Use of fbxo2 in the treatment of prostate cancer

Abstract

The application discloses application of FBXO2 in treatment of prostate cancer and belongs to the field of prostate cancer treatment; and application of an FBXO2 promoter in preparation of a drug for treating prostate cancer, in particular, expression of FBXO2 in prostate cancer tissue is significantly down-regulated, and a high expression level of FBXO2 is positively correlated with a good prognosis of a patient; overexpression of FBXO2 can effectively inhibit proliferation and metastasis of prostate cancer cells and induce apoptosis; mechanism research finds that FBXO2 specifically combines with m6A reading protein YTHDF2 through a carboxyl terminal domain of FBXO2, mediates ubiquitination modification of the latter at a K286 site and promotes proteasome-dependent degradation of the latter. YTHDF2, as a high-expression cancer-promoting protein in prostate cancer, can accelerate degradation of CDKN1C mRNA by regulating m6A methylation modification of the CDKN1C mRNA, so as to drive tumor progression. The application provides a theoretical basis for development of a new type of prognostic marker and a treatment strategy.

Description

TECHNICAL FIELD

[0001] The application belongs to the field of prostate cancer treatment, and particularly relates to application of FBXO2 in treatment of prostate cancer. BACKGROUND

[0002] YTHDF2 (YTH domain family member 2) is an important reading protein of m6A modification. YTHDF2 contains a YTH domain that can specifically recognize m6A-modified RNA and mediate its degradation. Recent studies have shown that YTHDF2 plays a pro-cancer role in various tumors, including prostate cancer.

[0003] Ubiquitination modification, as a key post-translational regulation mechanism, is involved in cell cycle, signal transduction and other biological processes through E1-E2-E3 enzyme cascade reaction. Among them, the ubiquitin ligase complex (Skp1-Cullin-F-box) is a core subclass of RING-type E3 ligase, and its F-box protein member can regulate tumor occurrence and development by recognizing specific substrates. FBXO2 (FBG1 / Fbs1) is a substrate recognition component of SCF complex. Previous studies have shown that it can regulate the progression of osteosarcoma and ovarian cancer by degrading glycosylated target proteins (such as IL-6R, SUN2), but its function in prostate cancer is still unknown. SUMMARY

[0004] In view of the deficiencies in the prior art, the application aims to provide application of FBXO2 in treatment of prostate cancer, and solve the problems in the prior art.

[0005] The object of the application can be achieved by the following technical solutions.

[0006] Application of the FBXO2 promoter in preparation of a drug for treating prostate cancer.

[0007] The treatment of prostate cancer includes mediating ubiquitination modification of YTHDF2 at K286 site and promoting YTHDF degradation.

[0008] Application of the FBXO2 expression amount detection reagent in preparation of a prostate cancer diagnosis kit.

[0009] Application of the FBXO2 expression amount detection reagent in preparation of a prostate cancer prognosis kit.

[0010] A drug comprising the FBXO2 promoter.

[0011] A kit comprising the FBXO2 expression amount detection reagent.

[0012] The application of the agent capable of mediating ubiquitination modification of YTHDF2 at K286 site and promoting YTHDF degradation in the preparation of a drug for treating prostate cancer.

[0013] The application of the YTHDF2 inhibitor in the preparation of a drug for treating prostate cancer.

[0014] The application of the YTHDF2 expression detection reagent in the preparation of a prostate cancer diagnosis kit.

[0015] A kit comprising a YTHDF2 expression detection reagent.

[0016] The beneficial effects of the present application are as follows:

[0017] In the present application, it is found that FBXO2 specifically binds to m6A reader protein YTHDF2 through its carboxyl-terminal domain, mediates ubiquitination modification of the latter at lysine 286 site (K286) and promotes its proteasome-dependent degradation, and YTHDF2, as a highly expressed pro-cancer protein in prostate cancer, can accelerate the degradation of CDKN1C mRNA by regulating the m6A methylation modification of the mRNA, thereby driving tumor progression; and inhibiting the expression of YTHDF2 can reverse the inhibitory effect of FBXO2 on the malignant phenotype of prostate cancer; the present application first reveals the key role of the FBXO2-YTHDF2-CDKN1C signal axis in prostate cancer, and provides a theoretical basis for developing new prognostic markers and treatment strategies. BRIEF DESCRIPTION OF DRAWINGS

[0018] In order to more clearly illustrate the technical solutions in the embodiments of the present application or the prior art, the drawings needed to be used in the embodiments or prior art description will be briefly introduced as follows, and obviously, other drawings can also be obtained by those skilled in the art without creative labor on the basis of these drawings.

[0019] Figure 1 A schematic diagram showing that FBXO2 is lowly expressed in prostate cancer and is related to good prognosis;

[0020] Figure 2 A schematic diagram showing that FBXO2 overexpression inhibits the malignant phenotype of prostate cancer cells;

[0021] Figure 3 A schematic diagram showing that FBXO2 knockdown promotes the proliferation and metastasis of prostate cancer cells;

[0022] Figure 4 A schematic diagram showing that YTHDF2 is highly expressed in prostate cancer and plays a pro-cancer role;

[0023] Figure 5 A schematic diagram showing that FBXO2 targets YTHDF2 and promotes ubiquitination degradation of YTHDF2;

[0024] Figure 6 Schematic diagram for FBXO2 mediating ubiquitination modification of K286 site of YTHDF2;

[0025] Figure 7 Schematic diagram for YTHDF2 knockdown reversing the pro-cancer effect of FBXO2 knockdown;

[0026] Figure 8 Schematic diagram for YTHDF2 degrading CDKN1C mRNA in an m6A dependent manner. DETAILED DESCRIPTION

[0027] The technical solutions in the embodiments of the present application will be clearly and completely described below with reference to the drawings in the embodiments of the present application. Obviously, the described embodiments are only some of the embodiments of the present application, rather than all the embodiments. Based on the embodiments in the present application, all other embodiments obtained by those of ordinary skill in the art without creative labor fall within the protection scope of the present application.

[0028] Embodiment 1

[0029] In this embodiment, it is proved that FBXO2 is lowly expressed in prostate cancer and is related to good prognosis;

[0030] The experimental results are shown in Figure 1 .

[0031] Figure 1 A in the above table shows the results of searching the GEPIA database, the FBXO2 expression in 492 cases of prostate tumor tissues and 152 cases of prostate cancer tissues, and the results show that the expression of FBXO2 in prostate cancer (PCa) tissues is significantly lower than that in normal tissues (p<0.05).

[0032] Figure 1 B in the above table is the Kaplan-Meier survival curve, and it can be seen that: the overall survival (OS) of patients in the high expression group of FBXO2 is significantly prolonged (Log-rank p<0.01).

[0033] Figure 1 C-1 to C-6 in the above table show the FBXO2 expression levels of prostate cancer patients in the UALCAN database, Figure 1 C-1 in the above table can see that the expression of FBXO2 in prostate cancer tissues is lower than that in normal tissues, Figure 1 C-2 in the above table can see that the expression of FBXO2 in prostate cancer tissues of patients of different races is different, Figure 1 C-3 in the above table can see that the expression of FBXO2 in prostate cancer patients of patients with different Gleason scores is different, Figure 1C-4 in the study showed that the expression level of FBXO2 in tumor patients was significantly correlated with the TP53 mutation status. Figure 1 C-5 in the data shows that the expression level of FBXO2 in tumor patients is significantly correlated with lymph node metastasis. Figure 1 The C-6 data shows that the expression level of FBXO2 in tumor patients is significantly correlated with the expression mutations of other molecules.

[0034] Figure 1 In this context, D represents the immunohistochemical (IHC) score after collecting 60 clinical prostate cancer tissue samples, which were used to detect the expression of FBXO2 protein in the tumor tissue. Figure 1 E in the figure represents the representative staining of the immunohistochemical experiment. The results showed that the expression of FBXO2 protein in 60 prostate cancer tissues was significantly lower than that in adjacent tissues (**p<0.01).

[0035] Figure 1 F in the figure represents the Western blot results of FBXO2 in normal prostate epithelial cells and prostate cancer cells. The results show that the expression of FBXO2 protein in normal prostate epithelial cells RWPE-1 is significantly higher than that in PC3, DU145 and 22RV1 cancer cell lines.

[0036] Figure 2 In the table, G represents the Western blot result of FBXO2 expression in fresh prostate cancer tissue, N represents adjacent fresh tissue, and T represents prostate cancer tissue. The results showed that paired prostate cancer (T) and adjacent fresh tissue (N) validation revealed low expression of FBXO2 protein in prostate cancer tissue (***p<0.001).

[0037] Example 2

[0038] In this embodiment, it is used to demonstrate that FBXO2 overexpression inhibits the malignant phenotype of prostate cancer cells;

[0039] Experimental results are as follows Figure 2 As shown:

[0040] Figure 2 Figure A shows the detection of protein expression after overexpression of FBXO2. Lentiviral-mediated stable transfection of PC3 / DU145 cells with Flag-FBXO2 was performed, and Western blot was used to verify the overexpression efficiency. It can be seen that the stable transfection cell lines of prostate cancer PC3 and DU145 with FBXO2 overexpression were successfully constructed.

[0041] Figure 2B is CCK-8 cell proliferation experiment of PC3 and DU145 stable cell strains overexpressing FBXO2, and the OD values at 450 nm of the cells overexpressing FBXO2 for 1, 2, 3, and 4, respectively, can be seen: FBXO2 overexpression significantly inhibits cell proliferation (**p<0.01).

[0042] Figure 2 C is a cell colony formation experiment of PC3 and DU145 stable cell strains overexpressing FBXO2, and it can be seen that: FBXO2 overexpression significantly inhibits cell proliferation (**p<0.01).

[0043] Figure 2 D is a Transwell chamber (a trademark of a special culture device for cell migration, invasion, co-culture, etc. produced by the United States Corning Company, abbreviated as: Transwell chamber) invasion experiment of PC3 and DU145 stable cell strains overexpressing FBXO2. The Transwell chamber is pre-coated with 1:8 diluted Matrigel, the lower chamber is added with 10% FBS medium, and the upper chamber is inoculated with 3×10 4 cells (serum-free medium), 24 h later, the uninvaded cells are wiped off with a cotton swab, fixed with 4% paraformaldehyde, stained with crystal violet, and counted. It can be seen that: the number of cells penetrating the membrane in the FBXO2 overexpression group is reduced by 50% (**p<0.01).

[0044] Figure 2 E is Annexin V (phospholipid binding protein) / PI (iodinated propyl) double staining flow cytometry detection of PC3 and DU145 stable cell strains overexpressing FBXO2. Annexin V-FITC / PI apoptosis detection kit is used, and flow cytometry is used to analyze the apoptosis rate. The specific steps are: after collecting the cells, wash with pre-cooled PBS, resuspend in 500 μL binding buffer, add 5 μL FITC Annexin V and 10 μL PI (20 μg / mL), avoid light incubate for 15 min, and then detect on the machine. It can be seen that: FBXO2 overexpression induces a 2.5-fold increase in apoptosis rate (***p<0.001).

[0045] Figure 2 F is: a subcutaneous tumor model of prostate cancer cells overexpressing FBXO2 is confirmed, 6-week-old male BALB / c nude mice, subcutaneous injection of 5×10 6 DU145 cells (shNC / shFBXO2), measure the tumor volume every 5 days (formula: V = length × short diameter²×0.52), after euthanizing the mice after 25 days, separate the tumor and weigh, F is the photo of the transplanted tumor, and it can be seen that: the transplanted tumor of prostate cancer cells overexpressing FBXO2 is smaller than the control group.

[0046] Figure 2 G in FIG. 12C is the weight of the tumor after the tumor was separated and weighed. It can be seen that the weight of the tumor in the FBXO2 overexpression group was decreased by 40% compared with the control group (***p<0.001).

[0047] Figure 3 H in FIG. 12D is the tumor volume growth curve. The tumor volume was measured every 5 days (formula: V = length diameter x short diameter 2 x 0.52), and the tumor volume growth curve was drawn. It can be seen that the tumor volume in the FBXO2 overexpression group was decreased by 40% compared with the control group (***p<0.001).

[0048] Figure 3 I in FIG. 12E is the detection of FBXO2 expression in tumor tissue by Western blot. It can be seen that the FBXO2 protein expression in the tumor tissue in the FBXO2 overexpression group was significantly higher than that in the control group.

[0049] Example 3

[0050] In this example, it is proved that FBXO2 knockdown promotes the proliferation and metastasis of prostate cancer cells;

[0051] The experimental results are shown in Figure 3 ;

[0052] Figure 3 A in FIG. 13A is the knockdown of FBXO2 protein expression in PC3 / DU145 cells by shRNA (nucleotide sequence is shown in SEQ ID NO. 4). The shRNA targeting FBXO2 and the empty vector plasmid were co-transfected into human embryonic kidney HEK293T cells with a lentivirus packaging plasmid. The virus supernatant was collected 48 h after transfection, filtered through a 0.45 μm filter, and incubated with prostate cancer cells. After 48 h of infection, the cells were selected with a medium containing 2 μg / mL puromycin for 3 days, and the gene expression level was verified by RT-qPCR and Western blot. The results show that the FBXO2 protein expression in PC3 / DU145 cells is successfully knocked down.

[0053] Figure 3 B in FIG. 13B is the CCK-8 proliferation experiment. It can be seen that the proliferation activity of the FBXO2 knockdown group was increased by 1.8 times ( ** p<0.01).

[0054] Figure 3 C in FIG. 13C is the cell colony formation experiment. It can be seen that the proliferation activity of the FBXO2 knockdown group was increased by 1.8 times ( ** p<0.01).

[0055] Figure 3D in the figure is Transwell chamber experiment, using Transwell chamber pre-coated 1:8 diluted Matrigel, the lower chamber added 10% FBS medium, the upper chamber inoculated 3 x 10 4 Knockdown FBXO2 expression cells (serum-free medium), 24 h after the cotton swab wipe off the invasion of cells, 4% paraformaldehyde fixation, crystal violet staining and counting. It can be seen that: FBXO2 knockdown group invasion cell number increased 2.2 times (***p<0.001).

[0056] Figure 4 E in the figure is Western blot experiment of PC3 / DU145 cells after transient knockdown of FBXO2, it can be seen that FBXO2 protein expression is successfully knocked down.

[0057] Figure 4 F in the figure is flow cytometry detection of apoptosis of PC3 / DU145 after transient knockdown of FBXO2, Annexin V-FITC / PI apoptosis detection kit was used, and flow cytometry was used to analyze the apoptosis rate. Specific steps: after collecting the cells, wash with pre-cooled PBS, resuspend in 500 μL binding buffer, add 5 μL FITC Annexin V and 10 μL PI (20 μg / mL), avoid light incubate for 15 min, then machine detection. It can be seen that: after siRNA transient knockdown of FBXO2, the apoptosis rate of prostate cancer cells decreased by 35% (*p<0.05).

[0058] Example 4

[0059] In this embodiment, YTHDF2 is highly expressed in prostate cancer and has a pro-cancer effect;

[0060] Figure 4 A in the figure is the immunohistochemical score of 60 cases of prostate cancer tissues, which shows that the expression of YTHDF2 protein is significantly higher than that of the adjacent tissues (***p<0.001).

[0061] Figure 4 B in the figure is the Western blot detection of proteins extracted from RWPE-1 normal cells and PC3 / DU145 prostate cancer cells, respectively, it can be seen that: Western blot detection shows that YTHDF2 is lowly expressed in RWPE-1 normal cells, but highly expressed in PC3 / DU145 prostate cancer cells.

[0062] Figure 4 C in the figure is the expression level of YTHDF2 mRNA in PC3 / DU145 prostate cancer cells after knockdown of YTHDF2 (nucleotide sequence is shown in SEQ ID NO. 5), it can be seen that: shYTHDF2 effectively knocks down mRNA (reduces by 80%) level;

[0063] Figure 4 D in the figure represents the protein expression of prostate cancer cells after knocking down YTHDF2. Western blot analysis of PC3 / DU145 prostate cancer cell proteins showed that shYTHDF2 effectively knocked down the protein level (reduced by 75%) (***p<0.001).

[0064] Figure 5 E in the figure represents the proliferation rate of PC3 / DU145 prostate cancer cells after YTHDF2 knockdown (CCK-8 assay). It can be seen that YTHDF2 knockdown leads to a 40% decrease in cell proliferation activity.

[0065] Figure 5 In the figure, F represents the cell colony formation assay performed after knocking down YTHDF2 in PC3 / DU145 prostate cancer cells. It can be seen that YTHDF2 knockdown resulted in a 55% reduction in the number of colonies formed.

[0066] Figure 5 In the figure, G represents the Transwell invasion ability experiment performed after knocking down YTHDF2 in PC3 / DU145 prostate cancer cells. It can be seen that the Transwell invasion ability decreased by 60% after YTHDF2 knockdown (**p<0.01).

[0067] Example 5

[0068] In this embodiment, it is used to illustrate that FBXO2 targets YTHDF2 and promotes its ubiquitination and degradation.

[0069] Experimental results are as follows Figure 5 As shown:

[0070] Figure 5 Figure A shows that DU145 cells were transfected with empty vectors pcDNA3.1 and Flag-FBXO2, respectively. Flag-FBXO2 immunoprecipitation combined with mass spectrometry identified YTHDF2 as an interacting protein. Coomassie brilliant blue staining showed a specific band at the 40kDa position. It can be seen that both pcDNA3.1 and Flag-FBXO2 groups can show the light and heavy chains of immunoglobulins, while the Flag-FBXO2 group shows a specific band at the 40kDa position, which indicates that the Flag-FBXO2 protein was successfully pulled down.

[0071] Figure 5 B in the figure represents the endogenous co-immunoprecipitation assay (Co-IP). The FBXO2 protein was immunoprecipitated using an antibody pre-immobilized on magnetic beads, and then incubated and visualized with an anti-YTHDF2 antibody. It can be seen that the endogenous Co-IP confirms the binding of FBXO2 and YTHDF2 in PC3 / DU145 cells.

[0072] Figure 5 C is exogenous co-immunoprecipitation experiment, respectively, in DU145 and PC3 cells transfected with Myc-labeled YTHDF2 plasmid (nucleotide sequence encoding YTHDF2 as shown in SEQ ID NO. 1) and Flag-labeled FBXO2 plasmid (nucleotide sequence encoding FBXO2 as shown in SEQ ID NO. 3). Flag-bead or Myc-bead is used for pull-down, and then SDS-PAGE gel electrophoresis is carried out. After co-transfection of exogenous Flag-FBXO2 and Myc-YTHDF2, co-immunoprecipitation verifies direct interaction. It can be seen that exogenous FBXO2 and exogenous YTHDF2 are directly combined in prostate cancer DU145 and PC3 cells.

[0073] Figure 5 D is an immunofluorescence experiment, respectively, using mouse anti-FBXO2 primary antibody and rabbit anti-YTHDF2 primary antibody for incubation, and then using green fluorescent goat anti-mouse secondary antibody and red fluorescent goat anti-rabbit secondary antibody for incubation. Immunofluorescence shows that FBXO2 (green) and YTHDF2 (red) are co-localized in the cytoplasm (DAPI marks the nucleus, scale bar 20 μm). It can be seen that immunofluorescence shows that FBXO2 (green) and YTHDF2 (red) have obvious co-localization in the cytoplasm (yellow), suggesting that they may interact.

[0074] Figure 5 E is Western blot detection of YTHDF2 protein expression after overexpression of FBXO2 in HEK293T cells. It can be seen that overexpression of FBXO2 reduces the level of YTHDF2 protein.

[0075] Figure 5 F is Western blot detection of YTHDF2 protein expression after overexpression of FBXO2 in DU145 and PC3 prostate cancer cells. It can be seen that overexpression of FBXO2 reduces the level of YTHDF2 protein.

[0076] Figure 6 G is RT-qPCR detection of YTHDF2 mRNA level after overexpression of FBXO2 in DU145 and PC3 prostate cancer cells. It can be seen that overexpression of FBXO2 does not change the level of YTHDF2 mRNA. (***p<0.001).

[0077] Figure 6 H is Western blot detection of YTHDF2 protein expression after knockdown of FBXO2 in DU145 and PC3 prostate cancer cells. It can be seen that knockdown of FBXO2 up-regulates the level of YTHDF2 protein.

[0078] Figure 6 Figure 22A shows that FBXO2 knockdown does not change YTHDF2 mRNA level.

[0079] Example 6

[0080] In this example, FBXO2 mediates ubiquitination modification of K286 site of YTHDF2 is illustrated.

[0081] The experimental results are shown in Figure 6

[0082] Figure 6 Figure 22A shows that FBXO2 knockdown does not change YTHDF2 mRNA level.

[0083] Figure 6 Figure 22B shows that FBXO2 knockdown prolongs YTHDF2 protein half-life.

[0084] Figure 6 Figure 22C shows that proteasome inhibitor MG132 reverses the degradation of YTHDF2 by FBXO2.

[0085] Figure 6 Figure 22D shows that FBXO2 promotes ubiquitination modification of YTHDF2.

[0086] Figure 6 Figure 22E shows a schematic diagram of FBXO2 and YTHDF2 deletion mutants used.

[0087] Figure 6 ​F. In F, F represents that HEK293T cells were transfected with appropriate plasmids, and Western blot analysis of IPs and whole cell lysates (WCL) was performed after 12 hours of treatment in MG132 (10 μM), and it can be seen that FBXO2 binds to YTHDF2 through the C-terminal domain.

[0088] Figure 7 G. In G, G represents that HEK293T cells were transfected with appropriate plasmids, and Western blot analysis of IPs and WCL was performed after 12 hours of treatment in MG132 (10 μM), and it can be seen that YTHDF2 binds to FBXO2 through the N-terminal domain.

[0089] Figure 7 H. In H, the corresponding experimental process is as follows: His-Ub, Myc-YTHDF2, Flag-FBXO2 or Flag-FBXO2-mutant plasmids were co-transfected into 293T cells, MG132 (10 μM) was added, and after 12 hours, YTHDF2 was immunoprecipitated using an anti-myc antibody, and it can be seen that FBXO2 promotes ubiquitination of YTHDF2 through the C-terminal domain.

[0090] Figure 7 I. In I, I is for co-transfecting 293T cells with Flag-FBXO2, His-Ub and Myc-YTHDF2 (WT (wild type), K286R (lysine (K) at position 286 is mutated to arginine (R)), K401R (lysine (K) at position 401 is mutated to arginine (R)), K503R (lysine (K) at position 503 is mutated to arginine (R)), K521R (lysine (K) at position 521 is mutated to arginine (R)), K536R (lysine (K) at position 536 is mutated to arginine (R)), K571R (lysine (K) at position 571 is mutated to arginine (R))) plasmids, in order to more accurately locate the lysine residues of the FBXO2-mediated ubiquitination modification of YTHDF2. The cell lysate was immunoprecipitated with a Myc antibody; it can be seen that the ubiquitination experiment confirms that FBXO2 promotes ubiquitination modification of YTHDF2 through its C-terminal domain, and the K286 site is the key modification site; mutating lysine (K) at position 286 of YTHDF2 to arginine (R) (i.e., K286R mutant) can eliminate the ubiquitination signal (indicating that the K286R mutant cannot be degraded by FBXO2-mediated ubiquitination modification), and the nucleotide sequence encoding the K286R mutant is shown in SEQ ID NO. 2.

[0091] Example 7

[0092] In this embodiment, YTHDF2 knockdown reverses the pro-cancer effect of FBXO2 knockdown is illustrated;

[0093] The experimental results are shown in Figure 7

[0094] Figure 7 A in FIG. 1 shows the construction of double knockdown shFBXO2+shYTHDF2 cell model (Western blot verification), it can be seen that: in PC3 and DU145 cells, shFBXO2 effectively knocked down FBXO2 protein expression, shYTHDF2 effectively knocked down YTHDF2 protein expression, and a FBXO2 and YTHDF2 double knockdown cell model was successfully constructed.

[0095] Figure 7 B in FIG. 1 is a CCK-8 cell proliferation experiment after the construction of double knockdown shFBXO2+shYTHDF2 cell model, it can be seen that: YTHDF2 knockdown partially reversed the cell proliferation / capacity enhancement caused by FBXO2 knockdown (reduced by 50%, **p<0.01).

[0096] Figure 7 C in FIG. 1 is a cell colony formation experiment after the construction of double knockdown shFBXO2+shYTHDF2 cell model, it can be seen that: YTHDF2 knockdown partially reversed the proliferation enhancement caused by FBXO2 knockdown.

[0097] Figure 7 D in FIG. 1 is a Transwell invasion experiment after the construction of double knockdown shFBXO2+shYTHDF2 cell model, it can be seen that: YTHDF2 knockdown partially reversed the invasion enhancement caused by FBXO2 knockdown.

[0098] Figure 7 E in FIG. 1 is Figure 7 the quantitative graph of C in FIG. 1, it can be seen that: YTHDF2 knockdown partially reversed the proliferation enhancement caused by FBXO2 knockdown (reduced by 50%, **p<0.01).

[0099] Figure 7 F in FIG. 1 is Figure 8 the quantitative graph of D in FIG. 1, it can be seen that: YTHDF2 knockdown partially reversed the invasion enhancement caused by FBXO2 knockdown (reduced by 50%, **p<0.01).

[0100] Figure 8 ​G in the figure is the nude mouse subcutaneous tumor model constructed with shFBXO2 (FBXO2 knockdown sequence is shown as SEQ ID NO. 4 and SEQ ID NO. 5), shYTHDF2 (YTHDF2 knockdown sequence is shown as SEQ ID NO. 6 and SEQ ID NO. 7) and shFBXO2+shYTHDF2 (double knockdown). The mice were sacrificed after 25 days, and the subcutaneous transplanted tumors were obtained by dissection; the results show that the nude mouse transplanted tumor model confirms that the tumor size of the double knockdown group is significantly reduced compared with the shFBXO2 single knockdown group.

[0101] Figure 8 H in the figure is the weight change diagram of the nude mouse subcutaneous transplanted tumor dissected in the nude mouse subcutaneous transplanted tumor experiment; it can be seen that the tumor weight of the double knockdown group is significantly reduced by 30% compared with the shFBXO2 single knockdown group (**p<0.01) over time.

[0102] Figure 8 I in the figure is the volume change diagram of the nude mouse subcutaneous transplanted tumor dissected in the nude mouse subcutaneous transplanted tumor experiment; it can be seen that the nude mouse transplanted tumor model confirms that the tumor volume of the double knockdown group is significantly reduced by 30% compared with the shFBXO2 single knockdown group (**p<0.01).

[0103] Example 8

[0104] As shown in Figure 8 , in this embodiment, YTHDF2 degrades CDKN1C mRNA in an m6A dependent manner is illustrated.

[0105] Figure 8 A in the figure is the RNA dot blot hybridization experiment diagram.

[0106] The experimental steps are as follows:

[0107] (1) Total RNA was extracted by Trizol (total RNA extraction reagent) method, and the RNA concentration of each treatment group was adjusted to a uniform level after instrument quantification.

[0108] (2) Mix SSC (sodium citrate) buffer and 37% deionized formaldehyde at a ratio of 3:2 to prepare denaturation buffer, mix the solution with RNA at 1:1, and use a PCR instrument to denature the nucleic acid (95°C x 5 min).

[0109] (3) Carefully spot the sample on a nitrocellulose membrane, and then perform ultraviolet crosslinking at a wavelength of 302 nm for 30 min.

[0110] (4) Block with skimmed milk at room temperature for 2 h, wash the membrane with TBST (membrane washing buffer) for 5 min, and add m6A antibody for 12 hours of incubation at 4°C.

[0111] (5) TBST wash membrane (3 times x 5 min), add corresponding secondary antibody and incubate at room temperature for 2 h, wash membrane as before (3 times x 5 min).

[0112] (6) ECL (‌electrochemiluminescence) chemiluminescence method to develop target bands.

[0113] (7) Prepare methylene blue-stained membrane in parallel: stain for 10-30 min → wash with TBST until background is clear → image and quantify the entire membrane.

[0114] The left part of the picture is the m6A total amount, and the right part of the picture is the RNA internal standard stained with methylene blue. It can be seen that: the RNA dot blot result shows that the expression level of FBXO2 affects the global m6A modification level (methylene blue as the RNA loading amount control).

[0115] Figure 8 B in FIG. 6 is MeRIP-seq (RNA methylation immunoprecipitation) data analysis of the main enrichment region of m6A peaks in PC3 cells. It can be seen that: MeRIP-seq combined with motif analysis identifies that the main enrichment of m6A peaks is in the 3'UTR region.

[0116] Figure 8 C in FIG. 6 is MeRIP-seq data analysis to identify the m6A consensus sequence "GGACU" in PC3 cells. It can be seen that: MeRIP-seq combined with motif analysis identifies that the CDKN1C mRNA 3'UTR region contains the conserved m6A site "GGACU".

[0117] Figure 8 D in FIG. 6 is the analysis result of Linked Omics online analysis software. The gene list positively correlated with FBXO2 and negatively correlated with YTHDF2 was obtained from the TCGA database, and on this basis, the differential gene list obtained from the MeRIP-seq (RNA methylation immunoprecipitation), mRNA-seq, RIP-seq sequencing data of YTHDF2 knockdown cells was integrated for comprehensive analysis. It can be seen that: 14 common target genes were finally identified, including CDKN1C, which is a known tumor suppressor in prostate cancer.

[0118] Figure 8 E in FIG. 6 is RT-qPCR verification of the transcription level of the potential downstream substrate CDKN1C mRNA in prostate cancer cell lines with knockdown of YTHDF2; it can be seen that: YTHDF2 knockdown up-regulates CDKN1C mRNA (qRT-PCR, ***p<0.001).

[0119] Figure 8F in FIG. 6 shows the transcription level of potential downstream substrate CDKN1C mRNA in prostate cancer cell lines overexpressing FBXO2 verified by RT-qPCR; it can be seen that FBXO2 overexpression upregulates CDKN1C mRNA (qRT-PCR, ***p<0.001).

[0120] Figure 8 G in FIG. 6 shows the treatment of control group and prostate cancer stable cell lines knocked down YTHDF2 using transcription inhibitor Actinomycin D; it can be seen that after blocking transcription using Actinomycin D, YTHDF2 knockdown prolongs the half-life (t1 / 2 is prolonged by 2 times, **p<0.01) of CDKN1C mRNA.

[0121] ​ H in FIG. 6 shows the treatment of prostate cancer cells using global methylation inhibitor (DAA); it can be seen that after treating prostate cancer cells using m6A demethylase DAA, YTHDF2 mediates CDKN1C mRNA degradation by recognizing m6A modification is blocked.

[0122] ​ I in FIG. 6 shows the RIP experiment using m6A antibody and RIP kit.

[0123] The experimental steps are as follows:

[0124] (1) Cell lysis and nuclease treatment: collect cell suspension, wash twice with 2 mL pre-cooled PBS buffer, centrifuge at 1000xg for 5 minutes at room temperature, and obtain cell precipitate. Add 0.9 mL Polysome Lysis Buffer and 9 μL RNAase inhibitor, and mix well by vortexing. Place the mixture on ice for 20 min, and vortex every 5 min to enhance the lysis efficiency.

[0125] (2) Genomic DNA removal: add 4.5 μL DNase salt stock and 10 μL DNase to the lysis product in turn, and incubate at 37°C for 10 minutes. After ice bath for 20 minutes, add 4.5 μL EDTA, 1.8 μL EGTA and DTT, and mix well. Finally, centrifuge at 4°C for 10 minutes, collect the supernatant and transfer it to a sterile EP tube for standby.

[0126] (3) Affinity purification method using Protein A / G magnetic beads: Take 20 μL of magnetic bead suspension, wash twice with 0.5 mL of Polysome Lysis Buffer (place in a magnetic separation rack and discard the supernatant), and finally resuspend the magnetic beads in 20 μL of Polysome Lysis Buffer for standby.

[0127] (4) Immunoprecipitation: Divide the lysate into IP and Input groups. Add the appropriate amount of antibody (1-5 μg, refer to the antibody instruction manual) to the IP lysate, and incubate at 4°C for 16 hours. Add the equilibrated magnetic beads and incubate at 4°C for 1 hour. Discard the supernatant in the magnetic separation rack. Wash 3 times with 0.5 mL of Polysome Washing Buffer 1 + 5 μL of DTT, each time for 5 minutes at 4°C with shaking. Wash 2 times with 0.5 mL of Polysome Washing Buffer 2 + 5 μL of DTT, following the same procedure. Add 100 μL of Polysome elution buffer, mix well, and prepare for use.

[0128] (5) Extract RNA: Add 1 mL of Trizol to each of the IP and Input samples, and let stand on ice for 5 minutes. Add 200 μL of chloroform, shake the mixture vigorously, and then perform ice bath treatment for 2 minutes. Keep at 4°C, and centrifuge at 13000 g for 10 minutes to collect the upper aqueous phase. Then, add 1 μL of glycogen, 50 μL of sodium acetate, and 1 mL of anhydrous ethanol. Precipitate at -80°C for 3 hours or overnight. Centrifuge at 16100 g for 30 minutes at 4°C, and discard the supernatant. Wash with 75% ethanol, dry after centrifugation, and dissolve in 30 μL of RNase-free water. Store at -80°C.

[0129] (6) qPCR verification results.

[0130] It can be seen that: compared with the control group using IgG antibody, CDKN1C mRNA is significantly enriched in the YTHDF2 immunoprecipitation group, indicating that YTHDF2 protein interacts directly with CDKN1C mRNA.

[0131] ​J in FIG. 6 is MeRIP-qPCR experiment to verify the site predicted by SRAMP. The m6A site prediction tool SRAMP predicts 14 m6A sites in the CDKN1C 3'UTR region. According to the site, the corresponding primers are designed, and MeRIP-qPCR is performed to detect and verify these predicted sites. It can be seen that compared with the IgG control group, MeRIP-qPCR verifies that the two predicted sites (site 999-1134 and site 2534) in the CDKN1C mRNA 3'UTR region have higher m6A modification levels, and the m6A antibody can specifically enrich the CDKN1C mRNA fragments with m6A modification at these two sites.

[0132] ​ K in FIG. 7 respectively shows the base sequence near the m6A modification site 999-1134 (left) and site 2534 (right) in the CDKN1C mRNA 3'UTR region. The red part is the base sequence corresponding to the primer used in the MeRIP-qPCR verification experiment.

[0133] In summary, FBXO2 inhibits the progression of prostate cancer by mediating the ubiquitination modification of the K286 site of YTHDF2 protein and promoting its proteasome degradation, thereby relieving the m6A-dependent degradation inhibition of CDKN1C mRNA by YTHDF2. Clinical data analysis combined with functional experiments confirm that the FBXO2-YTHDF2-CDKN1C signaling axis plays a key role in the occurrence and development of prostate cancer, providing a new direction for targeted therapy.

[0134] As the substrate recognition subunit of the SCF E3 ubiquitin ligase complex, FBXO2 has tissue-specific functions in tumors. Although previous studies have reported that FBXO2 promotes the progression of ovarian cancer and osteosarcoma by degrading proteins such as SUN2 and IL-6R, in the present invention, it was found that FBXO2 is significantly underexpressed in prostate cancer, and its overexpression is positively correlated with the good prognosis of patients (OS is significantly prolonged by 40%, **p<0.01). This contradiction suggests that FBXO2 may play a "double-edged sword" role through tissue-specific substrates. Through the construction of a conditional gene knockout mouse model and clinical cohort verification, it was found that overexpression of FBXO2 can inhibit the proliferation (IC50 value reduced by 50%), metastasis (number of lung metastases reduced by 60%) and induce apoptosis (apoptosis rate increased by 2.5 times) of prostate cancer cells, clearly demonstrating its tumor suppressor function in prostate cancer.

[0135] YTHDF2 protein as m6A reading protein, its expression level is dynamically regulated by ubiquitination modification. The present application discloses that FBXO2 specifically mediates ubiquitination degradation of K286 site of YTHDF2 by combining N-terminal domain (1-384) of YTHDF2 through co-immunoprecipitation-mass spectrometry (Co-IP-MS) combined with site mutation experiment for the first time. The finding expands the substrate spectrum of SCF complex and clarifies a new regulation mechanism of YTHDF2 protein stability. Notably, YTHDF2 presents oncogenic properties in prostate cancer, and its knockdown can inhibit cell proliferation (EdU positive cell rate decreases by 45%) and invasion (membrane penetration cell number decreases by 55%), while FBXO2 deletion can drive malignant phenotype by up-regulating YTHDF2 protein level. This result is in contrast to the tumor suppression effect of YTHDF2 in hepatocellular carcinoma, suggesting that its function is highly environment-dependent.

[0136] Further mechanism analysis finds that YTHDF2 accelerates degradation of CDKN1C mRNA (mRNA half-life is shortened by 50%) by recognizing m6A modification (motif "GGACU") in the 3'UTR region of CDKN1C mRNA. p57 Kip2 Protein as a cell cycle negative regulator, its expression level is significantly negatively correlated with the stage of prostate cancer (**p<0.01). The present application proves that FBXO2 overexpression or YTHDF2 knockdown can significantly increase CDKN1C mRNA level, and verifies the m6A dependence of its regulation through DAA demethylation treatment and MeRIP-qPCR. These findings are complementary to the expression silencing caused by high methylation of CDKN1C promoter in prostate cancer, and jointly reveal the cross-action network of epigenetic regulation and epigenetic regulation.

[0137] In summary, the present application systematically clarifies the cancer suppression mechanism of FBXO2-YTHDF2-CDKN1C axis in prostate cancer: FBXO2 degrades YTHDF2 through ubiquitination, removes the m6A-dependent degradation inhibition of YTHDF2 on CDKN1C mRNA, thereby blocking cell cycle progression and inducing apoptosis. The discovery of this signal axis not only provides a new prognostic marker (FBXO2 low expression / YTHDF2 high expression) for prostate cancer, but also suggests that targeting SCF complex (especially FBXO2)-YTHDF2 protein interaction or m6A modification microenvironment may become a potential strategy for treating high-risk prostate cancer. Subsequent research can further verify the clinical transformation value of FBXO2 promoter by developing FBXO2 promoters.

[0138] The nucleotide sequence encoding YTHDF2 is shown in SEQ ID NO. 1; specifically:

[0139] gagttcgagcttgcatgcctgcaggtcgttacataacttacggtaaatggcccgcctggctgaccgcccaacgacccccgcccattgacgtcaataatgacgtatgttcccatagtaacgccaatagggactttccattgacgtcaatgggtggagtatttacggtaaactgcccacttggcagtacatcaagtgtatcatatgccaagtacgccccctattgacgtcaatgacggtaaatggcccgcctggcattatgcccagtacatgaccttatgggactttcctacttggcagtacatctacgtattagtcatcgctattaccatggtgatgcggttttggcagtacatcaatgggcgtggatagcggtttgactcacggggatttccaagtctccaccccattgacgtcaatgggagtttgttttggcaccaaaatcaacgggactttccaaaatgtcgtaacaactccgccccattgacgcaaatgggcggtaggcgtgtacggtgggaggtctatataagcagagctcgtttagtgaaccgtcagatcgcctggagacgccatccacgctgttttgacctccatagaagacaccgggaccgatccagcctccggactctagaggatccggtactagaggaactgaaaaaccagaaagttaactggtaagtttagtctttttgtcttttatttcaggtcccggatccggtggtggtgcaaatcaaagaactgctcctcagtggatgttgcctttacttctaggcctgtacggaagtgttacttctgctctaaaagctgcggaattgtacccgcgggcccaccatggcatcaatggagcagaagctgatctcagaggaggacctgcttatggcca

[0140]

[0141] The nucleotide sequence for encoding the K286R mutant is shown as SEQ ID NO. 2, specifically:

[0142] gagttcgagcttgcatgcctgcaggtcgttacataacttacggtaaatggcccgcctggctgaccgcccaacgacccccgcccattgacgtcaataatgacgtatgttcccatagtaacgccaatagggactttccattgacgtcaatgggtggagtatttacggtaaactgcccacttggcagtacatcaagtgtatcatatgccaagtacgccccctattgacgtcaatgacggtaaatggcccgcctggcattatgcccagtacatgaccttatgggactttcctacttggcagtacatctacgtattagtcatcgctattaccatggtgatgcggttttggcagtacatcaatgggcgtggatagcggtttgactcacggggatttccaagtctccaccccattgacgtcaatgggagtttgttttggcaccaaaatcaacgggactttccaaaatgtcgtaacaactccgccccattgacgcaaatgggcggtaggcgtgtacggtgggaggtctatataagcagagctcgtttagtgaaccgtcagatcgcctggagacgccatccacgctgttttgacctccatagaagacaccgggaccgatccagcctccggactctagaggatccggtactagaggaactgaaaaaccagaaagttaactggtaagtttagtctttttgtcttttatttcaggtcccggatccggtggtggtgcaaatcaaagaactgctcctcagtggatgttgcctttacttctaggcctgtacggaagtgttacttctgctctaaaagctgcggaattgtacccgcgggcccaccatggcatcaatggagcagaagctgatctcagaggaggacctgcttatggcca

[0143]

[0144] The nucleotide sequence encoding FBX02 is shown as SEQ ID NO. 3, specifically:

[0145] atggacggagacggtgacccagagagcgtgggccagcccgaggaggcaagcccggaggagcagccagaggaggcgagtgctgaggaggagcggccggaggaccagcaggaggaggaggcggcggccgccgccgcgtacctggacgagctgcccgagccgctgctgctgcgcgtgctggccgcactgccggccgccgagctggtgcaggcctgccgcctggtgtgcctgcgctggaaggagctggtggacggcgcccgctgtggctgctcaagtgccagcaggaggggctggtgcccgagggcggcgtggaggaggagcgcgaccactggcagcagttctacttcctgagcaagcggcgccgcaaccttctgcgtaacccgtgtggggaagaggacttggaaggctggtgtgacgtggagcatggtggggacggctggagggtggaggagctgcctggagacagtggggtggagttcacccacgatgagagcgtcaagaagtacttcgcctcctcctttgagtggtgtcgcaaagcacaggtcattgacctgcaggctgagggctactgggaggagctgctggacacgactcagccggccatcgtggtgaaggactggtactcgggccgcagcgacgctggttgcctctacgagctcaccgttaagctactgtccgagcacgagaacgtgctggctgagttcagcagcgggcaggtggcagtgccccaagacagtgacggcgggggctggatggagatctcccacaccttcaccgactacgggccgggcgtccgcttcgtccgcttcgagcacggggggcaggactccgtctactggaagggctggttcggggcccgggtgaccaacagcagcgtgtgggtagaaccctga

[0146] The nucleotide sequence of shFBXO2 for knockdown is specifically as follows:

[0147] shFBXO2-1 (SEQ ID NO. 4): caccgttaagctactgtccgagcacgagaacgtgctggctgagttcagcatttttt

[0148] shFBXO2-2 (SEQ ID NO. 5): tcgtggtgaaggactggtactcgggccgcagcgacgctggttgcctctacttttt

[0149] The nucleotide sequence of shYTHDF2 for knockdown is specifically as follows:

[0150] shYTHDF2-1 (SEQ ID NO. 6): agttggctattgggaacgtccttcaagagaggacgttcccaatagccaacttttttt

[0151] shYTHDF2-2 (SEQ ID NO. 7): gcacagaagttgcaagcaatgttcaagagacattgcttgcaacttctgtgctttttt

[0152] In the description of the present specification, the description of the terms "one embodiment", "example", "specific example" and the like means that the specific features, structures, materials or characteristics described in connection with the embodiment or example are included in at least one embodiment or example of the present application. In the present specification, the illustrative expressions of the above terms do not necessarily refer to the same embodiment or example. Moreover, the specific features, structures, materials or characteristics described can be combined in any one or more embodiments or examples in a suitable manner.

[0153] The basic principles, main features and advantages of the present application are shown and described above. It should be understood by those skilled in the art that the present application is not limited by the above embodiments, and the above embodiments and descriptions in the specification are only illustrative of the principles of the present application. Without departing from the spirit and scope of the present application, various changes and improvements can be made to the present application, and these changes and improvements all fall within the scope of the claimed present application.

Claims

1. The application of FBXO2 promoter in the preparation of drugs for treating prostate cancer, wherein the FBXO2 promoter comprises: Lentiviral-mediated Flag-FBXO2.

2. The application according to claim 1, characterized in that, The treatment of prostate cancer includes mediating ubiquitination of YTHDF2 at the K286 site and promoting the degradation of YTHDF.

Images