Application of CHK2 in I-type interferon disease

Abstract

The invention relates to application of CHK2 in I-type interferon disease, and belongs to the field of biotechnology and medicine. The invention discloses a core effect of a target CHK2 in I-type interferon disease occurrence for the first time on the basis of molecular mechanism research on an I-type interferon disease model, and particularly discloses an application of the CHK2 as a treatment target of the I-type interferon disease, an application of the CHK2 as the target in preparation of a medicine for treating the I-type interferon disease, and an application of the CHK2 as the target in preparation of a medicine for treating the I-type interferon disease. The invention also discloses an application of CHK2 as a target spot in preparation of a kit for diagnosing type I interferon diseases. The diagnosis and treatment of the target spot and the application of the medicine provided by the invention are suitable for I-type interferon disease related diseases such as systemic lupus erythematosus (SLE) and AICdi-Goutires syndrome (AGS), and the phenotype of the diseases can be effectively relieved in both a cell model and an animal model.

Description

Technical Field

[0001] The present invention relates to the fields of biotechnology and medical technology, and in particular to the application of CHK2 in type I interferon disease. Background Art

[0002] Type I interferonopathy is a class of autoimmune diseases caused by overactivation of the type I interferon (IFN-α / β) signaling pathway, such as Aicardi-Goutières syndrome (AGS) and systemic lupus erythematosus (SLE) subtypes. Most genes associated with type I interferonopathy are closely related to nucleic acid metabolism or sensing, DNA signaling-mediated innate immune responses, and type I interferon receptor signaling.

[0003] As the primary exonuclease in mammalian cells, TREX1 prevents abnormal activation of the host's innate immune system due to DNA accumulation. In clinical studies, TREX1 mutations have been associated with various autoimmune diseases or type I interferonpathies, and TREX1 knockout mice exhibit a variety of lupus-like phenotypes. Currently, JAK1 / 2 inhibitors are used clinically to treat autoimmune diseases or type I interferonpathies caused by TREX1 mutations. Knockout of either cGAS or STING has been shown to rescue the lethal autoimmune phenotypes of TREX1-deficient and mutant mice, suggesting that the development of small molecule inhibitors targeting cGAS and STING may be an effective strategy for treating autoimmune diseases. To date, several cGAS / STING inhibitors have demonstrated promising therapeutic effects in mouse models of autoimmune diseases, identifying novel drug targets and candidate molecules for further development of autoimmune disease therapies. However, cGAS also plays an important role in cellular senescence, suggesting a link between cellular senescence, inflammation, and autoimmune responses, including the production of autoantibodies.

[0004] Cellular senescence manifests as irreversible cell cycle arrest and loss of proliferative potential. Morphologically, senescent cells are characterized by increased and flattened cell surface area, separation of heterochromatin from the nuclear lamina and relocation to the nuclear interior, accumulation of senescence-associated heterochromatin foci (SAHFs) in the nucleus, and the appearance of cytoplasmic micronuclei within primary nuclear satellites. Molecularly, senescence-associated β-galactosidase (SA-β-Gal) activity increases due to increased acidity in senescent cells. Furthermore, senescent cells express a senescence-associated secretory phenotype (SASP), which involves autocrine or paracrine signaling, leading to changes in the tissue microenvironment. The SASP has been implicated in diverse biological processes, including wound healing, tissue repair, and tumorigenesis, while the SASP-associated inflammatory response is believed to underlie many aging-related effects and diseases. Cellular senescence is accompanied by decreased genomic stability and the entry of damaged DNA fragments into the cytoplasm as micronuclei. The nuclear membrane of these micronuclei is unstable, leading to an increase in cytosolic DNA, activation of the cGAS-STING pathway, and induction of type I interferon and inflammatory cytokine production. Currently available JAK inhibitors in China include tofacitinib, ruxolitinib, and baricitinib. Type I interferonopathy is not an indication for these JAK inhibitors. Therefore, full informed consent is required before use, and approval by the institution's ethics committee is required if necessary. cGAS and STING inhibitors are also expected to be used in the treatment of type I interferonopathy, but clinical validation is still required. Therefore, it is necessary to develop a new strategy for the treatment of type I interferonopathy. Summary of the Invention

[0005] The technical problem to be solved by the present invention is to provide a new target for treating type I interferon disease.

[0006] In order to solve the above technical problems, the technical solution adopted by the present invention is:

[0007] In a first aspect, embodiments of the present invention provide the use of CHK2 as a therapeutic target for type I interferon disease.

[0008] The DNA damage response (DDR) also plays a key role in DNA damage-induced cellular senescence. The DDR pathway is mediated by ataxia telangiectasia mutated (ATM) / ataxia telangiectasia and rad3-related protein (ATR) and checkpoint kinases (CHK1 / CHK2), which stabilize p53 through phosphorylation. P53 activates the cell cycle inhibitor p21, which inhibits Cdk / cyclin, leading to cell cycle arrest at the G1 / S phase. Cdk / cyclin A, D, and E phosphorylate RB, thereby blocking the growth-inhibiting function of the RB pathway. RB is activated by p21 or p16, both of which inhibit Cdk / cyclin. Active, hypophosphorylated RB binds to E2F proteins and inhibits their transcriptional activity, thereby inhibiting cell cycle progression and driving cellular senescence. Therefore, inhibiting the DDR may be a therapeutic approach for type I interferon phenotypes. The present invention screened DDR marker proteins (ATM / ATR, CHK1 / CHK2, P53), and the results showed that Cell Cycle Checkpoint Kinase 2 (CHK2) may be an important target. The present invention provides the use of CHK2 in type I interferon disease and provides a new target for the treatment of type I interferon disease. As a therapeutic target, CHK2 can accurately regulate the type I interferon signaling pathway, thereby effectively inhibiting the excessive activation of type I interferon and reducing the inflammatory response.

[0009] In a second aspect, embodiments of the present invention provide the use of CHK2 as a target in the preparation of a drug for treating type I interferon-dependent diseases. The present invention provides a new direction for drug development, which helps to develop more effective and safer drugs for treating type I interferon-dependent diseases.

[0010] Optionally, the drug is used to inhibit the activity or expression of CHK2.

[0011] Optionally, the drug is one of a small molecule inhibitor, a monoclonal antibody, a siRNA, a shRNA, an antisense oligonucleotide or a gene editing tool.

[0012] Optionally, the drug is a CHK2 inhibitor BML-277. The present invention uses the CHK2 inhibitor BML-277 to treat Trex1 - / - mice and systematically evaluated the effect of BML-277 on Trex1 - / - In contrast, BML-277 treatment was found to partially improve Trex1 - / - Mouse type I interferon phenotype.

[0013] Optionally, the drug is used in combination with an immunosuppressant, a glucocorticoid or a JAK inhibitor.

[0014] In a third aspect, embodiments of the present invention provide a pharmaceutical composition comprising the aforementioned drug and a pharmaceutically acceptable carrier or excipient. By detecting CHK2 expression or activity, the diagnosis of type I interferon-dependent disease can be achieved, improving diagnostic accuracy and providing a rapid and reliable diagnostic tool for clinicians, thereby helping to optimize treatment options.

[0015] The dosage form of the pharmaceutical composition is injection, oral tablet, sustained-release preparation or local external preparation.

[0016] Fourthly, embodiments of the present invention provide the use of CHK2 as a target in the preparation of a kit for diagnosing type I interferon-induced diseases. This provides a new and groundbreaking method for the treatment of type I interferon-induced diseases and is expected to become an important means of treating such diseases in the future.

[0017] Optionally, the kit includes a tool for detecting the expression level or activity of CHK2.

[0018] In a fifth aspect, an embodiment of the present invention provides the use of a gene editing system for targeted modification of the CHK2 gene in the preparation of a drug for treating type I interferon disease.

[0019] Optionally, the gene editing system targets and modifies the CHK2 gene to regulate the type I interferon signaling pathway.

[0020] Alternatively, CRISPR-Cas9 technology can be used to construct Chk2 - / - Trex1 - / - The present invention constructed Chk2 by CRISPR-Cas9 technology - / - Trex1 - / - It was found that knockout of the Chk2 gene significantly improved Trex1 - / - Mouse type I interferon phenotype.

[0021] The type I interferon diseases referred to in the present invention are systemic lupus erythematosus, Aicardi-Goutières syndrome (AGS), Sjögren's syndrome or stimulator of interferon genes (STING)-associated infantile onset vasculopathy (SAVI). BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 It is a theoretical mechanism diagram of the present invention;

[0023] Figure 2 A is the candidate target for inhibiting the DDR pathway and the corresponding inhibitor of the present invention; Figure 2 B–G are the cytotoxicity of candidate DDR pathway target inhibitors; Figure 2 H-J are Trex1 treated with DDR pathway candidate target inhibitors - / -The expression levels of representative ISGs in MEFs cells;

[0024] Figure 3 A to B are the CHK2 inhibitors of the present invention for the treatment of Trex1 - / - Body shape and weight of mice; Figure 3 C to D are the treatments of Trex1 with CHK2 inhibitors of the present invention. - / - Spleen size and mass of mice; Figure 3 E is the treatment of Trex1 with the CHK2 inhibitor of the present invention - / - heart, kidney, lung, and muscle pathology in mice; Figure 3 F to I are the CHK2 inhibitors of the present invention for the treatment of Trex1 - / - Effects of autoantibody therapy in mice;

[0025] Figure 4 A~B are WT, Trex1 of the present invention - / - 、Chk2 - / - 、Trex1 - / - Chk2 + / - 、Trex1 - / - Chk2 - / - Body shape and weight of five genetic mice; Figure 4 C is the survival rate of the five genotype mice mentioned above; Figure 4 D to E show the spleen size and mass of the five genotype mice mentioned above; Figure 4 F is the immune complex Ig-M status of the kidneys of the five genotype mice mentioned above; Figure 4 G~H are the pathological conditions and histological scores of the heart, kidney, liver, non-skin and skin of the five genotype mice mentioned above; Figure 4 I to J are PMSA staining and histological scores of the kidneys of the five genotype mice mentioned above;

[0026] Figure 5 A~B are WT, Trex1 of the present invention - / - 、Chk2 - / - 、Trex1 - / - Chk2 + / - 、Trex1 - / - Chk2 - / - CD4 in spleen of five genetic mice + CD69 + Representative flow cytometry plots and statistical results of T cells; Figure 5 C to D are the five genotypes of mouse CD8 + CD69 + Representative flow cytometry plots and statistical results of T cells; Figure 5 E to F are the five genotypes of mouse CD8+ Ly6c + Representative flow cytometry plots and statistical results of T cells; Figure 5 G to H are the five genotypes of mouse CD8 + CD44 hi CD62L lo Representative flow cytometry plots and statistical results of T cells. DETAILED DESCRIPTION

[0027] To better understand the above technical solutions, exemplary embodiments of the present invention will be described in more detail below with reference to the accompanying drawings. Although exemplary embodiments of the present invention are shown in the accompanying drawings, it should be understood that the present invention can be implemented in various forms and should not be limited by the embodiments described herein. Instead, these embodiments are provided to enable a clearer and more thorough understanding of the present invention and to fully convey the scope of the present invention to those skilled in the art.

[0028] Unless otherwise specified, the equipment, materials, and reagents used in the embodiments of the present invention can be purchased from the market.

[0029] Example 1: By inhibiting Trex1 - / - The expression of ISG in MEFs was used to screen suitable targets for DDR pathway

[0030] The key genes of DDR pathway are ATM / ATR, CHK2 and p53 ( Figure 2 A). Inhibitors of DDR pathway targets KU-60019 (ATM), VE-821 (ATR), Rabusertib (CHK1), BML-277 (CHK2), Pifithrin-α (p53) and Pifithrin-μ (p53) ( Figure 2 A).

[0031] The cytotoxicity of the above inhibitors was determined using CCK-8. KU-60019 (ATM inhibitor, IC50 see Figure 2 B); VE-821 (ATM / ATR inhibitor, IC50 see Figure 2 C); BML-277 (CHK2 inhibitor, IC50 see Figure 2 D); Rabusertib (CHK1 inhibitor, IC50 see Figure 2 E); p53 inhibitor Pifithrin-α (IC50 see Figure 2 F); Pifithrin-μ (IC50 see Figure 2 G) Select appropriate drug concentration to treat Trex1 - / -MEFs were treated for 24 hours and the changes of ISGs were detected by RT-qPCR. The results showed that KU-60019 and VE-821 did not reduce but increased

[0032] Trex1 - / - ISG expression in MEFs Figure 2 H) p53 inhibitors Pifithrin-α and Pifithrin-μ treat Trex1 - / - MEFs also increased the expression of ISGs ( Figure 2 J) Trex1 was regulated using BML-277 (a CHK2 inhibitor) and Rabusertib (a CHK1 inhibitor) (a selective inhibitor of CHK2). - / - The expression of ISGs in MEFs showed a downward trend, but no significant difference was found ( Figure 2 I). Although BML-277 processes Trex1 - / - The trend of decreased cellular ISGs levels was not significant. Considering the differences between the cellular level and the animal level, the animal level is a systemic organism, and the tissue microenvironment plays an important role in disease development. Therefore, CHK2 may be a promising inhibitory DDR pathway to rescue Trex1. - / - targets a lupus-like phenotype in mice without affecting DNA repair processes.

[0033] Example 2: Evaluation of Trex1 treated with BML-277 - / - Characterization of type I interferonopathy in mice

[0034] We evaluated whether inhibition of the DDR (specifically, inhibition of CHK2 in the DDR pathway) could alleviate the development of type I interferonopathy or lupus-like disease. - / - Mice were intraperitoneally injected with 1 mg / kg BML-277 or solvent (5% DMSO, 10% PEG300, 2.5% Tween-80 in PBS) as a control daily for 4 consecutive weeks.

[0035] Data showed that BML-277 treatment of Trex1 - / - The mice gained size, had shiny fur and improved weight ( Figure 3 A, B). The size and weight of the spleen were also significantly reduced compared to the untreated control group ( Figure 3 C, D). Meanwhile, BML-277 treatment significantly reduced the expression of Trex1 - / - Inflammation in multiple organs in mice (including heart, kidney, lung, and muscle) ( Figure 3 E) High detection rate and high level of autoantibodies are important hallmarks of type I interferonopathy. Therefore, we tested the expression of Trex1 after BML-277 treatment.- / - Mouse autoantibody status ( Figure 3 FI). The results showed that BML-277 treatment significantly reduced multiple autoantibodies, including anti-dsDNA IgG1 ( Figure 3 F), anti-ssDNA IgG ( Figure 3 G), anti-ANA Total Ig ( Figure 3 H), anti-nRNP IgG ( Figure 3 I). These data indicate that inhibiting DDR-induced cellular senescence can significantly alleviate the lupus-like phenotype induced by Trex1 deficiency in mice.

[0036] Example 3: Study whether Trex1 is involved in cell senescence induced by activation of the DDR pathway - / - Lupus-like disease in mice

[0037] Chk2 gene knockout mice were constructed using CRISPR-Cas9 technology (see Table 1 for sgRNA sequences used in the CRISPR-Cas9 system). - / - Mice were caged and Chk2 was successfully obtained. - / - Trex1 - / - Double knockout mice. First, we recorded the expression of WT and Trex1 - / - 、Chk2 - / - 、Trex1 - / - Chk2 + / - 、Trex1 - / - Chk2 - / - The body sizes of the five genetically modified mice ( Figure 4 A) and weight status ( Figure 4 B) The results showed that Chk2 gene knockout can significantly improve the thinness and weight of Trex1- / - mice. The survival rate of mice was also greatly improved, making Trex1 - / - The median survival time of mice increased from three months to seven months ( Figure 4 C). The spleen size and weight of mice were also significantly improved ( Figure 4 D, E) Immunofluorescence was used to further evaluate the expression of Trex1 in Chk2 knockout patients. - / - The deposition of immune complex Ig-M in mouse kidneys. In contrast, Chk2 gene knockout significantly improved the deposition of immune complex Ig-M ( Figure 4 F) Same as Trex1 - / - Chk2 - / - Mouse HE ( Figure 4 G, H) and PASM ( Figure 4 I, L) pathological conditions were further confirmed. - / - CD4 of the mouse immune system +CD69 + T cells ( Figure 5 A, B), CD8 + CD69 + T cells ( Figure 5 C, D), CD8 + Ly6c + T( Figure 5 E, F), CD8 + CD44 hi CD62L lo T cells ( Figure 5 G, H) Abnormal activation is also alleviated by Chk2 gene knockout. The above results show that the loss of Chk2 gene effectively alleviates Trex1 - / - Type I interferon phenotype in mice.

[0038] Table 1

[0039] name Primer sequences m-sg1-CHK2-F GAGGAAGACATGTCAGAAAG m-sg1-CHK2-R CTTTCTGACATGTCTTCCTC m-sg2-CHK2-F GGAAGATTATTACATTGTTC m-sg2-CHK2-R GAACAATGTAATAATCTTCC m-sg3-CHK2-F CCTGTAAGCTCTACTTCTAC m-sg3-CHK2-R GTAGAAGTAGAGCTTACAGG m-sg4-CHK2-F GAACTATTTGACCGGGTGGT m-sg4-CHK2-R ACCACCCGGTCAAATAGTTC m-sg5-CHK2-F GAATGTTCTTTTATCATCTC m-sg5-CHK2-R GAGATGATAAAAGAACATTC

[0040] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the above embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the above embodiments, or replace some or all of the technical features therein with equivalents. However, these modifications or replacements do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. Application of CHK2 as a therapeutic target for type I interferon-dependent diseases.

2. Application of CHK2 as a target in the preparation of drugs for the treatment of type I interferon disease.

3. The use according to claim 2, characterized in that: The drug is used for inhibiting the activity or expression of CHK2.

4. The use according to claim 3, characterized in that: The drug is one of a small molecule inhibitor, a monoclonal antibody, a siRNA, a shRNA, an antisense oligonucleotide or a gene editing tool.

5. The use according to claim 3, characterized in that: The drug is used in combination with an immunosuppressant, a glucocorticoid or a JAK inhibitor.

6. Application of CHK2 as a target in the preparation of a kit for diagnosing type I interferon disease.

7. The use according to claim 6, characterized in that: The kit includes means for detecting CHK2 expression level or activity.

8. Application of a gene editing system for targeted modification of the CHK2 gene in the preparation of drugs for the treatment of type I interferon-dependent disease.

9. The use according to claim 8, characterized in that: The gene editing system targets and modifies the CHK2 gene to regulate the type I interferon signaling pathway.

10. The use according to claim 1, 2, 6 or 8, characterized in that: The type I interferon disease is systemic lupus erythematosus, Aicardi-Goutières syndrome, Sjögren's syndrome or interferon gene stimulator-related infantile vascular disease.

Images