Gene mutation analysis method and system, query sequence establishment method and system, equipment and medium

Abstract

The invention discloses a gene mutation analysis method, system and equipment and a storage medium, and the key points of the technical scheme are as follows: reading forward and reverse sequencing data to obtain first peak data and second peak data of each basic group, determining a first selected basic group and a second selected basic group according to the first peak data and the second peak data, and obtaining a forward selected sequence and a forward undetermined position; performing comparative analysis on the combined forward selection sequence and reverse selection sequence as well as the forward original sequence and reverse original sequence, and controlling the replacement of the base of the forward original sequence and the replacement of the base of the reverse original sequence according to the comparative analysis result to obtain a target forward sequencing sequence and a target reverse sequencing sequence; and judging whether to merge the forward original sequence and the reverse original sequence on the merged target forward sequencing sequence and target reverse sequencing sequence or not according to the replacement condition of the basic groups. According to the invention, the influence of improper sequencing operation or sample pollution on the accuracy of the query sequence can be reduced.

Description

Technical Field

[0001] The present invention belongs to the field of biomedical technology, and specifically relates to a method, system, equipment and medium for gene mutation analysis and query sequence establishment. Background Art

[0002] Currently, the primary method for detecting gene mutations is gene sequencing using Sanger sequencing technology. Sanger sequencing (the first generation of DNA sequencing technology) was originally used for sequencing the human genome. Known for its high accuracy, it remains the "gold standard" for existing sequencing technologies. Sanger sequencing's simple workflow, ease of use, and low cost make it uniquely advantageous in specific application scenarios, such as detecting single-gene genetic diseases, accurately screening for susceptibility genes, and verifying mutations.

[0003] Sanger sequencing data is stored in *.seq and *.ab1 formats. *.ab1 files contain peak plot information, while *.seq files are sequences consisting of bases represented by the highest peak signal at each position. Although they can be opened in Notepad, they do not display secondary peak information. If improper sequencing operations or sample contamination result in multiple peaks at a single position, or even if the true peak height is lower than the contaminating peak, using the *.seq file as a query sequence will prevent the true base information at that position from being determined. This will lead to inaccurate query sequences, potentially missing positive mutations or causing false-positive mutations during subsequent gene mutation detection. Summary of the Invention

[0004] The purpose of the present invention is to provide a method, system, device and medium for gene mutation analysis and query sequence establishment, which can reduce the impact of improper sequencing operations or sample contamination on the accuracy of the query sequence, and prevent the omission of positive mutations or the occurrence of false positive mutations due to inaccurate query sequences in mutation analysis.

[0005] The first aspect of the present invention provides a method for establishing a query sequence, comprising:

[0006] Read bidirectional sequencing data to obtain the forward original sequence and the first peak data of each base at each position, and obtain the reverse original sequence and the second peak data of each base at each position;

[0007] Determine the first selected base at each position based on the first peak data to obtain a forward selected sequence and a forward pending position; determine the second selected base at each position based on the second peak data to obtain a reverse selected sequence and a reverse pending position;

[0008] Combining the forward selected sequence and the reverse selected sequence to obtain a query sequence, and performing an alignment analysis on the query sequence, the forward original sequence, and the reverse original sequence to obtain a target alignment result;

[0009] Controlling the replacement of the base at the forward undetermined position of the forward original sequence according to the target comparison result to obtain a target forward sequencing sequence; controlling the replacement of the base at the reverse undetermined position of the reverse original sequence according to the target comparison result to obtain a target reverse sequencing sequence;

[0010] The target forward sequencing sequence and the target reverse sequencing sequence are combined to obtain a first target query sequence. According to the replacement of the bases, it is determined whether to combine the forward original sequence and the reverse original sequence on the first target query sequence to obtain a second target query sequence.

[0011] In some embodiments, a selected base at each position is determined based on the peak data to obtain a selected sequence and a pending position. When the peak data is first peak data, the selected base is the first selected base, the selected sequence is the forward selected sequence, and the pending position is the forward pending position. When the peak data is second peak data, the selected base is the second selected base, the selected sequence is the reverse selected sequence, and the pending position is the reverse pending position, including:

[0012] The peak value ratio was obtained by dividing the peak value of the second highest peak by the peak value of the highest peak at each position;

[0013] Determine whether the peak ratio is greater than or equal to a ratio threshold; if so, use the base corresponding to the second highest peak as the selected base; if not, use the base corresponding to the highest peak as the selected base;

[0014] All selected bases are arranged in position order to obtain a selected sequence, and positions where the peak ratio is greater than or equal to the ratio threshold are taken as pending positions.

[0015] In some embodiments, the comparison analysis of the query sequence, the forward original sequence, and the reverse original sequence to obtain a target comparison result includes:

[0016] Aligning the query sequence with the forward original sequence to obtain a first alignment result, and aligning the query sequence with the reverse original sequence to obtain a second alignment result;

[0017] The first comparison result is analyzed to obtain a first analysis result, the second comparison result is analyzed to obtain a second analysis result, and the first analysis result and the second analysis result are compared to obtain a target comparison result.

[0018] In some embodiments, analyzing the comparison result to obtain an analysis result, where if the comparison result is a first comparison result, the analysis result is the first analysis result; and if the comparison result is a second comparison result, the analysis result is the second analysis result, includes:

[0019] Sorting the comparison results, and indexing the sorted comparison results to obtain comparison index data;

[0020] Performing anomaly analysis on the comparison index data to obtain original analysis results;

[0021] Positions that meet preset filtering conditions are screened out from the original analysis results to obtain analysis results, wherein the preset filtering conditions include: both allele groups at the same position are homozygous and have the same base type as the query sequence, the sequence coverage of the position is greater than or equal to a first preset threshold, and the abnormality probability of the position is greater than or equal to a second preset threshold.

[0022] In some embodiments, comparing the first analysis result and the second analysis result to obtain a target comparison result includes:

[0023] The first analysis result and the second analysis result at the same site are compared. If the bases in the first analysis result and the second analysis result are complementary, the target comparison result in which the secondary peak is a true signal is obtained. If the bases in the first analysis result and the second analysis result are non-complementary, the target comparison result in which the secondary peak is a false signal is obtained.

[0024] In some embodiments, controlling the replacement of a base at a forward undetermined position of the forward original sequence according to the target alignment result to obtain a target forward sequencing sequence includes:

[0025] When the target alignment result corresponding to the forward undetermined position is that the second peak is a true signal, the base at the forward undetermined position is replaced by the base represented by the second peak to obtain the target forward sequencing sequence;

[0026] The step of controlling the replacement of the base at the reverse undetermined position of the reverse original sequence according to the target alignment result to obtain the target reverse sequencing sequence comprises:

[0027] When the target alignment result corresponding to the reverse pending position is that the second peak is a true signal, the base at the reverse pending position is replaced with the base represented by the second peak to obtain the target reverse sequencing sequence.

[0028] A second aspect of the present invention provides a method for analyzing gene mutations, comprising:

[0029] Select the corresponding reference sequence according to the sequencing species;

[0030] Using the above-mentioned query sequence establishment method on the sequencing data of the sequenced species to establish a second target query sequence;

[0031] Aligning the second target query sequence with the reference sequence to obtain alignment data;

[0032] The alignment data were analyzed to obtain all mutation sites.

[0033] A third aspect of the present invention provides a query sequence establishment system, comprising:

[0034] A data reading module is used to read bidirectional sequencing data, obtain the forward original sequence and the first peak data of each base at each position, and obtain the reverse original sequence and the second peak data of each base at each position;

[0035] a base selection module, configured to determine a first selected base at each position based on the first peak data, to obtain a forward selected sequence and a forward pending position, and to determine a second selected base at each position based on the second peak data, to obtain a reverse selected sequence and a reverse pending position;

[0036] An analysis and comparison module is used to combine the forward selected sequence and the reverse selected sequence to obtain a query sequence, and compare and analyze the query sequence, the forward original sequence and the reverse original sequence to obtain a target comparison result;

[0037] A base replacement module, configured to control the replacement of bases at the forward undetermined position of the forward original sequence according to the target alignment result to obtain a target forward sequencing sequence, and to control the replacement of bases at the reverse undetermined position of the reverse original sequence according to the target alignment result to obtain a target reverse sequencing sequence;

[0038] The sequence merging module is used to merge the target forward sequencing sequence and the target reverse sequencing sequence to obtain a first target query sequence, and determine whether to merge the forward original sequence and the reverse original sequence on the first target query sequence according to the base replacement situation to obtain a second target query sequence.

[0039] A fourth aspect of the present invention provides a computer device comprising a memory and a processor, wherein the memory stores a computer program, and the processor implements the steps of the above-mentioned query sequence establishment method when executing the computer program.

[0040] A fifth aspect of the present invention provides a computer-readable storage medium having a computer program stored thereon, which implements the steps of the above-mentioned query sequence establishment method when executed by a processor.

[0041] The technical solution provided by the present invention has the following advantages and effects: a first selected base and a second selected base are determined based on the peak data of the forward and reverse sequencing data to obtain corresponding forward selected sequences and reverse selected sequences, the merged forward selected sequences and reverse selected sequences are compared and analyzed with the forward original sequence and the reverse original sequence respectively to obtain a first analysis result and a second analysis result, and based on the comparison result of the first analysis result and the second analysis result, base replacement of the original sequence is controlled to reduce the impact of improper sequencing operation or sample contamination on the accuracy of the query sequence, thereby preventing positive mutations from being missed or false positive mutations from being caused due to inaccurate query sequences in mutation analysis. BRIEF DESCRIPTION OF THE DRAWINGS

[0042] Figure 1 1 is a flow chart of the method for establishing a query sequence provided by the present invention;

[0043] Figure 2 It is the mutation site information detected using the gene mutation analysis method provided by the present invention.

[0044] Figure 3 It is a structural block diagram of the query sequence establishment system provided by the present invention;

[0045] Figure 4 It is a diagram of the internal structure of a computer device provided by an embodiment of the present invention. DETAILED DESCRIPTION

[0046] To facilitate understanding of the present invention, specific embodiments of the present invention will be described in more detail below with reference to the accompanying drawings.

[0047] Unless otherwise specified or defined, the "first, second..." used in this article is only used to distinguish names and does not represent a specific quantity or order.

[0048] Unless stated otherwise or defined otherwise, the term "and / or" as used herein includes any and all combinations of one or more of the associated listed items.

[0049] It should be noted that, in this document, “fixed to” or “connected to” may mean directly fixing or connecting to an element, or indirectly fixing or connecting to an element.

[0050] like Figure 1 As shown, this embodiment provides a method for establishing a query sequence, comprising the following steps S1 to S5:

[0051] Step S1: Read bidirectional sequencing data to obtain the forward original sequence and the first peak data of each base at each position, and obtain the reverse original sequence and the second peak data of each base at each position.

[0052] In practical applications, bidirectional sequencing data is obtained by inputting the *.seq and *.ab1 files of the Sanger sequencing data. *.seq is a plain text file (fasta format) containing only the base sequence of the sequencing result, and *.ab1 is a binary format file generated directly by the sequencer and containing the raw sequencing data (such as electropherograms, base sequences, and quality values). Bidirectional sequencing data includes: forward raw sequencing file F.ab1, forward raw sequence file F.seq, reverse raw sequencing file R.ab1, and reverse raw sequence file R.seq. The readsangerseq function of the R package sangerseqR is used to read F.ab1, outputting the first peak data for each base at each position. The forward raw sequence is obtained by reading F.seq. The readsangerseq function of the R package sangerseqR is used to read R.ab1, outputting the second peak data for each base at each position. The reverse raw sequence is obtained by reading R.seq.

[0053] Step S2: determine the first selected base for each position based on the first peak data to obtain a forward selected sequence and a forward pending position; determine the second selected base for each position based on the second peak data to obtain a reverse selected sequence and a reverse pending position.

[0054] Specifically, the selected base of each position is determined according to the peak data to obtain a selected sequence and a pending position. When the peak data is the first peak data, the selected base is the first selected base, the selected sequence is the forward selected sequence, and the pending position is the forward pending position. When the peak data is the second peak data, the selected base is the second selected base, the selected sequence is the reverse selected sequence, and the pending position is the reverse pending position, including:

[0055] The peak value ratio was obtained by dividing the peak value of the second highest peak at each position by the peak value of the highest peak;

[0056] Determine whether the peak ratio is greater than or equal to a ratio threshold; if so, use the base corresponding to the second highest peak as the selected base; if not, use the base corresponding to the highest peak as the selected base;

[0057] All selected bases are arranged in position order to obtain a selected sequence, and positions where the peak ratio is greater than or equal to the ratio threshold are taken as pending positions.

[0058] In actual applications, each position corresponds to 4 bases, namely A, T, C, and G. Each base at each position has corresponding peak data. Under normal circumstances, each position has only one obvious peak. Under abnormal circumstances, there are at least two peaks of similar height at each position, indicating that improper operation or sample contamination during sequencing has caused multiple peaks to appear at one position, and even the true peak height is lower than the contamination peak. This method takes the peak with the highest peak at each position as the highest peak, and the peak with the second highest peak at each position as the second highest peak. The ratio threshold is set to 0.2. 0.2 is obtained based on data testing of multiple samples to prevent the positive sites from being missed due to excessive values, and many false positive sites from appearing due to excessive values. When the peak ratio at each position is greater than or equal to 0.2, the second highest peak is considered to be a true signal. At this time, the base corresponding to the second highest peak is selected as the selected base to facilitate further analysis of the position, reduce the impact of improper sequencing operation or sample contamination on the accuracy of the query sequence, and prevent the omission of positive mutations or the occurrence of false positive mutations due to inaccurate query sequences in mutation analysis. By using the position where the peak ratio is greater than or equal to the ratio threshold as the pending position, it is convenient to replace the base at the pending position later.

[0059] Step S3: Merge the forward selected sequence and the reverse selected sequence to obtain a query sequence, and perform an alignment analysis on the query sequence, the forward original sequence, and the reverse original sequence to obtain a target alignment result.

[0060] Specifically, the query sequence, the forward original sequence and the reverse original sequence are compared and analyzed to obtain a target comparison result, including:

[0061] Aligning the query sequence with the forward original sequence to obtain a first alignment result, and aligning the query sequence with the reverse original sequence to obtain a second alignment result;

[0062] The first comparison result is analyzed to obtain a first analysis result, the second comparison result is analyzed to obtain a second analysis result, and the first analysis result and the second analysis result are compared to obtain a target comparison result.

[0063] In practical applications, the tool bwa is used to align the query sequence with the forward original sequence, and to align the query sequence with the reverse original sequence, to obtain the first alignment result and the second alignment result respectively. The first alignment result and the second alignment result are analyzed to obtain the corresponding first analysis result and the second analysis result. The analysis result includes the base changes between the original sequence and the query sequence at the same site, and then compares the base changes of the forward alignment and the base changes of the reverse alignment. According to the comparison results of the base changes between the forward and reverse directions, it is determined whether the secondary peak is a true signal. Since the highest peak in the forward original sequence and the reverse original sequence is regarded as the true signal, and the forward selected sequence and the reverse selected sequence are replaced with bases represented by the secondary peak that may be the true signal, the forward selected sequence and the reverse selected sequence are merged and then aligned to the forward original sequence or the reverse original sequence. When the secondary peak appears as a true signal at the same position in the forward sequencing and the reverse sequencing, the base is replaced at that position to improve the replacement accuracy.

[0064] Specifically, analyzing the comparison result to obtain an analysis result, where if the comparison result is a first comparison result, the analysis result is the first analysis result; and if the comparison result is a second comparison result, the analysis result is the second analysis result, including:

[0065] Sorting the comparison results, and indexing the sorted comparison results to obtain comparison index data;

[0066] Performing anomaly analysis on the comparison index data to obtain original analysis results;

[0067] Positions that meet preset filtering conditions are screened out from the original analysis results to obtain analysis results, wherein the preset filtering conditions include: both allele groups at the same position are homozygous and have the same base type as the query sequence, the sequence coverage of the position is greater than or equal to a first preset threshold, and the abnormality probability of the position is greater than or equal to a second preset threshold.

[0068] In practice, alignment results are sorted by base position. The sorted alignment results are then indexed using the samtools tool to generate alignment index data. This index data is then analyzed using the bcftools tool to generate the original analysis results. To improve the accuracy of the analysis results, the original analysis results are filtered using preset filtering conditions to select positions that meet the preset filtering conditions. The two allele groups in the preset filtering conditions are both pure and the same base type as the query sequence, which can be expressed as GT=1 / 1, where GT represents the type of the two alleles carried by the site, 0 represents the base type of the original sequence, 1 represents the base type of the query sequence, and 1 / 1 represents pure and both are the base type of the query sequence; the sequence coverage of the position is greater than or equal to the first preset threshold, which is set to 2 and can be expressed as DP>=2. The two filtering conditions of GT=1 / 1 and DP>=2 ensure that the forward selected sequence and the reverse selected sequence in the query sequence are aligned with the reference sequence and are both of the same base type as the query sequence; the abnormality probability of the position is greater than or equal to the second preset threshold, and QUAL represents the abnormality probability, that is, the possibility of change at the site. The higher the score, the more reliable it is. The second preset threshold is set to 20, which can be expressed as QUAL>=20, to ensure the reliability of the screened positions.

[0069] Specifically, comparing the first analysis result and the second analysis result to obtain a target comparison result includes:

[0070] The first analysis result and the second analysis result at the same site are compared. If the bases in the first analysis result and the second analysis result are complementary, the target comparison result in which the secondary peak is a true signal is obtained. If the bases in the first analysis result and the second analysis result are non-complementary, the target comparison result in which the secondary peak is a false signal is obtained.

[0071] In practical applications, if the first analysis result at site A is that base A changes to base C, and the second analysis result is that base T changes to base G, then the bases of the first analysis result and the second analysis result at site A are complementary, and the secondary peak is a true signal. If the bases in the first analysis result and the second analysis result are not complementary, such as the first analysis result at site B is that base A changes to base C, and the second analysis result is that base T changes to base A, then the secondary peak at site B is a false signal, which prevents the omission of positive mutations or the occurrence of false positive mutations due to improper sequencing operation or sample contamination.

[0072] Step S4: controlling the replacement of the base at the forward undetermined position of the forward original sequence according to the target comparison result to obtain a target forward sequencing sequence; controlling the replacement of the base at the reverse undetermined position of the reverse original sequence according to the target comparison result to obtain a target reverse sequencing sequence.

[0073] Specifically, the method of controlling the replacement of bases at the forward pending position of the forward original sequence according to the target alignment result to obtain a target forward sequencing sequence includes: when the target alignment result corresponding to the forward pending position is a second peak that is a true signal, replacing the base at the forward pending position with the base represented by the second peak to obtain the target forward sequencing sequence. The method of controlling the replacement of bases at the reverse pending position of the reverse original sequence according to the target alignment result to obtain a target reverse sequencing sequence includes: when the target alignment result corresponding to the reverse pending position is a second peak that is a true signal, replacing the base at the reverse pending position with the base represented by the second peak to obtain the target reverse sequencing sequence.

[0074] In actual applications, if the first analysis result at site A is that base A changes to base C, and the second analysis result is that base T changes to base G, and the secondary peak is a true signal, then the forward pending position represents the position of site A on the forward original sequence, the original base at this position is A, and the base A at this position is replaced by base C, and the reverse pending position represents the position of site A on the reverse original sequence, the original base at this position is T, and the base T at this position is replaced by base G. If the target comparison result is that the secondary peak is a false signal, such as the secondary peak corresponding to site B is a false signal, then the forward pending position represents the position of site B on the forward original sequence, and the original base at this position is retained, and the reverse pending position represents the position of site B on the reverse original sequence, and the original base at this position is retained. By determining whether the secondary peak is a true signal, if the secondary peak is a true signal, the bases at the corresponding positions on the forward original sequence and the reverse original sequence are replaced to prevent positive mutations from being missed or false positive mutations from being caused by improper sequencing operations or sample contamination.

[0075] Step S5: Merge the target forward sequencing sequence and the target reverse sequencing sequence to obtain a first target query sequence, and determine whether to merge the forward original sequence and the reverse original sequence on the first target query sequence according to the base substitution to obtain a second target query sequence.

[0076] In actual applications, the target forward sequencing sequence and the target reverse sequencing sequence are merged to obtain a first target query sequence. After the base at the pending position is replaced, the forward original sequence and the reverse original sequence need to be merged into the first target query sequence, and the first target query sequence merged with the forward original sequence and the reverse original sequence is used as the second target query sequence. After replacing the base at the position where the secondary peak may be a true signal, it cannot be fully guaranteed that the secondary peak after replacement is necessarily a true signal, and the highest peak must be contamination or sequencing error, so the original original sequences are merged and analyzed together to reduce sequencing errors. After the base at the pending position is not replaced, there is no need to merge the forward original sequence and the reverse original sequence into the first target query sequence, and the first target query sequence without merging the forward original sequence and the reverse original sequence is used as the second target query sequence. By merging the forward sequence and the reverse sequence, it is convenient to perform forward and reverse sequencing of the second target query sequence according to the reference sequence, thereby improving coverage integrity and sequencing data accuracy.

[0077] This example uses Demo as an example to establish a query sequence for the 7 exons of the gene GLA:

[0078] (1) Read the Sanger sequencing data to obtain the forward original sequence and the first peak data of each base at each position; read the reverse sequencing data to obtain the reverse original sequence and the second peak data of each base at each position:

[0079] 1.1 Obtain the Sanger sequencing data for the GLA gene of sample Demo. The sample names of the 7 exon data are shown in the following table:

[0080] Exon number Forward sequencing Reverse sequencing EXON1 EX1_F.ab1, EX1_F.seq EX1_R.ab1, EX1_R.seq EXON2 EX2_F.ab1, EX2_F.seq EX2_R.ab1, EX2_R.seq EXON3 EX3_F.ab1, EX3_F.seq EX3_R.ab1, EX3_R.seq EXON4 EX4_F.ab1, EX4_F.seq EX4_R.ab1, EX4_R.seq EXON5-EXON6 EX56_F.ab1, EX56_F.seq EX56_R.ab1, EX56_R.seq EXON7 EX7_F.ab1, EX7_F.seq EX7_R.ab1, EX7_R.seq

[0081] 1.2 Use the readsangerseq function of the R package sangerseqR to read the forward sequencing result files EX1_F.ab1, EX2_F.ab1, EX3_F.ab1, EX4_F.ab1, EX56_F.ab1, and EX7_F.ab1 of each exon, output the peak data of each base at each position, and obtain the first peak data corresponding to each exon. Use the readsangerseq function of the R package sangerseqR to read the reverse sequencing result files EX1_R.ab1, EX2_R.ab1, EX3_R.ab1, EX4_R.ab1, EX56_R.ab1, and EX7_R.ab1 of each exon, output the peak data of each base at each position, and obtain the second peak data corresponding to each exon.

[0082] (2) Divide the peak value of the second highest peak at each position by the peak value of the highest peak to obtain the peak ratio. If the peak ratio is greater than or equal to 0.2, it is considered that the second highest peak may also be a true signal. When the peak ratio is less than 0.2, the base represented by the highest peak is selected as the selected base. When the peak ratio is greater than or equal to 0.2, that is, it may be a true signal, the base represented by the second highest peak is selected as the selected base. The bases selected at each position are sorted in sequence to form a complete sequence, thereby obtaining the forward selected sequence and reverse selected sequence in the fasta format. The results are as follows:

[0083] Forward selected sequence:

[0084] >EX1_F_secondaryseq

[0085] GCTCTCGGTGATGGTCTGCCCCTGAGGTTACTCTTATAAGCCCAGGTTACCCGCGGAGATTTATGCTGTCCGGTTACCGTGACAATGCAGCTGAGGAACCCAGAACTACATCTGGGCTGCGCGCTTGCGCTTCGCTTCCTGGCCCTCGTTTCCTGGGACATCCCTGGGGCTAGAGCACTGGACAATGGATTGGCAAGGACGCCTACCATGGGCTGGCTGCACTG GGAGCGCTTCATGTGCAACCTTGACTGCCAGGAAGAGCCAGATTCCTGCATCAGGTATCAGATATTGGGTACTCCCTTCCCTTTGCTTTTCCATGTGTTTGGGTGTGTTTGGGGAACTGGAGAGTCTCAACGGGAACAGTTGAGCCCGAGGGAGAGCTCCCCCACCCGACTCTGCTGCTGCTTTTTTATCCCCAGCAAACTGTCCCGAATCAGGGGTCAAGTTG

[0086] >EX2_F_secondaryseq

[0087] CAGTCATGCTGTCTGCTGATCTGACTCTTGACCTCAGGTGATCCACCCGCCTCGGCCTCCCAAAGTGTTGGGATTACAGGCGTGAGCCACCACGCCCGGCCATGAGGGCTGTTTCTAAACAAGCTTCTGTACAGAAGTGCTTACAGTCCTCTGAATGAACAAGAACATTATCTATAAACTCACATAATTAGCTAGCTGGCGAATCCCATGAGGAAAGCGCTGAGGGTCTGCCTGAAGTCTGCCTTCTGAATCTCTTTGGGGAGCCATCCAACAGTCATCAATGCAGAGGTACTCATAACCTGCATCCTTCCAGCCTTCTGAGACCATGAGCTCTGCCATCTCCATGAAGAGCTTCTCACTGAAAGAGAAATTCCAATAATCATTACAATTCATTAAATGAACACTTAGGTACCTCCCATTTATTAGGCACCTTGGGATTTCAGGTCATACCTGTTTCCTGA

[0088] >EX3_F_secondaryseq

[0089] CGTATGTCTCTCGTTCTGCTACCTCACGATTGTGCTTCTACTATGGTGACTCTTATTCCTCCCTCTCATTTCAGGTTCACAGCAAAGGACTGAAGCTAGGGATTTATGCAGATGTTGGAAATAAAACCTGCGCAGGCTTCCCTGGGAGTTTTGGATACTACGACATTGATGCCCAGACCTTTGCTGACTGGGGAGTAGATCTGCTAAAATTTGATGGTTGTTACTGTGACAGTTTGGAAAATTTGGCAGATGGTAATGTTTCATTCCAGAGATTTAGCCACAAAGGAAAGAACTTTGAGGCCATGGTAGCTGAGCCAAAGAACCAATCTTCGGTCATAGTGGTTTCCTGA

[0090] >EX4_F_secondaryseq

[0091] AGCAGCTGATCTTTCTTTCTCTTATTTTACCCATTGTTTTCTCATACAGGTTATAAGCACATGTCCTTGGCCCTGAATAGGACTGGCAGAAGCATTGTGTACTCCTGTGAGTGGCCTCTTTATATGTGGCCCTTTCAAAAGGTGAGATAGTGAGCCCAGAATCCAATAGAACTGTACTGATAGATAGAACTTGACAACAAAGGAAACCAAGGTCTCCTTCAAAGTCCAACGTTACTTACTATCATCCTACCATCTCTCCCAGGTTCCAACCACTTCTCACCATCCCCACTGGGTCATAGCTTGTTTCCTG

[0092] >EX56_F_secondaryseq

[0093] CTGAGACGTTCATCTGTAACGCGTYATAGGCTACTAGTGGCTCCTTTATACTGGTTTCTTCTCGCAAGGATGTTACTATAAAGAAGACAGAAGAGGCNTATCTGTTTTCACAGCCCAATTATACAGAAATCCGACAGTACTGCAATCACTGGCGAAATTTTGCTGACATTGATGATTCCTGGAAAAGTATAAAGAG TATCTTGGACTGGACATCTTTTAACCAGGAGAGAATTGTTGATGTTGCTGGACCAGGGGGTTGGAATGACCCAGATATGGTAAAAACTTGAGCCCTCCTTGTTCAAGACCCTGCGGTAGGCTTGTTTCCTATTTTGACATTCAAGGTAAATACAGGTAAAGTTCCTGGGAGGAGGCTTTATGTGAGAGTACTTAGA GCAGGATGCTGTGGAAAGTGGTTTCTCCATATGGGTCATCTAGGTAACTTTAAGAATGTTTCCTCCTCTCTTGTTTGAATTATTTCATTCTTTTTCTCAGTTAGTGATTGGCAACTTTGGCCTCAGCTGGAATCAGCAAGTAACTCAGATGGCCCTCTGGGCTATCATGGCTGCTCCTTTATTCATGTCTAATGACCTCCGACACATCAGCCCTCAAGCCAAAGCTCTCCTTCAGGATAAGGACGTAATTGCCATCAATCAGGACCCCTTGGGCAAGCAAGGGTACCAGCTTAGACAGGTAAATAAGAGTATATATTTTAAGATGGCTTTATATACCCAATACCAACTTTGTCTTGGGCCTAATCTATTTTGGTCTAACCCTGGTTTCCTGA

[0094] EX7_F_secondaryseq

[0095] AGACGTCCAGTCCGACTCATGTGATCTGCCCGCCTCAGCCTCCCAAAGTGCTGGGATTACAGGCATGAGCCACCTAGCCTTGAGCTTTTAAAGTGAATGGAGAAAAAGGTGGACAGGAAGTAGTAGTTGGCAATAAAATAAACATTTTAAAGTAAGTCTTTTAATGACATCTGCATTGTATTTTCTAGCTGAAGCAAAACAGTGCCTGTGGGATTTATGTGACTTCTTAACCTTGAAGTCCATTCATAGAACCCTAGCTTCCTTTTCACAGGGAGGAGCTGTGTGATGAAGCAGGCAGGATTACAGGCCACTCCTTTACCCAGGGAAGCAACTGCGATGGTATAAGAGCGAGGTCCACCAATCTCCTGCCGGTTTATCATAGCTACAGCCCAGGCTAAGCCTGAGAGAGGTCGTTCCCACACTTCAAAGTTGTCTCCCTGAAAAACCAAGAAAGTGTGATTGCTTAGCAACTAGTGATAAGTGGCCCTGTTAGTTTGGCATTCATTCTGGTCAAGCTGGGGTTTCCGGGA

[0096] Reverse selected sequence:

[0097] >EX1_R_secondaryseq

[0098] ATGAGTGCTGGCGAACATAGCAGCAGCAGAGTCGGGTGGGGGAGCTCTCCCTCGGGCTCAACTGTTCCCGTTGAGACTCTCCAGTTCCCCAAACACACCCAAACACATGGAAAAGCAAAGGGAAGGGAGTACCCAATATCTGATACCTGATGCAGGAATCTGGCTCTTCCTGGCAGTCAAGGTTGCACATGAAGCGCTCCCAGTGCAGCCAGCCCATGGTAGGCGTCCTTGCCAATCCATTGTCCAGTGCTCTAGCCCCAGGGATGTCCCAGGAAACGAGGGCCAGGAAGCGAAGCGCAAGCGCGCAGCCCAGATGTAGTTCTGGGTTCCTCAGCTGCATTGTCACGGTAACCGGACAGCATAAATTTCCGCGGGTAACCTGGGCTTTTAAGATTAACCTCAGGGGCGGACCAATCACCGATGACTTATTAAATAAACTGGCCGCGGTTTTACAA

[0099] >EX2_R_secondaryseq

[0100] CTGTGCTATAGTGGGAGGTACCTACGTGTTCATTTAATGAATTGTAATGATTATTGGAATTTCTCTTTCAGTGAGAAGCTCTTCATGGAGATGGCAGAGCTCATGGTCTCAGAAGGCTGGAAGGATGCAGGTTATGAGTACCTCTGCATTGATGACTGTTGGATGGCTCCCCAAAGAGATTCAGAAGGCAGACTTCAGGCAGACCCTCAGCGCTTTCCTCATGGGATTCGCCAGCTAGCTAATTATGTGAGTTTATAGATAATGTTCTTGTTCATTCAGAGGACTGTAAGCACTTCTGTACAGAAGCTTGTTTAGAAACAGCCCTCATGGCCGGGCGTGGTGGCTCACGCCTGTAATCCCAACACTTTGGGAGGCCGAGGCGGGTGGATCACCTGAGGTCAAGAGTTCAAGACCAGCCTGGCCAACATGGTGAAACCCCAACTCACTGGCCGTCGTTTTACAA

[0101] EX3_R_secondaryseq

[0102] GTTCTGCTCGCTACATGGCCTCTCAGTTCTTTCCTTTGTGGCTAAATCTCTGGAATGAAACATTACCATCTGCCAAATTTTCCAAACTGTCACAGTAACAACCATCAAATTTTAGCAGATCTACTCCCCAGTCAGCAAAGGTCTGGGCATCAATGTCGTAGTATCCAAAACT CCCAGGGAAGCCTGCGCAGGTTTTATTTCCAACATCTGCATAAATCCCTAGCTTCAGTCCTTTGCTGTGAACCTGAAATGAGAGGGAGGAAAAGAGTCACCATTGTAGAAGCACAATCGTGAGGTAGCAGAAAGAGAGAACCATTCCAGGCTGACTGGCCGTCGTTTTACAA

[0103] EX4_R_secondaryseq

[0104] AGTACTGAAGTGCTGTACTGGGAGAGTGGTAGGATGATAGTAAGTAACGTTGGACTTTGAAGGAGACCTTGGTTTCCTTTGTTGTCAAGTTCTATCTATCAGTACAGTTCTATTGGATTCTGGGCTCACTATCTCACCTTTTGAAAGGGCCACATATAAAGAGGCCACTCACAGGAGTACACAATGCTTCTGCCAGTCCTATTCAGGGCCAAGGACATGTGCTTATAACCTGTATGAGAAAACAATGGGTAAAATAAGGGAAAGAAATGAATTTCCAGCTGGGGCTATATATAGTACTGGCCGTCGTTTTACAA

[0105] EX56_R_secondaryseq

[0106] GATGCAGACAGTTGGTATTGGGTATATAAAGCCATCTTAAAATATATACTCTTATTTACCTGTCTAAGCTGGTACCCTTGCTTGCCCAAGGGGTCCTGATTGATGGCAATTACGTCCTTATCCTGAAGGAGAGCTTTGGCTTGAGGGCTGATGTGTCGGAGGTCATTAGACATGAATAAAGGAGCAGCCATGATAGCCCAGAGGGCCATCTGAGTTACTTGCTGATTCCAGCTGAGGCCAAAGTTGCCAATCACTAACTGAGAAAAAGAATGAAATAATTCAAACAAGAGAGGAGGAAACATTCTTAAAGTTACCTAGATGACCCATATGGAGAAACCACTTTCCACAGCATCCTGCTCTAAGTACTCTCACATAAAGCCTCCTCCCAGGAACTTTACCTGTATTTACCTTGAATGTCAAAATAGGAAACAAGCCTACCGCAGGGTCTTGAACAAGGAGGGCTCAAGTTTTTACCATATCTGGGTCATTCCAACCCCCTGGTCCAGCAACATCAACAATTCTCTCCTGGTTAAAAGATGTCCAGTCCAAGATACTCTTTATACTTTTCCAGGAATCATCAATGTCAGCAAAATTTCGCCAGTGATTGCAGTACTGTCGGATTTCTGTATAATTGGGCTGTGAAAACAGATACGACTCTTCTGTTTACTTTCTACTAACATCCTTGTGAGATGAAAACAGTTTAAAGGAGGCACTTGTAGCCTTCTCTTGAGTTTACAGATTGAACGTCTCCATAAGGAGGTCTAACTGGCGGCCCCTTTTTAAA

[0107] >EX7_R_secondaryseq

[0108] AGCAGCTAGCGGTCCCTTATCACTAGTTGCTAGCAATCACACTTTCTTGGTTTTTCAGGGAGACAACTTTGAAGTGTGGGAACGACCTCTCTCAGGCTTAGCCTGGGCTGTAGCTATGATAAACCGGCAGGAGA TTGGTGGACCTCGCTCTTATACCATCGCAGTTGCTTCCCTGGGTAAAGGAGTGGCCTGTAATCCTGCCTGCTTCATCACACAGCTCCTCCCTGTGAAAAGGAAGCTAGGGTTCTATGAATGGACTTCAAGGTTA AGAAGTCACATAAATCCCACAGGCACTGTTTTGCTTCAGCTAGAAAATACAATGCAGATGTCATTAAAAGACTTACTTTAAAATGTTTATTTTATTGCCAACTACTTCCTGTCCACCTTTTTCTCCATTCA CTTTAAAAGCTCAAGGCTAGGTGGCTCATGCCTGTAATCCCAGCACTTTGGGAGGCTGAGGCGGGCAGATCACCTGAGGTCGGGACTTTGAGACCCGCCTGGACACTGGCCGTCCGTTTTACAAGGTGGTTGGGG

[0109] (3) Combine the forward selected sequence and the reverse selected sequence of each exon as the query sequence, and perform an alignment analysis on the query sequence, the forward original sequence, and the reverse original sequence of each exon to obtain the target alignment result:

[0110] 3.1 Each exon uses its corresponding forward original sequence as the reference sequence. First, use the bwa tool to align the reference sequence and the query sequence to obtain the aligned bam file, which is the first alignment result. Then use the samtools tool to index the first alignment result to obtain the first index data. Use the bcftools tool to analyze the first index data to obtain the first original analysis result. Finally, filter the first original analysis result using the preset filter conditions to obtain the first analysis result, as shown in the following table:

[0111]

[0112] In the table, CHROM indicates the analysis result number corresponding to the exon, POS indicates the base position in the selected sequence, i.e., the pending position, REF indicates the base in the reference sequence, AIL indicates the base in the selected sequence, QUAL indicates the probability of anomaly, and INFO is used to store additional information, such as coverage depth and mutation frequency. FORMAT indicates the variant site format, which corresponds one-to-one to the content of the last column in the table. Different formats are separated by ":". In this example, GT (genotype) is 1 / 1, and PL (the probability of three different genotypes, 0 / 0, 0 / 1, and 1 / 1) are 120, 6, and 0, respectively. The smaller the value, the greater the probability of the corresponding genotype.

[0113] 3.2 Each exon uses its corresponding reversed original sequence as the reference sequence. First, use the bwa tool to align the reference sequence and query sequence to obtain the aligned bam file, which is the second alignment result. Then use the samtools tool to index the second alignment result to obtain the second index data. Use the bcftools tool to analyze the second index data to obtain the second original analysis result. Finally, filter the second original analysis result using the preset filter conditions to obtain the second analysis result, which is as follows:

[0114]

[0115]

[0116] 3.3 For the first analysis results, the second analysis results were then searched for complementary bases. In exon 7 (EXON7), base 460 in the forward sequencing was mutated from G to A, and base 38 in the reverse sequencing was mutated from C to T. These are complementary, and the secondary peak at this position is considered a true signal, resulting in a target alignment result indicating that the secondary peak is a true signal.

[0117] (4) Based on the target alignment results, the forward original sequence EX7_F.seq of exon 7 was used as a reference, and the base at position 460 was replaced with the base A represented by the secondary peak to obtain the target forward sequencing sequence EX7_F_secondarySeq of exon 7. The reverse original sequence EX7_R.seq of exon 7 was used as a reference, and the base at position 38 was replaced with the base T represented by the secondary peak to obtain the target reverse sequencing sequence EX7_R_secondarySeq of exon 7. The results are as follows:

[0118] >EX7_F_secondarySeq

[0119] GGGCTTCCAGTCCGACCTCAGGTGATCTGCCCGCCTCAGCCTCCCAAAGTGCTGGGATTACAGGCATGAGCCACCTAGCCTTGAGCTTTTAAAGTGAATGGAGAAAAAGGTGGACAGGAAGTAGTAGTTGGCAATAAAATAAACATTTTAAAGTAAGTCTTTTAATGACATCTGCATTGTATTTTCTAGCTGAAGCAAAACAGTGCCTGTGGGATTTATGTGACTTCTTAACCTTGAAGTCCATTCATAGAACCCTAGCTTCCTTTTCACAGGGAGGAGCTGTGTGATGAAGCAGGCAGGATTACAGGCCACTCCTTTACCCAGGGAAGCAACTGCGATGGTATAAGAGCGAGGTCCACCAATCTCCTGCCGGTTTATCATAGCTACAGCCCAGGCTAAGCCTGAGAGAGGTCGTTCCCACACTTCAAAGTTGTCTCCCTGAAAAACCAAGAAAGTGTGATTGCTTAGCAACTAGTGATAAGTGGCCCTGTTAGTTTGGCATTCATTCTGGTCAAGGGGGGGTTTCCGGGAAT

[0120] >EX7_R_secondarySeq

[0121] AGCAGCTAGAGGGCCCTTATCACTAGTTGCTAAGCAATCACACTTTCTTGGTTTTTCAGGGAGACAACTTTGAAGTGTGGGAACGACCTCTCTCAGGCTTAGCCTGGGCTGTAGCTATGATAAACCGGCAGGAGA TTGGTGGACCTCGCTCTTATACCATCGCAGTTGCTTCCCTGGGTAAAGGAGTGGCCTGTAATCCTGCCTGCTTCATCACACAGCTCCTCCCTGTGAAAAGGAAGCTAGGGTTCTATGAATGGACTTCAAGGTTAA GAAGTCACATAAATCCCACAGGCACTGTTTTGCTTCAGCTAGAAAATACAATGCAGATGTCATTAAAAGACTTACTTTAAAATGTTTATTTTATTGCCAACTACTTCCTGTCCACCTTTTTCTCCATTCACT TTAAAAGCTCAAGGCTAGGTGGCTCATGCCTGTAATCCCAGCACTTTGGGAGGCTGAGGCGGGCAGATCACCTGAGGTCGGGACTTTGAGACCCGCCTGGACACTGGCCGCCCGTTTTACAAACTAGCCTGCCCAA

[0122] If the original sequence of exons 1 to 6 is the same as the selected sequence, the original sequence is used as the target sequencing sequence.

[0123] (5) The target forward sequencing sequence and the target reverse sequencing sequence of exon 1 were merged to obtain EX1.fasta, the target forward sequencing sequence and the target reverse sequencing sequence of exon 2 were merged to obtain EX2.fasta, the target forward sequencing sequence and the target reverse sequencing sequence of exon 3 were merged to obtain EX3.fasta, the target forward sequencing sequence and the target reverse sequencing sequence of exon 4 were merged to obtain EX4.fasta, the target forward sequencing sequence and the target reverse sequencing sequence of exons 5 and 6 were merged to obtain EX56.fasta, and the forward original sequence, reverse original sequence, target forward sequencing sequence and target reverse sequencing sequence of exons 5 and 6 were merged to obtain EX7.fasta.

[0124] The present invention also provides a method for analyzing gene mutations, comprising:

[0125] Select the corresponding reference sequence according to the sequencing species;

[0126] Using the above-mentioned query sequence establishment method on the sequencing data of the sequenced species to establish a second target query sequence;

[0127] Aligning the second target query sequence with the reference sequence to obtain alignment data;

[0128] The alignment data were analyzed to obtain all mutation sites.

[0129] In practical application, using Demo as an example, the query sequence generation method described above was used to generate query sequences for the seven exons of the GLA gene, generating the corresponding first target query sequence. Using the hg19 human genome as the reference sequence, the bwa tool was used to align the reference sequence and the first target query sequence, generating a bam file. The samtools tool was then used to index the bam file, generating an index file. The bcftools tool was then used to analyze the index file to identify all mutation sites.

[0130] The refGeneWithVer database, dbSNP database, gnomAD database, ClinVar database, and HGMD database were installed using annovar software. All mutation sites were annotated using annovar software and the downloaded database to obtain detailed biological significance of the mutation sites. The results are as follows: Figure 2 shown.

[0131] like Figure 3 As shown, an embodiment of the present invention further provides a query sequence establishment system, comprising:

[0132] The data reading module 10 is used to read the bidirectional sequencing data, obtain the forward original sequence and the first peak data of each base at each position, and obtain the reverse original sequence and the second peak data of each base at each position;

[0133] a base selection module 20 for determining a first selected base at each position based on the first peak data to obtain a forward selected sequence and a forward pending position, and determining a second selected base at each position based on the second peak data to obtain a reverse selected sequence and a reverse pending position;

[0134] An analysis and comparison module 30 is used to combine the forward selected sequence and the reverse selected sequence to obtain a query sequence, and compare and analyze the query sequence, the forward original sequence, and the reverse original sequence to obtain a target comparison result;

[0135] A base replacement module 40 is used to control the replacement of bases at the forward undetermined position of the forward original sequence according to the target alignment result to obtain a target forward sequencing sequence, and to control the replacement of bases at the reverse undetermined position of the reverse original sequence according to the target alignment result to obtain a target reverse sequencing sequence;

[0136] The sequence merging module 50 is used to merge the target forward sequencing sequence and the target reverse sequencing sequence to obtain a first target query sequence, and determine whether to merge the forward original sequence and the reverse original sequence on the first target query sequence according to the base replacement situation to obtain a second target query sequence.

[0137] The specific definition of the query sequence establishment system can be found in the definition of the query sequence establishment method above and will not be repeated here. The various modules of the query sequence establishment system described above may be implemented in whole or in part via software, hardware, or a combination thereof. These modules and units may be embedded in or independent of a processor in a computer device in hardware form, or stored in a computer device memory in software form, so that the processor can call and execute the corresponding operations of each module.

[0138] like Figure 4 As shown, an embodiment of the present invention discloses a computer device, including a memory and a processor, wherein the memory stores a computer program;

[0139] The computer device may be a server, and its internal structure diagram may be as follows: Figure 4 As shown. The computer device includes a processor, memory, network interface, and database connected via a system bus. The processor of the computer device is used to provide computing and control capabilities. The memory of the computer device includes a non-volatile storage medium and an internal memory. The non-volatile storage medium stores an operating system, a computer program, and a database. The internal memory provides an environment for the operation of the operating system and computer program in the non-volatile storage medium. The network interface of the computer device is used to communicate with an external terminal via a network connection. When the computer program is executed by the processor, it implements the query sequence establishment method described in the above embodiments.

[0140] Those skilled in the art will understand that Figure 4 The structure shown in the figure is only a block diagram of a part of the structure related to the solution of the present application, and does not constitute a limitation on the computer device to which the solution of the present application is applied. The specific computer device may include more or fewer components than shown in the figure, or combine certain components, or have a different component arrangement.

[0141] An embodiment of the present invention further discloses a computer-readable storage medium storing a computer program, wherein the computer program enables a computer to execute the query sequence establishment method described in the above embodiments.

[0142] Those skilled in the art will appreciate that all or part of the processes in the above-mentioned embodiments can be implemented by instructing the relevant hardware through a computer program. The computer program can be stored in a non-volatile computer-readable storage medium. When the computer program is executed, it can include the processes of the embodiments of the above-mentioned methods. Among them, any reference to memory, storage, database or other media used in the embodiments provided in this application can include non-volatile and / or volatile memory. Non-volatile memory can include read-only memory (ROM), programmable ROM (PROM), electrically programmable ROM (EPROM), electrically erasable programmable ROM (EEPROM) or flash memory. Volatile memory can include random access memory (RAM) or external cache memory. By way of illustration and not limitation, RAM is available in various forms, such as static RAM (SRAM), dynamic RAM (DRAM), synchronous DRAM (SDRAM), double data rate SDRAM (DDRSDRAM), enhanced SDRAM (ESDRAM), synchronous link (Synchlink) DRAM (SLDRAM), memory bus (Rambus) direct RAM (RDRAM), direct memory bus dynamic RAM (DRDRAM), and memory bus dynamic RAM (RDRAM).

[0143] The technical features of the above embodiments can be combined arbitrarily. To make the description concise, not all possible combinations of the technical features in the above embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

Claims

1. A method for establishing a query sequence, characterized in that: include: Read bidirectional sequencing data to obtain the forward original sequence and the first peak data of each base at each position, and obtain the reverse original sequence and the second peak data of each base at each position; Determine the first selected base at each position based on the first peak data to obtain a forward selected sequence and a forward pending position; determine the second selected base at each position based on the second peak data to obtain a reverse selected sequence and a reverse pending position; Combining the forward selected sequence and the reverse selected sequence to obtain a query sequence, and performing an alignment analysis on the query sequence, the forward original sequence, and the reverse original sequence to obtain a target alignment result; Controlling the replacement of the base at the forward undetermined position of the forward original sequence according to the target comparison result to obtain a target forward sequencing sequence; controlling the replacement of the base at the reverse undetermined position of the reverse original sequence according to the target comparison result to obtain a target reverse sequencing sequence; The target forward sequencing sequence and the target reverse sequencing sequence are combined to obtain a first target query sequence. According to the replacement of the bases, it is determined whether to combine the forward original sequence and the reverse original sequence on the first target query sequence to obtain a second target query sequence.

2. The method for establishing a query sequence according to claim 1, wherein: Determining a selected base at each position according to the peak data to obtain a selected sequence and a pending position, wherein when the peak data is the first peak data, the selected base is the first selected base, the selected sequence is the forward selected sequence, and the pending position is the forward pending position; and when the peak data is the second peak data, the selected base is the second selected base, the selected sequence is the reverse selected sequence, and the pending position is the reverse pending position, including: The peak value ratio was obtained by dividing the peak value of the second highest peak by the peak value of the highest peak at each position; Determine whether the peak ratio is greater than or equal to a ratio threshold; if so, use the base corresponding to the second highest peak as the selected base; if not, use the base corresponding to the highest peak as the selected base; All selected bases are arranged in position order to obtain a selected sequence, and positions where the peak ratio is greater than or equal to the ratio threshold are taken as pending positions.

3. The method for establishing a query sequence according to claim 2, wherein: The query sequence, the forward original sequence and the reverse original sequence are compared and analyzed to obtain a target comparison result, including: Aligning the query sequence with the forward original sequence to obtain a first alignment result, and aligning the query sequence with the reverse original sequence to obtain a second alignment result; The first comparison result is analyzed to obtain a first analysis result, the second comparison result is analyzed to obtain a second analysis result, and the first analysis result and the second analysis result are compared to obtain a target comparison result.

4. The method for establishing a query sequence according to claim 3, wherein: Analyzing the comparison result to obtain an analysis result, where if the comparison result is a first comparison result, the analysis result is the first analysis result; and if the comparison result is a second comparison result, the analysis result is the second analysis result, including: Sorting the comparison results, and indexing the sorted comparison results to obtain comparison index data; Performing anomaly analysis on the comparison index data to obtain original analysis results; Positions that meet preset filtering conditions are screened out from the original analysis results to obtain analysis results, wherein the preset filtering conditions include: both allele groups at the same position are homozygous and have the same base type as the query sequence, the sequence coverage of the position is greater than or equal to a first preset threshold, and the abnormality probability of the position is greater than or equal to a second preset threshold.

5. The method for establishing a query sequence according to claim 3, wherein: Comparing the first analysis result and the second analysis result to obtain a target comparison result includes: The first analysis result and the second analysis result at the same site are compared. If the bases in the first analysis result and the second analysis result are complementary, the target comparison result in which the secondary peak is a true signal is obtained. If the bases in the first analysis result and the second analysis result are non-complementary, the target comparison result in which the secondary peak is a false signal is obtained.

6. The method for establishing a query sequence according to claim 3, wherein: The step of controlling the replacement of the base at the forward undetermined position of the forward original sequence according to the target comparison result to obtain the target forward sequencing sequence comprises: When the target alignment result corresponding to the forward undetermined position is that the second peak is a true signal, the base at the forward undetermined position is replaced by the base represented by the second peak to obtain the target forward sequencing sequence; The step of controlling the replacement of the base at the reverse undetermined position of the reverse original sequence according to the target alignment result to obtain the target reverse sequencing sequence comprises: When the target alignment result corresponding to the reverse pending position is that the second peak is a true signal, the base at the reverse pending position is replaced with the base represented by the second peak to obtain the target reverse sequencing sequence.

7. A method for analyzing gene mutations, characterized in that: include: Select the corresponding reference sequence according to the sequencing species; Establishing a second target query sequence using the query sequence establishment method according to any one of claims 1 to 6 for sequencing data of the sequenced species; Aligning the second target query sequence with the reference sequence to obtain alignment data; The alignment data were analyzed to obtain all mutation sites.

8. A query sequence establishment system, characterized in that: include: A data reading module is used to read bidirectional sequencing data, obtain the forward original sequence and the first peak data of each base at each position, and obtain the reverse original sequence and the second peak data of each base at each position; a base selection module, configured to determine a first selected base at each position based on the first peak data, to obtain a forward selected sequence and a forward pending position, and to determine a second selected base at each position based on the second peak data, to obtain a reverse selected sequence and a reverse pending position; An analysis and comparison module is used to combine the forward selected sequence and the reverse selected sequence to obtain a query sequence, and compare and analyze the query sequence, the forward original sequence and the reverse original sequence to obtain a target comparison result; A base replacement module, configured to control the replacement of bases at the forward undetermined position of the forward original sequence according to the target alignment result to obtain a target forward sequencing sequence, and to control the replacement of bases at the reverse undetermined position of the reverse original sequence according to the target alignment result to obtain a target reverse sequencing sequence; The sequence merging module is used to merge the target forward sequencing sequence and the target reverse sequencing sequence to obtain a first target query sequence, and determine whether to merge the forward original sequence and the reverse original sequence on the first target query sequence according to the base replacement situation to obtain a second target query sequence.

9. A computer device comprising a memory and a processor, wherein the memory stores a computer program, characterized in that: When the processor executes the computer program, the steps of the method according to any one of claims 1 to 6 are implemented.

10. A computer-readable storage medium having a computer program stored thereon, characterized in that: When the computer program is executed by a processor, the steps of the method according to any one of claims 1 to 6 are implemented.

Images