Related application of S4A7 protein or related biological material in preparation of lung adenocarcinoma medicine
By regulating the expression of S4A7 protein/SLC4A7 gene, the molecular mechanism of lung adenocarcinoma metastasis and invasion was solved, effective inhibition and growth suppression of lung adenocarcinoma cells were achieved, and a new treatment strategy was provided.
Patent Information
- Application Number
- CN202410259447.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-03-07
- Publication Date
- 2025-09-09
AI Technical Summary
Existing technologies do not fully understand the molecular mechanisms of lung adenocarcinoma metastasis and lack effective treatment strategies and drugs, especially those targeting the metastasis and invasion of tumor stem cells.
Using S4A7 protein or related biomaterials as targets, by upregulating or inhibiting the expression of S4A7 protein/SLC4A7 gene, the self-renewal, proliferation and metastasis ability of tumor stem cells are regulated, lactate transport is inhibited, and the metastasis and invasion of lung adenocarcinoma are blocked.
It effectively inhibits the metastasis and invasion of lung adenocarcinoma cells, regulates lactate transport, affects multiple signaling pathways, including cellular processes and proteoglycans and focal adhesions, and significantly inhibits tumor growth.
Smart Images

Figure HDA0004730374250000011 
Figure HDA0004730374250000012 
Figure HDA0004730374250000021
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of biomedicine and relates to the use of S4A7 protein or related biomaterials in the preparation of lung adenocarcinoma drugs. Background Art
[0002] Lung adenocarcinoma is a type of lung cancer, classified as non-small cell carcinoma. It originates from the bronchial mucosal epithelium, and a few cases originate from the mucous glands of the larger bronchi. Early symptoms are generally asymptomatic and are often detected on chest X-rays. It presents as a round or oval mass that typically grows slowly, but sometimes metastasizes early in the bloodstream. Lymphatic metastasis occurs later.
[0003] Lung adenocarcinoma metastasis is a key factor affecting patient survival. However, the molecular mechanisms of lung adenocarcinoma metastasis remain incompletely understood.
[0004] Cancer stem cells are considered to be key drivers of tumor metastasis, but the molecular mechanisms regulating their metastasis require further investigation. Therefore, identifying new lung adenocarcinoma-related genes and studying their role in lung adenocarcinoma cancer stem cell metastasis is of great significance for the development of new therapeutic strategies and drugs. Summary of the Invention
[0005] The purpose of the present invention is to provide related uses of S4A7 protein or related biological materials in the preparation of lung adenocarcinoma drugs.
[0006] The present invention protects the use of S4A7 protein or S4A7 protein-related biological materials in preparing medicines for treating lung cancer.
[0007] The present invention also protects the use of S4A7 protein or S4A7 protein-related biological materials in the preparation of drugs for inhibiting lung cancer metastasis.
[0008] The present invention also protects the use of S4A7 protein or S4A7 protein-related biological materials in the preparation of drugs for inhibiting lung cancer cell metastasis and / or invasion.
[0009] The present invention also protects the use of S4A7 protein or S4A7 protein-related biological materials in the preparation of drugs for inhibiting lung cancer cell proliferation.
[0010] The present invention also protects the use of a substance that inhibits the S4A7 protein or SLC4A7 gene in the preparation of a product for promoting the metastasis and / or invasion of lung cancer cells. Specifically, the product can be used to prepare a lung cancer cell model or an animal model of lung cancer.
[0011] The present invention also protects the use of a substance that inhibits the S4A7 protein or SLC4A7 gene in the preparation of a product for promoting lung cancer cell proliferation. Specifically, the product can be used to prepare a lung cancer cell model or an animal model of lung cancer.
[0012] The present invention also protects the use of S4A7 protein or SLC4A7 gene as a target in developing drugs for treating lung cancer. In the application, S4A7 protein or SLC4A7 gene is used as an up-regulation target.
[0013] Specifically, the S4A7 protein is human S4A7 protein.
[0014] Specifically, the S4A7 protein is shown in SEQ ID NO: 2.
[0015] Specifically, the S4A7 protein-related biological material is the following (a) or (b) or (c) or (d):
[0016] (a) SLC4A7 gene;
[0017] (b) an expression cassette for expressing the SLC4A7 gene;
[0018] (c) a recombinant plasmid expressing the SLC4A7 gene;
[0019] (d) Recombinant virus expressing the SLC4A7 gene.
[0020] The SLC4A7 gene is a gene encoding the S4A7 protein.
[0021] Specifically, the SLC4A7 gene is a human SLC4A7 gene.
[0022] Specifically, the coding frame of the SLC4A7 gene is shown in positions 28-3807 of SEQ ID NO: 1.
[0023] Specifically, the recombinant virus expressing the SLC4A7 gene is a recombinant lentivirus expressing the SLC4A7 gene.
[0024] The substance that takes the SLC4A7 gene as an inhibitory target may specifically be shRNA targeting the SLC4A7 gene.
[0025] The substance that inhibits the SLC4A7 gene can specifically be a recombinant plasmid that expresses shRNA targeting the SLC4A7 gene.
[0026] The substance that targets the SLC4A7 gene for inhibition may specifically be a recombinant virus that expresses shRNA targeting the SLC4A7 gene.
[0027] The substance that inhibits the SLC4A7 gene can specifically be a recombinant lentivirus that expresses shRNA targeting the SLC4A7 gene.
[0028] Specifically, the lung cancer is non-small cell lung cancer.
[0029] Specifically, the lung cancer is lung adenocarcinoma.
[0030] The inventors of the present invention discovered and verified the important regulatory role of S4A7 protein / SLC4A7 gene in the metastasis of lung adenocarcinoma tumor stem cells through experimental means such as protein expression profiling, gene knockdown, and gain of function. First, through protein expression profiling analysis, it was found that S4A7 protein / SLC4A7 gene was lowly expressed in lung adenocarcinoma tumor stem cells compared to non-tumor stem cells. Further studies have shown that S4A7 protein / SLC4A7 gene plays a key role in the metastasis of lung adenocarcinoma by regulating the self-renewal, proliferation and metastasis ability of tumor stem cells. The inventors of the present invention further discovered that S4A7 protein / SLC4A7 gene regulates the transport of lactate by regulating the expression of the lactate transporter MCT1 / 4 in tumor cells, resulting in a decrease in overall protein lactylation. S4A7 protein / SLC4A7 gene can provide new ideas for exploring new drug targets for blocking tumor metastasis. Specifically, by targeting S4A7 protein / SLC4A7 gene, inhibition of lung adenocarcinoma tumor metastasis can be achieved by upregulating protein abundance. BRIEF DESCRIPTION OF THE DRAWINGS
[0031] Figure 1 This is the result diagram of Example 1.
[0032] Figure 2 This is a diagram showing the results of detecting cell stemness in Example 2.
[0033] Figure 3 This is a diagram showing the results of detecting the clone forming ability in Example 2.
[0034] Figure 4 This is a graph showing the results of detecting proliferation ability in Example 2.
[0035] Figure 5 This is the result diagram of Example 3.
[0036] Figure 6 This is the result diagram of Example 4.
[0037] Figure 7 This is the result diagram of Example 5. DETAILED DESCRIPTION
[0038] The present invention will be further described in detail below in conjunction with specific embodiments. The examples provided are only for illustrating the present invention and are not intended to limit the scope of the present invention. The examples provided below can serve as a guide for further improvements by those skilled in the art and are not intended to limit the present invention in any way.
[0039] The experimental methods in the following examples, unless otherwise specified, are all conventional methods, and are carried out in accordance with the techniques or conditions described in the literature in this field or in accordance with the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial channels. Unless otherwise specified, the quantitative tests in the following examples were repeated three times, and the results were averaged. H1975 cells (also known as NCI-H1975 cells, human lung adenocarcinoma cells): Cell Bank of the Committee for the Collection of Typical Cultures of the Chinese Academy of Sciences, No. SCSP-597. pHelper 1.0 plasmid and pHelper 2.0 plasmid are auxiliary plasmids for preparing lentivirus, products of Shanghai JiKai Gene Chemistry Technology Co., Ltd.
[0040] Example 1: SLC4A7 is lowly expressed in lung adenocarcinoma tumor stem cells
[0041] Flow cytometry was used to obtain tumor stem cells (ALDH) in tumor tissues of patients with lung adenocarcinoma. + ) and non-stem cells (ALDH - WB verification revealed that SLC4A7 was significantly less expressed in cancer stem cells than in non-stem cells. Figure 1 (The left picture is case 1, and the right picture is case 2).
[0042] Example 2: SLC4A7 inhibits tumor cell stemness
[0043] 1. Construction of recombinant cells overexpressing the SLC4A7 gene
[0044] 1. Construction of recombinant plasmid
[0045] ① Prepare a double-stranded DNA molecule shown in SEQ ID NO: 1.
[0046] ② Take the GV348 vector (Shanghai Jikai Gene Chemical Technology Co., Ltd.), double-digest it with restriction endonucleases Age I and EcoRI, and recover the linearized vector backbone.
[0047] ③ The double-stranded DNA molecule obtained in step ① was co-incubated with the linearized vector backbone obtained in step ② (the co-incubation system contained the recombinase Exnase™) to obtain a recombinant plasmid, designated recombinant plasmid GV348-SLC4A7. Sequencing confirmed that the recombinant plasmid GV348-SLC4A7 contained the SLC4A7 gene coding frame set forth at positions 28-3807 of SEQ ID NO: 1.
[0048] 2. Lentiviral packaging
[0049] ① 293T cells in the logarithmic growth phase were digested with trypsin and the cell concentration was adjusted to 5×10 cells / mL using DMEM medium containing 10% FBS. 6 cells / 15 ml, and then inoculated into a cell culture dish with a diameter of 10 cm, and cultured until the cell density reaches 70% to 80% (about 24 hours).
[0050] ②After completing step ①, discard the liquid in the cell culture dish, add DMEM culture medium, and culture for 2 hours.
[0051] ③ Take 20 μg of the recombinant plasmid GV348-SLC4A7 prepared in step 1, 15 μg of pHelper 1.0 plasmid, and 10 μg of pHelper 2.0 plasmid, add transfection reagent (Shanghai Gene Chemistry Technology Co., Ltd.) to a total volume of 1 ml, mix well, and incubate at room temperature for 15 minutes. This is the transfection solution for one cell culture dish.
[0052] ④ Slowly add the transfection solution obtained in step ③ to the cell culture dish that completed step ②, mix well, culture for 6 hours, and then discard the liquid in the cell culture dish.
[0053] ⑤After completing step ④, add 10 ml of PBS buffer to the cell culture dish, shake gently, and then discard.
[0054] ⑥ After completing step ⑤, slowly add 20 ml of DMEM medium containing 10% FBS to the cell culture dish and culture for 48 hours.
[0055] ⑦ After completing step ⑥, centrifuge at 4°C and 4000g for 10 min, collect the supernatant and filter with a 0.45μm pore size filter membrane to collect the filtrate.
[0056] ⑧After completing step ⑦, transfer the filtrate to an ultracentrifuge tube and centrifuge at 25,000 rpm at 4°C for 2 hours. Discard the supernatant and dissolve the precipitate with PBS buffer. Then centrifuge at 10,000 rpm at 4°C for 5 minutes. Collect the supernatant, which is the recombinant lentiviral solution, named SLC4A7+ lentiviral solution, and store in aliquots.
[0057] 3. Lentiviral transfection and screening
[0058] ① Take a 12-well plate and inoculate H1975 cells (1×10 5 cells / well), cultured with DMEM medium containing 10% FBS until the cell density reached 60-70% (about 24 hours), and then discarded the supernatant.
[0059] ② Add 20 μl of 25× virus transfection reagent (Shanghai GeneChemical Technology Co., Ltd.) and SLC4A7+ lentivirus solution (virus content of 5×10 6 TU) was added into 500 μl DMEM culture medium, which was the viral transfection solution for one well.
[0060] ③ Add the viral transfection solution prepared in step ② to the 12-well plate prepared in step ①, culture for 24-48 hours, and then discard the supernatant.
[0061] ④ Take the 12-well plate prepared in step ③ and add 1 μg / ml DMEM medium containing 10% FBS (1 ml / well) for 5-7 days. During the culture process, subculture the cells every 2-3 days, using DMEM medium containing 1 μg / ml puromycin and 10% FBS each time.
[0062] ⑤ After completing step ④, collect the cells and inoculate 6,000-10,000 cells into a cell culture dish with a diameter of 10 cm. Culture them in DMEM medium containing 10% FBS for about two weeks. At this time, clones can be seen.
[0063] ⑥After completing step ⑤, gently scrape off larger clones with a Pasteur pipette and transfer them to a 6-well plate. Gently blow them apart and shake them evenly. Culture them in DMEM medium containing 10% FBS for 24 hours. Then replace with new DMEM medium containing 10% FBS and culture for about a week until the cells have covered the bottom of the wells.
[0064] ⑦Inoculate the cells from step ⑥ into a cell culture dish with a diameter of 10 cm for passage and preservation.
[0065] The cells obtained in the above steps are recombinant cells that overexpress the SLC4A7 gene, referred to as SLC4A7+ recombinant cells (represented by SLC4A7).
[0066] The recombinant plasmid GV348-SLC4A7 was replaced with the GV348 vector, and the above steps 2 and 3 were performed in sequence to obtain recombinant cells introduced with the GV348 vector (indicated by Vector), which served as control cells for SLC4A7+ recombinant cells.
[0067] 2. Construction of recombinant cells with suppressed SLC4A7 gene
[0068] 1. Construction of recombinant plasmid
[0069] ① Take the GV493 vector (Shanghai Jikai Gene Chemical Technology Co., Ltd.), double-digest it with restriction endonucleases Age I and EcoRI, and recover the linearized vector backbone.
[0070] ② Anneal SLC4A7-RNAi-1 (single-stranded DNA molecule) and SLC4A7-RNAi-2 (single-stranded DNA molecule) to obtain double-stranded DNA molecules with sticky ends.
[0071] SLC4A7-RNAi-1:CCGGGC AATGAAACTCTAGCACAAT CTCGAGATTGTGCTAGAGTTTCATTGCTTTTTG; SLC4A7-RNAi-2:AATTCAAAAAGC AATGAAACTCTAGCACAAT CTCGAGATTGTGCTAGAGTTTCATTGC.
[0072] ③ Ligate the linearized vector backbone to the double-stranded DNA molecule with sticky ends to generate the recombinant plasmid GV493-shSLC4A7. This recombinant plasmid has been sequenced and verified.
[0073] 2. Lentiviral packaging
[0074] Replace the recombinant plasmid GV348-SLC4A7 with the recombinant plasmid GV493-shSLC4A7. Other steps are the same as step 1, step 2.
[0075] The recombinant lentivirus solution was obtained and named as SLC4A7-lentivirus solution.
[0076] 3. Lentiviral transfection and screening
[0077] Replace the SLC4A7+ lentivirus solution with the SLC4A7- lentivirus solution. Otherwise, proceed as described in step 1, step 3.
[0078] The obtained cells are recombinant cells in which the SLC4A7 gene is suppressed, referred to as SLC4A7-recombinant cells (represented by shSLC4A7).
[0079] The recombinant plasmid GV493-shSLC4A7 was replaced with the GV493 vector, and the above steps 2 and 3 were performed in sequence to obtain recombinant cells introduced with the GV493 vector (indicated by Control), which served as control cells for SLC4A7-recombinant cells.
[0080] 3. Detection of cell stemness
[0081] Test cells: SLC4A7+ recombinant cells (indicated by SLC4A7), recombinant cells introduced with the GV348 vector (indicated by Vector), SLC4A7- recombinant cells (indicated by shSLC4A7), or recombinant cells introduced with the GV493 vector (indicated by Control).
[0082] 1. Take the test cells, extract total RNA, and reverse transcribe to obtain cDNA. Using cDNA as a template and GAPDH gene as an internal reference gene, the relative expression level of the target gene is determined by qRT-PCR.
[0083] The target genes are: OCT4 gene, SOX2 gene, and NANOG gene.
[0084] The primer pairs used to amplify the OCT4 gene are as follows:
[0085] Forward primer: GGGGTTCTATTTGGGAAGGTAT;
[0086] Reverse primer: TACTGGTTCGCTTTCTCTTTCG.
[0087] The primer pairs used to amplify the SOX2 gene are as follows:
[0088] Forward primer: ATGCACCGCTACGACGTG;
[0089] Reverse primer: CTGGAGTGGGAGGAAGAG.
[0090] The primer pairs used to amplify the NANOG gene are as follows:
[0091] Forward primer: ATAACCTTGGCTGCCGTCTC;
[0092] Reverse primer: AGCCTCCCAATCCAAACAA.
[0093] The primer pairs used to amplify the GAPDH gene are as follows:
[0094] Forward primer: ACGGATTTGGTCGTATTGGG;
[0095] Reverse primer: CGCTCCTGGAAGATGGTGAT.
[0096] See the results Figure 2 A.
[0097] 2. Take the test cells, disrupt the cells, extract the total protein, and perform Western blot identification.
[0098] The primary antibody used to identify GAPDH was GAPDH antibody (Cell Signaling Technology, 5174S).
[0099] The primary antibody used to identify OCT4 was OCT4 antibody (Cell Signaling Technology, 2750S).
[0100] The primary antibody used to identify SOX2 was SOX2 antibody (Cell Signaling Technology, 2748S).
[0101] The primary antibody used to identify NANOG was NANOG antibody (Abcam, ab109250).
[0102] See the results Figure 2 B.
[0103] 4. Detection of clone-forming ability
[0104] ① Take the test cells, digest them, resuspend them in DMEM medium containing 10% FBS, and count them to obtain a cell suspension.
[0105] ② Take a six-well plate and inoculate 1 ml of the cell suspension prepared in step ① (containing 5000 cells) into each well. Culture for 15 days. At this time, obvious clone colonies can be observed with the naked eye.
[0106] ③After completing step ②, discard the liquid in the six-well plate, add PBS buffer to wash and then discard.
[0107] ④After completing step ③, add 1 ml of 4% paraformaldehyde solution to each well, fix for 10-15 minutes, and then discard the liquid in the well.
[0108] ⑤ After completing step ④, add 1000 μl of 0.05% crystal violet solution to each well and stain for 20 minutes. Discard the liquid in the wells, wash with PBS buffer several times, then discard it, dry in the shade and take pictures.
[0109] The experiment was repeated three times, and three replicates were set for each experiment, and the results were averaged.
[0110] See the results Figure 3 , the left picture is a photo, and the right picture is the quantitative statistical results.
[0111] 5. Detection of proliferation ability
[0112] ① Take the test cells, digest them, resuspend them in DMEM medium containing 10% FBS and count them to obtain a cell suspension.
[0113] ② Inoculate 100 μl of the cell suspension prepared in step 1 (1000 cells) into each well of a 96-well plate and culture for 1, 2, 3, 4, or 5 days.
[0114] ③ After completing step ②, discard the liquid in the wells, add 10 μl MTS (KeyGEN BioTECH, KGA327) and 90 μl DMEM medium to each well, incubate at 37°C for 1 hour, and then place in a microplate reader to measure the OD value at 490 nm.
[0115] Seven replicate experiments were conducted, with three replicate treatments set up for each replicate experiment, and the results were averaged.
[0116] Proliferation curves were drawn based on the results.
[0117] See the results Figure 4 .
[0118] The results of this example show that overexpression of the SLC4A7 gene can inhibit stemness marker expression, while knockdown of the SLC4A7 gene promotes stemness marker expression; overexpression of the SLC4A7 gene inhibits colony formation, while knockdown of the SLC4A7 gene has the opposite effect; overexpression of the SLC4A7 gene inhibits cell proliferation, while knockdown of the SLC4A7 gene promotes cell proliferation. These results indicate that SLC4A7 inhibits tumor cell stemness.
[0119] Example 3: SLC4A7 inhibits tumor cell metastasis and invasion
[0120] 1. SLC4A7 inhibits tumor cell metastasis (transwell experiment)
[0121] Test cells: SLC4A7+ recombinant cells (denoted by SLC4A7), recombinant cells introduced with the GV348 vector (denoted by Vector), SLC4A7- recombinant cells (denoted by shSLC4A7), or recombinant cells introduced with the GV493 vector (denoted by Control). All were prepared in Example 2.
[0122] 1. Place the Transwell chamber (pore size 8 μM) in a 24-well plate.
[0123] 2. Take the 24-well plate prepared in step 1, add 600 μL of DEME medium containing 20% FBS to each well, and place the 24-well plate in an incubator to fully wet the membrane.
[0124] 3. Take the test cells and adjust the cell concentration to 1×10 6 cells
[0125] / mL, which is the cell suspension.
[0126] 4. Take the 24-well plate prepared in step 2, add the cell suspension prepared in step 3 to the upper chamber of Transwell, and then culture for 24 hours.
[0127] 5. After completing step 4, remove the chamber, remove the liquid, rinse with ultrapure water, and then place it in a well containing crystal violet staining solution and stain for 20 minutes.
[0128] 6. After completing step 5, remove the chamber from the crystal violet staining solution, rinse thoroughly with ultrapure water, and then remove the surface moisture. Use tweezers to hold a cotton swab and gently wipe the cells in the upper layer of the chamber that have not passed through the membrane. Observe the cells passing through the membrane under an optical microscope and take pictures at 10x field of view (select 5 fields of view for each chamber: top, middle, bottom, left, and right).
[0129] The experiment was repeated three times, and three replicates were set for each experiment, and the results were averaged.
[0130] See the results Figure 5 The results showed that overexpression of SLC4A7 gene could inhibit cell migration, while knockdown of SLC4A7 gene could promote cell migration.
[0131] 2. SLC4A7 inhibits tumor cell invasion (wound healing assay)
[0132] Test cells: SLC4A7+ recombinant cells (denoted by SLC4A7), recombinant cells introduced with the GV348 vector (denoted by Vector), SLC4A7- recombinant cells (denoted by shSLC4A7), or recombinant cells introduced with the GV493 vector (denoted by Control). All were prepared in Example 2.
[0133] 1. Take the test cells and adjust the cell concentration to 1×10 6 cells / mL, which is the cell suspension.
[0134] 2. Take a six-well plate and add 1 mL of the cell suspension prepared in step 1 to each well and culture for 12 hours.
[0135] 3. Take the six-well plate from step 2 and draw a straight line across the bottom of the wells using a sterilized pipette tip (20 μL). Wash the plate three times with PBS buffer to remove suspended cells. At this point, take a microscopic image to serve as a 0-hour control.
[0136] 4. After completing step 3, add 1 mL of DMEM medium containing 2% FBS to each well and culture for 24 hours. Then discard the medium, wash with PBS buffer three times, and take pictures.
[0137] Wound healing rate = (scratch area at 0 h - scratch area after 24 h) ÷ scratch area of control at 0 h × 100%.
[0138] The experiment was repeated three times, and three replicates were set for each experiment, and the results were averaged.
[0139] See the results Figure 5 The results showed that overexpression of SLC4A7 gene could inhibit cell invasion, while knockdown of SLC4A7 gene could promote cell invasion.
[0140] 3. Animal Experiments
[0141] 1. 5×10 6 The SLC4A7+ recombinant cells prepared in Example 2 were suspended in 200 μL PBS-matrigel (obtained by mixing equal volumes of PBS buffer and matrigel) to obtain a cell suspension.
[0142] 2. 5×10 6 The recombinant cells introduced with the GV348 vector prepared in Example 2 were suspended in 200 μL of PBS-matrigel (obtained by mixing equal volumes of PBS buffer and matrigel) to obtain a cell suspension.
[0143] 3. BALB / c mice (female, 5-6 weeks old) were divided into two groups, with 8 mice in each group.
[0144] Experimental group (expressed by SLC4A7): 200 μL of the cell suspension prepared in step 1 was subcutaneously injected into the right axilla of each mouse.
[0145] Control group (indicated by Vector): 200 μL of the cell suspension prepared in step 2 was subcutaneously injected into the right axilla of each mouse.
[0146] Days were counted from the time of injection, with each 24-hour period representing one day. Tumor volume and mouse body weight were measured at time 0, 2 days, 5 days, 9 days, 12 days, and 16 days after injection. After 19 days, mice were sacrificed, and tumor tissue was isolated and weighed.
[0147] The statistical results of tumor tissue weight are shown in Figure 5 C. Changes in tumor volume over time are shown in Figure 5 D. Changes in mouse body weight over time are shown in Figure 5 The results are the average of 8 mice. The results showed that the SLC4A7 gene significantly inhibited tumor growth.
[0148] Example 4: SLC4A7 inhibits lactate transport in tumor cells
[0149] In order to explore the regulatory mechanism of SLC4A7 in tumor progression, considering that it is a transmembrane protein responsible for Na + and HCO3 - The transport of lactate by SLC4A7 is also involved, and the same family proteins MCT1 / 4 are responsible for the transport of lactate. Therefore, we first verified the effect of SLC4A7 on lactate. We found that overexpression of SLC4A7 can inhibit the content of lactate in tumor cells, while knockout has the opposite effect (see Figure 6 To further explore the regulatory mechanism of SLC4A7 on lactate, it was found that overexpression of SLC4A7 could inhibit the expression of MCT1 / 4, and conversely promote the expression of MCT1 / 4 (see Figure 6 B).
[0150] Example 5: SLC4A7 inhibits tumor cell protein lactylation
[0151] One of the important mechanisms of lactic acid regulation on tumor cells is protein lactylation. In view of the effect of SLC4A7 on lactic acid, in order to explore its mechanism, WB verification found that overexpression of SLC4A7 can inhibit the overall protein lactylation of tumor cells (see Figure 7 To further elucidate the regulation of protein lactylation by SLC4A7, we performed a lactylation proteomic analysis and found that overexpression of SLC4A7 resulted in decreased lactylation levels of many oncogenic proteins (see Figure 7 B). Differential protein enrichment analysis found that overexpression of SLC4A7 affects multiple signaling pathways, including cellular processes related to cancer development (see Figure 7 C) and signaling pathways such as proteoglycans and focal adhesions (see Figure 7 D).
[0152] The present invention has been described in detail above. It will be apparent to those skilled in the art that the present invention may be practiced over a wide range of parameters, concentrations, and conditions without departing from the spirit and scope of the present invention and without unnecessary experimentation. Although specific embodiments have been given herein, it should be understood that further modifications may be made to the present invention. In summary, this application is intended to encompass any variations, uses, or improvements to the present invention, including those made by conventional techniques known in the art that depart from the scope of the present invention. Applications of the essential features may be made within the scope of the following claims.
Claims
1. Use of S4A7 protein or S4A7 protein-related biomaterials in the preparation of drugs for the treatment of lung cancer; The S4A7 protein-related biological material is the following (a) or (b) or (c) or (d): (a) SLC4A7 gene; (b) an expression cassette for expressing the SLC4A7 gene; (c) a recombinant plasmid expressing the SLC4A7 gene; (d) recombinant virus expressing the SLC4A7 gene; The SLC4A7 gene is a gene encoding the S4A7 protein.
2. Use of S4A7 protein or S4A7 protein-related biomaterials in the preparation of a drug for inhibiting lung cancer metastasis; the S4A7 protein-related biomaterial is the S4A7 protein-related biomaterial described in claim 1.
3. Use of S4A7 protein or S4A7 protein-related biomaterials in the preparation of a drug for inhibiting metastasis and / or invasion of lung cancer cells; the S4A7 protein-related biomaterial is the S4A7 protein-related biomaterial described in claim 1.
4. Use of S4A7 protein or S4A7 protein-related biomaterials in the preparation of a drug for inhibiting the proliferation of lung cancer cells; the S4A7 protein-related biomaterial is the S4A7 protein-related biomaterial described in claim 1.
5. Use of a substance with the S4A7 protein or SLC4A7 gene as an inhibitory target in the preparation of a product for promoting metastasis and / or invasion of lung cancer cells; the SLC4A7 gene is a gene encoding the S4A7 protein.
6. Use of a substance with S4A7 protein or SLC4A7 gene as an inhibitory target in the preparation of a product for promoting lung cancer cell proliferation; the SLC4A7 gene is a gene encoding the S4A7 protein.
7. Use of S4A7 protein or SLC4A7 gene as a target in the development of drugs for treating lung cancer; the SLC4A7 gene is a gene encoding the S4A7 protein.