denaturation at 94°C for 5 min; 30 cycles of denaturation at 94°C for 30 s, annealing at 58°C for 30 s, and extension at 72°C for 60 s; 13 cycles of denaturation at 94°C for 30 s, annealing at 53°C for 30 s, and extension at 72°C for 60 s; and extension at 72°C for 10 min.

[0019] Beneficial effects of the present invention:

[0020] This study, using BSA-seq technology, has for the first time identified an InDel molecular marker significantly associated with litchi pit size. This marker is tightly linked to the pit size trait and has a high phenotypic explanatory rate. Using the specific primer set and detection method provided by this invention, early prediction and selection of pit size traits can be performed in litchi seedlings without waiting for plants to bear fruit, significantly improving breeding efficiency, shortening the breeding cycle, and reducing breeding costs. This study provides an effective molecular tool for targeted improvement of litchi pit size and has significant application value. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 The results of agarose gel electrophoresis of the amplified products of 87 litchi materials using the primers of the present invention are shown.

[0022] Figure 2 The results of capillary electrophoresis of the primers of the present invention on four large-core litchi materials LZ0037, LZ0275, LZ0333, and LZ0651 were shown.

[0023] Figure 3 The results of capillary electrophoresis of the primers of the present invention on four large-core litchi materials LZ0850, LZ1018, LZ1442, and LZ1712 were shown.

[0024] Figure 4 The results of capillary electrophoresis detection of two pyrokeratin-type litchi materials, LZ0223 and LZ0629, using the primers of the present invention are shown.

[0025] Figure 5 The results of capillary electrophoresis detection of two pyrokeratin-type litchi materials, LZ1630 and LZ1785, using the primers of the present invention are shown. DETAILED DESCRIPTION

[0026] The specific embodiments of the present invention are described below to facilitate understanding of the present invention by those skilled in the art. However, it should be clear that the present invention is not limited to the scope of the specific embodiments. For those skilled in the art, as long as various changes are within the spirit and scope of the present invention as defined and determined by the appended claims, these changes are obvious, and all inventions and creations utilizing the concepts of the present invention are protected.

[0027] Screening and identification of InDel molecular markers of Example 1

[0028] 1. Material preparation: 130 early-maturing litchi cultivar resources with similar genetic backgrounds were selected, and fruit traits such as single fruit weight, seed weight, edible rate, percentage of stone fruit weight, and core-burning rate were determined. 15 extreme materials were selected to construct a large-core pool NS (core-burning rate 0, average seed weight > 3.5 g, percentage of stone fruit weight > 20%) and a core-burning pool AS (core-burning rate ≥ 75%, average seed weight < 2.5 g, percentage of stone fruit weight < 15%).

[0029] 2. BSA-seq analysis: Genomic DNA of the two pools was extracted, whole-genome resequencing was performed, and sequencing data were quality controlled, aligned, and variant detected. Combined with Euclidean distance (ED) algorithm and Δindex analysis, the 24.93 Mb~25.69 Mb region of chromosome 5 was located to be significantly related to fruit core size.

[0030] 3. Screening and verification of InDel markers: InDel sites were screened in the located region, and finally one stable and reliable InDel marker was obtained, which was located at the 25585686 site of chromosome 5 of the litchi reference genome GeneBank: GCA_019925255.1. The genotype of the marker in core-burning litchi materials was homozygous “GAAAA / GAAAA”, and the genotype of the marker in large-core litchi materials was heterozygous “G- - - - / GAAAA”.

[0031] 4. Primer design: According to the above-obtained InDel molecular marker, specific amplification primer pairs and fluorescently labeled primers were designed as follows:

[0032] Forward primer (SEQ ID NO. 1):

[0033] 5'-TGTAAAACGACGGCCAGTACAGTCAATTTCTGAGCCATACATAG-3';

[0034] Reverse primer (SEQ ID NO. 2): 5'-GGATTTTCCTTGATCCAACATTTGG-3';

[0035] FAM fluorescently labeled primer (SEQ ID NO. 3): 5'-TGTAAAACGACGGCCAGT-3' (6-FAM fluorescent tag was added at 5').

[0036] Example 2: Molecular identification of different litchi germplasm resources

[0037] (1) Selection of experimental materials: 87 early-maturing inbred population breeding materials were selected as test materials for the verification of InDel molecular markers;

[0038] (2) Extracting genomic DNA from samples to be analyzed: Using the modified CTAB method, DNA from the leaves of the above-mentioned litchi breeding materials was extracted;

[0039] (3) PCR amplification reaction: PCR amplification was performed using the extracted material DNA as the amplification template and three primers labeled with InDel molecules as amplification primers. The PCR reaction system was: 15 μL, including 1.0 μL 50 ng / ul genomic DNA, 7.5 μL 2×Taq PCR Mix, 0.2 μL 1 μM upstream primer, 1.2 μL 1 μM downstream primer, 1.2 μL 1 μM FAM fluorescent labeled primer, and 3.9 μL ddH2O. PCR reaction amplification program: 94°C pre-denaturation for 5 min; 94°C denaturation for 30 s, 58°C annealing for 30 s, and 72°C extension for 60 s, for 30 cycles; 94°C denaturation for 30 s, 53°C annealing for 30 s, and 72°C extension for 60 s, for 13 cycles; 72°C extension for 10 min;

[0040] (4) Detection of PCR amplification products: 5 μL of PCR amplification products were electrophoresed on a 2% agarose gel containing Super Red nucleic acid dye in 1×TAE buffer at 120 V for 25 min. The gel run results were photographed and recorded in a gel imaging system.

[0041] (5) Genotype detection of PCR amplification products: The fluorescently labeled PCR amplification products were subjected to capillary electrophoresis, and different genotypes were distinguished according to the size and position of the bands: the macronucleus had both 296 bp and 300 bp bands, and the genotype was G- - - - / GAAAA; the focal nucleus had only a 300 bp band, and the genotype was GAAAA / GAAAA.

[0042] The test results are as follows:

[0043] like Figure 1 As shown: the amplified band size of the primers of the present invention in 87 litchi materials is about 300 bp ( Figure 1 ).

[0044] Table 1 shows the phenotypic data of some sample fruits, and Table 2 shows the genotypic detection results. The sizes of the amplified bands of the primers of the present invention show insertion / deletion differences. Figure 2-5 This is the capillary electrophoresis result.

[0045] Table 1. Phenotypic data of some sample fruits

[0046]

[0047] Table 2 Analysis of primer amplification products of some samples

[0048]

[0049] In summary, this study successfully identified an InDel marker (Chr5_25585686_InDel) significantly associated with litchi kernel size through related experiments. Its primers (forward primer 5'-TGTAAAACGACGGCCAGTACAGTCAATTTCTGAGCCATACATAG-3', reverse primer GGATTTTCCTTGATCCAACATTTGG, and fluorescent marker primer 5'-TGTAAAACGACGGCCAGT-3') can be used for detection. This marker is homozygous for the "GAAAA / GAAAA" genotype in litchi with a large kernel and heterozygous for the "G- - - - / GAAAA" genotype in litchi with a large kernel. This provides an effective tool for molecular marker-assisted breeding of litchi kernel size, potentially shortening breeding cycles, improving breeding efficiency, and promoting litchi variety improvement.

Claims

1. A primer set for detecting litchi pit size, characterized in that: It consists of an upstream primer with a nucleotide sequence as shown in SEQ ID NO. 1, a downstream primer with a nucleotide sequence as shown in SEQ ID NO. 2, and a FAM fluorescent-labeled primer with a nucleotide sequence as shown in SEQ ID NO. 3.

Images