Application of MsCDPK9 gene to improvement of stress resistance of saccharomyces cerevisiae strain

Abstract

The invention discloses application of an MsCDPK9 gene to improvement of stress resistance of a saccharomyces cerevisiae strain, and belongs to the technical field of gene engineering. The nucleotide sequence of the alfalfa MsCDPK9 coding gene is shown as SEQ ID NO.1, the alfalfa MsCDPK9 coding gene is transferred into a saccharomyces cerevisiae genome and is excessively expressed in a transgenic strain, and the salt, cadmium and lead stress resistance of the saccharomyces cerevisiae strain can be improved. The saccharomyces cerevisiae strain overexpressing the medicago sativa MsCDPK9 gene can remarkably improve the salt, cadmium and lead stress resistance, the application in actual production is beneficial to improving the tolerance of saccharomyces cerevisiae to salt, cadmium and lead stress, and the gene can be used as an important gene resource.

Description

Technical Field

[0001] The invention belongs to the technical field of genetic engineering, and particularly relates to an application of the MsCDPK9 gene in improving the stress resistance of a saccharomyces cerevisiae strain. Background Art

[0002] Calcium-dependent protein kinases (CDPKs) are widely present in plants. 2+ A family of protein kinases that regulates calcium (Ca 2+ ) is an important component of the regulatory signaling pathway. CDPKs contain four domains: serine / threonine kinase domain (STKD), N-terminal variable domain (ND), autoinhibitory linker domain (AID), and C-terminal adjustable calmodulin-like domain (CaM-LD). The calmodulin-like domain is usually composed of 1-4 EF-hand domains, which can bind to Ca 2+ Combined. More and more CDPK genes have been identified in plants. For example, 34, 41, 25 and 40 CDPK gene family members have been identified in Arabidopsis, cotton, rapeseed, rice and corn, respectively. More and more studies have shown that CDPK genes are widely involved in plant responses to abiotic stress. 2+ It is a universal second messenger. When plants are subjected to abiotic stress, intracellular Ca 2+ When the concentration changes, CDPKs are activated to sense Ca 2+ Signal, involved in downstream regulatory effects.

[0003] A growing body of research indicates that CDPK genes are involved in regulating plant abiotic stresses. In Arabidopsis, AtCDPK23 negatively regulates salt tolerance; in tobacco, MDCPK1A, and in wheat, TaCDPK27 and TaCDPK34 positively regulate salt tolerance; and in rice, OsCDPK4 plays a key role in the response to salt stress. CDPK genes can induce the expression of ABA pathway genes and regulate related anion channels, thereby regulating stomatal opening and closing, participating in the salt stress response. In Arabidopsis, AtCDPK11 phosphorylates Di19 (Dehydration-induced preotein 19), further enhancing the expression of downstream genes in the ABA and stress signaling pathways, thereby regulating plant responses to salt stress. AtCDPK4 and AtCDPK21, as regulators of the ABA signaling pathway, positively regulate Arabidopsis salt tolerance through this pathway. In rice, the OsDCPK21 gene phosphorylates OsGF14e (14-3-3 protein), modulating the ABA-dependent salt stress signaling pathway to enhance rice salt tolerance. In Vitis amurensis, constitutive expression of VaCDPK1 and VaCDPK26 modulates the ABA signaling pathway to enhance plant salt tolerance. Furthermore, OsCDPK12 regulates ROS homeostasis under salt stress by inducing the expression of ROS scavenging genes, thereby modulating plant salt tolerance. GuCDPKs enhance salt tolerance in G. uralensis by increasing the synthesis of glycyrrhizic acid and flavonoids, but their role in cadmium and lead tolerance is less well-researched. Summary of the Invention

[0004] Based on the above-mentioned shortcomings, the purpose of the present invention is to provide an application of the MsCDPK9 gene to improve the stress resistance of Saccharomyces cerevisiae strains, which is used to improve the resistance of Saccharomyces cerevisiae under salt, cadmium and lead stress.

[0005] The technical solution adopted by the present invention is as follows: an application of the MsCDPK9 gene to improve the stress resistance of a cerevisiae strain, wherein the nucleotide sequence of the alfalfa MsCDPK9 encoding gene is shown in SEQ ID NO.1. The alfalfa MsCDPK9 encoding gene is transferred into the cerevisiae genome and overexpressed in the transgenic strain, thereby improving the cerevisiae strain's ability to resist salt, cadmium, and lead stresses.

[0006] The PEG / LiAc method was used to transfer an overexpression recombinant vector pYES2-MsCDPK9 into a Saccharomyces cerevisiae strain. The overexpression recombinant vector pYES2-MsCDPK9 contained the full-length nucleotide sequence of a cDNA encoding the alfalfa MsCDPK9 gene. The nucleotide sequence of the alfalfa MsCDPK9 encoding gene was shown in SEQ ID NO.1. Transgenic Saccharomyces cerevisiae strains were obtained by screening. Compared with a control, the transgenic Saccharomyces cerevisiae strains had improved resistance to salt, cadmium, and lead stresses.

[0007] Furthermore, in the method for constructing a transgenic strain as described above, the pYES2 plasmid is double-digested with restriction endonucleases BamHⅠ and EcorⅠ, and then recovered by gel excision. The purified MsCDPK9 product with vector homology arms obtained by PCR amplification is homologously recombined using a kit. The primer set for PCR amplification is shown in SEQ ID NO.2 and SEQ ID NO.3.

[0008] Advantages and beneficial effects of the present invention: The cerevisiae yeast strain overexpressing the alfalfa MsCDPK9 gene of the present invention can significantly improve the ability to resist salt, cadmium and lead stress. Its application in actual production helps to improve the tolerance of cerevisiae yeast to salt, cadmium and lead stress. The gene can be used as an important gene resource. BRIEF DESCRIPTION OF THE DRAWINGS

[0009] Figure 1 This is the electrophoresis diagram of PCR amplification of the MsCDPK9 gene in alfalfa, where M: DL2000 DNA marker; 1-3: full-length amplification results of the MsCDPK9 gene cDNA;

[0010] Figure 2 This is the predicted tertiary structure of MsCDPK9 protein from alfalfa;

[0011] Figure 3 This is the evolutionary tree of MsCDPK9 protein;

[0012] Figure 4 is the pYES2-MsCDPK9 vector map;

[0013] Figure 5 This is a PCR test of the yeast culture medium of the alfalfa MsCDPK9 gene transformed Saccharomyces cerevisiae, where M: DL2000 DNA marker; 1-4: detection of Saccharomyces cerevisiae transformants;

[0014] Figure 6 This is a graph showing the growth of transgenic Saccharomyces cerevisiae strains and the control strain after 48 h of 100 μmol / L cadmium stress;

[0015] Figure 7This is a graph showing the growth of transgenic Saccharomyces cerevisiae strains and control strains after 48 hours of 200mmol / L salt stress.

[0016] Figure 8 This is a graph showing the growth of transgenic Saccharomyces cerevisiae strains and the control strain after 48 hours of 110 μmol / L lead stress. DETAILED DESCRIPTION

[0017] The present invention provides an alfalfa MsCDPK gene, MsCDPK9. Using cDNA reverse-transcribed from alfalfa strain A1 as a template, the full-length sequence of the MsCDPK9 gene was obtained through primer design, gene amplification, and sequencing, and its nucleotide and amino acid sequences were determined. The MsCDPK9 gene was then constructed into an expression vector, pYES2, and transformed into competent yeast Saccharomyces cerevisiae to identify the function of MsCDPK9. The present invention is further illustrated by the following examples:

[0018] Example 1

[0019] Cloning of MsCDPK9 gene

[0020] Alfalfa cultivar Zhongfu No. 1 leaves (from the experimental fields of Northeast Agricultural University) were collected and quickly placed in liquid nitrogen. The samples were ground and then extracted using the FastPure Plant Total RNA Isolation Kit (Novagen). RNA samples were reverse transcribed into cDNA using the HiScript IV 1st Strand cDNA Synthesis Kit (with gDNA wiper) (Novagen) and stored at -20°C until use.

[0021] The MsCDPK9 gene was obtained through analysis and screening of alfalfa genome data.

[0022] Design a pair of cloning primers based on the full-length gene sequence:

[0023] The forward primer sequence MsCDPK9F1 was: 5′-ATGGCGAAAGAGAATCCAACTCC-3′;

[0024] The reverse primer sequence for MsCDPK9R1 is: 5′-CTAAAGATAACCATCAATAACTTGATTGGATCC-3′. Using the aforementioned alfalfa cDNA stored at -20°C as a template, PCR amplification was performed using a 50 μL system. The amplification program was as follows: 95°C denaturation for 5 minutes; 95°C denaturation for 15 seconds, 58°C annealing for 15 seconds, and 72°C extension for 60 seconds, for a total of 35 cycles; and a final extension at 72°C for 5 minutes. The PCR amplification product, such as Figure 1 The PCR product, as shown, was consistent with the predicted size. Following gel purification, it was ligated using a 5-min TA / Blunt-Zero Cloning Kit (Novagen) and transformed into E. coli DH5α. Positive clones were selected and sequenced. The results showed that MsCDPK9 contained a 1512 bp open reading frame (ORF) encoding 503 amino acids.

[0025] Example 2

[0026] Bioinformatics Analysis of MsCDPK9 Gene in Medicago sativa

[0027] The amino acid sequence encoded by the MsCDPK9 gene of alfalfa was analyzed for its physicochemical properties such as molecular weight and isoelectric point using the ProtParam online tool of the ExPASy server. The MsCDPK9 gene encodes 503 amino acids, and the results showed that its molecular weight was 56.82 kDa, isoelectric point was 5.16, and instability index was 39.81, indicating a stable protein. The average hydrophilicity value was -0.343, indicating that the protein was a hydrophilic protein. The conserved domain prediction of the protein showed that the MsCDPK9 protein had a PKc_like super-family conserved domain. The transmembrane region and signal peptide of the protein were analyzed using the online tools TMHMM Server v.2.0 and SignalP 5.0server, respectively. The results showed that the MsCDPK9 protein had a transmembrane structure and did not contain a signal peptide. The tertiary structure of the MsCDPK9 protein was predicted by the bioinformatics software Expasy, and the tertiary structure model of the MsCDPK9 protein was constructed using the SWISS MODEL database (such as Figure 2 The cDNA sequences were compared for homology using the BLASTP function on the NCBI website, and the phylogenetic tree of the gene was established using MEGA7.0 software. The phylogenetic tree showed that the gene had the highest homology with the CDPK gene XP_003630428.1 of Medicago truncatula (see Figure 2). Figure 3 shown).

[0028] Example 3

[0029] Functional verification of the alfalfa MsCDPK9 gene in improving salt, cadmium, and lead tolerance in Saccharomyces cerevisiae

[0030] (1) Construction of recombinant vector containing MsCDPK9 gene

[0031] The coding region of MsCDPK9 gene was cloned. The cDNA of alfalfa Zhonglu No. 1 leaf was used as template. Primers were designed according to the coding region of MsCDPK9 and introduced into the homology arms of pYES2 vector.

[0032] MsCDPK9-F:

[0033] 5'- TTAAGCTTGGTACCGAGCTCAA ATGGAGTCAAACAACAACAACATGAAATCAC-3'MsCDPK9-R:

[0034] 5'- GATATCTGCAGAATTC TCAAGTACTAGTTGAAGAAGAAGAAGGACCC-3'

[0035] The underlined letters are the homology arms of the introduced vector.

[0036] The pYES2 plasmid was double-digested with restriction endonucleases BamHⅠ and EcoI, and then the gel was excised and recovered. The purified product of MsCDPK9 with vector homology arms obtained by PCR amplification was homologously recombined using a kit and transformed into Escherichia coli DH5α competent cells. Positive clones were selected, and the plasmids were extracted for sequencing. If the sequencing results were correct, the recombinant vector was obtained and labeled as pYES2-MsCDPK9. Figure 4 shown.

[0037] (2) Transformation of Saccharomyces cerevisiae with the recombinant vector pYES2-MsCDPK9

[0038] The recombinant vector pYES2-MsCDPK9 was transformed into Saccharomyces cerevisiae INVSc1 competent cells using the PEG / LiAc method. The following steps were performed: pre-treat the carrier DNA (95°C for 5 minutes, then quickly insert on ice). To 100 μl of thawed INVSc1 competent cells, 0.5-2 μg of the target plasmid, 10 μl of the pre-treated carrier DNA, and 500 μl of PEG / LiAc were added, mixing thoroughly by pipetting. The cells were incubated at 30°C for 30 minutes (inverting 6-8 times every 15 minutes to mix thoroughly). The cells were then placed in a 42°C waterbath for 15 minutes (inverting 6-8 times every 7.5 minutes to mix thoroughly). The cells were centrifuged at 5000 rpm for 2 minutes, the supernatant discarded, and the cells were resuspended in 100 μl of sterile ddH2O. The cells were plated onto SD-Ura solid medium and incubated upside down at 30°C in the dark for 48-96 hours. Simultaneously, an empty pYES2 vector was transformed into INVSc1 cells as a control, labeled INVSC1(pYES2). Randomly pick a single colony of transformed Saccharomyces cerevisiae (containing the recombinant plasmid pYES2-MsCDPK9) and expand the culture to extract yeast DNA.

[0039] Primer T7: 5'-TAATACGACTCACTATAGGG-3'

[0040] PCR amplification was performed with primer CYC1: 5'-GTGACATAACTAATTACATGATG-3' and detected by 1% agarose gel electrophoresis. Figure 5 As shown, the size of the amplified fragment was consistent with the expectation, indicating that the target gene was successfully transferred into Saccharomyces cerevisiae INVSc1.

[0041] (3) Stress treatment of Saccharomyces cerevisiae

[0042] Monoclonal cells of Saccharomyces cerevisiae (pYES2-MsCDPK9) and Saccharomyces cerevisiae (containing empty pYES2 as a control) were picked up in SD-Ura liquid medium (containing 2% glucose) and cultured at 30°C with shaking at 180 rpm until OD600 = 1.0. The cells were collected by centrifugation, rinsed 3-5 times with deionized water, resuspended to OD600 = 0.6, and transferred to SG-Ura liquid medium containing 2% galactose at a ratio of 1:100. Expression was induced at 30°C for 36 h. The cells were collected by centrifugation, rinsed 3-5 times with deionized water, and Saccharomyces cerevisiae (pYES2-MsCDPK9) and Saccharomyces cerevisiae (pYES2) were resuspended to OD600 = 1.0 and diluted 10 0 , 10 -1 , 10 -2 , 10 -3Then, the plates were dropped onto SD-Ura solid medium containing 100 μmol / L CdCl2, 200 mmol / L NaCl, and 110 μmol / L PB(NO3)2, and the yeast was observed after culturing at 30℃ for 48 h. Figure 6 As shown), salt stress medium (as Figure 7 As shown), lead stress medium (as Figure 8 Through experimental comparison, it was found that the transgenic strain INVSc1-pYES2-MsCDPK9 of Saccharomyces cerevisiae of the present invention had improved ability to resist salt, cadmium and lead stress compared with the control INVSc1-pYES2, indicating that the obtained gene MsCDPK9 is involved in the regulation of resistance to adverse stress, which helps to improve the resistance of Saccharomyces cerevisiae to salt, cadmium and lead stress.

Claims

1. A use of the MsCDPK9 gene to improve the stress resistance of a Saccharomyces cerevisiae strain. The nucleotide sequence of the alfalfa MsCDPK9 encoding gene is shown in SEQ ID NO.

1. The alfalfa MsCDPK9 encoding gene is transferred into the Saccharomyces cerevisiae genome and overexpressed in the transgenic strain, thereby improving the Saccharomyces cerevisiae strain's ability to resist salt, cadmium, and lead stresses.

2. A method for constructing a transgenic strain, characterized in that: The PEG / LiAc method was used to transfer an overexpression recombinant vector pYES2-MsCDPK9 into a Saccharomyces cerevisiae strain. The overexpression recombinant vector pYES2-MsCDPK9 contained the full-length nucleotide sequence of a cDNA encoding the alfalfa MsCDPK9 gene. The nucleotide sequence of the alfalfa MsCDPK9 encoding gene was shown in SEQ ID NO.

1. Transgenic Saccharomyces cerevisiae strains were obtained by screening. Compared with a control, the transgenic Saccharomyces cerevisiae strains had improved resistance to salt, cadmium, and lead stresses.

3. The method for constructing a transgenic strain according to claim 2, characterized in that: The pYES2 plasmid was double-digested with restriction endonucleases BamHI and EcorⅠ, and then the gel was excised and recovered. The purified product of MsCDPK9 with vector homology arms obtained by PCR amplification was homologously recombined using a kit. The primer set for PCR amplification is shown in SEQ ID NO.2 and SEQ ID NO.3.

Images