Fully sulfated chondroitin sulfate, preparation method thereof and application of fully sulfated chondroitin sulfate in inhibition of CRISPR / Cas

Abstract

The invention discloses fully sulfated chondroitin sulfate, a preparation method thereof and application of the fully sulfated chondroitin sulfate in inhibiting CRISPR / Cas, the structure of the fully sulfated chondroitin sulfate is shown as VII, the fully sulfated chondroitin sulfate polysaccharide can prevent specific binding of Cas9 and gRNA and inhibit the cleavage activity of Cas9, the Cas9 can be represented by fluorescence intensity, and the Cas9 and gRNA can be combined with gRNA. Meanwhile, the protamine can promote the fully sulfated chondroitin to enter escherichia coli to play a role. According to the invention, full sulfated chondroitin (VII) with a clear structure is found to be used as a non-protein inhibitor to inhibit the activity of CRISPR / Cas, and protamine is used as an auxiliary agent to promote the full sulfated chondroitin to rapidly achieve the inhibition effect. # imgabs0 #

Description

Technical Field

[0001] The present invention relates to the field of medical technology, and in particular to fully sulfated chondroitin sulfate, a preparation method thereof, and an application thereof in inhibiting CRISPR / Cas. Background Art

[0002] The CRISPR-Cas system has developed into an important gene-editing tool and has been applied in fields such as biomedicine. However, its scope of application remains limited. The ever-present concern of off-target effects persists, and widespread application requires safety assurance, quality control, and time-testing. Therefore, to make gene editing more efficient and safe, scientists have discovered a variety of compounds with anti-CRISPR activity, such as Acr proteins, small molecules, and nucleic acids. However, these compounds have several limitations: Acr proteins are difficult to deliver, susceptible to enzymatic degradation, and immunogenic; small molecules are generally cytotoxic and require complex screening; and nucleic acids are unstable and susceptible to enzymatic degradation. Therefore, to overcome these limitations, further development of safer, more precise, and controllable anti-CRISPR tools is urgently needed to improve the controllability of gene-editing technology while ensuring that its widespread application meets stringent safety and quality standards. Consequently, the practicality of the CRISPR-Cas system is expected to further enhance its capabilities, better meeting the needs of the medical and biopharmaceutical fields. Summary of the Invention

[0003] Purpose of the invention: In response to the problems existing in the prior art, the present invention provides a fully sulfated chondroitin polysaccharide candidate with a clear structure. The fully sulfated chondroitin prepared by the present invention exhibits excellent inhibitory activity in the Escherichia coli dual-plasmid screening system, and avoids the problems of unclear structure and instability of the polysaccharide, thereby greatly reducing application concerns. It can be effectively used for the inhibition of the CRISPR-Cas system, and effectively solves the problems of existing anti-CRISPR tools in inhibiting the CRISPR-Cas system, such as difficult delivery, poor stability, low permeability and high immunogenicity.

[0004] The present invention also provides a preparation method and application of the fully sulfated chondroitin. The present invention has been found to be applicable to the inhibition of CRISPR / Cas. It has been found that the use of specific protamine can promote the entry of chondroitin sulfate into Escherichia coli, thereby exerting a greater inhibitory effect. The discovery of a structure-clear fully sulfated chondroitin inhibition technology can better meet the needs of the medical and biopharmaceutical fields.

[0005] Technical solution: In order to achieve the above-mentioned purpose, the fully sulfated chondroitin sulfate of the present invention is characterized in that the structure of the fully sulfated chondroitin sulfate is shown as follows (VII):

[0006]

[0007] The fully sulfated chondroitin is synthesized by an enzymatic method to obtain chondroitin with a clear sugar chain length, and then the chondroitin is fully sulfated and modified by a chemical method to obtain fully sulfated chondroitin with 17 sugar units.

[0008] The glycosyl acceptor of the sulfated chondroitin is 4-nitrophenyl-β-D-glucuronic acid sodium salt, the glycosyl donor is uridine diphosphate N-acetylgalactosamine and uridine diphosphate glucuronic acid; and the enzyme is chondroitin sulfate synthase Kfoc.

[0009] The method for preparing fully sulfated chondroitin sulfate of the present invention comprises the following steps:

[0010] Step a: reacting a uridine diphosphate N-acetylgalactosamine glycosyl donor compound (II), compound (I) and chondroitin polymerase Kfoc in a buffer solution at room temperature, and separating the reaction product to obtain compound (III);

[0011] Step b: reacting compound (III), glucuronic acid glycosyl donor (IV) and chondroitin polymerase Kfoc in a buffer solution at room temperature, and separating the reaction product to obtain compound (V);

[0012] Repeat steps a and b: (a) Compound (V) is synthesized into a tetrasaccharide using uridine diphosphate N-acetylgalactosamine (II) as a glycosyl donor via chondroitin polymerase Kfoc; (b) the tetrasaccharide product is further synthesized into a pentasaccharide using uridine diphosphate glucuronic acid (IV) as a glycosyl donor via chondroitin polymerase Kfoc. This process is repeated multiple times to ultimately obtain compound (VI) consisting of 17 sugar units.

[0013] Step c: dissolving compound (VI) and sulfur trioxide-pyridine in an organic solvent, heating the mixture for reaction, cooling the mixture after the reaction is complete and waiting for the product to precipitate; removing the solvent and freeze-drying the mixture to obtain fully sulfated chondroitin sulfate (VII);

[0014]

[0015] In step a, the final concentrations of the uridine diphosphate N-acetylgalactosamine glycosyl donor compound (II), compound (I), and chondroitin polymerase Kfoc added to the reaction system are 5-15 mM, 5-15 mM, and 15-25 μg / mL, respectively, and the reaction conditions are room temperature for 10-12 hours.

[0016] In step b, the final concentrations of compound (III), glucuronic acid glycosyl donor (IV), and chondroitin polymerase Kfoc added to the reaction system are 5-15 mM, 10-25 mM, and 15-25 μg / mL, respectively, and the reaction conditions are room temperature for 10-12 hours.

[0017] In step c, the final concentrations of compound (VI) and sulfur trioxide-pyridine added to the reaction system are 5-15 mM and 30-50 mM, respectively, and the reaction conditions are 60-70° C. for 1-2 hours.

[0018] The use of the fully sulfated chondroitin sulfate of the present invention in inhibiting the activity of CRISPR / Cas.

[0019] Among them, the fully sulfated chondroitin sulfate is combined with protamine to inhibit the activity of CRISPR / Cas.

[0020] The application is as follows: fully sulfated chondroitin polysaccharide and protamine combine to inhibit the Escherichia coli CRISPR / Cas9 system; the Escherichia coli CRISPR / Cas system includes Cas9, gRNA and fluorescent reporter gene mCherry; the protamine can combine with fully sulfated chondroitin to form a complex, promoting the entry of fully sulfated chondroitin into Escherichia coli, and the fully sulfated chondroitin polysaccharide can prevent Cas9 from specifically binding to gRNA, thereby inhibiting the cutting activity of Cas9.

[0021] The present invention also proposes a novel fully sulfated chondroitin CRISPR / Cas inhibition system and method. The system comprises an E. coli CRISPR / Cas9 system, fully sulfated chondroitin, and a protamine adjuvant. The E. coli CRISPR / Cas system includes Cas9, guide RNA (gRNA), and the fluorescent reporter gene mCherry. The fully sulfated chondroitin polysaccharide prevents the specific binding of Cas9 to the gRNA, inhibiting the cleavage activity of Cas9.

[0022] Preferably, the E. coli CRISPR / Cas9 system is an E. coli CRISPR / Cas9 dual-plasmid screening system, wherein the dual-plasmid screening system is a pCas9 plasmid and a pmCherry plasmid, wherein the pCas9 plasmid elements include a Cas9 gene, a kanamycin resistance gene, a gRNA gene, and a rhamnose promoter for regulating gRNA transcription, and the pmCherry plasmid elements include a spectinomycin resistance gene and a fluorescent reporter gene mCherry. The mCherry gene in the expression vector pBAD_mCherry_GFP_++ (Addgene#187389) is cloned into the plasmid backbone pET29a+ (Addgene#66890), and the kanamycin resistance gene in the backbone is replaced with the spectinomycin resistance gene in the expression vector pEcgRNA (Addgene#166581), thereby constructing the pmCherry plasmid, and the synthesized sgRNA targeting pmCherry is cloned into the vector pEcCas (Addgene#73227) to form the pCas9 plasmid. In the dual-plasmid screening system, Cas9 and the transcribed gRNA form a complex. Under the guidance of the gRNA, the complex targets and cuts the fluorescent expression gene mCherry, thereby reducing the fluorescence expression level.

[0023] Furthermore, the construction of the E. coli CRISPR / Cas9 dual plasmid screening system is shown in Figure 1 The construction process involves transforming the pCas9 plasmid into E. coli, screening with kanamycin to obtain positive clones, further making these clones competent, and then transforming the pmCherry plasmid into competent cells. Finally, screening with spectinomycin and kanamycin to obtain positive clones is the screening strain. When rhamnose is added to the culture medium, it can initiate transcription of the gRNA, forming a complex with the Cas9 protein. The Cas9 protein can then cleave the mCherry gene, thereby downregulating fluorescence expression.

[0024] The addition of 5 μM rhamnose initiated the transcription of sgRNA, forming a complex with the Cas9 protein, thereby inhibiting the expression of the fluorescent group.

[0025] The fully sulfated chondroitin polysaccharide of the present invention is prepared by enzymatically synthesizing chondroitin with a clear sugar chain length, and then chemically modifying the chondroitin with full sulfate to obtain fully sulfated chondroitin with 17 sugar units.

[0026] The fully sulfated chondroitin polysaccharide synthesis receptor is 4-nitrophenyl-β-D-glucuronic acid sodium salt, and sugar chain synthesis is alternately carried out using uridine diphosphate N-acetylgalactosamine glycosyl donor and uridine diphosphate glucuronic acid glycosyl donor under the catalysis of chondroitin polymerase Kfoc.

[0027] The fully sulfated chondroitin polysaccharide described herein can inhibit CRISPR / Cas by enhancing the fluorescence signal. Within a safe range, higher concentrations of fully sulfated chondroitin increase the fluorescence signal, with the inhibition of Cas9 cleavage activity being characterized by fluorescence intensity. Fully sulfated chondroitin can hinder the formation of a complex between Cas9 and guide RNA, thereby inhibiting the cleavage of the fluorescent reporter gene mCherry, resulting in increased fluorescence expression.

[0028] Furthermore, protamine is added to the inhibition system. The protamine can combine with fully sulfated chondroitin to form a complex, thereby promoting the entry of fully sulfated chondroitin into Escherichia coli and exerting an inhibitory effect to a greater extent.

[0029] Preferably, the final concentration of protamine is 15 μM. The protamine should be incubated with the reaction buffer on ice for 3 hours before being added to the culture medium for reaction.

[0030] The inhibition system in the present invention further comprises a reaction buffer, which comprises: Tris-HCl, KCl, TCEP, and PMSF, and the pH value of the reaction buffer is 7.2-8.

[0031] Preferably, the pH value of the reaction buffer system is 7.6.

[0032] More preferably, the concentration of Tris-HCl in the buffer is 10 mM, the concentration of KCl is 1 M, the concentration of TCEP is 1 mM, and the concentration of PMSF is 0.15 mM.

[0033] The present invention prepares a polysaccharide with anti-CRISPR activity of a completely new structure, which has a synergistic effect when used in combination with protamine. The fully sulfated chondroitin polysaccharide of the present invention can prevent Cas9 from specifically binding to gRNA, inhibit the cutting activity of Cas9, and is characterized by fluorescence intensity. At the same time, protamine can promote the entry of fully sulfated chondroitin into Escherichia coli to exert its effect. The present invention discovered that fully sulfated chondroitin (VII) with a clear structure inhibits the activity of CRISPR / Cas as a non-protein inhibitor, and uses protamine as an adjuvant to promote fully sulfated chondroitin to quickly achieve an inhibitory effect. By comparison, the inhibition efficiency of sugar alone is not high, and the addition of protamine can achieve a higher inhibition efficiency. The structure is completely new, and there are currently no reports of polysaccharides having anti-CRISPR activity.

[0034] The structurally clear polysaccharide synthesized by the present invention has anti-CRISPR activity, which inhibits the activity of CRISPR / Cas. However, CRISPR / Cas as a gene editing tool can cause off-target effects and reduce editing accuracy. Inhibiting CRISPR / Cas can effectively inhibit the activity of Cas9 protein, thereby improving the accuracy and controllability of gene editing.

[0035] Beneficial effects: Compared with the prior art, the present invention has the following advantages:

[0036] 1. This study discovered for the first time that sulfated chondroitin with a specific structure has a significant inhibitory effect on CRISPR / Cas, which is expected to facilitate precise editing of the CRISPR-Cas system.

[0037] 2. The present invention synthesizes a well-defined sulfated chondroitin, avoiding the contamination of natural extraction and solving the problem of heterogeneous structure of chondroitin sulfate sources. In addition, the fully sulfated modification can increase anti-CRISPR activity.

[0038] 3. The chondroitin sulfate synthesized in this invention has high biocompatibility, low toxicity and side effects, and has physiological effects such as anti-inflammatory and anti-tumor. These advantages provide impetus for the research and development of safe pharmaceutical products and provide important guarantees for the safe application of CRISPR / Cas technology.

[0039] 4. The present invention utilizes protamine as an adjuvant for the first time, and its addition can promote the inhibitory effect of the fully sulfated chondroitin synthesized by the present invention, and the inhibitory effect is excellent. BRIEF DESCRIPTION OF THE DRAWINGS

[0040] Figure 1 This is a schematic diagram of the construction principle of the E. coli double plasmid;

[0041] Figure 2 This is the NMR image of fully sulfated chondroitin;

[0042] Figure 3 The effect of chondroitin sulfate and protamine concentration on bacterial growth

[0043] Figure 4 This is a graph showing the effects of protamine and fully sulfated chondroitin on gene editing efficiency;

[0044] Figure 5 This is a graph showing the effect of different concentrations of fully sulfated chondroitin on gene editing efficiency;

[0045] Figure 6 This is the effect of incubation time of fully sulfated chondroitin and protamine on gene editing efficiency

[0046] Figure 7 This is a graph showing the effect of different concentrations of protamine and fully sulfated chondroitin mixtures on gene editing efficiency;

[0047] Figure 8 Response surface plot of the interactive effect of chondroitin sulfate concentration and incubation time on gene editing efficiency;

[0048] Figure 9Response surface plot of the interactive effect of chondroitin sulfate concentration and protamine concentration on gene editing efficiency;

[0049] Figure 10 Response surface plot of the interactive effect of chondroitin sulfate concentration and incubation time on gene editing efficiency. DETAILED DESCRIPTION

[0050] The present invention can be better understood according to the following examples. However, it is easy for those skilled in the art to understand that the contents described in the examples are only used to illustrate the present invention, and should not and will not limit the present invention described in detail in the claims.

[0051] The experimental methods described in the examples are conventional methods unless otherwise specified; the reagents and materials described are commercially available unless otherwise specified.

[0052] Among them, chondroitin polymerase Kfoc (CAD5992240.1), N-acetylglucosamine kinase NahK (ANC68241.1), and N-acetylglucosamine uridyltransferase GlmU (ACO75977.1) were artificially synthesized according to the sequences on NCBI and obtained by fermentation according to the literature (Zheng, J.; Xu, H.; Li, BZ; Sohail, M.; Bi, JJ; Zhang, FM; Linhardt, RJ; Huang, H.; Zhang, X. Spatially Segregated MOF Bioreactor Enables Versatile Modular Glycoenzyme Assembly for Hierarchical Glycan Library Construction. ACS Appl. Mater. Interfaces 2023, 15(16): 19807-19816.).

[0053] Protamine was purchased from Maclean, CAS: 9012-00-4.

[0054]

[0055] 4-Nitrophenyl-β-D-glucuronic acid, sodium salt: purchased from Jinan Shanmu, product number: SAM312, CAS: 89772-41-8.

[0056]

[0057] UDP-GalNAc.2Na (UDP-N-acetylgalactosamine, sodium salt): purchased from Wuhan Tangzhi Pharmaceutical, product number: SN-1006, CAS: 108320-87-2.

[0058]

[0059] UDP-GlcA.3Na (UDP-glucuronic acid, sodium salt): purchased from Wuhan Tangzhi Pharmaceutical, product number: SN-1007, CAS: 67300-19-6.

[0060]

[0061] Sulfur trioxide-pyridine complex: purchased from Aladdin, product number: S106808, CAS: 26421-87-3.

[0062]

[0063] Example 1

[0064] The effects of the synthesis of fully sulfated chondroitin and protamine on gene editing efficiency.

[0065] (1) Preparation of fully sulfated chondroitin sulfate, the reaction route is as follows:

[0066]

[0067] The first step, i.e., step a, is to react 10 mM uridine diphosphate N-acetylgalactosamine glycosyl donor compound (II, UDP-GalNAc.2Na), 10 mM compound (I, 4-nitrophenyl-β-D-glucuronic acid sodium salt) and 20 μg / mL chondroitin polymerase Kfoc in a buffer solution containing 10 mM MnCl2, 100 mM Tris-HCl (pH 7.0), and 10 ml H2O at room temperature for 12 hours. The reaction is detected by HPLC under the following detection conditions: a YMC Polyamine II column (4.6 mm × 250 mm, 5 μm; PAMN) with a gradient elution of 0 → 1 mol / L potassium dihydrogen phosphate within 45 minutes at a flow rate of 0.5 mL / min: the detection wavelengths are 310 nm (for detecting pNP) and 260 nm (for detecting the reaction of the glycosyl donor). The reaction was detected every 12 h. After the reaction was completed, the reaction solution was filtered with a 0.22 μm filter membrane, the precipitate was discarded, and the solution was purified with a C18 (3×50 cm) column to obtain compound (III);

[0068] The second step, i.e., step b, is as follows: 10 mM compound (III), 15 mM uridine diphosphate glucuronide glycosyl donor (IV), and 20 μg / mL chondroitin polymerase Kfoc are reacted in a buffer solution containing 10 mM MnCl2, 100 mM Tris-HCl, pH 7.0, and 10 mL H2O at room temperature for 12 hours. The reaction is detected by HPLC using a YMC Polyamine II column (4.6 mm × 250 mm, 5 μm; PAMN) with a gradient elution of 0 → 1 mol / L potassium dihydrogen phosphate over 45 minutes at a flow rate of 0.5 mL / min. The detection wavelengths are 310 nm (for detection of pNP) and 260 nm (for detection of the reaction of the glycosyl donor). The reaction is detected every 12 hours. After completion of the reaction, the reaction solution is filtered through a 0.22 μm filter membrane, the precipitate is discarded, and the reaction is purified using a C18 (3 × 50 cm) column to obtain compound (V).

[0069] The purification method of the C18 column (3×50 cm) in the above steps (1) and (2) is as follows: (1) Solution preparation: Buffer A is a 20% methanol-water solution containing 0.1% trifluoroacetic acid, and buffer B is an 80% methanol-water solution containing 0.1% trifluoroacetic acid; (2) Equilibration of the C18 column: The C18 column is rinsed with buffer A for approximately 1.5 column volumes; (3) Sample loading: The reaction solution is filtered through a 0.22 μm filter membrane and then passed through the C18 column; (4) The C18 column is rinsed with buffer A until there is no obvious ultraviolet absorption at 260 nm; (5) Sample collection: The C18 column is rinsed with buffer B and the components with specific absorption at 310 nm are collected; (6) Column preservation: The C18 column is rinsed with 80% methanol-water solution for approximately 2 column volumes to remove other impurities in the C18 column and preserve the column. The detection wavelengths required for this process are 310 nm (for detecting pNP) and 260 nm (for detecting glycosyl donors), and the flow rate is 5 mL / min.

[0070] In the third step, steps a and b are repeated: (a) compound (V) is synthesized into a tetrasaccharide using uridine diphosphate N-acetylgalactosamine (II) as a glycosyl donor by catalysis of chondroitin polymerase Kfoc; (b) the tetrasaccharide product is further synthesized into a pentasaccharide using uridine diphosphate glucuronic acid (IV) as a glycosyl donor by catalysis of chondroitin polymerase Kfoc; this process is repeated multiple times to finally obtain compound (VI) composed of 17 sugar units;

[0071] The fourth step, i.e., step c: 10 mM compound (VI) and 40 mM sulfur trioxide-pyridine were dissolved in 10 mL DMF, and the reaction was carried out in a CEM microwave reactor at 60°C for 2 h. After the reaction was completed, the mixture was placed on ice to cool to 0°C, and then 1 mL of pre-cooled H2O and 6.25 mL of EtOH were added, and the mixture was allowed to stand on ice for 1 h to wait for precipitation; H2O, EtOH, and part of DMF were removed by rotary evaporation at 85°C; and finally, freeze-dried to obtain fully sulfated chondroitin sulfate (VII). The hydrogen spectrum of compound (VII) prepared in this example is shown in FIG. Figure 2 shown.

[0072] (2) Construction of the E. coli dual-plasmid system. The principle is shown in Figure 1 .

[0073] The dual-plasmid screening system consists of a pCas9 plasmid and a pmCherry plasmid. The pCas9 plasmid elements include the Cas9 gene, the kanamycin resistance gene, the gRNA gene, and a rhamnose promoter that regulates gRNA transcription. The pmCherry plasmid elements include the spectinomycin resistance gene and the fluorescent reporter gene mCherry. Among them, the mCherry gene in the expression vector pBAD_mCherry_GFP_++ (Addgene#187389) was cloned into the plasmid backbone pET29a+ (Addgene#66890), and the kanamycin resistance gene in the backbone was replaced with the spectinomycin resistance gene in the expression vector pEcgRNA (Addgene#166581) to construct the pmCherry plasmid, and the synthesized sgRNA targeting pmCherry (UUGAGCUCGAGAUCUGAGUCGUUUUAGAGCUAGAAAUAGCAAGUUA AAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGU GC) was cloned into the vector pEcCas (Addgene#73227) to form the pCas9 plasmid. (See Maji, B.; Gangopadhyay, SA; Lee, M.; Shi, M.; Wu, P.; Heler, R.; Mok, B.; Lim, D.; Siriwardena, SU; Paul, B.; et al. A High-Throughput Platform to Identify Small-Molecule Inhibitors ofCRISPR-Cas9.Cell 2019,177(4),1067-1079.e1019.

[0074] First, the pCas9 plasmid is transformed into Escherichia coli, and positive clones are obtained by screening with kanamycin antibiotics. The positive clones are further made competent, and the pmCherry plasmid is then transformed into competent. Finally, the positive clones are screened with spectinomycin and kanamycin, that is, the required screening strain (containing pCas9 and pmCherry double plasmids) is obtained for culture verification in subsequent steps and embodiments. When there is no rhamnose in the culture medium, the gRNA cannot be transcribed, and the effector complex Cas9:gRNA cannot be formed with Cas9, and the targeted cutting activity cannot be exerted, and the fluorescent gene mCherry is expressed normally; when rhamnose is added to the culture medium, the gRNA is transcribed normally, and the gRNA can form a complex with the Cas9 protein, targeting and cutting the fluorescent gene mCherry, thereby failing to express normally, and the fluorescent expression level is lowered compared to the previous step.

[0075] (4) Preparation of protamine reaction buffer: 10 mM Tris-HCl, 1 M KCl, 1 mM TCEP, 0.15 mM PMSF, pH value of reaction buffer was 7.6.

[0076] (5) Prepare 10 mL of 10 μM protamine solution using a buffer solution, mix thoroughly, and store at low temperature.

[0077] (6) E. coli was cultured in LB medium containing 0-40 μM chondroitin sulfate and 0-40 μM protamine. The culture was carried out at 37°C for 4 hours. The OD value was measured by spectrophotometer to obtain the survival rate of E. coli. Figure 3 , the concentrations of protamine and chondroitin sulfate have a certain effect on cell growth: the increase of chondroitin sulfate concentration to above 30μM has a greater impact on cells.

[0078] (6) Five groups of Escherichia coli, Group A, Group B, Group C, Group D and Group E, were cultured separately. Group A did not add rhamnose and added 10 μM fully sulfated chondroitin, Group B added rhamnose with a final concentration of 5 μM, Group C added rhamnose with a final concentration of 5 μM and 15 μM protamine solution, Group D added rhamnose with a final concentration of 5 μM and 10 μM fully sulfated chondroitin, and Group E added rhamnose, 10 μM fully sulfated chondroitin and 15 μM protamine solution. The culture medium was placed on a 96-well plate and incubated at 37°C for 16 hours, and then the intensity of the mCherry fluorescence signal in the bacterial solution was measured using an enzyme-linked microplate reader. By comparing the fluorescence signals of different groups, it was determined whether protamine and fully sulfated chondroitin had an effect on the cutting efficiency. Results Figure 4 As shown, when protamine was added alone, gene editing was not affected, but when chondroitin sulfate was added, the gene editing efficiency decreased. When a mixture of chondroitin sulfate and protamine was added, the gene editing efficiency was significantly lower than when chondroitin sulfate was added alone.

[0079] Example 2

[0080] Effects of different concentrations of fully sulfated chondroitin on gene editing efficiency.

[0081] The method of Example 1 was used to prepare fully sulfated chondroitin, construct a dual-plasmid system of Escherichia coli and a protein buffer.

[0082] During the experiment, culture media containing fully sulfated chondroitin at final concentrations of 0 μM, 5 μM, 10 μM, 15 μM, 20 μM, 25 μM, and 30 μM were prepared and incubated with protamine at a final concentration of 15 μM at 4°C for 2 hours; then rhamnose was added at a final concentration of 5 μM. The culture medium was placed on a 96-well plate and incubated at 37°C for 16 hours. The intensity of the mCherry fluorescence signal in the bacterial solution was then measured using an enzyme-linked microplate reader. By comparing the fluorescence signals of different groups, the effect of fully sulfated chondroitin on the cutting efficiency was investigated. The results are shown in Figure 2. Figure 5 As shown, when the chondroitin sulfate concentration is 15 μM, the gene editing efficiency is the lowest, that is, the inhibition effect is the best. As the chondroitin sulfate concentration increases, it has a certain effect on the growth of Escherichia coli.

[0083] Example 3

[0084] Effect of incubation time of fully sulfated chondroitin and protamine on gene editing efficiency

[0085] The method of Example 1 was used to prepare fully sulfated chondroitin, construct a dual-plasmid system of Escherichia coli and a protein buffer.

[0086] 10 μM fully sulfated chondroitin and 15 μM protamine were incubated at 4°C for 0 h, 1 h, 2 h, 3 h, 4 h, and 5 h, respectively; then 5 μM rhamnose was added. It was added to E. coli culture medium, and the culture medium was placed on a 96-well plate and incubated at 37°C for 16 hours. The intensity of the mCherry fluorescence signal in the bacterial solution was then measured using a microplate reader. The fluorescence signals of the groups with different incubation times were compared. The results are shown in Figure 2. Figure 6 As shown, the gene editing efficiency of fully sulfated chondroitin was better when chondroitin sulfate and protamine 5'-10' eggs were incubated for 3 hours.

[0087] Example 4

[0088] Effects of different concentrations of protamine and fully sulfated chondroitin mixture on gene editing efficiency.

[0089] The method of Example 1 was used to prepare fully sulfated chondroitin, construct a dual-plasmid system of Escherichia coli and a protein buffer.

[0090] Use buffer to prepare protamine solutions with concentrations of 0μM, 5μM, 10μM, 15μM, 20μM, and 25μM, respectively. 10μM fully sulfated chondroitin and protamine at different concentrations were incubated at 4°C for 2 hours, and then 5μM rhamnose was added to the Escherichia coli culture medium. The culture medium was placed on a 96-well plate and incubated at 37°C for 16 hours. The intensity of the mCherry fluorescence signal in the bacterial solution was then measured with an enzyme-linked microplate reader. By comparing the fluorescence signals of the groups with different concentrations of protamine, the effect of protamine on fully sulfated chondroitin was investigated. The results are shown in the figure. Figure 7 As shown in the figure, when the concentration of protamine reaches 15 μM, the inhibitory effect is the best. As the concentration of protamine increases, it will neutralize chondroitin sulfate and affect the effect of chondroitin sulfate.

[0091] Example 5

[0092] The method of Example 1 was used to prepare fully sulfated chondroitin, an E. coli dual-plasmid system, and a protein buffer solution. Based on Examples 2, 3, and 4, the Box-Behnken response surface experimental design method was used to select a chondroitin sulfate concentration of 5-15 μM, an incubation time of 2-4 h, and a protamine concentration of 10-20 μM. The response surface optimization process and the results are shown in Table 1. The response surface software Design-Expert 8.6.0.1 was used to perform variance analysis on the results obtained in Table 1, and the model coefficients were tested for significance. The results are shown in Table 2. The response surface results are shown in Table 2. Figure 8 、 9 , as shown in 10.

[0093] Table 1 Response surface experiment design and results for optimizing the conditions for inhibiting CRISPR-Cas

[0094]

[0095] Table 2 Results of variance analysis of regression model

[0096]

[0097] Note: “**” indicates a significant effect on the results (P<0.01); “*” indicates a significant effect on the results (P<0.05).

[0098] As shown in Table 2, the model is significant (P<0.01), the lack of fit term is not significant (P>0.05), and R 2 =0.9879, correction coefficient R 2=0.9750, indicating that the model has a high degree of fit. The F value shows that the inhibitory effect of each factor on CRISPR-Cas is in the following order: chondroitin sulfate concentration (A) > protamine concentration (C) > incubation time (B). Combined with the P value, it can be seen that the linear terms A, B, C and the quadratic term A 2 、B 2 、C 2 The effect on the results was extremely significant (P < 0.01); the interaction term AC had a significant effect on the results (P < 0.05), while other factors were not significant (P > 0.05). The response surface showed that, under the same reaction system, the addition of protamine solution (10 μM) significantly inhibited gene editing compared to the absence of protamine solution. Furthermore, under the same reaction system, the addition of chondroitin sulfate (15 μM) significantly inhibited gene editing compared to the absence of chondroitin sulfate.

[0099] After response surface optimization, the optimal conditions for inhibiting CRISPR-Cas were determined to be a chondroitin sulfate concentration of 14.99 μM, an incubation time of 3.19 hours, and a protamine concentration of 10.01 μM. Under these conditions, the predicted gene editing efficiency was 37.8858%. Based on practical conditions and feasibility, the chondroitin sulfate concentration was adjusted to 15 μM, an incubation time of 3.2 hours, and a protamine concentration of 10 μM. Three parallel experiments were performed under these conditions, and the resulting gene editing efficiency reached 39%, which was comparable to the predicted value and consistent with the objective results. Therefore, the optimal process conditions were chondroitin sulfate concentration of 15 μM, incubation time of 3.2 hours, and protamine concentration of 10 μM.

Claims

1. A fully sulfated chondroitin sulfate, characterized in that The structure of the fully sulfated chondroitin sulfate is shown below VII:

2. The fully sulfated chondroitin sulfate according to claim 1, characterized in that The fully sulfated chondroitin is synthesized by an enzymatic method to produce chondroitin with a clear sugar chain length, and then fully sulfated chondroitin is modified by a chemical method to obtain fully sulfated chondroitin with 17 sugar units.

3. The fully sulfated chondroitin sulfate according to claim 2, characterized in that The glycosyl acceptor of the sulfated chondroitin is 4-nitrophenyl-β-D-glucuronic acid sodium salt, the glycosyl donor is uridine diphosphate N-acetylgalactosamine and uridine diphosphate glucuronic acid; and the enzyme is chondroitin polymerase Kfoc.

4. A method for preparing fully sulfated chondroitin sulfate according to claim 1, characterized in that: The steps include: Step a: reacting a uridine diphosphate N-acetylgalactosamine glycosyl donor compound (II), compound (I), and chondroitin polymerase Kfoc in a buffer solution at room temperature, and separating the reaction product to obtain compound (III); Step b: reacting compound (III), glucuronic acid glycosyl donor (IV) and chondroitin polymerase Kfoc in a buffer solution at room temperature, and separating the reaction product to obtain compound (V); Repeating steps a and b: (a) using uridine diphosphate N-acetylgalactosamine (II) as a glycosyl donor, compound (V) is catalyzed by chondroitin polymerase Kfoc to synthesize a tetrasaccharide; (b) the tetrasaccharide product is further catalyzed by chondroitin polymerase Kfoc to synthesize a pentasaccharide using uridine diphosphate glucuronic acid (IV) as a glycosyl donor; repeating this process multiple times, ultimately obtaining compound (VII) composed of 17 sugar units; Step c: dissolving compound (VI) and sulfur trioxide-pyridine in an organic solvent, heating the mixture for reaction, cooling the mixture after the reaction is complete and waiting for the product to precipitate; removing the solvent and freeze-drying the mixture to obtain fully sulfated chondroitin sulfate (VII); 5. The method for preparing fully sulfated chondroitin sulfate according to claim 1, wherein In step a, the final concentrations of uridine diphosphate N-acetylgalactosamine glycosyl donor compound (II), compound (I), and chondroitin polymerase Kfoc added to the reaction system are 5-15 mM, 5-15 mM, and 15-25 μg / mL, respectively. The reaction conditions are room temperature for 10-12 hours.

6. The method for preparing fully sulfated chondroitin sulfate according to claim 1, wherein: In step b, the final concentrations of compound (III), glucuronide donor (IV), and chondroitin polymerase Kfoc added to the reaction system are 5-15 mM, 10-25 mM, and 15-25 μg / mL, respectively. The reaction conditions are room temperature for 10-12 hours.

7. The method for preparing fully sulfated chondroitin sulfate according to claim 1, wherein: In step c, the final concentrations of compound (VI) and sulfur trioxide-pyridine added to the reaction system are 5-15 mM and 30-50 mM, respectively. The reaction conditions are 60-70° C. for 1-2 hours.

8. A use of the fully sulfated chondroitin sulfate according to claim 1 in inhibiting the activity of CRISPR / Cas.

9. The use according to claim 8, characterized in that The fully sulfated chondroitin sulfate combined with protamine is preferably used to inhibit the activity of CRISPR / Cas.

10. The use according to claim 8, characterized in that The application is as follows: fully sulfated chondroitin polysaccharide and protamine combine to inhibit the Escherichia coli CRISPR / Cas9 system; the Escherichia coli CRISPR / Cas system includes Cas9, gRNA and fluorescent reporter gene mCherry; the protamine can combine with fully sulfated chondroitin to form a complex, promoting the entry of fully sulfated chondroitin into Escherichia coli, and the fully sulfated chondroitin polysaccharide can prevent Cas9 from specifically binding to gRNA, thereby inhibiting the cutting activity of Cas9.

Images