Double-stranded ribonucleic acid for inhibiting expression of ANGPTL4 gene as well as modifier, conjugate and application of double-stranded ribonucleic acid
By designing double-stranded RNA and its modifications and conjugates, the ANGPTL4 gene transcript is specifically cut, which solves the problem of lack of ANGPTL4 inhibitors in the existing technology and achieves the effect of highly effective treatment of ANGPTL4-related diseases.
Patent Information
- Application Number
- CN202510533945.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Priority Date
- 2025-03-11
- Filing Date
- 2025-04-25
- Publication Date
- 2025-09-12
AI Technical Summary
The existing technology lacks effective ANGPTL4 inhibitors and cannot effectively treat ANGPTL4-related diseases such as breast cancer, hepatitis C, glucose metabolism disorders, lipid metabolism disorders, vascular dysfunction, cardiovascular and cerebrovascular diseases, etc.
Develop double-stranded RNA, double-stranded RNA modifications, double-stranded RNA conjugates and prodrugs that form complementary structures with target sequences, bind to RNA-induced silencing complexes, specifically cut the transcripts of the ANGPTL4 gene, and inhibit its expression.
It achieves efficient and specific inhibition of ANGPTL4 gene expression for the treatment of related diseases, improves the therapeutic effect, reduces the impact on non-target tissues, and enhances safety and stability.
Smart Images

Figure BDA0005378862670000061 
Figure BDA0005378862670000071 
Figure BDA0005378862670000081
Abstract
Description
Technical Field
[0001] The present disclosure belongs to the field of biomedicine. Specifically, the present disclosure relates to a double-stranded RNA, a double-stranded RNA modification, a double-stranded RNA conjugate, a prodrug, a pharmaceutical composition and uses for inhibiting ANGPTL4 gene expression, and a method for inhibiting ANGPTL4 gene expression in cells. Background Art
[0002] Angiopoietin-like protein 4 (ANGPTL4), also known as ANGPL4, ARP4, FIAF, HARP, PGAR, HFARP, TGQTL, etc., belongs to the angiopoietin-like protein family. Its structure is similar to that of the angiopoietins (ANGPTs) and plays a role in a wide range of biological functions, including the regulation of lipid and glucose metabolism, hematopoietic stem cell expansion, chronic inflammation, angiogenesis, and vascular permeability. ANGPTL4 is a glycoprotein (≈45-65 kDa) secreted by various cell types, such as adipocytes, hepatocytes, myocytes, macrophages, endothelial cells, and enterocytes. ANGPTL4 is highly expressed in adipose tissue and liver of humans and mice, and is expressed to a lower extent in heart, muscle, kidney, skin, and other tissues.
[0003] Since its discovery, ANGPTL4 has been extensively studied, with reported involvement in a variety of physiological and pathological conditions, including energy homeostasis, tumorigenesis, angiogenesis, wound healing, and redox regulation. One of the most widely studied roles of ANGPTL4 is its role in lipid metabolism, particularly as a potent inhibitor of lipoprotein lipase (LPL), which regulates LPL activity to inhibit the clearance of triglycerides (TG) from the circulation. In this regard, loss of ANGPTL4 expression reduces circulating TG, while its overexpression increases TG levels. Through this regulatory mechanism, ANGPTL4 may contribute to protecting cells from lipotoxicity by reducing extracellular TG hydrolysis and subsequent fatty acid uptake.
[0004] Carriers of loss-of-function (LOF) variants in ANGPTL4 have lower plasma triglycerides and higher plasma HDL-C levels than non-carriers. The most common genetic variant is E40K, which results in the production of an unstable ANGPTL4 protein. The frequency of heterozygous individuals ranges from 0.1% in African Americans to 18% reported in the Tunisian population. E40K carrier status was found to be associated with a significantly reduced risk of coronary artery disease, suggesting that inactivation of ANGPTL4 may be a viable pharmacological strategy to improve plasma lipid levels and reduce the risk of coronary artery disease.
[0005] Treatments for ANGPTL4-related diseases are limited, and new treatments are needed. The present invention aims to provide double-stranded RNAs and their modifications, double-stranded RNA conjugates, prodrugs, pharmaceutical compositions, and uses for inhibiting ANGPTL4 gene expression, as well as methods for inhibiting ANGPTL4 gene expression in cells, which can affect the RNA-induced silencing complex (RISC)-mediated cleavage of ANGPTL4 gene RNA transcripts, thereby selectively and effectively inhibiting ANGPTL4 gene expression and achieving the purpose of disease treatment. Summary of the Invention
[0006] Problems to be solved by the invention
[0007] Given the problems existing in the prior art, there is a need to develop more ANGPTL4 inhibitors for the treatment of ANGPTL4-related diseases, including breast cancer, hepatitis C, glucose metabolism disorders (including but not limited to one or more of diabetes, fructose metabolism disorders, and glycogen storage diseases), lipid metabolism disorders, vascular dysfunction, cardiovascular and cerebrovascular diseases (including but not limited to coronary heart disease), kidney disease, inflammatory diseases, and other unidentified related conditions, pathologies, or syndromes. The present disclosure aims to provide a series of double-stranded RNAs, double-stranded RNA modifications, double-stranded RNA conjugates, prodrugs, and pharmaceutical compositions for inhibiting ANGPTL4 gene expression, which are capable of inhibiting ANGPTL4 gene expression and have important application prospects in the treatment of clinical diseases.
[0008] Solutions for solving problems
[0009] [1] A double-stranded RNA for inhibiting ANGPTL4 gene expression, the double-stranded RNA comprising a sense strand and an antisense strand, wherein the sense strand and the antisense strand are reverse complementary and / or substantially reverse complementary to form a double-stranded region of the double-stranded RNA;
[0010] wherein the sense strand comprises a sequence A that differs by no more than 3 nucleotides from at least 15 consecutive nucleotides in the target sequence, and the antisense strand comprises a sequence B that differs by no more than 3 nucleotides from the reverse complementary sequence of at least 15 consecutive nucleotides in the target sequence;
[0011] The target sequence is selected from the nucleotide sequence shown in any one of SEQ ID NOs: 1 to 5 and a sequence consisting of at least 15 consecutive nucleotides contained in any one of SEQ ID NOs: 1 to 5.
[0012] [2] The double-stranded RNA according to [1], wherein the target sequence is selected from the nucleotide sequence shown in any one of SEQ ID NOs: 1, 4 to 11, the sense strand comprises a sequence A consisting of at least 15 consecutive nucleotides in the nucleotide sequence shown in any one of SEQ ID NOs: 1, 4 to 11, and the antisense strand comprises a sequence B that is reverse complementary and / or substantially reverse complementary to a sequence consisting of at least 15 consecutive nucleotides in the nucleotide sequence shown in any one of SEQ ID NOs: 1, 4 to 11.
[0013] [3] The double-stranded ribonucleic acid according to [1] or [2], wherein the sense strand consists of 15-28 nucleotides, preferably 19-25 nucleotides, more preferably 19-23 nucleotides, and more preferably 19, 21 or 23 nucleotides.
[0014] [4]. The double-stranded RNA according to [3], wherein the nucleotide sequence of the sense strand is a sequence A that differs by no more than 1 nucleotide from a sequence consisting of 15-28 consecutive nucleotides in the nucleotide sequence of any one of SEQ ID NOs: 1, 4 to 11, preferably 19-25 consecutive nucleotides, more preferably 19-23 consecutive nucleotides, and more preferably 19, 21 or 23 nucleotides.
[0015] [5] The double-stranded ribonucleic acid according to any one of [1] to [4], wherein the antisense strand consists of 15-28 nucleotides, preferably 19-25 nucleotides, more preferably 19-23 nucleotides, and more preferably 19, 21 or 23 nucleotides.
[0016] [6]. The double-stranded ribonucleic acid according to any one of [1] to [5], wherein the nucleotide sequence of the antisense strand is a sequence B that differs by no more than 1 nucleotide from the reverse complementary sequence of a sequence consisting of 15-28 consecutive nucleotides in the nucleotide sequence of any one of SEQ ID NOs: 1, 4 to 11, preferably 19-25 consecutive nucleotides, more preferably 19-23 consecutive nucleotides, and more preferably 19, 21 or 23 nucleotides.
[0017] [7] The double-stranded ribonucleic acid according to any one of [1] to [6], wherein the length of the double-stranded region is 15-25 nucleotides, preferably 19-23 nucleotides, and more preferably 19, 21 or 23 nucleotides.
[0018] [8] The double-stranded ribonucleic acid according to any one of [1] to [7], wherein
[0019] The sense strand and the antisense strand complement each other to form the double-stranded region, and the 3' end of the sense strand has 1-2 protruding nucleotides extending out of the double-stranded region, and the 3' end of the antisense strand forms a blunt end; or,
[0020] The sense strand and the antisense strand complement each other to form the double-stranded region, and the 3' end of the antisense strand has 1-2 protruding nucleotides extending out of the double-stranded region, and the 3' end of the sense strand forms a blunt end; or,
[0021] The sense strand and the antisense strand complement each other to form the double-stranded region, and the 3' ends of the sense strand and the antisense strand each have 1-2 protruding nucleotides extending out of the double-stranded region; or,
[0022] The sense strand and the antisense strand complement each other to form the double-stranded region, and the 3' ends of the sense strand and the antisense strand both form blunt ends.
[0023] [9] The double-stranded RNA according to any one of [1] to [8], wherein the sense strand comprises the sense strand of any one of the siRNAs shown in Table 1 and Table 1-1 herein, and the antisense strand comprises the antisense strand of the corresponding siRNA;
[0024] Preferably, the sense strand comprises the sense strand of any one of siRNA 24, siRNA 44, siRNA45, siRNA144 to siRNA146, or siRNA202 to siRNA204 shown in Table 1 and Table 1-1 herein, and the antisense strand comprises the antisense strand of the corresponding siRNA.
[0025]
[10] . The double-stranded ribonucleic acid according to any one of [1] to [9], wherein each nucleotide in the sense strand is independently a modified nucleotide or an unmodified nucleotide, and / or each nucleotide in the antisense strand is independently a modified nucleotide or an unmodified nucleotide.
[0026]
[11] . The double-stranded ribonucleic acid according to any one of [1] to
[10] , wherein any two nucleotides connected in the sense strand are connected by a phosphodiester bond or a phosphorothioate diester bond, and / or any two nucleotides connected in the antisense strand are connected by a phosphodiester bond or a phosphorothioate diester bond.
[0027]
[12] The double-stranded ribonucleic acid according to any one of [1] to
[11] , wherein the 5' terminal nucleotide of the antisense strand is linked to a 5' phosphate group or a 5' phosphate derivative group, or the 5' terminal nucleotide of the antisense strand is not linked to a 5' phosphate group or a 5' phosphate derivative group.
[0028]
[13] . The double-stranded RNA according to any one of [1] to
[12] , wherein neither the 5' end nor the 3' end of the sense strand is linked (invAb), or only the 5' end of the sense strand is linked (invAb), or only the 3' end of the sense strand is linked (invAb), or each of the 5' end and 3' end of the sense strand is linked (invAb).
[0029]
[14] The double-stranded ribonucleic acid according to any one of [1] to
[13] , wherein the double-stranded ribonucleic acid is siRNA for inhibiting ANGPTL4 gene expression.
[0030]
[15] A modified double-stranded RNA, which is a modified double-stranded RNA as described in any one of [1] to
[14] , wherein the modified double-stranded RNA comprises at least one of the following chemical modifications:
[0031] (1) modification of at least one nucleotide in the sense strand,
[0032] (2) modification of the phosphodiester bond at at least one position in the sense strand,
[0033] (3) modification of at least one nucleotide in the antisense strand,
[0034] (4) modification of the phosphodiester bond at at least one position in the antisense strand;
[0035] Optionally, the 3' end of sequence A in the sense strand of the double-stranded RNA is linked to a sequence D consisting of 1-2 nucleotides, preferably a sequence D consisting of 1-2 thymidine deoxyribonucleotides; and / or, the 3' end of sequence B in the antisense strand of the double-stranded RNA is linked to a sequence E consisting of 1-2 nucleotides, preferably a sequence E consisting of 1-2 thymidine deoxyribonucleotides; and / or, the 3' end of sequence A in the sense strand of the double-stranded RNA is excluding 1-2 nucleotides to form sequence A';
[0036] Optionally, the sense strand and antisense strand of the double-stranded RNA modification are selected from the following sequence combinations:
[0037] The nucleotide sequence of the sense strand is the sequence shown in Sequence A, and the nucleotide sequence of the antisense strand is the sequence shown in Sequence B;
[0038] Alternatively, the nucleotide sequence of the sense strand is the sequence shown in sequence A, and the nucleotide sequence of the antisense strand is the sequence shown in sequence B connected to sequence E;
[0039] Alternatively, the nucleotide sequence of the sense strand is the sequence shown in sequence A connected to sequence D, and the nucleotide sequence of the antisense strand is the sequence shown in sequence B;
[0040] Alternatively, the nucleotide sequence of the sense strand is the sequence shown in sequence A connected to sequence D, and the nucleotide sequence of the antisense strand is the sequence shown in sequence B connected to sequence E;
[0041] Alternatively, the nucleotide sequence of the sense strand is the sequence shown in sequence A', and the nucleotide sequence of the antisense strand is the sequence shown in sequence B;
[0042] Alternatively, the nucleotide sequence of the sense strand is the sequence shown in sequence A', and the nucleotide sequence of the antisense strand is the sequence shown in sequence B connected to sequence E.
[0043]
[16] The double-stranded RNA modified substance according to
[15] , wherein the modification of the nucleotide is selected from 2'-fluoro modification, 2'-alkoxy modification, 2'-substituted alkoxy modification, 2'-alkyl modification, 2'-substituted alkyl modification, 2'-deoxy modification, nucleotide derivative modification, or a combination of any two or more thereof;
[0044] Preferably, the modification of the nucleotide is selected from 2'-F modification, 2'-O-CH3 modification, 2'-O-CH2-CH2-O-CH3 modification, 2'-O-CH2-CH=CH2 modification, 2'-CH2-CH2-CH=CH2 modification, 2'-deoxy modification, nucleotide derivative modification or a combination of any two or more thereof.
[0045]
[17] . The double-stranded RNA modification according to
[16] , wherein the nucleotide derivative in the nucleotide derivative modification is selected from isonucleotides, LNA, ENA, cET, UNA or GNA.
[0046]
[18] The double-stranded ribonucleic acid modified substance according to any one of
[15] to
[17] , wherein, in the direction from the 5' end to the 3' end, the ribonucleotides at positions 7, 9, 10 and 11 in the sense strand are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions in the sense strand are 2'-O-CH3 modified ribonucleotides;
[0047] Alternatively, from the 5' end to the 3' end, the 7th, 9th, 10th and 11th ribonucleotides in the sense strand are 2'-F modified ribonucleotides, the remaining ribonucleotides in the sense strand are 2'-O-CH3 modified ribonucleotides, and the overhang at the 3' end is removed;
[0048] Alternatively, along the 5' end to the 3' end, the ribonucleotides at positions 5, 7, 8, and 9 in the sense strand are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions in the sense strand are 2'-O-CH3 modified ribonucleotides;
[0049] Alternatively, along the 3' end to the 5' end, the 9th, 10th, 11th and 13th ribonucleotides in the sense strand are 2'-F modified ribonucleotides, and the ribonucleotides in the remaining positions in the sense strand are 2'-O-CH3 modified ribonucleotides;
[0050] Alternatively, along the 3' end to the 5' end, the ribonucleotides at positions 11, 12, 13, and 17 in the sense strand are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions in the sense strand are 2'-O-CH3 modified ribonucleotides;
[0051] Alternatively, along the 3' end to the 5' end, the 9th, 11th, 13th and 17th ribonucleotides in the sense strand are 2'-F modified ribonucleotides, and the remaining ribonucleotides in the sense strand are 2'-O-CH3 modified ribonucleotides;
[0052] Alternatively, from the 3' end to the 5' end, the ribonucleotides at positions 6, 11 and 13 in the sense strand are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions in the sense strand are 2'-O-CH3 modified ribonucleotides.
[0053]
[19] The double-stranded RNA modified substance according to any one of
[15] to
[18] , wherein when neither the 5' end nor the 3' end of the sense strand is linked (invAb), the sense strand comprises a phosphorothioate diester bond located at the following position along the 5' end toward the 3' end:
[0054] Between the first and second nucleotides starting from the 5' end of the sense strand;
[0055] Between the second and third nucleotides starting from the 5' end of the sense strand;
[0056] Between the first and second nucleotides starting from the 3' end of the sense strand;
[0057] Between the second and third nucleotides starting from the 3' end of the sense strand;
[0058] or,
[0059] The sense strand contains phosphorothioate diester bonds located at the following positions:
[0060] Between the first and second nucleotides starting from the 5' end of the sense strand;
[0061] Between the second and third nucleotides starting from the 5' end of the sense strand;
[0062] When only one (invAb) is attached to the 5' end of the sense strand, the sense strand comprises phosphorothioate diester bonds at the following positions, moving from the 5' end to the 3' end:
[0063] Between the 5' end (invAb) and the first nucleotide starting from the 5' end of the sense strand;
[0064] Between the first and second nucleotides starting from the 5' end of the sense strand;
[0065] When only one (invAb) is attached to the 3' end of the sense strand, the sense strand contains phosphorothioate diester bonds at the following positions, moving from the 5' end to the 3' end:
[0066] Between the first and second nucleotides starting from the 5' end of the sense strand;
[0067] Between the second and third nucleotides starting from the 5' end of the sense strand;
[0068] Between the 3' end (invAb) of the sense strand and the first nucleotide starting from the 3' end;
[0069] When the 5' end and the 3' end of the sense strand are each linked to one (invAb), the sense strand comprises phosphorothioate diester bonds at the following positions along the 5' end to the 3' end:
[0070] Between the 5' end (invAb) and the first nucleotide starting from the 5' end of the sense strand;
[0071] Between the first and second nucleotides starting from the 5' end of the sense strand;
[0072] Between the 3' end (invAb) and the first nucleotide from the 3' end of the sense strand.
[0073]
[20] The double-stranded ribonucleic acid modified substance according to any one of
[15] to
[19] , wherein, in the direction from the 5' end to the 3' end, the ribonucleotides at positions 2, 6, 14 and 16 in the antisense strand are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions in the antisense strand are 2'-O-CH3 modified ribonucleotides;
[0074] Alternatively, along the 5' end to the 3' end, the ribonucleotides at positions 2, 6, 8, 9, 14 and 16 in the antisense strand are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions in the antisense strand are 2'-O-CH3 modified ribonucleotides;
[0075] Alternatively, from the 5' end to the 3' end, the ribonucleotides at positions 2, 6, 14, and 16 in the antisense strand are 2'-F modified ribonucleotides, the ribonucleotide at position 7 in the antisense strand is a ribonucleotide modified with the nucleotide derivative GNA, and the ribonucleotides at the remaining positions in the antisense strand are 2'-O-CH3 modified ribonucleotides;
[0076] Alternatively, along the 5' end to the 3' end, the ribonucleotides at positions 2, 14, and 16 in the antisense strand are 2'-F modified ribonucleotides, the ribonucleotide at position 6 in the antisense strand is a ribonucleotide modified with the nucleotide derivative GNA, and the ribonucleotides at the remaining positions in the antisense strand are 2'-O-CH3 modified ribonucleotides;
[0077] Alternatively, along the 5' end to the 3' end, the ribonucleotides at positions 2, 5, 7 and 14 in the antisense strand are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions in the antisense strand are 2'-O-CH3 modified ribonucleotides;
[0078] Alternatively, along the 5' end to the 3' end, the ribonucleotides at positions 2, 7, 10 and 14 in the antisense strand are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions in the antisense strand are 2'-O-CH3 modified ribonucleotides;
[0079] Alternatively, from the 5' end to the 3' end, the ribonucleotides at positions 2, 7, and 14 in the antisense strand are 2'-F modified ribonucleotides, the ribonucleotides at positions 5 and 12 in the antisense strand are replaced with 2'-deoxyribonucleotides, and the ribonucleotides at the remaining positions in the antisense strand are 2'-O-CH3 modified ribonucleotides;
[0080] Alternatively, along the 5' end to the 3' end, the ribonucleotides at positions 2, 3, 5, 7, 10, 12 and 14 in the antisense chain are 2'-F modified ribonucleotides, the ribonucleotide at position 6 in the antisense chain is a ribonucleotide modified with the nucleotide derivative GNA, and the ribonucleotides at the remaining positions in the antisense chain are 2'-O-CH3 modified ribonucleotides.
[0081]
[21] The double-stranded RNA modification according to any one of
[15] to
[20] , wherein, in the direction from the 5' end to the 3' end, the nucleotide at the 5' end of the antisense strand is linked to a 5' phosphate group or a 5' phosphate derivative group, or the nucleotide at the 5' end of the antisense strand is not linked to a 5' phosphate group or a 5' phosphate derivative group.
[0082]
[22] The double-stranded RNA modified substance according to any one of
[15] to
[21] , wherein the antisense strand comprises a phosphorothioate diester bond located at the following position:
[0083] Between the first and second nucleotides starting from the 5' end of the antisense strand;
[0084] between the second and third nucleotides starting from the 5' end of the antisense strand;
[0085] between the first and second nucleotides starting from the 3' end of the antisense strand;
[0086] between the second and third nucleotides starting from the 3' end of the antisense strand.
[0087]
[23] The double-stranded RNA modified substance according to any one of
[15] to
[22] , wherein the double-stranded RNA modified substance is a siRNA modified substance for inhibiting ANGPTL4 gene expression.
[0088]
[24] The double-stranded RNA modified substance according to any one of
[15] to
[23] , wherein the sense strand comprises the sense strand of any one of the siRNA modified substances shown in Table 2 herein, and the antisense strand comprises the antisense strand of the corresponding siRNA modified substance;
[0089] Preferably, the sense strand comprises the sense strand of any one of the siRNA modifications siRNA 154, siRNA 162, or siRNA 171 shown in Table 2 herein, and the antisense strand comprises the antisense strand of the corresponding siRNA modification.
[0090]
[25] . A double-stranded RNA conjugate or a prodrug thereof, wherein the double-stranded RNA conjugate comprises the double-stranded RNA as described in any one of [1]-
[14] , or the double-stranded RNA modification as described in any one of
[15] -
[24] ; and a conjugated group conjugated to the double-stranded RNA or the double-stranded RNA modification.
[0091]
[26] The double-stranded RNA conjugate or its prodrug according to
[25] , wherein the conjugated group has the following structure:
[0092]
[0093]
[0094]
[27] The double-stranded RNA conjugate or its prodrug according to
[25] or
[26] , wherein the conjugated group is connected to the 3' end of the sense strand.
[0095]
[28] The double-stranded RNA conjugate or its prodrug according to
[27] , wherein the conjugated group is conjugated to the 3' end of the sense strand via a phosphodiester bond;
[0096] Preferably, the sense strand and the antisense strand of the double-stranded RNA conjugate are complementary to each other to form a double-stranded region of the double-stranded RNA conjugate, and the 3' end of the sense strand forms a blunt end, and the 3' end of the antisense strand has 1-2 protruding nucleotides extending out of the double-stranded region;
[0097] or,
[0098] The sense strand and antisense strand of the double-stranded RNA conjugate are complementary to each other to form a double-stranded region of the double-stranded RNA conjugate, and the 3' end of the sense strand forms a blunt end, and the 3' end of the antisense strand forms a blunt end.
[0099]
[29] The double-stranded RNA conjugate or a prodrug thereof according to any one of
[25] to
[28] , wherein the double-stranded RNA conjugate has the following structure:
[0100]
[0101] The double helix structure is double-stranded RNA or a modified double-stranded RNA.
[0102]
[30] The double-stranded ribonucleic acid conjugate or a prodrug thereof according to any one of
[25] to
[29] , wherein the double-stranded ribonucleic acid conjugate is an siRNA conjugate for inhibiting ANGPTL4 gene expression.
[0103]
[31] The double-stranded RNA conjugate or its prodrug according to any one of
[25] to
[30] , wherein the double-stranded RNA conjugate is formed by linking any one of the siRNAs shown in Table 1 and Table 1-1 with a conjugation group, or the double-stranded RNA conjugate is formed by linking any one of the siRNA modifications shown in Table 2 with a conjugation group;
[0104] Preferably, in the double-stranded ribonucleic acid conjugate, the sense strand comprises the sense strand of any one of the siRNA conjugates shown in Table 3 herein, and the antisense strand comprises the antisense strand of the corresponding siRNA conjugate;
[0105] More preferably, the sense strand comprises the sense strand of any one of the siRNA conjugates siRNA 181, siRNA 189, or siRNA 198 shown in Table 3 herein, and the antisense strand comprises the antisense strand of the corresponding siRNA conjugate.
[0106]
[32] . A pharmaceutical composition, wherein the pharmaceutical composition comprises at least one of the following: a double-stranded ribonucleic acid as described in any one of [1]-
[14] , a double-stranded ribonucleic acid modification as described in any one of
[15] -
[24] , a double-stranded ribonucleic acid conjugate as described in any one of
[25] -
[31] or a prodrug thereof.
[0107]
[33] The pharmaceutical composition according to
[32] , wherein the pharmaceutical composition further comprises one or more pharmaceutically acceptable carriers.
[0108]
[34] Use of the double-stranded RNA according to any one of [1] to
[14] , the double-stranded RNA modified product according to any one of
[15] to
[24] , the double-stranded RNA conjugate or a prodrug thereof according to any one of
[25] to
[31] , or the pharmaceutical composition according to any one of
[32] to
[33] in at least one of the following:
[0109] (1) Inhibiting ANGPTL4 gene expression, or preparing a drug for inhibiting ANGPTL4 gene expression;
[0110] (2) for preventing or treating a disease associated with abnormal expression of the ANGPTL4 gene, or for preparing a drug for preventing or treating a disease associated with abnormal expression of the ANGPTL4 gene;
[0111] (3) for treating a subject suffering from a disease that would benefit from reduced expression of an ANGPTL4 gene, or for preparing a medicament for treating a subject suffering from a disease that would benefit from reduced expression of an ANGPTL4 gene.
[0112]
[35] The use according to
[34] , wherein the disease associated with abnormal expression of the ANGPTL4 gene is selected from the group consisting of the following diseases:
[0113] Breast cancer, hepatitis C, glucose metabolism disorders, lipid metabolism disorders, vascular dysfunction, cardiovascular and cerebrovascular diseases, kidney disease, and inflammatory diseases;
[0114] Optionally, the carbohydrate metabolism disorder includes one or more of diabetes, fructose metabolism disorder, and glycogen storage disease;
[0115] Optionally, the cardiovascular and cerebrovascular diseases include coronary heart disease.
[0116]
[36] . A method for inhibiting ANGPTL4 gene expression in a cell, wherein the method comprises contacting the cell with the double-stranded RNA according to any one of [1]-
[14] , the double-stranded RNA modified substance according to any one of
[15] -
[24] , the double-stranded RNA conjugate or a prodrug thereof according to any one of
[25] -
[31] , or the pharmaceutical composition according to any one of
[32] -
[33] .
[0117]
[37] The method according to
[36] , wherein the subject has at least one of the following characteristics:
[0118] Abnormal expression of the ANGPTL4 gene in the body, more specifically abnormally high expression of the ANGPTL4 gene;
[0119] Suffering from diseases related to abnormal expression of the ANGPTL4 gene;
[0120] Having a disease that would benefit from decreased expression of the ANGPTL4 gene.
[0121] Effects of the Invention
[0122] In some embodiments, the double-stranded RNA provided by the present disclosure can bind to form an RNA-induced silencing complex (RISC) in cells, cleave the mRNA transcribed from the ANGPTL4 gene, and efficiently and specifically inhibit the expression of the ANGPTL4 gene, and is used to treat ANGPTL4-related diseases including breast cancer, hepatitis C, type II diabetes, glucose metabolism disorders, lipid metabolism disorders, vascular dysfunction, cardiovascular and cerebrovascular diseases, coronary heart disease, kidney disease, inflammatory diseases, diabetes, fructose metabolism disorders, glycogen storage disease, coronary heart disease, etc., as well as other related diseases, pathologies or syndromes that have not yet been identified.
[0123] Furthermore, the double-stranded RNA disclosed herein is siRNA, which targets and degrades the mRNA, the transcription product of the ANGPTL4 gene, thereby exerting the effect of RNA interference and inhibiting the protein expression of the ANGPTL4 gene. It is an ANGPTL4 inhibitor with a high inhibition rate and good specificity.
[0124] In some embodiments, the present disclosure modifies double-stranded RNA to obtain modified double-stranded RNA. The modified double-stranded RNA has high stability and is suitable for use in in vivo disease treatment.
[0125] Furthermore, the double-stranded RNA modification is a siRNA modification, which has high stability and good inhibitory activity.
[0126] In some embodiments, the present disclosure discloses conjugates of double-stranded RNA or double-stranded RNA modifications obtained by connecting conjugated groups to double-stranded RNA or double-stranded RNA modifications, which can be used for efficient targeted delivery to tissues and cells, reducing the effects of double-stranded RNA or double-stranded RNA modifications on non-targeted normal tissues and cells, and improving their safety in clinical disease treatment.
[0127] Furthermore, the double-stranded RNA conjugate is a siRNA conjugate, which maintains the inhibitory activity and stability of siRNA while having organ or tissue targeting, can reduce the impact on other tissues or organs and reduce the amount of siRNA molecules used, thereby achieving the purpose of reducing toxicity and reducing costs.
[0128] Furthermore, the conjugated group in the present disclosure is a group (GalNAc) having a structure shown in Formula I. GalNAc can be used for targeted delivery to liver cells and tissues to effectively inhibit the expression of the ANGPTL4 gene in the liver. DETAILED DESCRIPTION
[0129] definition
[0130] Unless otherwise stated, the terms used in the present invention have the following meanings.
[0131] In the claims and / or description of the present invention, the word "a" or "an" or "the" may mean "one", but may also mean "one or more", "at least one" and "one or more than one".
[0132] As used in the claims and description, the words "comprising," "having," "including," or "containing" are inclusive or open-ended and do not exclude additional, unrecited elements or method steps.
[0133] Throughout this application, the term "about" indicates that a value includes the standard deviation of error for the device or method used to determine the value. The numerical ranges and parameters used to define the present invention are approximate values, and the relevant numerical values in the specific examples have been presented as accurately as possible. However, any numerical value inherently inevitably contains standard deviations due to the aforementioned testing methods or equipment. Therefore, unless otherwise expressly stated, it should be understood that all ranges, amounts, values and percentages used in this disclosure are modified by "about". Here, "about" generally means that the actual value is within plus or minus 10%, 5%, 1% or 0.5% of a particular value or range.
[0134] The term "ANGPTL4" used in the context of this disclosure refers to well-known genes and polypeptides. The ANGPTL4 gene and ANGPTL4 mRNA sequence are easily obtained using, for example, GenBank, UniProt, and the Online Mendelian Inheritance in Man (OMIM).
[0135] The term "ANGPTL4 gene" may refer to a wild-type ANGPTL4 gene or a mutant ANGPTL4 gene having sequence variations. Many sequence variations in the ANGPTL4 gene have been identified and can be found in, for example, NCBI dbSNP and UniProt (see, for example, ncbi.nlm.nih.gov / snp).
[0136] The terms "polypeptide" and "protein" interchangeably refer to a string of at least two amino acid residues interconnected by covalent bonds (e.g., peptide bonds), and can be a recombinant polypeptide, a naturally occurring polypeptide, or a synthetic polypeptide. A polypeptide can be linear or branched, can contain modified amino acids, and can be interrupted by non-amino acids. The term also includes amino acid polymers that have been modified (e.g., by disulfide bond formation, glycosylation, lipidation, acetylation, phosphorylation, or any other manipulation).
[0137] The term "target sequence" as used in the context of this disclosure refers to a contiguous portion of the nucleotide sequence of an mRNA molecule formed during transcription of a target gene, including mRNA that is a product of RNA processing of a primary transcript.
[0138] In some optional embodiments, the target sequence may include another shorter target sequence. In some embodiments, the target sequence may include one or more shorter target sequences. It should be considered that two or more shorter target sequences included in the same target sequence have the same characteristics. For example, target sequence II includes target sequences II-1 to II-3.
[0139] In some embodiments, the target gene is the ANGPTL4 gene. In some embodiments, the target portion of the sequence (i.e., the portion corresponding to the target sequence in the mRNA sequence) will be at least long enough to serve as a substrate for iRNA-directed cleavage at or near the nucleotide sequence portion of the mRNA molecule formed during transcription of the ANGPTL4 gene.
[0140] In the art, "G", "C", "A", "T" and "U" generally represent bases containing guanine, cytosine, adenine, thymine and uracil, respectively. However, it is also generally known in the art that "G", "C", "A", "T" and "U" each generally represent nucleotides containing guanine, cytosine, adenine, thymine and uracil as bases, respectively. This is a common way to represent deoxyribonucleic acid sequences and / or ribonucleic acid sequences. Therefore, in the context of the present disclosure, the meanings represented by "G", "C", "A", "T" and "U" include the above-mentioned various possible situations. However, it should be understood that the term "ribonucleotide" or "nucleotide" can also refer to a modified nucleotide (as further described below) or an alternative replacement part. In this application, "nucleotide", "ribonucleic acid" and "ribonucleotide" are used interchangeably, and in this application, "deoxyribonucleotide" and "2'-deoxyribonucleotide" are used interchangeably. Those skilled in the art will appreciate that guanine, cytosine, adenine and uracil can be replaced by other parts without substantially changing the base pairing properties of an oligonucleotide (including a nucleotide with such a replacement part). For example, without limitation, a nucleotide comprising inosine as its base can be base paired with a nucleotide comprising adenine, cytosine or uracil. Therefore, a nucleotide containing uracil, guanine or adenine can be replaced by a nucleotide containing, for example, inosine in the nucleotide sequence of the dsRNA characterized by the present invention. In another example, adenine and cytosine anywhere in the oligonucleotide can be replaced by guanine and uracil, respectively, to form a GU wobble base pairing with the target mRNA. Sequences containing such replacement parts are suitable for the compositions and methods characterized by the present invention.
[0141] In the present application, "5'-nucleotide" refers to a nucleotide in which the phosphate group in the nucleotide is linked to the 5' carbon of a pentose, which is the main type of nucleotide free in the body. "3'-nucleotide" refers to a nucleotide in which the phosphate group in the nucleotide is linked to the 3' carbon of a pentose, for example, it may include adenosine-3'-phosphate, guanosine-3'-phosphate, cytidine-3'-phosphate, uridine-3'-phosphate, 2'-deoxythymidine-3'-phosphate, 2'-O-methyladenosine-3'-phosphate, 2'-O-methyladenosine-3'-thiophosphate, 2'-fluoroadenosine-3'-phosphate, 2'-fluoroadenosine-3'-thiophosphate, 2'-O-methylguanosine-3'-phosphate, 2'-O-methylguanosine-3'-phosphate, guanosine-3'-phosphate, 2'-fluoroguanosine-3'-phosphate, 2'-fluoroguanosine-3'-phosphate, 2'-O-methylcytidine-3'-phosphate, 2'-O-methylcytidine-3'-phosphate, 2'-fluorocytidine-3'-phosphate, 2'-fluorocytidine-3'-phosphate, 2'-O-methyluridine-3'-phosphate, 2'-O-methyluridine-3'-phosphate, 2'-fluorouridine-3'-phosphate, 2'-fluorouridine-3'-phosphate, 2'-deoxythymidine-3'-phosphate. This definition can be applied to modified or unmodified nucleoside phosphoramidite monomers.
[0142] As used herein, "nucleotide substitution with a deoxyribonucleotide" refers to the replacement of ribonucleotides A, U, C, and G with corresponding deoxyribonucleotides dA, T, dC, and dG during the modification process. For example, in the 5' to 3' direction, the 12th nucleotide of the antisense strand of N-ER-FY045080 is replaced with a deoxyribonucleotide, which means that the 12th ribonucleotide "U" is replaced with "T"; similarly, the adenine ribonucleotide (A) is replaced with the corresponding adenine deoxyribonucleotide (dA); the cytosine ribonucleotide (C) is replaced with the corresponding cytosine deoxyribonucleotide (dC); and the guanine ribonucleotide (G) is replaced with the corresponding guanine deoxyribonucleotide (dG).
[0143] As used herein, the terms "iRNA," "RNAi agent," "iRNA agent," and "RNA interfering agent" are used interchangeably herein to refer to siRNAs, as such terms are defined herein, and to mediate targeted cleavage of RNA transcripts via the RNA-induced silencing complex (RISC) pathway. iRNAs direct the sequence-specific degradation of mRNAs through a process known as RNA interference (RNAi). iRNAs modulate, e.g., inhibit, expression of a target gene in a cell, e.g., a cell of a subject, e.g., a mammalian subject.
[0144] As used herein, the terms "double-stranded ribonucleic acid," "double-stranded RNA (dsRNA) molecule," and "dsRNA" are used interchangeably. The term "dsRNA" refers to a complex of ribonucleic acid molecules having a double-stranded structure comprising two antiparallel and substantially complementary nucleic acid strands, referred to as "sense" and "antisense" orientations relative to a target gene, such as the ANGPTL4 gene. In some embodiments, double-stranded ribonucleic acid (dsRNA) triggers the degradation of a target RNA, such as an mRNA, through a post-transcriptional gene silencing mechanism (referred to herein as RNA interference or RNAi).
[0145] Typically, the majority of the nucleotides in each strand of the dsRNA molecule are double-stranded ribonucleotides, but as described in detail herein, each or both of the two strands may also include one or more non-ribonucleotides, e.g., deoxyribonucleotides and / or modified nucleotides. Additionally, as used in this disclosure, "double-stranded RNA" may include ribonucleotides, phosphate backbones, and the like having chemical modifications. These modifications may include all types of modifications disclosed herein or known in the art.
[0146] The term "isonucleotide" as used in the context of this disclosure refers to a compound formed by a change in the position of the base on the ribose ring in a nucleotide, for example, a compound formed by the base not being attached to the 1'-position of the ribose ring but to the 2'-position or 3'-position of the ribose ring.
[0147] In some embodiments, the double-stranded ribonucleic acids disclosed herein are siRNAs that interact with mRNA sequences transcribed from target genes (e.g., mRNA sequences transcribed from the ANGPTL4 gene) to guide the cleavage of the target RNA. Without wishing to be bound by theory, long double-stranded RNAs introduced into cells are broken down into siRNAs by a type III endonuclease called Dicer (Sharp et al., Genes Dev. 2001, 15:485). Dicer (an RNase III-like enzyme) processes the dsRNAs into 19-23 base pair short interfering RNAs with characteristic two-base 3' overhangs (Bernstein et al., (2001) Nature 409:363). These siRNAs are then incorporated into the RNA-induced silencing complex (RISC), where one or more helicases unwind the siRNA duplex, enabling the complementary antisense strand to guide target recognition (Nykanen et al., (2001) Cell 107:309). Once bound to the appropriate target mRNA, one or more endonucleases within RISC cleave the target to induce silencing (Elbashir et al. (2001) Genes Dev. 15:188).
[0148] As used herein, the terms "overhanging nucleotides" and "overhang" refer to one or more unpaired nucleotides that protrude from the duplex structure of a double-stranded RNA when the 3' end of one strand of the double-stranded RNA extends beyond the 5' end of the other strand, or vice versa. "Blunt end" or "blunt end" means that there are no unpaired nucleotides at that end of the double-stranded RNA, i.e., there are no nucleotide overhangs. A "blunt-ended" double-stranded RNA is a dsRNA that is double-stranded throughout its length, i.e., there are no nucleotide overhangs at either end of the molecule. "Double-stranded region" refers to the double-stranded region of the siRNA where the sense strand and the antisense strand complement each other to form the siRNA.
[0149] The term "antisense strand" refers to a region of double-stranded RNA that is substantially complementary to a target sequence (e.g., derived from human ANGPTL4 mRNA). Where the region of complementarity is not completely complementary to the target sequence, mismatches are most tolerated in the terminal regions, and if mismatches occur, they are typically within one or more regions of the termini, e.g., 5, 4, 3, 2, or 1 nucleotides of the 5' and / or 3' termini.
[0150] The term "sense strand" refers to the strand of a double-stranded RNA that contains a region that is substantially complementary to a region of the antisense strand.
[0151] The terms "complementary" and "reverse complement" are used interchangeably and have the meanings known to those skilled in the art, i.e., the pairing of bases on one strand of a double-stranded nucleic acid molecule with bases on the other strand in a complementary manner. In DNA, the purine base adenine (A) always pairs with the pyrimidine base thymine (T) (or uracil (U) in RNA); the purine base guanine (G) always pairs with the pyrimidine base cytosine (C). Each base pair consists of a purine and a pyrimidine. When adenine on one strand always pairs with thymine (or uracil) on the other strand, and guanine always pairs with cytosine, the two strands are considered complementary to each other, and the sequence of that strand can be inferred from the sequence of its complementary strand. Accordingly, "mismatch" is used in the art to mean that the bases at corresponding positions in a double-stranded nucleic acid are not paired in a complementary manner.
[0152] The term "substantially reverse complementary" means that there are no more than three base mismatches between the two nucleotide sequences involved, that is, there are 1, 2 or 3 base mismatches between the two nucleotide sequences involved; "completely complementary" means that there are no base mismatches between the two nucleotide sequences.
[0153] The terms "complementary," "fully complementary," and "substantially complementary" can be used with respect to base pairing between the sense and antisense strands of a dsRNA, or between the antisense strand of a dsRNA and a target sequence, as will be understood from the context of their use.
[0154] In the above and below, especially when describing the preparation methods of the double-stranded RNA, double-stranded RNA modified products, or conjugates thereof or pharmaceutical compositions of the present disclosure, unless otherwise specified, a nucleoside monomer refers to a modified or unmodified nucleoside phosphoramidite monomer used in phosphoramidite solid phase synthesis, depending on the type and sequence of nucleotides in the siRNA or siRNA conjugate to be prepared. Phosphoramidite solid phase synthesis is a method used in RNA synthesis well known to those skilled in the art. The nucleoside monomers used in the present disclosure are all commercially available.
[0155] The term "inhibit" is used interchangeably with "reduce," "silence," "downregulate," "suppress," and other similar terms and includes any level of inhibition.
[0156] The term "inhibiting the expression of an ANGPTL4 gene" includes inhibiting the expression of any ANGPTL4 gene (such as, for example, a mouse ANGPTL4 gene, a rat ANGPTL4 gene, a monkey ANGPTL4 gene, or a human ANGPTL4 gene), as well as variants (e.g., naturally occurring variants) or mutants of an ANGPTL4 gene. Thus, the ANGPTL4 gene can be a wild-type ANGPTL4 gene, a mutant ANGPTL4 gene, or a transgenic ANGPTL4 gene in the context of a genetically manipulated cell, cell group, or organism.
[0157] "Inhibiting ANGPTL4 gene expression" includes any level of inhibition of the ANGPTL4 gene, such as at least partial inhibition of ANGPTL4 gene expression, such as inhibition of at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%.
[0158] The term "each independently" means that at least two groups (or ring systems) present in a structure with the same or similar value ranges can have the same or different meanings in specific circumstances. For example, if substituent X and substituent Y are each independently hydrogen, hydroxyl, alkyl, or aryl, then when substituent X is hydrogen, substituent Y can be either hydrogen, hydroxyl, alkyl, or aryl. Similarly, when substituent Y is hydrogen, substituent X can be either hydrogen, hydroxyl, alkyl, or aryl.
[0159] The term "alkyl" includes straight chain, branched chain or cyclic saturated alkyl groups. For example, alkyl groups include, but are not limited to, methyl, ethyl, propyl, cyclopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, cyclobutyl, n-pentyl, cyclohexyl and the like. For example, "C 1-6 "C" in "alkyl" 1-6 ” refers to a group containing 1, 2, 3, 4, 5 or 6 carbon atoms in a straight chain, branched or cyclic form.
[0160] The term "alkoxy" as used herein refers to an alkyl group attached to the remainder of the molecule via an oxygen atom (-O-alkyl), wherein the alkyl group is as defined herein. Non-limiting examples of alkoxy include methoxy, ethoxy, trifluoromethoxy, difluoromethoxy, n-propoxy, isopropoxy, n-butoxy, tert-butoxy, n-pentoxy, and the like.
[0161] The term "treatment" refers to exposing a subject to (e.g., administering) a double-stranded RNA, a modified double-stranded RNA, a double-stranded RNA conjugate, or a pharmaceutical composition after the subject has contracted a disease, thereby alleviating the symptoms of the disease compared to a condition without such exposure. It does not necessarily mean that the symptoms of the disease are completely suppressed. Suffering from a disease means that the symptoms of the disease appear in the body.
[0162] The term "prevention" means that before a subject develops a disease, the symptoms after developing the disease are alleviated compared to when the subject does not develop the disease by exposing the subject to (e.g., administering) the double-stranded RNA, double-stranded RNA modified product, double-stranded RNA conjugate, or pharmaceutical composition of the present disclosure, and it does not necessarily mean that the disease must be completely suppressed.
[0163] The term "effective amount" refers to an amount or dosage of a double-stranded RNA, double-stranded RNA modification, double-stranded RNA conjugate or pharmaceutical composition of the present invention that, after administration to a patient in a single or multiple doses, produces the desired effect in a patient in need of treatment or prevention. The effective amount can be readily determined by the attending physician, who is skilled in the art, by considering a variety of factors such as: the species of the mammal; its size, age and general health; the specific disease involved; the extent or severity of the disease; the response of the individual patient; the specific antibody administered; the mode of administration; the bioavailability characteristics of the administered formulation; the selected dosing regimen; and the use of any concomitant therapy. The term "therapeutically effective amount" refers to an amount or dosage of a double-stranded RNA, double-stranded RNA modification, conjugate or pharmaceutical composition of the present invention that, after administration to a patient in a single or multiple doses, produces the desired therapeutic effect in a patient in need of treatment or prevention.
[0164] The term "disease associated with abnormal expression of the ANGPTL4 gene" refers to a disease or disorder associated with the involvement of ANGPTL4. The term "disease associated with abnormal expression of the ANGPTL4 gene" includes diseases, disorders, or conditions that would benefit from reducing the expression of ANGPTL4 (i.e., "ANGPTL4-related diseases"). In some embodiments, the disease associated with abnormal expression of the ANGPTL4 gene is selected from the group consisting of breast cancer, hepatitis C, glucose metabolism disorders, lipid metabolism disorders, vascular dysfunction, cardiovascular and cerebrovascular diseases, kidney disease, inflammatory diseases, diabetes, fructose metabolism disorders, glycogen storage diseases, coronary heart disease, and the like.
[0165] For example, the following scientific literature discloses that diseases associated with abnormal expression of the ANGPTL4 gene include breast cancer, hepatitis C, type II diabetes, glucose metabolism disorders, lipid metabolism disorders, vascular dysfunction, cardiovascular and cerebrovascular diseases, coronary heart disease, kidney disease, inflammatory diseases, diabetes, fructose metabolism disorders, glycogen storage disease, coronary heart disease, etc., but the diseases associated with abnormal expression of the ANGPTL4 gene are not limited to the scope disclosed in the following literature: Jing Zhao et al., “ANGPTL4 overexpression is associated with progression and poor prognosis in breast cancer”, Oncol Lett. 2020 Sep; 20(3): 2499-2505; Diana Gomes et al., “ANGPTL4 is a potential driver of HCV-induced peripheral insulin resistance”, Nature Scientific Reports, 13, Article number: 6767(2023); Carlos Fernández-Hernando et al., “ANGPTL4: a multifunctional protein involved in metabolism and vascular homeostasis”, Curr Opin Hematol.2020May;27(3):206-213.; Kelli L Sylvers-Davie et al., "Regulation of lipoprotein metabolism by ANGPTL3, ANGPTL4, and ANGPTL8", Am JPhysiol Endocrinol Metab.2021Oct1;321(4):E493-E508.; Eman Al Shawaf et al., "ANGPTL4:A Predictive Marker for Diabetic Nephropathy", J Diabetes Res. 2019Oct27:2019:4943191.; Yuyue Zuo et al., "Dual role of ANGPTL4 in inflammation", InflammRes.2023Jun 10:1-11; Binod Aryal et al., "ANGPTL4 in Metabolic and CardiovascularDisease", Trends Mol Med.2019Aug;25(8):723-734.。
[0166] The term "pharmaceutically acceptable excipient" or "pharmaceutically acceptable carrier" refers to an auxiliary material widely used in the field of drug production. The main purpose of using excipients is to provide a pharmaceutical composition that is safe to use, stable in nature and / or has specific functionality, and also to provide a method so that after the drug is administered to a subject, the active ingredient can be dissolved at a desired rate, or to promote the effective absorption of the active ingredient in the body of the subject receiving the drug. Pharmaceutically acceptable excipients can be inert fillers or functional ingredients that provide a certain function to the pharmaceutical composition (such as stabilizing the overall pH value of the composition or preventing the degradation of the active ingredient in the composition). Non-limiting examples of pharmaceutically acceptable excipients include, but are not limited to, binders, suspending agents, emulsifiers, diluents (or fillers), granulating agents, adhesives, disintegrants, lubricants, anti-adhesive agents, glidants, wetting agents, gelling agents, absorption delaying agents, dissolution inhibitors, enhancers, adsorbents, buffers, chelating agents, preservatives, colorants, flavoring agents, sweeteners, etc.
[0167] The term "pharmaceutical composition" refers to a mixture of one or more double-stranded RNAs, modified double-stranded RNAs, or conjugates thereof disclosed herein and a pharmaceutically acceptable excipient / carrier. The purpose of a pharmaceutical composition is to facilitate administration of the double-stranded RNAs, modified double-stranded RNAs, or conjugates thereof disclosed herein to an organism.
[0168] The term "corresponding siRNA" used in the context of the present disclosure refers to the same siRNA mentioned above. For example, when it is stated that "the sense chain comprises the sense chain of any one of the siRNAs shown in Table 1 and Table 1-1 herein, and the antisense chain comprises the antisense chain of the corresponding siRNA", it means that the sense chain and antisense chain are from the same siRNA shown in Table 1 and Table 1-1 herein, for example, when the sense chain comprises 5'-GCGUCCUGGGACGAGAUGAAU-3' (SEQ ID NO: 12), the antisense chain comprises 5'-UCAUCUCGUCCCAGGACGCAA-3' (SEQ ID NO: 57). Similarly, the term "corresponding siRNA modification" refers to the same siRNA modification mentioned above. For example, when it is stated that "the sense chain comprises the sense chain of any one of the siRNA modifications shown in Table 2 herein, and the antisense chain comprises the antisense chain of the corresponding siRNA modification", it means that the sense chain and antisense chain are from the same siRNA modification shown in Table 2 herein. Similarly, the term "corresponding siRNA conjugate" refers to the same siRNA conjugate mentioned above. For example, when it is stated that "the sense strand comprises the sense strand of any one of the siRNA conjugates shown in Table 3 herein, and the antisense strand comprises the antisense strand of the corresponding siRNA conjugate", it means that the sense strand and antisense strand comprised are from the same siRNA conjugate shown in Table 3 herein. In addition, in these contexts, "comprising" includes the case of consisting of these sequences.
[0169] The pharmaceutical compositions of the present disclosure can be prepared using any method known to those skilled in the art, such as conventional mixing, dissolving, granulating, emulsifying, pulverizing, encapsulating, embedding and / or lyophilizing processes.
[0170] In the present disclosure, the route of administration can be varied or adjusted in any applicable manner to suit the nature of the drug, the convenience of the patient and medical personnel, and other relevant factors.
[0171] The terms "individual," "patient," or "subject" as used herein include mammals. Mammals include, but are not limited to, domestic animals (e.g., cows, sheep, cats, dogs, and horses), primates (e.g., humans and non-human primates such as monkeys), rabbits, and rodents (e.g., mice and rats).
[0172] Unless defined otherwise or clearly indicated by the context, all technical and scientific terms in this disclosure have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs.
[0173] double-stranded RNA
[0174] In a first aspect, the present disclosure provides a double-stranded RNA (dsRNA) for inhibiting ANGPTL4 gene expression. One strand of the dsRNA is an antisense strand, which complementarily pairs with the mRNA sequence produced during the expression of the target gene (i.e., the ANGPTL4 gene) and is used to guide the cleavage of the target mRNA (i.e., the transcript of the ANGPTL4 gene). The other sense strand of the dsRNA includes a double-stranded region that is partially and fully complementary to the antisense strand, forming the dsRNA.
[0175] In some embodiments, double-stranded RNA (dsRNA) serves as a substrate for the endonuclease (Dicer), cleaving it into small fragments of dsRNA, also known as siRNA. In some embodiments, the double-stranded RNA is siRNA. The siRNA assembles into an RNA-induced silencing complex (RISC), which cleaves the target mRNA and inhibits ANGPTL4 gene expression.
[0176] Based on a target sequence derived from human ANGPTL4 mRNA (NM_139314.3), siRNAs that bind to the target mRNA are designed. In some embodiments, the target sequence is selected from the nucleotide sequence set forth in any one of SEQ ID NOs: 1 to 5. In more specific embodiments, the target sequence is selected from the nucleotide sequence set forth in any one of SEQ ID NOs: 1, 4 to 11.
[0177] In some specific embodiments, the nucleotide sequence shown in SEQ ID NO: 2 comprises the nucleotide sequences shown in SEQ ID NO: 6-8.
[0178] In some specific embodiments, the nucleotide sequence shown in SEQ ID NO: 3 comprises the nucleotide sequences shown in SEQ ID NO: 9-11.
[0179] In some embodiments, the antisense strand comprises a sequence B that differs by no more than 3 nucleotides from the reverse complementary sequence of at least 15 consecutive nucleotides in the target sequence. Specifically, along the direction from the 5' end to the 3' end, a starting nucleotide is selected in the target sequence, and at least 15 nucleotides extending in the 3' direction including the starting nucleotide are used as the binding region of the siRNA. The antisense strand comprises the reverse complementary sequence of the nucleotide sequence corresponding to the binding region. It should be noted that the starting nucleotide can be a nucleotide at any position in the target sequence, as long as at least 15 consecutive nucleotides (including the nucleotide at the starting position) can be obtained by extending in the 3' direction of the target sequence based on the starting nucleotide.
[0180] In the present disclosure, the nucleotide sequence of the antisense strand can be completely complementary or substantially complementary to the target sequence. When the nucleotide sequence of the antisense strand is substantially complementary to the target sequence, there are no more than 3 mismatched bases in the nucleotide sequence of the antisense strand with the target sequence. For example, there are 1, 2, or 3 mismatched bases. When the nucleotide sequence of the antisense strand is completely complementary to the target sequence, there are no mismatched bases in the nucleotide sequence of the antisense strand with the target sequence.
[0181] Furthermore, the antisense strand is composed of at least 15 nucleotides. In some embodiments, the antisense strand is composed of 15-28 nucleotides. For example, the antisense strand is 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27 or 28 nucleotides in length.
[0182] Preferably, the antisense strand consists of 19-25 nucleotides, more preferably 19-23 nucleotides, and most preferably 19, 21 or 23 nucleotides.
[0183] In some alternative embodiments, the sequence B comprised by the antisense strand is identical to the reverse complementary sequence of a sequence consisting of at least 15 consecutive nucleotides on the target sequence.
[0184] In some specific embodiments, the sequence B comprised by the antisense strand is identical to the reverse complement of a sequence consisting of 15-28 consecutive nucleotides on the target sequence, preferably 19-25 consecutive nucleotides on the target sequence, more preferably 19-23 consecutive nucleotides on the target sequence, and most preferably 19, 21 or 23 consecutive nucleotides on the target sequence.
[0185] In some optional embodiments, the sequence B comprised in the antisense strand differs by 1 nucleotide from the reverse complementary sequence of a sequence consisting of at least 15 consecutive nucleotides on the target sequence.
[0186] In some specific embodiments, the sequence B comprised in the antisense strand differs by 1 nucleotide from the reverse complement of a sequence consisting of 15-28 nucleotides of the target sequence, preferably 19-25 consecutive nucleotides of the target sequence, more preferably 19-23 consecutive nucleotides of the target sequence, and most preferably 19, 21, or 23 consecutive nucleotides.
[0187] In some specific embodiments, the different nucleotides are located at the 3' end of sequence B. In other specific embodiments, the different nucleotides are located at the 5' end of sequence B.
[0188] In some embodiments, the sense strand comprises a sequence A that differs by no more than 3 nucleotides from at least 15 consecutive nucleotides in the target sequence. The sense strand includes a region complementary to the antisense strand, and the nucleotide sequence of the sense strand is identical or substantially identical to the sequence of the region where the antisense strand binds to the target sequence. Therefore, the nucleotide sequence of the sense strand is the at least 15 consecutive nucleotides in the target sequence that bind to the antisense strand; alternatively, the nucleotide sequence of the sense strand differs from the at least 15 consecutive nucleotides in the target sequence that bind to the antisense strand by 1, 2, or 3 bases.
[0189] Further, the sense strand is composed of at least 15 nucleotides. In some embodiments, the sense strand is composed of 15-28 nucleotides. For example, the length of the sense strand is 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27 or 28 nucleotides.
[0190] Preferably, the sense strand consists of 19-25 nucleotides, more preferably 19-23 nucleotides, and most preferably 19, 21 or 23 nucleotides.
[0191] In some alternative embodiments, the sense strand comprises a sequence A that is identical to a sequence consisting of at least 15 consecutive nucleotides in the target sequence.
[0192] In some specific embodiments, the sequence A included in the sense strand is identical to a sequence consisting of 15-28 consecutive nucleotides on the target sequence, preferably 19-25 consecutive nucleotides on the target sequence, more preferably 19-23 consecutive nucleotides on the target sequence, and most preferably 19, 21 or 23 consecutive nucleotides on the target sequence.
[0193] In some optional embodiments, the sequence A comprised in the sense strand differs by 1 nucleotide from a sequence consisting of at least 15 consecutive nucleotides in the target sequence.
[0194] In some specific embodiments, the sense strand comprises sequence A that differs by 1 nucleotide from a sequence consisting of 15-28 consecutive nucleotides of the target sequence, preferably 19-25 consecutive nucleotides of the target sequence, more preferably 19-23 consecutive nucleotides of the target sequence, and most preferably 19, 21, or 23 consecutive nucleotides of the target sequence.
[0195] In some specific embodiments, the different nucleotides are located at the 3' end of sequence A. In other specific embodiments, the different nucleotides are located at the 5' end of sequence A. In the present disclosure, the length of the sense strand and the length of the antisense strand can be the same or different.
[0196] In some embodiments, the sense strand and the antisense strand are the same length, specifically, the sense strand / antisense strand length ratio is 15 / 15, 16 / 16, 17 / 17, 18 / 18, 19 / 19, 20 / 20, 21 / 21, 22 / 22, 23 / 23, 24 / 24, 25 / 25, 26 / 26, 27 / 27, or 28 / 28. Preferably, the sense strand / antisense strand length ratio is 19 / 19, 20 / 20, 21 / 21, 22 / 22, 23 / 23, 24 / 24, or 25 / 25, more preferably 19 / 19, 20 / 20, 21 / 21, 22 / 22, or 23 / 23, and most preferably 19 / 19, 21 / 21, or 23 / 23.
[0197] In some embodiments, the sense strand and the antisense strand are of different lengths. For example, the sense strand / antisense strand length ratio is 19 / 20, 19 / 21, 19 / 22, 19 / 23, 19 / 24, 19 / 25, 19 / 26, 20 / 19, 20 / 21, 20 / 22, 20 / 23, 20 / 24, 20 / 25, 20 / 26, 21 / 19, 21 / 20, 21 / 22, 21 / 23, 21 / 24, 21 / 25 , 21 / 26, 22 / 19, 22 / 20, 22 / 21, 22 / 23, 22 / 24, 22 / 25, 22 / 26, 23 / 19, 23 / 20, 23 / 21, 23 / 22, 23 / 24, 23 / 25 or 23 / 26, etc.; in some preferred embodiments, the length ratio of the sense chain / antisense chain is 19 / 21, 20 / 22 or 21 / 23.
[0198] In the present disclosure, the sense strand and the antisense strand may be completely complementary or substantially complementary. When the two are substantially complementary, there are no more than three mismatched bases in the double-stranded region formed by the sense strand and the antisense strand.
[0199] In some embodiments, after the sense strand and the antisense strand complement each other to form a double-stranded region, the sense strand, the antisense strand, or a combination thereof has protruding nucleotides extending out of the double-stranded region. The number of protruding nucleotides can be 1 or more, for example, 1 or 2. In addition, the protruding 1-2 nucleotides can be located at the 5' end, 3' end, or both ends of any antisense strand or sense strand, and each protruding nucleotide can be any type of nucleotide. For example, when the sense strand consists of a sequence A+D with a length of 21 and the antisense strand consists of a sequence B+E with a length of 21, in the direction from the 5' end to the 3' end, nucleotides 1-19 of sequence A are completely reverse complementary to nucleotides 1-19 of sequence B, so that sequence D and sequence E form protruding nucleotides at the 3' end of their respective chains. For example, when the sense strand consists of sequence A with a length of 19 and the antisense strand consists of sequence B+E with a length of 21, nucleotides 1-19 of sequence A are completely reverse complementary to nucleotides 1-19 of sequence B in the direction from the 5' end to the 3' end, thereby forming a protruding nucleotide at the 3' end of sequence E on the antisense strand.
[0200] In some embodiments, the sense strand and the antisense strand are complementary to each other to form the double-stranded region, and the 3' end of the sense strand has 1-2 protruding nucleotides extending beyond the double-stranded region, while the 3' end of the antisense strand forms a blunt end.
[0201] In some embodiments, the sense strand and the antisense strand are complementary to each other to form the double-stranded region, and the 3' end of the antisense strand has 1-2 protruding nucleotides extending beyond the double-stranded region, while the 3' end of the sense strand forms a blunt end.
[0202] In some embodiments, the sense strand and the antisense strand are complementary to each other to form the double-stranded region, and the 3' ends of the sense strand and the antisense strand each have 1-2 overhanging nucleotides extending beyond the double-stranded region.
[0203] In some embodiments, the sense strand and the antisense strand are complementary to each other to form the double-stranded region, and the 3' ends of the sense strand and the antisense strand both form blunt ends.
[0204] In the present disclosure, as described above, the nucleotide sequence of the antisense strand and the target sequence can be completely complementary or substantially complementary; the sense strand and the antisense strand can be completely complementary or substantially complementary. Therefore, for target sequences and siRNAs that can be complementary to these target sequences, for the antisense strand of each siRNA, the case where the target sequence to which it is complementary is substantially complementary is included, that is, the nucleotide sequence of the antisense strand of each siRNA may have a base mismatch with the corresponding target sequence; for the sense strand of each siRNA, the case where the target sequence is substantially consistent with it is included, that is, the nucleotide sequence of the sense strand of each siRNA may have a base mismatch or base difference with the corresponding target sequence. In some embodiments, the base mismatch or base difference can be a mismatch or difference with the target sequence that is no more than 3 bases, for example, the number of mismatched bases or difference bases is 1, 2 or 3.
[0205] In some embodiments, the sense strand comprises the sense strand of any one of the siRNAs shown in Table 1 or Table 1-1 herein, and the antisense strand comprises the antisense strand of the corresponding siRNA.
[0206] In some embodiments, the sense strand comprises the sense strand of any one of siRNAs listed in Table 1, siRNA 24, siRNA 44, siRNA 45, siRNA 144 to siRNA 146, and siRNA 202 to siRNA 204, and the antisense strand comprises the antisense strand of the corresponding siRNA.
[0207] In some specific embodiments, the siRNA of the present disclosure inhibits the ANGPTL4 gene by at least about 5%, and may be at least about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or a value or range between any two of these values.
[0208] In some specific embodiments, the double-stranded RNA is selected from any siRNA listed in Table 1 and Table 1-1. The siRNA provided herein has high specificity for binding to target mRNA (ANGPTL4 mRNA), has good target mRNA silencing activity, can significantly inhibit ANGPTL4 gene expression, and is used to treat ANGPTL4-related diseases including breast cancer, hepatitis C, glucose metabolism disorders, lipid metabolism disorders, vascular dysfunction, cardiovascular and cerebrovascular diseases, kidney disease, inflammatory diseases, diabetes, fructose metabolism disorders, glycogen storage diseases, coronary heart disease, and the like.
[0209] In some embodiments, the present disclosure provides an siRNA composition comprising any one or a combination of two or more of the siRNAs shown in Table 1 and Table 1-1.
[0210] In some embodiments, each nucleotide of the sense strand is independently a modified nucleotide or an unmodified nucleotide. In some embodiments, each nucleotide of the antisense strand is independently a modified nucleotide or an unmodified nucleotide.
[0211] In some embodiments, any two nucleotides in the sense strand are linked by a phosphodiester bond or a phosphorothioate diester bond. In some embodiments, any two nucleotides in the antisense strand are linked by a phosphodiester bond or a phosphorothioate diester bond.
[0212] In some embodiments, the 5' terminal nucleotide of the antisense strand is linked to a 5' phosphate group or a 5' phosphate-derived group.
[0213] The 5' terminal nucleotide of the antisense strand is linked to a 5' phosphate group or a 5' phosphate derivative group to form the following structure:
[0214]
[0215] Formula (1) is the structural formula formed after the 5' terminal nucleotide is connected to the 5' phosphate group, formula (2) is the structural formula formed after the 5' terminal nucleotide is connected to EVP, and formula (3) is the structural formula formed after the 5' terminal nucleotide is connected to the 5' methylene phosphate group, wherein Base represents a base, such as A, U, G, C or T. R' is a hydroxyl group or is substituted by various groups known to those skilled in the art, for example, 2'-fluoro (2'-F) modified nucleotides, 2'-alkoxy modified nucleotides, 2'-substituted alkoxy modified nucleotides, 2'-alkyl modified nucleotides, 2'-substituted alkyl modified nucleotides, and 2'-deoxyribonucleotides.
[0216] In some embodiments, the 5' terminal nucleotide of the antisense strand is not connected to a 5' phosphate group or a 5' phosphate derivative group (i.e., the ribose group of the 5' terminal nucleotide of the antisense strand is a 5' hydroxyl group), and its structure is shown in Formula (X):
[0217]
[0218] Wherein, Base represents a base, such as A, U, G, C or T. R is hydroxyl or hydrogen or is substituted by various groups known to those skilled in the art. For example, R can be 2'-fluoro (2'-F), 2'-alkoxy, 2'-substituted alkoxy, 2'-alkyl, 2'-substituted alkyl, 2'-amino, 2'-substituted amino, or 2'-deoxynucleotide.
[0219] In some embodiments, neither the 5' end nor the 3' end of the sense strand is linked to (invAb), or only the 5' end of the sense strand is linked to one (invAb), or only the 3' end of the sense strand is linked to one (invAb), or both the 5' end and the 3' end of the sense strand are linked to one (invAb); in the double-stranded RNA modification, (invAb) is not counted as a site.
[0220] In some embodiments, the sense strand may include one or more blocking residues or moieties, sometimes referred to in the art as "caps," "end caps," or "blocking residues." As used herein, a "blocking residue" is a non-nucleotide compound or other moiety that can be incorporated into one or more ends of the nucleotide sequence of the siRNA disclosed herein. In some cases, blocking residues can provide certain beneficial properties for the siRNA, such as protection from exonuclease degradation. In some embodiments, an inverted abasic deoxyribose residue (invAb) is added as a blocking residue. In some embodiments, the blocking residue appears at the 3' end or both the 5' and 3' ends of the sense strand.
[0221] In some embodiments, one or more inverted abasic deoxyribose residues (invAb) are added to the 3' end of the sense strand. In some embodiments, one or more inverted abasic deoxyribose residues (invAb) are added to the 5' end of the sense strand and the 3' end of the sense strand. The inverted abasic deoxyribose residues can be connected via a phosphate bond, a phosphorothioate bond, or other internucleoside bond. When describing the modification site in the modification method, (invAb) is not counted as the first site of the sequence. The chemical structure of the inverted abasic deoxyribose residue is shown below:
[0222] When (invAb) is located at the 3' end of the siRNA, it is Formula B; when (invAb) is located at the 5' end of the siRNA, it is Formula C:
[0223]
[0224] Double-stranded RNA modifications
[0225] A second aspect of the present disclosure provides a modified double-stranded RNA. Furthermore, the modified double-stranded RNA is a modified siRNA. The modified siRNA can improve the stability of the siRNA while maintaining high ANGPTL4 mRNA inhibitory activity.
[0226] In some embodiments, the double-stranded RNA modification comprises at least one modified nucleotide. The modification of the nucleotide is selected from at least one of modification of the ribose group and modification of the base. In some embodiments, "modification of the nucleotide" refers to a nucleotide or nucleotide derivative formed by replacing the 2'-hydroxyl group of the ribose group of the nucleotide with another group, or a nucleotide in which the base on the nucleotide is a modified base. The modification of the nucleotide does not significantly weaken or lose the function of the siRNA to inhibit gene expression. For example, the modified nucleotides disclosed in JK Watts, GF Deleavey, and MJ Damha, Chemically modified siRNA: tools and applications. Drug Discov Today, 2008, 13(19-20): 842-55 can be selected. The modification of the nucleotide can improve the stability of the siRNA and maintain its high inhibitory efficiency against the ANGPTL4 gene.
[0227] Exemplarily, the modified nucleotide has the following structure:
[0228] Wherein, Base represents a base, such as A, U, G, C or T. The hydroxyl group at the 2' position of the ribose group is substituted by R. The hydroxyl group at the 2' position of these ribose groups can be substituted by various groups known to those skilled in the art, for example, R can be selected from halogen, alkyl, alkoxy, substituted alkyl and substituted alkoxy. For example, in some specific embodiments, the modified nucleotides include but are not limited to 2'-fluoro (2'-F) modified nucleotides, 2'-alkoxy modified nucleotides, 2'-substituted alkoxy modified nucleotides, 2'-alkyl modified nucleotides, 2'-substituted alkyl modified nucleotides, and 2'-deoxyribonucleotides.
[0229] In some embodiments, the 2'-alkoxy modified nucleotide is a 2'-methoxy (2'-OMe, 2'-O-CH3) modified nucleotide, and the like.
[0230] In some embodiments, the 2'-substituted alkoxy modified nucleotide is a 2'-methoxyethoxy (2'-O-CH2-CH2-O-CH3) modified nucleotide, a 2'-O-CH2-CH=CH2 modified nucleotide, or the like.
[0231] In some embodiments, the 2'-substituted alkyl modified nucleotide is a 2'-CH2-CH2-CH=CH2 modified nucleotide, and the like.
[0232] In some embodiments, the modification of the nucleotide is a modification of the base. The modification of the base can be various types of modifications known to those skilled in the art. Exemplary, the modification of the base includes but is not limited to m 6 A、Ψ、m 1 A、m 5 A.ms 2 i 6 A.i 6 A、m 3 C、m 5 C、ac 4 C、m 7 G、m 2,2 G、m 2 G、m 1 G, Q, m 5 U、mcm 5 U、ncm 5 U、ncm 5 Um、D、mcm 5 s 2 U、Inosine(I),hm 5 C.s 4 U.s. 2 U, azobenzene, Cm, Um, Gm, t 6 A、yW、ms 2 t 6 A or its derivatives.
[0233] In some embodiments, a nucleotide derivative refers to a compound that can replace a nucleotide in a nucleic acid but has a structure different from adenine ribonucleotide, guanine ribonucleotide, cytosine ribonucleotide, uracil ribonucleotide, or thymine deoxyribonucleotide. In some embodiments, a nucleotide derivative can be an isonucleotide, a bridged nucleic acid (BNA), or an acyclic nucleotide. BNA refers to a constrained or inaccessible nucleotide. BNA can contain a five-membered ring, a six-membered ring, or a seven-membered ring with a "fixed" C3'-endo sugar condensation bridge structure. The bridge is typically incorporated into the 2'- or 4'-position of the ribose to provide a 2',4'-BNA nucleotide, such as LNA, ENA, cET, etc.
[0234] LNA is shown in formula (4), ENA is shown in formula (5), and cET is shown in formula (6):
[0235]
[0236] Here, Base represents a base.
[0237] Acyclic nucleotides are a type of nucleotide formed by opening the sugar ring of a nucleotide, such as unlocked nucleic acid (UNA) or glycerol nucleic acid (GNA), where UNA is shown in formula (7) and GNA is shown in formula (8):
[0238]
[0239]
[0240] In the above formula (7) and formula (8), Base represents a base; and R is selected from H, OH or alkoxy (O-alkyl).
[0241] In the structural formulas above and below, the wavy lines indicate the positions of bond formation. For example, in the GNA structure above, the upper wavy line connects to the 3-position of the 5-terminal nucleotide, forming a phosphodiester bond, while the lower wavy line connects to the 5-position of the 3-terminal nucleotide, forming a phosphodiester bond.
[0242] In some embodiments, the nucleotide derivative modification refers to that the nucleotide in the nucleic acid is replaced by a nucleotide derivative. Exemplarily, the nucleotide derivative is selected from isonucleotides, LNA, ENA, cET, UNA or GNA.
[0243] In some embodiments, nucleotides in a nucleic acid are replaced with isonucleotides, which in the context of the present disclosure are also referred to as isonucleoside modifications. In some embodiments, isonucleoside modifications include incorporating isonucleosides at one or more sites in the sense and / or antisense strands of the siRNA to be modified to replace natural nucleosides for coupling at the corresponding positions.
[0244] In some embodiments, the isonucleoside modification is a D-isonucleoside modification. In other embodiments, the isonucleoside modification is an L-isonucleoside modification. In yet other embodiments, the isonucleoside modification is a D-isonucleoside modification and an L-isonucleoside modification.
[0245] In some embodiments, the double-stranded RNA modification comprises a modification of the phosphodiester bond at at least one position. In some embodiments, the modification of the phosphodiester bond refers to the replacement of at least one oxygen atom in the phosphodiester bond with a sulfur atom to form a phosphorothioate diester bond. The phosphorothioate diester bond can stabilize the double-stranded structure of the siRNA and maintain the specificity of base pairing. Exemplary, the phosphorothioate diester bond structure is shown below:
[0246]
[0247] In some embodiments, the double-stranded RNA modification comprises at least one of the following chemical modifications:
[0248] (1) modification of at least one nucleotide in the sense strand,
[0249] (2) modification of the phosphodiester bond at at least one position in the sense strand,
[0250] (3) modification of at least one nucleotide in the antisense strand,
[0251] (4) Modification of the phosphodiester bond at at least one position in the antisense strand.
[0252] Furthermore, the double-stranded RNA modification product is an siRNA modification product comprising at least one chemical modification of (1) to (4).
[0253] In the present disclosure, after sequence A in the sense strand and sequence B in the antisense strand complement each other to form a double-stranded region, the 3' ends of sequence A and sequence B can be any of the following:
[0254] (1) The 3' ends of sequence A and sequence B are both blunt-ended;
[0255] (2) The 3' end of sequence A has 1-2 protruding nucleotides extending beyond the double-stranded region, and the 3' end of sequence B forms a blunt end;
[0256] (3) The 3' end of sequence B has 1-2 protruding nucleotides extending beyond the double-stranded region, and the 3' end of sequence A forms a blunt end;
[0257] (4) The 3' end of sequence A has 1-2 protruding nucleotides extending beyond the double-stranded region, and the 3' end of sequence B has 1-2 protruding nucleotides extending beyond the double-stranded region.
[0258] In some embodiments, the nucleotide sequence of the sense strand is the sequence shown in Sequence A, and the nucleotide sequence of the antisense strand is the sequence shown in Sequence B.
[0259] In some embodiments, after the nucleotide sequences of the sense and antisense strands complement each other to form a double-stranded region, if there are no overhanging nucleotides at the 3' termini of the sense and antisense strands, 1-2 nucleotides are added to the 3' termini of at least one of the sense and antisense strands to serve as overhanging nucleotides. The 1-2 nucleotides attached to the 3' termini of the sense strand constitute sequence D, and the 1-2 nucleotides attached to the 3' termini of the antisense strand constitute sequence E. Accordingly, the nucleotide sequence of the sense strand is the sequence shown in sequence A connected to sequence D, and the nucleotide sequence of the antisense strand is the sequence shown in sequence B connected to sequence E. Alternatively, the nucleotide sequence of the sense strand is the sequence shown in sequence A, and the nucleotide sequence of the antisense strand is the sequence shown in sequence B connected to sequence E. Alternatively, the nucleotide sequence of the sense strand is the sequence shown in sequence A, and the nucleotide sequence of the antisense strand is the sequence shown in sequence B connected to sequence E. Alternatively, the nucleotide sequence of the sense strand is the sequence shown in sequence A connected to sequence D, and the nucleotide sequence of the antisense strand is the sequence shown in sequence B.
[0260] Exemplarily, two deoxyribonucleotides (TT) are added to the 3' end of the sense strand as sequence D, and two deoxyribonucleotides (TT) are added to the 3' end of the antisense strand as sequence E. Alternatively, two deoxyribonucleotides (TT) are added only to the 3' end of the antisense strand as sequence E. Alternatively, two deoxyribonucleotides (TT) are added only to the 3' end of the sense strand as sequence D.
[0261] In some embodiments, when the nucleotide sequences of the sense and antisense strands complement each other to form a double-stranded region, if there is no overhanging nucleotide at the 3' end of the sense strand, a sequence D consisting of 1-2 nucleotides is added to the 3' end of the sense strand to serve as the overhanging nucleotide. Then, after chemical modification, the nucleotide sequence formed by ligating sequence A with sequence D is excluded from the nucleotide sequence consisting of 1-2 nucleotides. Accordingly, in a modified double-stranded RNA, the nucleotide sequence of the sense strand is represented by sequence A, and the nucleotide sequence of the antisense strand is represented by sequence B. Alternatively, in a modified double-stranded RNA, the nucleotide sequence of the sense strand is represented by sequence A, and the nucleotide sequence of the antisense strand is represented by sequence B ligated with sequence E. In some embodiments, when sequence A has an overhang of 1-2 nucleotides at its 3' end extending beyond the double-stranded region after ligating sequence B, the nucleotide sequence of sequence A, excluding the overhanging nucleotide at the 3' end, is used as the nucleotide sequence of the sense strand. The sequence excluding the overhanging nucleotide at the 3' end is referred to as sequence A'. Accordingly, the nucleotide sequence of the sense strand of the modified double-stranded RNA is the sequence shown in sequence A', and the nucleotide sequence of the antisense strand of the modified double-stranded RNA is the sequence shown in sequence B. Alternatively, the nucleotide sequence of the sense strand of the modified double-stranded RNA is the sequence shown in sequence A', and the nucleotide sequence of the antisense strand of the modified double-stranded RNA is the sequence shown in sequence B connected to sequence E.
[0262] In some embodiments, the sense strand of the siRNA modifier includes the following modifications along the 5' end to the 3' end: the ribonucleotides at positions 7, 9, 10, and 11 in the sense strand are 2'-fluoro-modified ribonucleotides; and the ribonucleotides at other positions in the sense strand are 2'-methoxy-modified ribonucleotides.
[0263] In some embodiments, the sense strand of the siRNA modification comprises the following modifications along the 5' end to the 3' end: the ribonucleotides at positions 7, 9, 10, and 11 in the sense strand are 2'-fluoro-modified ribonucleotides; the ribonucleotides at other positions in the sense strand are 2'-methoxy-modified ribonucleotides, and the overhang is removed at the 3' end.
[0264] In some embodiments, the sense strand of the siRNA modifier includes the following modifications along the 5' end to the 3' end: the ribonucleotides at positions 5, 7, 8, and 9 in the sense strand are 2'-fluoro-modified ribonucleotides, and the ribonucleotides at the remaining positions in the sense strand are 2'-methoxy-modified ribonucleotides.
[0265] In some embodiments, the sense strand of the siRNA modifier includes the following modifications along the 3' end to the 5' end: the ribonucleotides at positions 9, 10, 11, and 13 in the sense strand are 2'-fluoro-modified ribonucleotides, and the ribonucleotides at the remaining positions in the sense strand are 2'-methoxy-modified ribonucleotides.
[0266] In some embodiments, the sense strand of the siRNA modifier includes the following modifications along the 3' end to the 5' end: the ribonucleotides at positions 11, 12, 13, and 17 in the sense strand are 2'-fluoro-modified ribonucleotides, and the ribonucleotides at the remaining positions in the sense strand are 2'-methoxy-modified ribonucleotides.
[0267] In some embodiments, the sense strand of the siRNA modifier includes the following modifications along the 3' end to the 5' end: the ribonucleotides at positions 9, 11, 13, and 17 in the sense strand are 2'-fluoro-modified ribonucleotides, and the ribonucleotides at the remaining positions in the sense strand are 2'-methoxy-modified ribonucleotides.
[0268] In some embodiments, the sense strand of the siRNA modifier includes the following modifications along the 3' end to the 5' end: the ribonucleotides at positions 6, 11, and 13 in the sense strand are 2'-fluoro-modified ribonucleotides, and the ribonucleotides at the remaining positions in the sense strand are 2'-methoxy-modified ribonucleotides.
[0269] In this context, the 5' terminal nucleotide of the sense strand is not connected to a 5' phosphate group or a 5' phosphate derivative group or an inverted abasic deoxyribose residue (i.e., the ribose group of the 5' terminal nucleotide of the sense strand is a 5' hydroxyl group), and the structure is shown in Formula X:
[0270]
[0271] Wherein, Base represents a base, such as A, U, G, C or T; R is a hydroxyl group or is substituted by various groups known to those skilled in the art, for example, R can be 2'-fluoro (2'-F), 2'-alkoxy, 2'-substituted alkoxy, 2'-alkyl, 2'-substituted alkyl, 2'-amino, 2'-substituted amino, or 2'-deoxynucleotide.
[0272] In some embodiments, when neither the 5' end nor the 3' end of the sense strand is linked (invAb), the sense strand of the siRNA modification includes phosphorothioate diester bonds at the following positions, along the 5' end to the 3' end: between the first nucleotide and the second nucleotide starting from the 5' end, between the second nucleotide and the third nucleotide starting from the 5' end, between the first nucleotide and the second nucleotide starting from the 3' end, and between the second nucleotide and the third nucleotide starting from the 3' end.
[0273] In some embodiments, when neither the 5' end nor the 3' end of the sense strand is linked (invAb), the sense strand of the siRNA modification comprises phosphorothioate diester bonds at the following positions, from the 5' end to the 3' end: between the first nucleotide and the second nucleotide starting from the 5' end, and between the second nucleotide and the third nucleotide starting from the 5' end.
[0274] In some embodiments, when only the 5' end of the sense strand is linked to an (invAb), the sense strand of the siRNA modifier comprises a phosphorothioate diester bond at the following positions along the 5' end to the 3' end:
[0275] Between the 5' end (invAb) and the first nucleotide starting from the 5' end of the sense strand;
[0276] between the first and second nucleotides starting from the 5' end of the sense strand.
[0277] In some embodiments, when only one (invAb) is attached to the 3' end of the sense strand, the sense strand of the siRNA modification comprises a phosphorothioate diester bond at the following positions along the 5' end to the 3' end:
[0278] Between the first and second nucleotides starting from the 5' end of the sense strand;
[0279] Between the second and third nucleotides starting from the 5' end of the sense strand;
[0280] Between the 3' end (invAb) and the first nucleotide from the 3' end of the sense strand.
[0281] In some embodiments, when the 5' end and the 3' end of the sense strand are each linked to an (invAb), the sense strand of the siRNA modification comprises a phosphorothioate diester bond at the following positions along the 5' end to the 3' end:
[0282] Between the 5' end (invAb) and the first nucleotide starting from the 5' end of the sense strand;
[0283] Between the first and second nucleotides starting from the 5' end of the sense strand;
[0284] Between the 3' end (invAb) and the first nucleotide from the 3' end of the sense strand.
[0285] In some embodiments, the antisense strand of the siRNA modification comprises the following modifications along the 5' end to the 3' end: the ribonucleotides at positions 2, 6, 14, and 16 in the antisense strand are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions in the antisense strand are 2'-O-CH3 modified ribonucleotides.
[0286] In some embodiments, the antisense strand of the siRNA modification comprises the following modifications along the 5' end to the 3' end: the ribonucleotides at positions 2, 6, 8, 9, 14, and 16 in the antisense strand are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions in the antisense strand are 2'-O-CH3 modified ribonucleotides.
[0287] In some embodiments, the antisense strand of the siRNA modifier includes the following modifications along the 5' end to the 3' end: the ribonucleotides at positions 2, 6, 14, and 16 in the antisense strand are 2'-F modified ribonucleotides, the ribonucleotide at position 7 in the antisense strand is a ribonucleotide modified with the nucleotide derivative GNA, and the ribonucleotides at the remaining positions in the antisense strand are 2'-O-CH3 modified ribonucleotides.
[0288] In some embodiments, along the 5' end to the 3' end, the ribonucleotides at positions 2, 14, and 16 in the antisense chain are 2'-F modified ribonucleotides, the ribonucleotide at position 6 in the antisense chain is a ribonucleotide modified with the nucleotide derivative GNA, and the ribonucleotides at the remaining positions in the antisense chain are 2'-O-CH3 modified ribonucleotides.
[0289] In some embodiments, along the 5' end to the 3' end direction, the ribonucleotides at positions 2, 5, 7 and 14 in the antisense strand are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions in the antisense strand are 2'-O-CH3 modified ribonucleotides.
[0290] In some embodiments, along the 5' end to the 3' end, the ribonucleotides at positions 2, 7, 10 and 14 in the antisense strand are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions in the antisense strand are 2'-O-CH3 modified ribonucleotides.
[0291] In some embodiments, along the 5' end to the 3' end direction, the ribonucleotides at positions 2, 7, and 14 in the antisense chain are 2'-F modified ribonucleotides, the ribonucleotides at positions 5 and 12 in the antisense chain are replaced with 2'-deoxyribonucleotides, and the ribonucleotides at the remaining positions in the antisense chain are 2'-O-CH3 modified ribonucleotides.
[0292] In some embodiments, along the 5' end to the 3' end, the ribonucleotides at positions 2, 3, 5, 7, 10, 12 and 14 in the antisense chain are 2'-F modified ribonucleotides, the ribonucleotide at position 6 in the antisense chain is a ribonucleotide modified with the nucleotide derivative GNA, and the ribonucleotides at the remaining positions in the antisense chain are 2'-O-CH3 modified ribonucleotides.
[0293] In some embodiments, the antisense strand of the siRNA modification comprises phosphorothioate diester bonds at the following positions, along the 5'-end to 3'-end direction: between the first nucleotide and the second nucleotide starting from the 5'-end, between the second nucleotide and the third nucleotide starting from the 5'-end, between the first nucleotide and the second nucleotide starting from the 3'-end, and between the second nucleotide and the third nucleotide starting from the 3'-end.
[0294] In some embodiments, when the 5'-terminal nucleotide of the antisense strand is not linked to a 5'-phosphate group or a 5'-phosphate derivative group (i.e., the ribose group of the 5'-terminal nucleotide of the antisense strand is a 5'-hydroxyl group), the structure of the 5'-terminal nucleotide is as shown in Formula X:
[0295]
[0296] Wherein, Base represents a base, such as A, U, G, C or T; R is a hydroxyl group or is substituted by various groups known to those skilled in the art, for example, R can be 2'-fluoro (2'-F), 2'-alkoxy, 2'-substituted alkoxy, 2'-alkyl, 2'-substituted alkyl, 2'-amino, 2'-substituted amino, or 2'-deoxynucleotide.
[0297] In some embodiments, double-stranded RNA modifications include, but are not limited to, siRNA modifications as shown in Table 2.
[0298] In some optional embodiments, the sense strand and the antisense strand are selected from the following combinations:
[0299] The sense strand comprises the sense strand of any one of the siRNA modifications shown in Table 2 herein, and the antisense strand comprises the antisense strand of the corresponding siRNA modification;
[0300] Preferably, the sense strand and the antisense strand are selected from the following combinations:
[0301] The sense strand comprises the sense strand of any one of the siRNA modifications of siRNA 154, siRNA 162, or siRNA 171 shown in Table 2 herein, and the antisense strand comprises the antisense strand of the corresponding siRNA modification.
[0302] In some specific embodiments, the inhibition rate of the ANGPTL4 gene by the modified siRNA of the present disclosure is at least about 5%, and may be at least about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or a value or range between any two of these values.
[0303] Double-stranded RNA conjugate
[0304] The third aspect of the present disclosure provides a double-stranded RNA conjugate, which is obtained by conjugating the double-stranded RNA provided by the first aspect of the present disclosure or the double-stranded RNA modification provided by the second aspect with a conjugation group.
[0305] In the present disclosure, the sense strand and the antisense strand of the double-stranded RNA conjugate form a double-stranded region of the double-stranded RNA conjugate, and a blunt end is formed at the 3' end of the sense strand of the double-stranded RNA conjugate. In some embodiments, the 3' end of the sense strand of the double-stranded RNA conjugate forms a blunt end, and the 3' end of the antisense strand of the double-stranded RNA conjugate has 1-2 protruding nucleotides extending out of the double-stranded region. In other embodiments, the 3' end of the sense strand of the double-stranded RNA conjugate forms a blunt end, and the 3' end of the antisense strand of the double-stranded RNA conjugate forms a blunt end.
[0306] In some preferred embodiments, the double-stranded RNA conjugate is obtained by conjugating a double-stranded RNA modified substance to a conjugation group, wherein the sense strand and the antisense strand of the double-stranded RNA modified substance are complementary to form a double-stranded region of the double-stranded RNA modified substance, and the 3' end of the sense strand of the double-stranded RNA modified substance forms a blunt end, and the conjugation group is conjugated to the 3' end of the sense strand having the blunt end to form the double-stranded RNA conjugate.
[0307] Illustratively, the sense strand of the double-stranded RNA modified substance is the sequence shown in sequence A, and the antisense strand is the sequence shown in sequence B connected to sequence E. Furthermore, the 3' end of the sense strand of the double-stranded RNA modified substance is blunt-ended, and the 3' end of the sense strand of the double-stranded RNA modified substance is connected to a conjugated group to form a double-stranded RNA conjugate.
[0308] Illustratively, the sense strand of the double-stranded RNA modified substance is the sequence shown in sequence A, and the antisense strand is the sequence shown in sequence B. Furthermore, the 3' end of the sense strand of the double-stranded RNA modified substance is blunt-ended, and the 3' end of the sense strand of the double-stranded RNA modified substance is connected to a conjugation group to form a double-stranded RNA conjugate.
[0309] Illustratively, the sense strand of the double-stranded RNA modified substance is a sequence represented by sequence A connected to sequence D, and the antisense strand is a sequence represented by sequence B connected to sequence E. Furthermore, the 3' end of the sense strand of the double-stranded RNA modified substance has a protruding sequence D consisting of 1-2 nucleotides. After excluding sequence D at the 3' end of the sense strand of the double-stranded RNA modified substance, a conjugation group is connected to the 3' end of sequence A to form a double-stranded RNA conjugate.
[0310] Illustratively, the sense strand of the double-stranded RNA modified substance is the sequence shown by sequence A connected to sequence D, and the antisense strand is the sequence shown by sequence B. Furthermore, the 3' end of the sense strand of the double-stranded RNA modified substance has a protruding sequence D consisting of 1-2 nucleotides. After excluding sequence D at the 3' end of the sense strand of the double-stranded RNA modified substance, a conjugation group is connected to the 3' end of sequence A to form a double-stranded RNA conjugate.
[0311] Illustratively, the sense strand of the double-stranded RNA modified compound is the sequence shown in sequence A, and the antisense strand is the sequence shown in sequence B connected to sequence E. Sequence A has a protruding nucleotide at the 3' end extending beyond the double-stranded region, and the sequence after excluding the protruding nucleotide at the 3' end of sequence A (also referred to as sequence A') serves as the nucleotide sequence for attaching the conjugated group. Therefore, the nucleotide sequence of the sense strand of the double-stranded RNA conjugate is the sequence shown in sequence A', and the nucleotide sequence of the antisense strand is the sequence shown in sequence B connected to sequence E.
[0312] For example, the sense strand of the double-stranded RNA modified compound is the sequence shown in Sequence A, and the antisense strand is the sequence shown in Sequence B. Sequence A has a protruding nucleotide at the 3' end extending beyond the double-stranded region. The sequence after excluding the protruding nucleotide at the 3' end of Sequence A (also referred to as Sequence A') serves as the nucleotide sequence for attaching the conjugated group. Therefore, the nucleotide sequence of the sense strand of the double-stranded RNA conjugate is the sequence shown in Sequence A', and the nucleotide sequence of the antisense strand is the sequence shown in Sequence B.
[0313] For example, the siRNA conjugate shown as N-ER-FY045016M3L96 is a conjugate obtained by combining a modified product of N-ER-FY045016M3 with a conjugating group. Based on the sequence of N-ER-FY045016M3, the 3' end of the sense strand of the conjugate originally has a protruding nucleotide -smCsmC extending out of the double-stranded region. Before binding to the conjugating group, the protruding -smCsmC nucleotide at the 3' end of the sense strand is removed to form a conjugate containing 5'-mCsmAsmGmCmAmGGfmAUfCfCfmAmGmCmAmAmCmUmCmUmU-3' (SEQ ID The blunt-ended sequence of SEQ ID NO: 105 was used as the nucleotide sequence for linking the L96 conjugation group (i.e., L96 was linked via a phosphodiester bond after the sequence was synthesized to the blunt end). Therefore, the sequence forming the siRNA conjugate was: the sense strand was 5'-mCsmAsmGmCmAmGGfmAUfCfCfmAmGmCmAmAmCmUmCmUmUL96-3' (SEQ ID NO: 166), and the antisense strand was 5'-P1mAsAfsmGmAmGUfmUGfCfmUmGmGmAUfmCCfmUmGmCmUmGsmUsmU-3' (SEQ ID NO: 122).
[0314] Furthermore, the double-stranded RNA conjugate is an siRNA conjugate, wherein the siRNA molecule connected to the conjugation group in the siRNA conjugate can be an unmodified siRNA or a modified siRNA. The siRNA molecule modified with the conjugation group maintains high inhibitory activity and stability while also having good tissue and organ targeting and the ability to promote cellular endocytosis, which can reduce the impact on other tissues or organs and reduce the amount of siRNA molecules used, thereby achieving the purpose of reducing toxicity and reducing costs. Optionally, any one of the siRNA molecules shown in Table 1, Table 1-1 or Table 2 is selected and connected to the conjugation group to obtain a double-stranded RNA conjugate.
[0315] The conjugation site of the siRNA to the conjugated group can be at the 3' end or 5' end of the siRNA sense strand, at the 5' end of the antisense strand, or in the internal sequence of the siRNA. In some embodiments, the conjugation site of the siRNA to the conjugated group is at the 3' end of the siRNA sense strand.
[0316] In some embodiments, the conjugate group can be connected to the phosphate group, 2'-hydroxyl group or base of the nucleotide. In some embodiments, the conjugate group can also be connected to the 3'-hydroxyl group, in which case the nucleotides are connected by a 2', 5'-phosphodiester bond. When the conjugate group is connected to the end of the siRNA chain, the conjugate group is usually connected to the phosphate group of the nucleotide; when the conjugate group is connected to the internal sequence of the siRNA, the conjugate group is usually connected to the ribose sugar ring or the base. Various connection methods can be referred to in the literature: Muthiah Manoharan et.al.siRNA conjugates carrying sequentially assembled trivalent N-acetylgalactosamine linked through nucleosides elicit robust gene silencing in vivo inhepatocytes.ACS Chemical biology, 2015, 10(5): 1181-7.
[0317] In the present disclosure, the conjugated group can be a ligand conventionally used in the field of siRNA administration. In some embodiments, the conjugated group can be selected from one or more of the ligands formed by the following targeting molecules or their derivatives: lipophilic molecules, such as cholesterol, bile acid, vitamins (such as vitamin E), lipid molecules of different chain lengths; polymers, such as polyethylene glycol; polypeptides, such as membrane-permeable peptides; aptamers; antibodies; quantum dots; carbohydrates, such as lactose, polylactose, mannose, galactose, N-acetylgalactosamine (GalNAc); folic acid (folate); receptor ligands expressed by hepatocytes, such as asialoglycoproteins, asialoglycosylated residues, lipoproteins (such as high-density lipoproteins, low-density lipoproteins, etc.), glucagon, neurotransmitters (such as epinephrine), growth factors, transferrin, etc.
[0318] In some specific embodiments, the conjugated group has a structure as shown in any one of the above formulas I, III, IV, V, VI, VII, VIII, and IX (wherein a phosphate bond or a thiophosphate bond portion is exemplarily shown in some conjugated groups).
[0319] The conjugated group shown in Formula I is GalNAc. GalNAc has liver targeting properties and can deliver siRNA molecules to liver tissue with high specificity, specifically inhibiting the high expression of the ANGPTL4 gene in the liver.
[0320] In some specific embodiments, GalNAc is conjugated to the 3' end of the sense strand via a phosphodiester bond to obtain an siRNA conjugate with the following structure:
[0321]
[0322] The double helix structure is unmodified siRNA or siRNA modification.
[0323] In some embodiments, double-stranded ribonucleic acid conjugates include, but are not limited to, siRNA conjugates as shown in Table 3.
[0324] Preferably, the sense strand comprises the sense strand of any one of the siRNA conjugates siRNA 181, siRNA 189, or siRNA 198 shown in Table 3 herein, and the antisense strand comprises the antisense strand of the corresponding siRNA conjugate.
[0325] In some specific embodiments, the siRNA conjugates of the present disclosure inhibit the ANGPTL4 gene by at least about 10%, and may be at least about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or a value or range between any two of these values.
[0326] As used herein, "prodrug" refers to a compound that can be converted into an active compound by certain chemical or physiological processes (e.g., enzymatic processes and metabolic hydrolysis). Therefore, the term "prodrug" also refers to a precursor of a pharmaceutically acceptable biologically active compound.
[0327] In this article, considering the situation where the 5' terminal nucleotide of the antisense chain is connected to the 5' hydroxyl group (i.e., there is no phosphate group), such an antisense chain will first be phosphorylated in the body to convert the 5' terminal nucleotide into a nucleotide carrying a 5' phosphate group, and then play a role in the body. Therefore, in the present invention, such siRNA, siRNA modifications, and siRNA conjugates are also referred to as prodrugs. For example, in this application, an siRNA modification or conjugate with an M6 pattern modification is a prodrug of an siRNA modification or conjugate with an M2 pattern modification, because the difference between the M2 pattern modification and the M6 pattern modification is whether the 5' end of the antisense chain has P1. Similarly, the relationship between the M7 pattern modification and the M3 pattern modification is the same. Therefore, the double-stranded ribonucleic acid herein includes its corresponding prodrug.
[0328] Pharmaceutical composition
[0329] The fourth aspect of the present disclosure provides a pharmaceutical composition comprising one or more of the double-stranded RNA described in the first aspect, the double-stranded RNA modification described in the second aspect, and the double-stranded RNA conjugate or its prodrug described in the third aspect.
[0330] In some embodiments, the pharmaceutical composition contains siRNA as described above as an active ingredient and a pharmaceutically acceptable carrier. In the present disclosure, the purpose of using the pharmaceutical composition is to promote the administration for an organism, which is conducive to the absorption of the active ingredient and then exerts biological activity. The pharmaceutical composition of the present disclosure can be administered in any form, including injection (intra-arterial, intravenous, intramuscular, intraperitoneal, subcutaneous), mucosal, oral (oral solid preparations, oral liquid preparations), rectal, inhalation, implantation, local (e.g., eye) administration, etc. Non-limiting examples of oral solid preparations include but are not limited to powders, capsules, lozenges, granules, tablets, etc. Non-limiting examples of liquid preparations for oral or mucosal administration include but are not limited to suspensions, tinctures, elixirs, solutions, etc. Non-limiting examples of topical preparations include but are not limited to emulsions, gels, ointments, creams, patches, pastes, foams, lotions, drops or serum preparations. Non-limiting examples of parenteral preparations include but are not limited to solutions for injection, dry powders for injection, suspensions for injection, emulsions for injection, etc. The pharmaceutical compositions of the present disclosure can also be formulated into controlled-release or delayed-release dosage forms (eg, liposomes or microspheres).
[0331] In the present disclosure, the route of administration can be varied or adjusted in any applicable manner to suit the nature of the drug, the convenience of the patient and medical personnel, and other relevant factors.
[0332] Medical uses
[0333] The fifth aspect of the present disclosure provides at least one of the following uses of a double-stranded RNA, a double-stranded RNA modification, a double-stranded RNA conjugate, or a prodrug thereof:
[0334] (1) Inhibiting ANGPTL4 gene expression, or preparing a drug for inhibiting ANGPTL4 gene expression;
[0335] (2) for preventing or treating a disease associated with abnormal expression of the ANGPTL4 gene, or for preparing a drug for preventing or treating a disease associated with abnormal expression of the ANGPTL4 gene;
[0336] (3) for treating a subject suffering from a disease that would benefit from reduced expression of an ANGPTL4 gene, or for preparing a medicament for treating a subject suffering from a disease that would benefit from reduced expression of an ANGPTL4 gene.
[0337] The present disclosure further provides the use of siRNA molecules (including unmodified siRNA, siRNA modifications, and siRNA conjugates) or pharmaceutical compositions in at least one of the above (1)-(3).
[0338] In the present disclosure, abnormal expression of the ANGPTL4 gene causes one or more of the following diseases related to abnormal expression of the ANGPTL4 gene: breast cancer, hepatitis C, glucose metabolism disorders (including but not limited to one or more of diabetes, fructose metabolism disorders, and glycogen storage diseases), lipid metabolism disorders, vascular dysfunction, cardiovascular and cerebrovascular diseases (including but not limited to coronary heart disease), kidney disease, inflammatory diseases, etc.
[0339] The siRNA molecule causes the expression of the ANGPTL4 gene to be inhibited by at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98% or at least about 99%, thereby treating diseases related to abnormal expression of the ANGPTL4 gene.
[0340] In some embodiments, the present disclosure provides a method for inhibiting ANGPTL4 gene expression in a cell, comprising contacting the cell with a double-stranded RNA, a double-stranded RNA modification, a double-stranded RNA conjugate, or a pharmaceutical composition.
[0341] Furthermore, the method for inhibiting the expression of the ANGPTL4 gene in cells is to introduce siRNA molecules (including unmodified siRNA, siRNA modifications, siRNA conjugates) or pharmaceutical compositions into the cells.
[0342] In some embodiments, the cell is an in vivo cell or an in vitro cell. In some specific embodiments, the cell is in a subject.
[0343] In some embodiments, the present disclosure provides a method for preventing or treating a disease, comprising administering a double-stranded RNA, a double-stranded RNA modification, a double-stranded RNA conjugate, or a pharmaceutical composition to a subject.
[0344] Furthermore, the method for preventing or treating a disease is to administer an siRNA molecule (including unmodified siRNA, siRNA modifications, siRNA conjugates) or a pharmaceutical composition to a subject.
[0345] In the present disclosure, a "subject" includes either a human or a non-human animal, preferably a vertebrate, and more preferably a mammal. The subject may include a transgenic organism. Most preferably, the subject is a human. Further, the subject has at least one of the following characteristics:
[0346] (1) Abnormal expression of the ANGPTL4 gene in vivo, more specifically, abnormally high expression of the ANGPTL4 gene;
[0347] (2) suffer from diseases related to abnormal expression of the ANGPTL4 gene;
[0348] (3) Those suffering from a disease that would benefit from reduced ANGPTL4 gene expression, such as those suffering from or prone to a disease associated with abnormal ANGPTL4 gene expression.
[0349] Table 1 siRNA sequence information
[0350]
[0351]
[0352]
[0353] Table 1-1
[0354]
[0355]
[0356] Table 2 siRNA modifications
[0357]
[0358]
[0359]
[0360]
[0361]
[0362]
[0363]
[0364] In the above table, the capital letters "G", "C", "A", "T" and "U" each generally represent a nucleotide containing guanine, cytosine, adenine, thymine and uracil as a base respectively; mA, mU, mC, mG: represent 2'-methoxy modified nucleotides; Af, Gf, Cf, Uf: represent 2'-fluoro modified nucleotides; the lowercase letter s indicates that the two nucleotides adjacent to the letter s and the nucleotide and (invAb) are connected by a phosphorothioate diester bond; "dG", "dC", "dA": indicate that the ribonucleotide at the corresponding position in the motif sequence is replaced by a 2'-deoxyribonucleotide; when "T" is at the overhang position, represents thymine ribonucleotide (T), and when "T" is in the double-stranded region of the motif, it indicates that the uracil ribonucleotide (U) at the corresponding position in the motif sequence is replaced by thymine ribonucleotide (T); P1: indicates that the nucleotide adjacent to the right of P1 is a 5'-phosphate nucleotide; EVP: indicates a 5'-trans vinyl phosphonate group (i.e., the nucleotide adjacent to the right of EVP is a trans vinyl phosphonate nucleotide); [GNA] indicates that the ribonucleotide adjacent to the right is a GNA-modified ribonucleotide (GNA-modified ribonucleotide indicates that the ribonucleotide is replaced by GNA); (invAb) is an inverted abasic deoxyribose residue.
[0365] Table 3 siRNA conjugates
[0366]
[0367]
[0368]
[0369]
[0370]
[0371]
[0372] In the above table, the capital letters "G", "C", "A", "T" and "U" each generally represent a nucleotide containing guanine, cytosine, adenine, thymine and uracil as a base respectively; mA, mU, mC, mG: represent 2'-methoxy modified nucleotides; Af, Gf, Cf, Uf: represent 2'-fluoro modified nucleotides; the lowercase letter s indicates that the two nucleotides adjacent to the letter s and the nucleotide and (invAb) are connected by a phosphorothioate diester bond; "dG", "dC", "dA": indicate that the ribonucleotide at the corresponding position in the motif sequence is replaced by a 2'-deoxyribonucleotide; when "T" is at the overhang position, it represents a thymine ribonucleotide (T), and when "T" is in the double-stranded region of the motif, it indicates that the uracil ribonucleotide (U) at the corresponding position in the motif sequence is replaced by a thymine ribonucleotide (T); P1: indicates that the nucleotide adjacent to the right of P1 is a 5'-phosphate nucleotide; EVP: indicates a 5'-trans vinyl phosphonate group (i.e., the nucleotide adjacent to the right of EVP is a trans vinyl phosphonate nucleotide); [GNA] indicates that the ribonucleotide adjacent to the right is a GNA-modified ribonucleotide (GNA-modified ribonucleotide indicates that the ribonucleotide is replaced by GNA); L96 is the conjugate group GalNAc shown in formula I; (invAb) is a reverse abasic deoxyribose residue.
[0373] L96 in Table 3 is connected to the 3' end of the sense strand in Table 2 or the blunt end formed by the 3' end of the sense strand via a phosphodiester bond. L96 is also the conjugate group GalNAc shown in Formula I.
[0374] In Table 1, Table 1-1, Table 2 and Table 3, if the left side of the 5' terminal nucleotide of the sense strand, modified sense strand and modified sense strand connected to the conjugate group is not labeled with EVP, P1 or (invAb), it means that the ribose group of the 5' terminal nucleotide is a 5' hydroxyl group, and its structure is shown in Formula X:
[0375]
[0376] Wherein, Base represents a base, such as A, U, G, C or T; R is a hydroxyl group or is substituted by various groups known to those skilled in the art, for example, R can be 2'-fluoro (2'-F), 2'-alkoxy, 2'-substituted alkoxy, 2'-alkyl, 2'-substituted alkyl, 2'-amino, 2'-substituted amino, or 2'-deoxynucleotide.
[0377] In Table 1, Table 1-1, Table 2 and Table 3, if the left side of the 5' terminal nucleotide of the antisense strand and the modified antisense strand is not marked with EVP or P1, it means that the ribose group of the 5' terminal nucleotide is a 5' hydroxyl group, and its structure is also shown in Formula X.
[0378] In Table 1, Table 1-1 and Table 2, when the 3' ends of the sense strand and the modified sense strand are not linked (invAb), the 3' position of the 3' terminal nucleotide of the sense strand and the modified sense strand is a hydroxyl group.
[0379] The 3' position of the 3' terminal nucleotide of the antisense strand and the modified antisense strand in Table 1, Table 1-1, Table 2 and Table 3 is a hydroxyl group.
[0380] In Table 2, in the modified sense chain,
[0381] When (invAb) is located at the 3' end, the structure of (invAb) is
[0382] When (invAb) is located at the 5' end, the structure of (invAb) is
[0383] Example
[0384] Other objects, features and advantages of the present disclosure will become apparent from the following detailed description. However, it should be understood that the detailed description and specific examples (although indicating specific embodiments of the present disclosure) are given for illustrative purposes only, as various changes and modifications within the spirit and scope of the present disclosure will become apparent to those skilled in the art after reading the detailed description.
[0385] The experimental techniques and methods used in this example are conventional unless otherwise specified. For example, in the following examples, where specific conditions are not specified, conventional conditions such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989) or the conditions recommended by the manufacturer are generally followed. Materials and reagents used in the examples were obtained through commercial channels unless otherwise specified.
[0386] The siRNA, siRNA modifications, and siRNA conjugates involved in the following examples were synthesized by Tianlin Biotechnology (Shanghai) Co., Ltd. The cells and reagents used in the examples are as follows:
[0387] Table 4
[0388]
[0389] Example 1: Synthesis of siRNA
[0390] 1.1 siRNA sequence design
[0391] Based on the human ANGPTL4 gene mRNA sequence, multiple pairs of ANGPTL4 siRNAs were designed at different sites. All designed single siRNAs were able to target all transcripts of the target gene (as shown in Table 5). These multiple pairs of siRNAs showed minimal homology with all other non-target gene sequences after sequence similarity comparison using sequence similarity software.
[0392] Table 5
[0393] target gene species Gene ID NM_ID ANGPTL4 Homo sapiens 51129 NM_139314.3
[0394] The target sequence used for siRNA design is shown below. The target sequence is derived from the ANGPTL4 gene mRNA sequence (see NM_139314.3). For ease of comparison, the target sequence below is represented by the DNA sequence corresponding to the mRNA. In the synthesis process of this example, when ribonucleotides are added, the position corresponding to T is uracil ribonucleotide U or modified U.
[0395] Target sequence I:
[0396] TTGCGTCCTGGGACGAGATGAATGTCC(SEQ ID NO:1)
[0397] Target sequence II:
[0398] CCCTGAGGTCCTTCACAGCCTGCAGACACAACTCAAGGCTCAGAACAGCAGGATCCAGC AACTCTTCCACAAGGTGGCCCAGCAGCAGCGGCACCTGGAGAAGCAGCACCTGCGAATTCAGC ATCT (SEQ ID NO: 2)
[0399] Target sequence II-1:
[0400] CCCTGAGGTCCTTCACAGCCTGCAGACACAACTCAAGGC(SEQ ID NO:6)
[0401] Target sequence II-2:
[0402] CAGAACAGCAGGATCCAGCAACTCTTCCACA(SEQ ID NO:7)
[0403] Target sequence II-3:
[0404] GAAGCAGCACCTGCGAATTCAGCATCT(SEQ ID NO:8)
[0405] Target sequence III:
[0406] TTGGGGAGAGGCAGAGTGGACTATTTGAAATCCAGCCTCAGGGGTCTCCGCCATTTTTGG TGAACTGCAAGATGACCTCAGATGGAGGCTGGACAGTAATTCAGA(SEQ ID NO:3)
[0407] Target sequence III-1:
[0408] TTGGGGAGAGGCAGAGTGGACTATTTGAAATC(SEQ ID NO:9)
[0409] Target sequence III-2:
[0410] GTTCTCCGCCATTTTTGGTGAACTGCAAGATGACC(SEQ ID NO:10)
[0411] Target sequence III-3:
[0412] TGGAGGCTGGACAGTAATTCAGA(SEQ ID NO:11)
[0413] Target sequence IV:
[0414] AGGGAATCTTCTGGAAGACCTGG(SEQ ID NO:4)
[0415] Target sequence V:
[0416] TATCTGGGCGGAGCTCACAGAGTTCTTGGAATAAAAGCAACCTCAGAACA(SEQ ID NO:5)
[0417] 1.2 Description of synthesis method:
[0418] Using the solid-phase phosphoramidite method, nucleoside monomers are linked one by one in the 3'-5' direction according to the nucleotide arrangement order. Each linking of a nucleoside monomer includes a four-step reaction of deprotection, coupling, oxidation or sulfurization, and capping. Specifically, when two nucleotides are linked by a phosphodiester bond, the subsequent linking of a nucleoside monomer involves a four-step reaction of deprotection, coupling, oxidation, and capping. When two nucleotides are linked by a phosphorothioate diester bond, the subsequent linking of a nucleoside monomer involves a four-step reaction of deprotection, coupling, sulfurization, and capping. The present invention selects nucleotide monomers based on the target sequence for synthesis. The selected nucleotide monomers are commonly used by those skilled in the art. For example, the nucleotide monomer for synthesizing A can be, but is not limited to, adenosine-3-phosphate. It should be understood that these monomers, when present in an oligonucleotide, can be linked to each other via a 5'-3' phosphodiester bond or a 5'-3' phosphorothioate diester bond. When, for example, the 3' position of the last nucleotide in the 5' to 3' direction is a hydroxyl group, this is achieved using conventional means in the art.
[0419] 1.3 Synthesis conditions are given as follows:
[0420] The nucleoside monomers were provided as a 0.1 M acetonitrile solution. The deprotection reaction conditions for each step were the same, namely, a temperature of 25°C, a reaction time of 70 seconds, and a deprotection reagent of 3% v / v dichloroacetic acid in dichloromethane. The molar ratio of dichloroacetic acid to the 4,4'-dimethoxytrityl protecting group on the solid support was 5:1.
[0421] The coupling reaction conditions were the same for each step, including a temperature of 25°C, a molar ratio of the nucleic acid sequence attached to the solid support to the nucleoside monomer of 1:10, a molar ratio of the nucleic acid sequence attached to the solid support to the coupling reagent of 1:65, a reaction time of 600 seconds, and a coupling reagent of 0.5 M acetonitrile solution of 5-ethylthio-1H-tetrazole.
[0422] The oxidation reaction conditions for each step were identical, including a temperature of 25°C, a reaction time of 15 seconds, and 0.05 M iodine-water as the oxidizing agent. The molar ratio of iodine to the nucleic acid sequence attached to the solid support during the coupling step was 30:1. The reaction was carried out in a mixed solvent of tetrahydrofuran: water: pyridine = 3:1:1 (volume ratio).
[0423] The sulfurization reaction conditions for each step were identical, including a temperature of 25°C, a reaction time of 300 seconds, and the sulfurization reagent being hydroxanthin. The molar ratio of the sulfurization reagent to the nucleic acid sequence attached to the solid support during the coupling step was 120:1. The reactions were performed in a mixed solvent of acetonitrile:pyridine = 1:1 (volume ratio).
[0424] The capping conditions were identical for each step, including a temperature of 25°C and a reaction time of 15 seconds. The capping reagent solution consisted of a 1:1 molar mixture of CapA and CapB. The molar ratio of capping reagent to the nucleic acid sequence attached to the solid support was 1:1:1 acetic anhydride:N-methylimidazole:nucleic acid sequence attached to the solid support.
[0425] After the last nucleoside monomer is connected, the nucleic acid sequence connected to the solid phase support is cut, aminolyzed, purified, desalted, and then freeze-dried to obtain the sense chain and antisense chain; finally, the two chains are heated and annealed to obtain the product, which is freeze-dried to obtain freeze-dried powder.
[0426] The synthesized siRNAs are shown in Table 1 and Table 1-1, and the synthesized siRNA modifications are shown in Table 2.
[0427] Example 2: Synthesis of siRNA conjugate (GalNAc-siRNA)
[0428] 2.1 The siRNA conjugate has the structure shown in Formula II below:
[0429]
[0430] 2.2 Synthesis of siRNA conjugates
[0431] Take L96 as an example:
[0432] In the first step, DMTr-L96 and succinic anhydride are reacted to obtain compound L96-A:
[0433]
[0434] Preparation: DMTr-L96, succinic anhydride, 4-dimethylaminopyridine, and diisopropylethylamine were added to dichloromethane and stirred at 25°C for 24 hours. The reaction solution was then washed with 0.5M triethylamine phosphate. The aqueous phase was washed three times with dichloromethane. The combined organic phases were evaporated to dryness under reduced pressure to obtain the crude product. Purification by column chromatography afforded pure L96-A.
[0435] In the second step, L96-A is reacted with NH2-SPS to obtain L96-B:
[0436]
[0437] Preparation process: L96-A, O-benzotriazole-tetramethyluronium hexafluorophosphate (HBTU), and diisopropylethylamine (DIPEA) were mixed and dissolved in acetonitrile. Stir at room temperature for 5 minutes to obtain a homogeneous solution. Aminomethyl resin (100-200 mesh) was added to the reaction liquid and the reaction was shaken at 25°C. After 18 hours of reaction, the mixture was filtered and washed with dichloromethane and acetonitrile to obtain a filter cake. The resulting filter cake was capped with a CapA / CapB mixture to obtain L96-B, which is the solid support containing the conjugated molecule.
[0438] Step 3: Synthesis of siRNA conjugates:
[0439] L96-B was used as a solid phase carrier to synthesize the sense strand of the siRNA conjugate according to the siRNA synthesis method described above, and the antisense strand of the siRNA conjugate was synthesized using the siRNA synthesis method described above, and annealing was performed to generate the siRNA conjugate of this application.
[0440] The synthesized siRNA conjugates are shown in Table 3.
[0441] Example 3: siRNA and siRNA modifications inhibit ANGPTL4 gene expression
[0442] 3.1 Experimental Materials
[0443] Huh7 cells were provided by Shanghai WuXi AppTec Co., Ltd., catalog number JCRB0403;
[0444] RNA extraction kit, 96Kit, purchased from QIAGEN, catalog number QIAGEN-74182;
[0445] RNAiMAX transfection reagent, purchased from Invitrogen, catalog number 13778-150;
[0446] FastStart Universal SYBR Green Master, purchased from Roche, catalog number 04914058001;
[0447] Dulbecco's Modified Eagle Medium, purchased from Gibco, product number 11965-092;
[0448] Fastking RT Kit (with gDNase), purchased from TIANGEN, catalog number KR116-02;
[0449] Opti-medium: Reduced serum medium, purchased from Gibco, catalog number 31985-070;
[0450] AO / PI, purchased from Countstar, product number RE010212;
[0451] FBS, purchased from Gibco, catalog number 10099141;
[0452] ANGPTL4 forward primer, purchased from Sangon Biotech, catalog number 2800327537;
[0453] ANGPTL4 reverse primer, purchased from Sangon Biotech, catalog number 2800327538;
[0454] GAPDH forward primer, purchased from Sangon Biotech, catalog number 2800263525;
[0455] GAPDH reverse primer was purchased from Sangon Biotech, catalog number 2800263526.
[0456] 3.2 Experimental methods:
[0457] 3.2.1 Huh7 cells were digested to prepare cell suspension. 20 μL of cell suspension was taken and mixed with AO / PI. The cells were counted using Countstar. The cell suspension was diluted with 10% FBSDMEM to the desired final cell density of 2×10 5 cells / mL.
[0458] 3.2.2 Dry powders of the test siRNA, siRNA modifications, and siRNA conjugates (collectively referred to as siRNA in the experimental process of this example for ease of description) were centrifuged at low temperature and high speed, and then dissolved in ultrapure distilled water to prepare a 100 μM siRNA stock solution.
[0459] 3.2.3 Preparation of 20 nM siRNA diluent Z and 2 nM siRNA diluent W
[0460] (1) Preparation of 0.1 μM siRNA Stock Solution Y and 0.01 μM siRNA Stock Solution E:
[0461] a) Take 2 μL of the 100 μM siRNA stock solution prepared in step 3.2.2 above and add 18 μL of ultrapure distilled water to obtain a siRNA dilution solution with a final concentration of 10 μM;
[0462] b) taking 2 μL of the 10 μM siRNA dilution prepared in step a) and adding 18 μL of ultrapure distilled water to obtain siRNA stock solution Q with a final concentration of 1 μM;
[0463] c) taking 2 μL of the 1 μM siRNA stock solution Q prepared in step b), adding 18 μL of ultrapure distilled water to obtain siRNA stock solution Y with a final concentration of 0.1 μM;
[0464] d) taking 2 μL of the 0.1 μM siRNA stock solution Y prepared in step c) and adding 18 μL of ultrapure distilled water to obtain siRNA stock solution E with a final concentration of 0.01 μM;
[0465] (2) Take 2 μL of the prepared siRNA stock solution Y and siRNA stock solution E, and add 8 μL of Opti-medium to obtain 20 nM siRNA dilution solution Z and 2 nM siRNA dilution solution W, respectively.
[0466] 3.2.4 Transfection of Huh7 cells
[0467] (1) Take 3 μL of RNAiMAX transfection reagent was added to 97 μL of Opti-medium to obtain RNAiMAX transfection reagent diluent; Prepare a transfection mixture by mixing RNAiMAX transfection reagent diluent and 20 nM siRNA diluent Z prepared in step 3.2.3 at a volume ratio of 1:1. Let it stand for 5 minutes. Then, add 10 μL of the transfection mixture to a 96-well plate to transfect the Huh7 cells cultured in step 3.2.1 (final volume 100 μL, siRNA concentration in this system is 1 nM).
[0468] (2) Take 3 μL of RNAiMAX transfection reagent was added to 97 μL of Opti-medium to obtain RNAiMAX transfection reagent diluent; RNAiMAX transfection reagent diluent and 2 nM siRNA diluent W prepared in step 3.2.3 were mixed in a 1:1 volume ratio to prepare a transfection mixture. The mixture was allowed to stand for 5 minutes. 10 μL of the transfection mixture was added to a 96-well plate to transfect the Huh7 cells cultured in step 3.2.1 (final volume 100 μL, siRNA concentration in this system was 0.1 nM).
[0469] The cells were cultured for 48 hours after transfection; two replicates were set for each concentration (1 nM and 0.1 nM).
[0470] 3.2.5 Utilization According to the 96Kit instruction manual, total RNA was extracted from Huh7 cells obtained in 3.2.4.
[0471] 3.2.6 Reverse transcribe the extracted total RNA into cDNA using the Fastking RT Kit (with gDNase) by following the steps below:
[0472] a) Remove gDNA using gDNAase according to the table below;
[0473] Table 6
[0474] Volume / μL 5×g DNA Buffer 2 Sample(RNA) 8
[0475] 42℃, 3min; 4℃, let stand
[0476] b) adding the following reagents to the system obtained in step a) and performing reverse transcription;
[0477] Table 7
[0478] Volume / μL The mixed solution obtained in step a) 10 FastKing RT Enzyme Mix 1 FQ-RT Primer Mix 2 10× King RT Buffer 2 <![CDATA[RNase-Free ddH2O]]> 5
[0479] 42℃, 15min; 95℃, 3min.
[0480] c) The reverse transcription product obtained in step b) was stored at -20°C for real-time PCR analysis.
[0481] 3.2.7 Real-time PCR analysis
[0482] a) Prepare the qPCR reaction mixture as shown in the table below. Keep all reagents on ice throughout the entire procedure.
[0483] Table 8
[0484] Components Volume / (μL,1×reaction) FastStart Universal SYBR Green Master 5 ANGPTL4 forward primer (10 μM) 0.4 ANGPTL4 reverse primer (10 μM) 0.4 cDNA obtained in step 3.2.6 2 <![CDATA[RNase-free ddH2O]]> 2.2 Total volume 10 Components Volume / (μL,1×reaction) FastStart Universal Probe Master 5 GAPDH forward primer (10 μM) 0.4 GAPDH reverse primer (10 μM) 0.4 GAPDH cDNA obtained in step 3.2.6 2 <![CDATA[RNase-free ddH2O]]> 2.2 Total volume 10
[0485] b) Perform qPCR procedure as follows
[0486] 50℃, 2 minutes;
[0487] 95°C, 10 minutes;
[0488] 95°C, 15 seconds, 60°C, 1 minute (40 cycles of this operation).
[0489] 3.2.8 Result Analysis
[0490] a) Quant Studio 6Flex software was used with default settings to automatically calculate Ct values;
[0491] b) Calculate the relative gene expression using the following formula:
[0492] ΔCt=Ct(ANGPTL4 gene)–Ct(GAPDH)
[0493] ΔΔCt = ΔCt (test sample group) - ΔCt (mock group)
[0494] mRNA expression relative to the Mock group = 2 -ΔΔCt .
[0495] The Mock group represents a group without the addition of siRNA compared to the test sample group.
[0496] Inhibition rate (%) = (relative mRNA expression level of the Mock group - relative mRNA expression level of the test sample group) / relative mRNA expression level of the Mock group × 100%
[0497] 3.3 Silence test results
[0498] 3.3.1 Concentrations of 0.1 nM and 1 nM were selected for testing. The results are shown in Tables 9, 10, and 11 below.
[0499] Table 9
[0500]
[0501] Table 10
[0502]
[0503] Table 11
[0504]
[0505]
[0506] Table 11-1 Control sequence
[0507]
[0508] Note: “--” results are not shown.
[0509] As can be seen from Tables 9, 10, and 11, the siRNA, siRNA modifications, and siRNA conjugates provided by the present disclosure exhibit excellent inhibitory effects on the ANGPTL4 gene.
[0510] 3.3.2IC 50 Measurement results
[0511] The following siRNA concentration ranges (nM) were set as follows: 10, 2.5, 0.625, 0.156, 0.039, 0.0097, 0.0024, 0.0006, and IC values were determined similarly to those in 3.2. 50 Determination.
[0512] Result analysis:
[0513] a) Quant Studio 6Flex software was used with default settings to automatically calculate Ct values;
[0514] b) Calculate the relative gene expression using the following formula:
[0515] ΔCt=Ct(ANGPTL4 gene)–Ct(GAPDH)
[0516] ΔΔCt=ΔCt(test sample group)–ΔCt(Mock group), where the Mock group represents the group without siRNA compared with the test sample group;
[0517] mRNA expression relative to the Mock group = 2 -ΔΔCt
[0518] Inhibition rate (%) = (relative mRNA expression level of the Mock group - relative mRNA expression level of the test sample group) / relative mRNA expression level of the Mock group × 100%
[0519] The log value of siRNA concentration was used as the X-axis and the percentage inhibition rate was used as the Y-axis. The “log (inhibitor) vs. response-variable slope” function module of the analysis software GraphPadPrism 8 was used to fit the dose-effect curve to obtain the IC of each siRNA. 50 value.
[0520] The fitting formula is: Y = Bottom + (Top-Bottom) / (1 + 10^((logIC 50 -X)*HillSlope))
[0521] Among them: Top represents the percentage inhibition rate at the top platform, and the top standard of the curve is generally between 80% and 120%; Bottom represents the percentage inhibition rate at the bottom platform, and the bottom of the curve is generally between -20% and 20%; HillSlope represents the slope of the percentage inhibition rate curve.
[0522] The results are shown in Table 12 below.
[0523] Table 12
[0524] siRNA ID <![CDATA[IC 50 (nM)]]> N-ER-FY045016M2 1.025 N-ER-FY045054M2 0.648 N-ER-FY045055M2 0.316 N-ER-FY045058M2 0.206 N-ER-FY045023M50L96 0.2487 N-ER-FY045080M50L96 0.0332
[0525] As can be seen from Table 12, the siRNA modifications and siRNA conjugates provided by the present disclosure exhibit excellent inhibitory effects on the ANGPTL4 gene.
[0526] Example 4: Determination of the inhibition rate of siRNA conjugates in inhibiting ANGPTL4 gene expression
[0527] 4.1 Test materials:
[0528] Primary human hepatocytes PHH cells were provided by Huizhiheyuan Biotechnology (Suzhou) Co., Ltd.
[0529] PHH medium was provided by Huizhiheyuan Biotechnology (Suzhou) Co., Ltd.;
[0530] RNAiMAX transfection reagent, purchased from Invitrogen, catalog number: 13778-150;
[0531] RNA extraction kit, purchased from QIAGEN, catalog number: QIAGEN-74106;
[0532] Reverse transcription kit, purchased from Vazyme, catalog number: R312-02;
[0533] FastStart Universal Probe master, purchased from Roche, catalog number: 04914058001;
[0534] TaqMan TM Gene expression master mix, purchased from Applied Biosystems, catalog number: 4369016;
[0535] ANGPTL4 probe, purchased from Thermo, catalog number: Hs01101123_g1;
[0536] GAPDH probe was purchased from Thermo, catalog number: Hs99999905_m1.
[0537] 4.2 Test methods
[0538] 4.2.1 Total RNA extraction
[0539] siRNA conjugates (final concentrations of siRNA conjugates were 5 nM and 1 nM, respectively, in duplicate) were transfected into PHH cells by the following process: frozen PHH cells were taken, revived, counted, and the number of cells was adjusted to 6 × 10 5 cells / mL, applied simultaneously siRNA conjugates were transfected into cells using RNAiMax transfection reagent. Cells were seeded at a density of 54,000 cells per well in a 96-well plate with 100 μL of culture medium per well. The cells were cultured in a 5% CO2, 37°C incubator. After 48 hours, the culture medium was removed and the cells were harvested for total RNA extraction. Total RNA was extracted using an RNA extraction kit according to the kit's instructions.
[0540] siRNA conjugates (final concentrations of siRNA conjugates were 200 nM and 10 nM, respectively, in duplicate) were freely taken up by PHH cells. The process was as follows: frozen PHH cells were taken, revived, counted, and the cell density was adjusted to 6 × 10 5 Cells / mL were added, and siRNA conjugates were added at the same time. Cells were seeded into 96-well plates at a density of 54,000 cells per well, with 100 μL of culture medium per well. Cells were cultured in a 5% CO2, 37°C incubator. After 48 hours, the culture medium was removed and the cells were collected for total RNA extraction. Use according to the kit product instructions. Total RNA was extracted using 96Kit.
[0541] 4.2.2 Reverse transcription (RNA to cDNA)
[0542] 1) Take 12 μL of the total RNA obtained in step 4.2.1 above and perform reverse transcription;
[0543] 2) Prepare the first step reverse transcription reaction mixture as shown in Table 13 and mix thoroughly. Keep all reagents on ice throughout the entire operation.
[0544] Table 13
[0545] Components Volume / (μL) 5×gDNA wiper mix 2 Total RNA 50-80ng <![CDATA[RNase-free ddH2O]]> Make up to 10 μL
[0546] 42°C, 2 min;
[0547] 3) Prepare the second-step reverse transcription reaction mixture as shown in Table 14 below and mix thoroughly;
[0548] Table 14
[0549] Components Volume / (μL) The mixed solution obtained in step 2) 10 10×RT Mix 2 HiScriptⅢEnzyme Mix 2 <![CDATA[Oligo(dT) 20 VN]]> 1 Random hexamers 1 <![CDATA[RNase-free ddH2O]]> 4
[0550] 4) Second step reverse transcription procedure: 50°C, 15 min, 85°C, 5 s, store at 4°C.
[0551] 4.2.3 Amplification and Analysis
[0552] 1) Add 50 μL of RNase-free ddH2O
[0553] 2) Prepare the qPCR reaction mixture as shown in Tables 15 and 16. Keep all reagents on ice throughout the entire operation.
[0554] Table 15
[0555]
[0556] Table 16
[0557]
[0558] 2) Perform qPCR as follows:
[0559] 50℃, 2 minutes;
[0560] 95°C, 10 minutes;
[0561] Then enter the cycle mode, 95°C, 15 seconds, 60°C, 1 minute (this operation is 40 cycles).
[0562] Result analysis:
[0563] a) Quant Studio 7 software was used with default settings to automatically calculate Ct values;
[0564] b) Calculate the relative gene expression using the following formula:
[0565] ΔCt=Ct(ANGPTL4 gene)–Ct(GAPDH)
[0566] ΔΔCt=ΔCt(test sample group)–ΔCt(Mock group), where the Mock group represents the group without the addition of siRNA conjugates compared with the test sample group;
[0567] mRNA expression relative to the Mock group = 2 -ΔΔCt
[0568] Inhibition rate (%) = (relative mRNA expression level of the Mock group - relative mRNA expression level of the test sample group) / relative mRNA expression level of the Mock group × 100%
[0569] Table 17
[0570]
[0571] Note: “--” results are not shown.
[0572] As can be seen from Table 17, the siRNA conjugates provided by the present disclosure showed excellent inhibitory effects on the ANGPTL4 gene.
[0573] Example 5: In vitro stability study of rat liver homogenate of siRNA conjugates
[0574] 5.1 Experimental reagents and consumables
[0575] Table 18
[0576] Reagent name brand Product Number / CAS Number <![CDATA[1M MgCl2]]> Beyotime ST269 ammonium bicarbonate Tianjin Guangfu Fine Chemicals GB663-78 Sodium dihydrogen phosphate Tianjin Guangfu Fine Chemicals GB / T1267-1999 Disodium hydrogen phosphate Tianjin Guangfu Fine Chemicals 10039-32-4 Acetonitrile Honeywell AH015-4HC Methanol Honeywell AH230-4HC 0.5M EDTA Beyotime ST066
[0577] 5.2 Experimental steps
[0578] 5.2.1 Preparation of liver homogenate
[0579] 5.2.1.1 Preparation of grinding fluid
[0580] Table 19
[0581]
[0582] 5.2.1.2 Tissue homogenate
[0583] Rat liver tissue (collected from SD rats, purchased from Beijing Weitonglihua Experimental Animal Technology Co., Ltd.) was mixed with grinding solution at a ratio of 100 mg:5 mL to prepare liver homogenate (concentration of 20 mg / mL); after preparation, grinding beads were added to the homogenizer, and the grinding parameters were set as follows.
[0584] Table 20
[0585] Running speed 60Hz Runtime 30s Pause time 15s Number of runs 4 times Operating temperature -20℃
[0586] 5.2.2 Sample preparation
[0587] The siRNA conjugate sample was prepared with enzyme-free water to a 1 mg / mL solution for later use. The internal standard sample was prepared with enzyme-free water to a concentration of 0.125 mg / mL.
[0588] 5.2.3 Sample incubation
[0589] (1) Add 250 μL of prepared liver homogenate to a 2 mL enzyme-free tube.
[0590] (2) Add 50 μL of nucleic acid sample based on step 1;
[0591] (3) The system is 300 μL of biological sample, vortexed, and allowed to stand for 5 min;
[0592] (4) Divide into 2 tubes, 100 μL each;
[0593] (5) System incubation time: 48h.
[0594] 5.2.4 Biological sample processing
[0595] Vortex and mix every 100 μL of biological sample system, add 300 μL of clarity OTX lysis buffer (Clarity OTXLysis-loading Buffer, purchased from Agel-Fenome, product number AL0-8579), vortex, let stand for 30 minutes, add 100 μL of internal standard solution, vortex, let stand for 5 minutes, centrifuge for 1 minute, and set aside (total sample volume is about 500 μL).
[0596] 5.2.5 Solid Phase Extraction
[0597] (1) Preparation of solid phase extraction reagents
[0598] Activator: Add 200 mL of methanol to the mobile phase bottle and mark it as activator;
[0599] Equilibration solution: Prepare 1 M phosphate buffer solution [877 mL sodium dihydrogen phosphate (1.56 g / L) + 123 mL sodium dihydrogen phosphate (3.58 g / L)], dilute 100-fold, adjust the pH to 5.5 with phosphoric acid, and mark it as equilibrium solution;
[0600] Flushing solution: Take 500 mL of the equilibrium solution and transfer it to a 1 L mobile phase bottle. Add 500 mL of acetonitrile and adjust the pH to 5.5 with phosphoric acid. Mix well and mark as flushing solution.
[0601] Eluent: Weigh 7.9 g of ammonium bicarbonate into a 1 L mobile phase bottle, add 1 L of water, take 500 mL of ammonium bicarbonate solution into a 1 L mobile phase bottle, add 500 mL of acetonitrile, adjust the pH to 9 with sodium hydroxide, mix well, and mark as eluent;
[0602] (2) The extraction steps are as follows:
[0603] Table 21
[0604] step process activation 1 mL activator, 10 min balance 2*1mL equilibration solution, 10 minutes for the first time and 10 minutes for the second time Loading 400 μL (4 / 5 of the total volume) rinse 2*1mL flushing solution, 20 minutes for the first flush and 20 minutes for the second flush Elution 2*0.75mL eluent, 20 minutes for the first time and 20 minutes for the second time
[0605] 5.2.6 Post-processing
[0606] The eluate (in two separate 600 mL portions, for a total of 1200 mL) was placed in a 2 mL EP tube and concentrated under vacuum for 6 hours at 1800 rpm. The concentrated sample was reconstituted with 100 μL of mobile phase (at the initial ratio) and centrifuged at low speed for 2 minutes. 10 μL of the supernatant was then injected into a high-resolution mass spectrometer. The antisense strand ratio of the siRNA conjugates of this application was semi-quantitatively determined using LC-MS / MS. The metabolic results after 48 hours of in vitro incubation in rat liver homogenate are shown in the table below.
[0607] Table 22 Remaining percentage of antisense strand of siRNA conjugate
[0608] siRNA ID AS% N-ER-FY045023M11L96 84.94% N-ER-FY045023M50L96 98.52% N-ER-FY045058M6L96 86.36% N-ER-FY045058M50L96 98.95% N-ER-FY045080M6L96 84.14% N-ER-FY045080M50L96 93.86%
[0609] Wherein, AS represents the antisense strand of siRNA. The greater the remaining amount of AS, the better the stability of the drug and the longer the drug's effectiveness. As can be seen from Table 22, the siRNA conjugates disclosed herein have excellent in vitro stability in rat liver homogenate.
[0610] Example 6: Inhibitory Effect of siRNA Conjugates on Human ANGPTL4 Gene Expression in Humanized Mice
[0611] 6-8 week old C57BL / 6-hANGPTL4 mice (provided by Biocytogen (Beijing) Pharmaceutical Technology Co., Ltd.) were housed in a housing facility. After 7 days of acclimation, N-ER-FY045058M50L96 and N-ER-FY045080M50L96 were administered subcutaneously at a single dose of 3 mg / kg (5 mice per group). On day 14 after administration, mice were euthanized, and 30 mg of left middle lobe liver tissue was collected and quickly frozen in liquid nitrogen in two aliquots. After freeze-grinding to homogenate, tissue RNA was extracted and target gene mRNA expression was assayed.
[0612] Table 23 Inhibition rate of hANGPTL4 protein by siRNA conjugates
[0613]
[0614] As can be seen from Table 23, the siRNA conjugates disclosed herein have high inhibitory activity against the ANGPTL4 gene in vivo.
[0615] The above embodiments of the present disclosure are merely examples for the purpose of clearly illustrating the present disclosure, and are not intended to limit the embodiments of the present disclosure. For those skilled in the art, other variations or modifications in different forms can be made based on the above description. It is not necessary and impossible to enumerate all the embodiments here. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present disclosure shall be included within the scope of protection of the claims of the present disclosure.
Claims
1. A double-stranded RNA for inhibiting ANGPTL4 gene expression, the double-stranded RNA comprising a sense strand and an antisense strand, wherein the sense strand is reverse complementary and / or substantially reverse complementary to the antisense strand to form a double-stranded region of the double-stranded RNA; in, The sense strand comprises a sequence A that differs by no more than 3 nucleotides from at least 15 consecutive nucleotides in the target sequence, and the antisense strand comprises a sequence B that differs by no more than 3 nucleotides from the reverse complement of at least 15 consecutive nucleotides in the target sequence; The target sequence is selected from the nucleotide sequence shown in any one of SEQ ID NOs: 1 to 5 and a sequence consisting of at least 15 consecutive nucleotides contained in any one of SEQ ID NOs: 1 to 5.
2. The double-stranded ribonucleic acid according to claim 1, wherein The target sequence is selected from the nucleotide sequence shown in any one of SEQ ID NOs: 1, 4 to 11, the positive strand comprises a sequence A consisting of at least 15 consecutive nucleotides in the nucleotide sequence shown in any one of SEQ ID NOs: 1, 4 to 11, and the antisense strand comprises a sequence B that is reverse complementary and / or substantially reverse complementary to a sequence consisting of at least 15 consecutive nucleotides in the nucleotide sequence shown in any one of SEQ ID NOs: 1, 4 to 11.
3. The double-stranded ribonucleic acid according to claim 1 or 2, wherein The sense strand consists of 15-28 nucleotides, preferably 19-25 nucleotides, more preferably 19-23 nucleotides, and even more preferably 19, 21 or 23 nucleotides.
4. The double-stranded ribonucleic acid according to claim 3, wherein The nucleotide sequence of the positive chain is a sequence A that differs by no more than 1 nucleotide compared to a sequence consisting of 15-28 consecutive nucleotides in the nucleotide sequence shown in any one of SEQ ID NOs: 1, 4 to 11, preferably 19-25 consecutive nucleotides, more preferably 19-23 consecutive nucleotides, and more preferably 19, 21 or 23 nucleotides.
5. The double-stranded ribonucleic acid according to any one of claims 1 to 4, wherein The antisense strand consists of 15-28 nucleotides, preferably 19-25 nucleotides, more preferably 19-23 nucleotides, and even more preferably 19, 21 or 23 nucleotides.
6. The double-stranded ribonucleic acid according to any one of claims 1 to 5, wherein The nucleotide sequence of the antisense strand is a sequence B that differs by no more than 1 nucleotide from the reverse complementary sequence of a sequence consisting of 15-28 consecutive nucleotides in the nucleotide sequence shown in any one of SEQ ID NOs: 1, 4 to 11, preferably 19-25 consecutive nucleotides, more preferably 19-23 consecutive nucleotides, and more preferably 19, 21 or 23 nucleotides.
7. The double-stranded ribonucleic acid according to any one of claims 1 to 6, wherein The length of the double-stranded region is 15-25 nucleotides, preferably 19-23 nucleotides, more preferably 19, 21 or 23 nucleotides.
8. The double-stranded ribonucleic acid according to any one of claims 1 to 7, wherein The sense strand and the antisense strand complement each other to form the double-stranded region, and the 3' end of the sense strand has 1-2 protruding nucleotides extending out of the double-stranded region, and the 3' end of the antisense strand forms a blunt end; or, The sense strand and the antisense strand complement each other to form the double-stranded region, and the 3' end of the antisense strand has 1-2 protruding nucleotides extending out of the double-stranded region, and the 3' end of the sense strand forms a blunt end; or, The sense strand and the antisense strand complement each other to form the double-stranded region, and the 3' ends of the sense strand and the antisense strand each have 1-2 protruding nucleotides extending out of the double-stranded region; or, The sense strand and the antisense strand complement each other to form the double-stranded region, and the 3' ends of the sense strand and the antisense strand both form blunt ends.
9. The double-stranded ribonucleic acid according to any one of claims 1 to 8, wherein The sense strand comprises the sense strand of any one of the siRNAs shown in Table 1 and Table 1-1 herein, and the antisense strand comprises the antisense strand of the corresponding siRNA; Preferably, the sense strand comprises the sense strand of any one of siRNA 24, siRNA 44, siRNA 45, siRNA144 to siRNA146, or siRNA202 to siRNA204 shown in Table 1 and Table 1-1 herein, and the antisense strand comprises the antisense strand of the corresponding siRNA.
10. The double-stranded ribonucleic acid according to any one of claims 1 to 9, wherein Each nucleotide in the sense strand is independently a modified nucleotide or an unmodified nucleotide, and / or each nucleotide in the antisense strand is independently a modified nucleotide or an unmodified nucleotide.
11. The double-stranded ribonucleic acid according to any one of claims 1 to 10, wherein Any two nucleotides connected in the sense strand are connected by a phosphodiester bond or a phosphorothioate diester bond, and / or any two nucleotides connected in the antisense strand are connected by a phosphodiester bond or a phosphorothioate diester bond.
12. The double-stranded ribonucleic acid according to any one of claims 1 to 11, wherein The 5' terminal nucleotide of the antisense strand is linked to a 5' phosphate group or a 5' phosphate-derived group, or the 5' terminal nucleotide of the antisense strand is not linked to a 5' phosphate group or a 5' phosphate-derived group.
13. The double-stranded ribonucleic acid according to any one of claims 1 to 12, wherein The sense strand has no ligation at either the 5' or 3' end (invAb), or has one ligation at only the 5' end (invAb), or has one ligation at only the 3' end (invAb), or has one ligation at each of the 5' and 3' ends (invAb).
14. The double-stranded ribonucleic acid according to any one of claims 1 to 13, wherein The double-stranded ribonucleic acid is siRNA for inhibiting the expression of ANGPTL4 gene.
15. A modified double-stranded RNA, which is the modified double-stranded RNA according to any one of claims 1 to 14, wherein the modified double-stranded RNA comprises at least one of the following chemical modifications: (1) modification of at least one nucleotide in the sense strand, (2) modification of the phosphodiester bond at at least one position in the sense strand, (3) modification of at least one nucleotide in the antisense strand, (4) modification of the phosphodiester bond at at least one position in the antisense strand; Optionally, the 3' end of sequence A in the sense strand of the double-stranded RNA is linked to a sequence D consisting of 1-2 nucleotides, preferably a sequence D consisting of 1-2 thymidine deoxyribonucleotides; and / or, the 3' end of sequence B in the antisense strand of the double-stranded RNA is linked to a sequence E consisting of 1-2 nucleotides, preferably a sequence E consisting of 1-2 thymidine deoxyribonucleotides; and / or, the 3' end of sequence A in the sense strand of the double-stranded RNA is excluding 1-2 nucleotides to form sequence A'; Optionally, the sense strand and antisense strand of the double-stranded RNA modification are selected from the following sequence combinations: The nucleotide sequence of the sense strand is the sequence shown in Sequence A, and the nucleotide sequence of the antisense strand is the sequence shown in Sequence B; Alternatively, the nucleotide sequence of the sense strand is the sequence shown in sequence A, and the nucleotide sequence of the antisense strand is the sequence shown in sequence B connected to sequence E; Alternatively, the nucleotide sequence of the sense strand is the sequence shown in sequence A connected to sequence D, and the nucleotide sequence of the antisense strand is the sequence shown in sequence B; Alternatively, the nucleotide sequence of the sense strand is the sequence shown in sequence A connected to sequence D, and the nucleotide sequence of the antisense strand is the sequence shown in sequence B connected to sequence E; Alternatively, the nucleotide sequence of the sense strand is the sequence shown in sequence A', and the nucleotide sequence of the antisense strand is the sequence shown in sequence B; Alternatively, the nucleotide sequence of the sense strand is the sequence shown in sequence A', and the nucleotide sequence of the antisense strand is the sequence shown in sequence B connected to sequence E.
16. The modified double-stranded RNA according to claim 15, wherein The modification of the nucleotide is selected from 2'-fluoro modification, 2'-alkoxy modification, 2'-substituted alkoxy modification, 2'-alkyl modification, 2'-substituted alkyl modification, 2'-deoxy modification, nucleotide derivative modification, or a combination of any two or more thereof; Preferably, the modification of the nucleotide is selected from 2'-F modification, 2'-O-CH3 modification, 2'-O-CH2-CH2-O-CH3 modification, 2'-O-CH2-CH=CH2 modification, 2'-CH2-CH2-CH=CH2 modification, 2'-deoxy modification, nucleotide derivative modification or a combination of any two or more thereof.
17. The modified double-stranded RNA according to claim 16, wherein The nucleotide derivative in the nucleotide derivative modification is selected from isonucleotide, LNA, ENA, cET, UNA or GNA.
18. The modified double-stranded ribonucleic acid according to any one of claims 15 to 17, wherein From the 5' end to the 3' end, the ribonucleotides at positions 7, 9, 10 and 11 in the sense strand are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions in the sense strand are 2'-O-CH3 modified ribonucleotides; Alternatively, from the 5' end to the 3' end, the 7th, 9th, 10th and 11th ribonucleotides in the sense strand are 2'-F modified ribonucleotides, the remaining ribonucleotides in the sense strand are 2'-O-CH3 modified ribonucleotides, and the overhang at the 3' end is removed; Alternatively, along the 5' end to the 3' end, the ribonucleotides at positions 5, 7, 8, and 9 in the sense strand are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions in the sense strand are 2'-O-CH3 modified ribonucleotides; Alternatively, along the 3' end to the 5' end, the 9th, 10th, 11th and 13th ribonucleotides in the sense strand are 2'-F modified ribonucleotides, and the ribonucleotides in the remaining positions in the sense strand are 2'-O-CH3 modified ribonucleotides; Alternatively, along the 3' end to the 5' end, the ribonucleotides at positions 11, 12, 13, and 17 in the sense strand are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions in the sense strand are 2'-O-CH3 modified ribonucleotides; Alternatively, along the 3' end to the 5' end, the 9th, 11th, 13th and 17th ribonucleotides in the sense strand are 2'-F modified ribonucleotides, and the remaining ribonucleotides in the sense strand are 2'-O-CH3 modified ribonucleotides; Alternatively, from the 3' end to the 5' end, the ribonucleotides at positions 6, 11 and 13 in the sense strand are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions in the sense strand are 2'-O-CH3 modified ribonucleotides.
19. The modified double-stranded ribonucleic acid according to any one of claims 15 to 18, wherein When neither the 5' end nor the 3' end of the sense strand is linked (invAb), the sense strand comprises phosphorothioate diester bonds at the following positions, moving from the 5' end to the 3' end: Between the first and second nucleotides starting from the 5' end of the sense strand; Between the second and third nucleotides starting from the 5' end of the sense strand; Between the first and second nucleotides starting from the 3' end of the sense strand; Between the second and third nucleotides starting from the 3' end of the sense strand; or, The sense strand contains phosphorothioate diester bonds located at the following positions: Between the first and second nucleotides starting from the 5' end of the sense strand; Between the second and third nucleotides starting from the 5' end of the sense strand; When only one (invAb) is attached to the 5' end of the sense strand, the sense strand comprises phosphorothioate diester bonds at the following positions, moving from the 5' end to the 3' end: Between the 5' end (invAb) and the first nucleotide starting from the 5' end of the sense strand; Between the first and second nucleotides starting from the 5' end of the sense strand; When only one (invAb) is attached to the 3' end of the sense strand, the sense strand contains phosphorothioate diester bonds at the following positions, moving from the 5' end to the 3' end: Between the first and second nucleotides starting from the 5' end of the sense strand; Between the second and third nucleotides starting from the 5' end of the sense strand; Between the 3' end (invAb) of the sense strand and the first nucleotide starting from the 3' end; When the 5' end and the 3' end of the sense strand are each linked to one (invAb), the sense strand comprises phosphorothioate diester bonds at the following positions along the 5' end to the 3' end: Between the 5' end (invAb) and the first nucleotide starting from the 5' end of the sense strand; Between the first and second nucleotides starting from the 5' end of the sense strand; Between the 3' end (invAb) and the first nucleotide from the 3' end of the sense strand.
20. The modified double-stranded ribonucleic acid according to any one of claims 15 to 19, wherein From the 5' end to the 3' end, the ribonucleotides at positions 2, 6, 14 and 16 in the antisense strand are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions in the antisense strand are 2'-O-CH3 modified ribonucleotides; Alternatively, along the 5' end to the 3' end, the ribonucleotides at positions 2, 6, 8, 9, 14 and 16 in the antisense strand are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions in the antisense strand are 2'-O-CH3 modified ribonucleotides; Alternatively, from the 5' end to the 3' end, the ribonucleotides at positions 2, 6, 14, and 16 in the antisense strand are 2'-F modified ribonucleotides, the ribonucleotide at position 7 in the antisense strand is a ribonucleotide modified with the nucleotide derivative GNA, and the ribonucleotides at the remaining positions in the antisense strand are 2'-O-CH3 modified ribonucleotides; Alternatively, along the 5' end to the 3' end, the ribonucleotides at positions 2, 14, and 16 in the antisense strand are 2'-F modified ribonucleotides, the ribonucleotide at position 6 in the antisense strand is a ribonucleotide modified with the nucleotide derivative GNA, and the ribonucleotides at the remaining positions in the antisense strand are 2'-O-CH3 modified ribonucleotides; Alternatively, along the 5' end to the 3' end, the ribonucleotides at positions 2, 5, 7 and 14 in the antisense strand are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions in the antisense strand are 2'-O-CH3 modified ribonucleotides; Alternatively, along the 5' end to the 3' end, the ribonucleotides at positions 2, 7, 10 and 14 in the antisense strand are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions in the antisense strand are 2'-O-CH3 modified ribonucleotides; Alternatively, from the 5' end to the 3' end, the ribonucleotides at positions 2, 7, and 14 in the antisense strand are 2'-F modified ribonucleotides, the ribonucleotides at positions 5 and 12 in the antisense strand are replaced with 2'-deoxyribonucleotides, and the ribonucleotides at the remaining positions in the antisense strand are 2'-O-CH3 modified ribonucleotides; Alternatively, along the 5' end to the 3' end, the ribonucleotides at positions 2, 3, 5, 7, 10, 12 and 14 in the antisense chain are 2'-F modified ribonucleotides, the ribonucleotide at position 6 in the antisense chain is a ribonucleotide modified with the nucleotide derivative GNA, and the ribonucleotides at the remaining positions in the antisense chain are 2'-O-CH3 modified ribonucleotides.
21. The modified double-stranded ribonucleic acid according to any one of claims 15 to 20, wherein From the 5' end to the 3' end, the nucleotide at the 5' end of the antisense strand is linked to a 5' phosphate group or a 5' phosphate derivative group, or the nucleotide at the 5' end of the antisense strand is not linked to a 5' phosphate group or a 5' phosphate derivative group.
22. The modified double-stranded ribonucleic acid according to any one of claims 15 to 21, wherein The antisense strand contains phosphorothioate diester bonds located at the following positions: Between the first and second nucleotides starting from the 5' end of the antisense strand; between the second and third nucleotides starting from the 5' end of the antisense strand; between the first and second nucleotides starting from the 3' end of the antisense strand; between the second and third nucleotides starting from the 3' end of the antisense strand.
23. The modified double-stranded ribonucleic acid according to any one of claims 15 to 22, wherein The double-stranded RNA modification product is a siRNA modification product for inhibiting the expression of the ANGPTL4 gene.
24. The modified double-stranded ribonucleic acid according to any one of claims 15 to 23, wherein The sense strand comprises the sense strand of any one of the siRNA modifications shown in Table 2 herein, and the antisense strand comprises the antisense strand of the corresponding siRNA modification; Preferably, the sense strand comprises the sense strand of any one of the siRNA modifications siRNA 154, siRNA 162, or siRNA 171 shown in Table 2 herein, and the antisense strand comprises the antisense strand of the corresponding siRNA modification.
25. A double-stranded RNA conjugate or a prodrug thereof, wherein: The double-stranded RNA conjugate comprises the double-stranded RNA according to any one of claims 1 to 14, or the double-stranded RNA modification according to any one of claims 15 to 24; and a conjugated group conjugated to the double-stranded RNA or the double-stranded RNA modification.
26. The double-stranded RNA conjugate or a prodrug thereof according to claim 25, wherein The conjugated group has the following structure:
27. The double-stranded RNA conjugate or a prodrug thereof according to claim 25 or 26, wherein The conjugated group is attached to the 3' end of the sense strand.
28. The double-stranded RNA conjugate or a prodrug thereof according to claim 27, wherein The conjugated group is conjugated to the 3' end of the sense strand via a phosphodiester bond; Preferably, the sense strand and the antisense strand of the double-stranded RNA conjugate are complementary to each other to form a double-stranded region of the double-stranded RNA conjugate, and the 3' end of the sense strand forms a blunt end, and the 3' end of the antisense strand has 1-2 protruding nucleotides extending out of the double-stranded region; or, The sense strand and antisense strand of the double-stranded RNA conjugate are complementary to each other to form a double-stranded region of the double-stranded RNA conjugate, and the 3' end of the sense strand forms a blunt end, and the 3' end of the antisense strand forms a blunt end.
29. The double-stranded ribonucleic acid conjugate or a prodrug thereof according to any one of claims 25 to 28, wherein The double-stranded RNA conjugate has the following structure: The double helix structure is double-stranded RNA or a modified double-stranded RNA.
30. The double-stranded ribonucleic acid conjugate or a prodrug thereof according to any one of claims 25 to 29, wherein: The double-stranded ribonucleic acid conjugate is a siRNA conjugate for inhibiting the expression of the ANGPTL4 gene.
31. The double-stranded ribonucleic acid conjugate or a prodrug thereof according to any one of claims 25 to 30, wherein: The double-stranded RNA conjugate is formed by connecting any one of the siRNAs shown in Table 1 and Table 1-1 to a conjugation group, or the double-stranded RNA conjugate is formed by connecting any one of the siRNA modifications shown in Table 2 to a conjugation group; Preferably, in the double-stranded ribonucleic acid conjugate, the sense strand comprises the sense strand of any one of the siRNA conjugates shown in Table 3 herein, and the antisense strand comprises the antisense strand of the corresponding siRNA conjugate; More preferably, the sense strand comprises the sense strand of any one of the siRNA conjugates siRNA 181, siRNA 189, or siRNA 198 shown in Table 3 herein, and the antisense strand comprises the antisense strand of the corresponding siRNA conjugate.
32. A pharmaceutical composition, wherein The pharmaceutical composition comprises at least one of the following: the double-stranded ribonucleic acid according to any one of claims 1 to 14, the double-stranded ribonucleic acid modification according to any one of claims 15 to 24, the double-stranded ribonucleic acid conjugate according to any one of claims 25 to 31, or a prodrug thereof.
33. The pharmaceutical composition according to claim 32, wherein The pharmaceutical composition further comprises one or more pharmaceutically acceptable carriers.
34. Use of the double-stranded RNA according to any one of claims 1 to 14, the modified double-stranded RNA according to any one of claims 15 to 24, the double-stranded RNA conjugate or a prodrug thereof according to any one of claims 25 to 31, or the pharmaceutical composition according to any one of claims 32 to 33 in at least one of the following: (1) Inhibiting ANGPTL4 gene expression, or preparing a drug for inhibiting ANGPTL4 gene expression; (2) for preventing or treating a disease associated with abnormal expression of the ANGPTL4 gene, or for preparing a drug for preventing or treating a disease associated with abnormal expression of the ANGPTL4 gene; (3) for treating a subject suffering from a disease that would benefit from reduced expression of an ANGPTL4 gene, or for preparing a medicament for treating a subject suffering from a disease that would benefit from reduced expression of an ANGPTL4 gene.
35. The use according to claim 34, wherein The disease associated with abnormal expression of the ANGPTL4 gene is selected from the group consisting of the following diseases: Breast cancer, hepatitis C, glucose metabolism disorders, lipid metabolism disorders, vascular dysfunction, cardiovascular and cerebrovascular diseases, kidney disease, and inflammatory diseases; Optionally, the carbohydrate metabolism disorder includes one or more of diabetes, fructose metabolism disorder, and glycogen storage disease; Optionally, the cardiovascular and cerebrovascular diseases include coronary heart disease.
36. A method for inhibiting ANGPTL4 gene expression in a cell, wherein: The method comprises contacting the cell with the double-stranded ribonucleic acid according to any one of claims 1 to 14, the double-stranded ribonucleic acid modification according to any one of claims 15 to 24, the double-stranded ribonucleic acid conjugate or a prodrug thereof according to any one of claims 25 to 31, or the pharmaceutical composition according to any one of claims 32 to 33.
37. The method according to claim 36, wherein The subject has at least one of the following characteristics: Abnormal expression of the ANGPTL4 gene in the body, more specifically abnormally high expression of the ANGPTL4 gene; Suffering from diseases related to abnormal expression of the ANGPTL4 gene; Having a disease that would benefit from decreased expression of the ANGPTL4 gene.