Pseudomonas aeruginosa bscR gene, BscR protein, and engineering bacteria and application of pseudomonas aeruginosa bscR gene and BscR protein

Abstract

The invention relates to a pseudomonas aeruginosa bscR gene, a pseudomonas aeruginosa BscR protein, an engineering bacterium of the pseudomonas aeruginosa bscR gene and application of the engineering bacterium. A novel regulatory factor BscR is identified in a pseudomonas aeruginosa genome, and regulation of the toxicity of the pseudomonas aeruginosa is realized by regulating a bscR gene in the pseudomonas aeruginosa. After the bscR gene is regulated and controlled in the pseudomonas aeruginosa, multiple modules related to toxicity are changed, the motility ability is enhanced, and the synthesis efficiency of a biofilm, pyocyanine and siderophore is reduced. The regulation factor BscR is beneficial to clarification of a pathogenic molecular mechanism of the pseudomonas aeruginosa, can be used as a new target for research and development of pseudomonas aeruginosa prevention and treatment drugs, and has important significance on prevention and control of pseudomonas aeruginosa infection.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to a Pseudomonas aeruginosa bscR Gene, BscR protein, engineered bacteria and applications thereof. Background Art

[0002] Pseudomonas aeruginosa is a significant opportunistic pathogen that primarily infects immunocompromised or deficient patients, causing diseases such as bacteremia and urinary tract infections. Specifically, P. aeruginosa is highly susceptible to developing drug resistance and exhibits varying pathogenicity, infectiousness, and prevalence, making it a significant source of hospital-acquired infections. In recent years, the rate of resistance to drugs such as aztreonam, levofloxacin, ciprofloxacin, and trimethoprim-sulfamethoxazole has steadily increased, and P. aeruginosa isolated from patients of different ages also exhibits resistance to different antibiotics.

[0003] Therefore, for the common multidrug-resistant pathogens in clinical practice, the research and development of prevention and control of Pseudomonas aeruginosa infection is imminent. Summary of the Invention

[0004] The technical problem to be solved by the present invention is: how to regulate the virulence of Pseudomonas aeruginosa to enhance the prevention and control of Pseudomonas aeruginosa infection.

[0005] In order to solve the above technical problems, in the first aspect, the present invention first provides a Pseudomonas aeruginosa bscR gene, the bscR The gene includes the nucleotide sequence shown in SEQ ID No.1.

[0006] In a second aspect, the present invention provides a method according to the above bscR Application of genes, wherein the application is any one of F1)-F2): F1) Application in regulating the virulence of Pseudomonas aeruginosa; F2) Application in the development or preparation of drugs for treating Pseudomonas aeruginosa infection.

[0007] Furthermore, in the above application, by knocking out or overexpressing the bscR Genes realize the application of F1)-F2).

[0008] Furthermore, in the above application, the regulation of Pseudomonas aeruginosa virulence is: positively regulating the biofilm production, pyocyanin production and siderophore biosynthesis of Pseudomonas aeruginosa; and / or negatively regulating the motility of Pseudomonas aeruginosa.

[0009] In a third aspect, the present invention also protects a method for regulating the virulence of Pseudomonas aeruginosa, by modifying the above-mentionedbscR Gene knockout or overexpression is achieved through genetic engineering methods.

[0010] In a fourth aspect, the present invention also protects an engineered bacterium of Pseudomonas aeruginosa, wherein the engineered bacterium is a knockout of the above-mentioned bscR Pseudomonas aeruginosa or overexpressing the gene bscR genes of Pseudomonas aeruginosa.

[0011] In a fifth aspect, the present invention also protects a method for preparing the engineered bacteria described above, wherein the knockout bscR aeruginosa, or, using the M2 method, to overexpress bscR genes of Pseudomonas aeruginosa, wherein: M1) The method comprises the following steps: using gene knockout technology to knock out the bscR Gene knockout, knockout bscR genes of Pseudomonas aeruginosa; M2) The method comprises the following steps: bscR The gene expression vector was transformed into Pseudomonas aeruginosa to overexpress bscR genes of Pseudomonas aeruginosa.

[0012] In a sixth aspect, the present invention also protects a BscR protein, which is bscR The amino acid sequence of the BscR protein is shown in SEQ ID No. 2.

[0013] In a seventh aspect, the present invention further protects an application of the above-mentioned BscR protein, which is any one of P1) to P2): P1) Application in regulating the virulence of Pseudomonas aeruginosa; P2) Application in the development or preparation of drugs against Pseudomonas aeruginosa infection.

[0014] In an eighth aspect, the present invention also protects a drug for resisting Pseudomonas aeruginosa infection, wherein the target of the drug is the above-mentioned bscR Gene or bscR The gene encodes the BscR protein.

[0015] Technical effects of the present invention: The present invention identified a new regulatory factor BscR in the genome of Pseudomonas aeruginosa for the first time. bscR Genes provide an effective way to regulate the virulence of Pseudomonas aeruginosa. bscRAfter the gene was expressed, multiple virulence-related modules underwent changes, manifesting as enhanced motility and reduced biofilm, pyocyanin, and siderophore synthesis efficiency. This study not only helps to elucidate the molecular pathogenic mechanism of Pseudomonas aeruginosa, but also provides a new target for the development of drugs to prevent and treat Pseudomonas aeruginosa, which is of great significance for the prevention and control of Pseudomonas aeruginosa infections.

[0016] Further features and aspects of the present disclosure will become apparent from the following detailed description of exemplary embodiments with reference to the attached drawings. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] The accompanying drawings, which are incorporated in and constitute a part of the specification, illustrate exemplary embodiments, features, and aspects of the disclosure and, together with the description, serve to explain the principles of the disclosure.

[0018] Figure 1 The embodiment of the present invention provides bscR Schematic diagram of the effects of gene knockout on bacterial biofilm; Figure 2 The embodiment of the present invention provides bscR Schematic diagram of the effects of gene knockout on bacterial motility; Figure 2 A: Swarming motility and swimming motility plate diffusion images of the test strain, the motility is characterized by the diffusion diameter of the colony edge; B: The average colony migration diameter calculated based on three independent biological replicates of Swarming motility in A; C: The average colony migration diameter calculated based on three independent biological replicates of Swimming motility in A; EV represents empty plasmid; Figure 3 The embodiment of the present invention provides bscR Schematic diagram of the effects of gene knockout on flagellar synthesis; Figure 3 Middle A: WT (wild type) and overexpression bscR WT of the gene (WT( bscR )) of flagella; B: Quantitative statistical analysis of flagella length based on 11 samples in A; C: WT, Δ bscR Knockout strains and complement Δ bscR ( bscR ) qRT-PCR assay results for the expression of flagellar synthesis-related genes; EV represents empty plasmid; Figure 4 The embodiment of the present invention provides bscR Schematic diagram of the effects of gene knockout on pyocyanin; Figure 4 A: Pyocyanin production determination results of the tested strain and schematic diagram of the culture solution color change; B: Pyocyanin synthesis-related genes (phzA1 、 phzB1 、 phzC1 ) expression level determination; EV stands for empty plasmid; Figure 5 Shows WT and Δ provided by the embodiment of the present invention bscR Schematic diagram of transcriptome analysis of knockout strains; Figure 5 In, A: Δ bscR Volcano plot of differentially expressed genes between the knockout strain and the WT strain, highlighting the differential expression of genes related to siderophore synthesis, flagella formation, biofilm, and pyocyanin biosynthesis; Legend: Up indicates upregulation; Down indicates downregulation; NS indicates no significant difference; B: GO function enrichment analysis of differentially expressed genes; Figure 6 The embodiment of the present invention provides bscR Schematic diagram of the effects of gene knockout on siderophores; Figure 6 Middle, A: RT-qPCR analysis of WT, Δ bscR Knockout strains and complement Δ bscR ( bscR ) in the expression level of PVD synthesis genes; B: RT-qPCR analysis of WT, Δ bscR Knockout strains and complement Δ bscR ( bscR ) in the expression level of PCH synthesis gene; C: dynamic determination of WT, Δ bscR Knockout strains and complement Δ bscR ( bscR ) PVD yield; EV stands for empty plasmid; Figure 7 Shown are microscopic imaging and statistical analysis diagrams of the localization of the BscR protein at the cell pole provided by an embodiment of the present invention; Figure 7 A: Confocal fluorescence microscopy imaging of GFP and BscR-GFP fusion proteins in cells (magnification ×100), where the green fluorescent marker shows the localization characteristics of BscR protein at the cell pole; B: A bar graph of the polar distribution ratio obtained after statistics of 100 cells; Figure 8 Schematic diagram showing the regulation of biofilm and swimming motility by BscR through cellular level localization provided by an embodiment of the present invention; Figure 8 A: Laser scanning confocal microscopy detection of subcellular localization of BscR-GFP fusion protein; B: Determination of biofilm production of the test strain; C: Swimming motility plate diffusion image of the test strain; D: Average colony migration diameter calculated based on three independent biological replicates of Swimming motility in C; EV stands for empty plasmid. DETAILED DESCRIPTION

[0019] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0020] It should be understood that the terms described herein are intended only to describe particular embodiments and are not intended to limit the present invention. In addition, for numerical ranges herein, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Each smaller range between any intermediate value within a stated value or stated range and any other stated value or intermediate value within the stated range is also encompassed by the present invention. The upper and lower limits of these smaller ranges may be independently included or excluded within the scope.

[0021] Unless otherwise indicated, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art. Although only preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein may also be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of any conflict with any incorporated document, the contents of this specification shall prevail.

[0022] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments of the present invention without departing from the scope or spirit of the invention. Other embodiments will be apparent to those skilled in the art from the present invention. The present description and examples are intended to be illustrative only.

[0023] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0024] The pathogenicity of Pseudomonas aeruginosa is highly dependent on the dynamic coordination of its virulence factors, with biofilms and motility playing a central role in the infection process. On one hand, the biofilm is composed of polysaccharides such as Psl, Pel, and alginate, extracellular DNA, and proteins, forming a three-dimensional protective matrix that helps the bacteria adhere to host tissues or medical device surfaces. This structure not only acts as a physical barrier to antibiotic penetration, such as reducing the effectiveness of β-lactams, but also suppresses host immune defenses, such as by blocking macrophage phagocytosis. This is particularly crucial for persistent colonization in chronic infections, such as in the lungs of patients with cystic fibrosis. Biofilm formation is precisely regulated by the quorum sensing system and the c-di-GMP signaling pathway. High c-di-GMP levels promote polysaccharide synthesis and biofilm stability, while low levels trigger bacterial dispersion, leading to disseminated infection. On the other hand, motility is mediated by both flagella and type IV pili. Flagella-driven chemotaxis helps bacteria penetrate the host's mucus layer and colonize damaged tissues, while simultaneously activating the TLR5 pathway and triggering excessive inflammation. Type IV pili enhance surface adhesion through "twitching" and participate in the early construction of biofilms. Motility and biofilm formation exist in a dynamic balance, with high motility typically associated with acute infection, while biofilm formation signals the establishment of chronic infection.

[0025] Pseudomonas aeruginosa is a common multidrug-resistant pathogen. The complexity of its virulence regulatory network seriously restricts the effectiveness of traditional antibacterial therapy.

[0026] In view of this, the first aspect of the present invention provides a method for bscR Gene, bscR The gene includes the nucleotide sequence shown in SEQ ID No.1.

[0027] The present invention, through research on Pseudomonas aeruginosa, identifies a regulatory factor BscR in the Pseudomonas aeruginosa genome for the first time, providing an effective approach for regulating the virulence of Pseudomonas aeruginosa.

[0028] above ​ The coding region of the gene is 510 base pairs long and is as follows: ATGGCAATCAACCTGAAAGAAATCCTCGCCATGAACAAACTCGACCGCTACGACCTGGCT60 ATCCTCGAAGAACTCCAGCGCGACGCACGCATCTCCAACCAGGAACTGGCAGAACGGATA 120 GGCCTGTCGCCATCGCCCTGTTCGCGACGGGTCAAGCAGCTCGAGGACGACGGCTACATC180 GTCCGCCAGGTAGCCTTGCTGGACCGCAAGAAGCTCGGCCTGAGCCTCACCGCCTTCGTC240 CTCATAGGCATGGACCGACACACCCCGGAACGCTTCGAACATTTTCAGGAAGTCATCGGC300 AAATGCCCGGAAGTGCTGGAGTGCAGCCTGGTCACCGGGATGGACGCGGACTACCAGTTG 360 AAGGTCTGGTGCCGGACATGGACCATTACCAGAAACTCCTGCTGGGTACCCTGACGCGC420 ATCGAGGGGGTCTCCAGCGTGCGCTCCAGCTTCGTCCTCAACCAGGTGCTGGCGAGTACC480 GAACTGCCGCTGGAGCACCTGCGCGATTGA510 (SEQ ID No. 1) In a second aspect, the present invention provides a ​ Gene application, application is any one of F1) - F2): F1) Application in regulating the virulence of Pseudomonas aeruginosa; F2) Application in the development or preparation of drugs for treating Pseudomonas aeruginosa infection.

[0029] Furthermore, in the above application, by knocking out or overexpressing the ​ Genes realize the application of F1)-F2).

[0030] Specifically, in the above application, the sequence to be knocked out or overexpressed is all the sequences shown in SEQ ID No.1 ​ Gene sequence.

[0031] Furthermore, in the above application, regulating the virulence of Pseudomonas aeruginosa is: positively regulating the biofilm production, pyocyanin production and siderophore biosynthesis of Pseudomonas aeruginosa; and / or negatively regulating the motility of Pseudomonas aeruginosa.

[0032] Among the above applications, applications in regulating the virulence of Pseudomonas aeruginosa include: Application in regulating the formation of Pseudomonas aeruginosa biofilm; application in regulating the motility of Pseudomonas aeruginosa; application in regulating the production of pyocyanin of Pseudomonas aeruginosa; application in regulating the iron carrier of Pseudomonas aeruginosa.

[0033] That is, in ​ In the process of genetic regulation of Pseudomonas aeruginosa virulence, the regulation of Pseudomonas aeruginosa virulence is manifested in the inhibition of multiple virulence modules such as bacterial biofilm formation, pyocyanin, and siderophore synthesis. The biofilm, motility, pyocyanin, and siderophore synthesis of the knockout strains change. Specifically, the knockout strains positively regulate the biofilm production, pyocyanin production, and siderophore biosynthesis of Pseudomonas aeruginosa; and / or negatively regulate the motility of Pseudomonas aeruginosa. That is, compared with the wild-type strain, the knockout strains have reduced biofilm production, enhanced motility, impaired pyocyanin synthesis ability, reduced production, and significantly reduced siderophore synthesis.

[0034] In a third aspect, the present invention also protects a method for regulating the virulence of Pseudomonas aeruginosa, by modifying the above-mentioned ​ Gene knockout or overexpression is achieved through genetic engineering methods.

[0035] In a fourth aspect, the present invention also protects an engineered bacterium of Pseudomonas aeruginosa, wherein the engineered bacterium is a knockout of the above-mentioned ​ Pseudomonas aeruginosa or overexpressing the gene ​ genes of Pseudomonas aeruginosa.

[0036] The present invention is through the ​ Gene knockout or overexpression was used to obtain engineered Pseudomonas aeruginosa, and its virulence was effectively inhibited.

[0037] In a fifth aspect, the present invention also protects a method for preparing the engineered bacteria described above, wherein the knockout ​ aeruginosa, or, using the M2 method, to overexpress ​ genes of Pseudomonas aeruginosa, wherein: M1) The method comprises the following steps: using gene knockout technology to knock out the ​ Gene knockout, knockout ​ genes of Pseudomonas aeruginosa; M2) The method comprises the following steps: ​ The gene expression vector was transformed into Pseudomonas aeruginosa to overexpress ​ genes of Pseudomonas aeruginosa.

[0038] In the above preparation method, knockout or overexpression is performed by genetic engineering method ​ The preparation of genetically engineered bacteria is achieved, and the genetic engineering method is preferably a homologous recombination method, more preferably a homologous double crossover recombination technology.

[0039] Specifically, the above preparation method includes M1) or M2): M1) Gene knockout: Using the Pseudomonas aeruginosa genome as a template, primer pairs UF and UR were used to amplify ​ The upstream homology arm of the gene was amplified using primers NF and NR. The upstream and downstream fragments were fused by overlapping PCR, and after electroporation into the host bacteria, the sucrose sensitivity screening and PCR verification were used to obtain the ​ Gene scarless knockout mutants; M2) Gene overexpression: Amplify OEF and OER using primers ​ The full-length gene sequence was cloned into the expression vector and transformed into the host bacteria to obtain ​ Overexpression strains; The sequences of primers UF, UR, NF, NR, OEF, and OER are shown in SEQ ID No. 3-8, specifically as follows: Primer UF: gagctcggtacccggggatccTCGGCCTGCGCCTGGACG (SEQ ID No. 3); Primer UR: ctacgaCGGCAAGGTGAATTTGAGTGA (SEQ ID No. 4); Primer NF: aattcaccttgccgTCGTAGCGAGACCTGGGACA (SEQ ID No. 5); Primer NR: acgacggccagtgccaagcttTGTTCTAGGCAATGGCAAGGC (SEQ ID No. 6); Primer OEF: gagctcggtacccggggatccGCGGGCAAAGAAAAAGGG (SEQ ID No. 7); Primer OER: acgacggccagtgccaagcttTATACGGCATGCCGCCTG (SEQ ID No. 8).

[0040] In a sixth aspect, the present invention also protects a BscR protein, which is ​ The amino acid sequence of the BscR protein is shown in SEQ ID No. 2.

[0041] It should be noted that BscR protein is composed of ​ Genetically encoded, ​ The nucleotide sequence of the gene is shown in SEQ ID No. 1, and the amino acid sequence of the BscR protein is shown in SEQ ID No. 2. The protein is composed of 169 amino acids, has a molecular weight of 19.29 kDa, and a theoretical isoelectric point of 5.70. The specific amino acid sequence is as follows: MAINLKEILA MNKLDRYDLR ILEELQRDAR ISNQELAERI GLSPSPCSRR VKQLEDDGYIVRQVALLDRK KLGLSLTAFV LIGMDRHTPE RFEHFQEVIG KCPEVLECSL VTGMDADYQL KVVVPDMDHY QKLLLGTLTR IEGVSSVRSS FVLNQVLAST ELPLEHLRD (SEQ ID No. 2).

[0042] In a seventh aspect, the present invention further protects an application of the above-mentioned BscR protein, which is any one of P1) to P2): P1) Application in regulating the virulence of Pseudomonas aeruginosa; P2) Application in the development or preparation of drugs against Pseudomonas aeruginosa infection.

[0043] In an eighth aspect, the present invention also protects a drug for resisting Pseudomonas aeruginosa infection, wherein the drug targets the above-mentioned ​ Gene or ​ The gene encodes the BscR protein.

[0044] The present invention is based on ​ Gene integration regulates multiple virulence modules such as biofilm formation, motility, pyocyanin and siderophore, and drives the molecular mechanism of bacterial infection process, which is of great significance for the prevention and control of Pseudomonas aeruginosa infection. ​ After gene deletion, the strain was found to have significantly reduced biofilm formation, pyocyanin synthesis, and iron absorption capacity compared to the wild-type strain, while bacterial motility was also enhanced. Further studies demonstrated that the BscR protein is specifically localized to the bacterial cell poles, and its regulatory effects on biofilm formation and swimming motility are dependent on this subcellular localization. This invention provides a specific molecular target for the development of novel antibacterial drugs targeting virulence pathways, particularly offering a solution for the clinical prevention and treatment of persistent Pseudomonas aeruginosa biofilm-associated infections.

[0045] The present invention is further illustrated below by way of examples. The experimental methods in the following examples, unless otherwise specified, are conventional methods and were performed according to techniques or conditions described in literature in the art or according to product specifications. The materials and reagents used in the following examples, unless otherwise specified, were commercially available.

[0046] Example 1 Knockout ​ Detection of Genetic Influence on Bacterial Biofilm Production Obtain fresh LB broth to culture the wild type (WT) strain overnight. ​ Knockout strain (Δ ​ ) and its complement Δ ​ ( ​ ) was diluted until its absorbance at 600 nm (OD600) reached 0.002; wherein, the complement body construction process of this embodiment is specifically as follows: the full-length ​ The gene was cloned into pUCP20 vector and the complementing plasmid was transformed into Δ ​ The mutants were screened for resistance (carbenicillin, 100 μg / mL) and verified by DNA sequencing to confirm the success of complement construction.

[0047] Subsequently, 120 μl of the diluted bacterial solution was transferred to a 96-well culture plate, which was then incubated at 37°C for 8 hours. After the incubation period, the culture medium was carefully removed, and the 96-well culture plate was gently rinsed with sterile water to remove unattached bacteria. Next, 200 μl of a 0.1% crystal violet solution was added to the biofilm cells attached to the inner wall of the culture plate and stained at room temperature for 15 minutes. After staining, the culture plate was rinsed again with sterile water to remove unbound dye. After the culture plate was air-dried, 200 μl of 95% ethanol was added to each well to dissolve the biofilm. Finally, the absorbance of the solution in each well was measured at a wavelength of 570 nm.

[0048] like ​ As shown in the experimental results, after the test strain was cultured in a 96-well plate for 8 hours, the Δ ​ The biofilm production of the knockout strain was reduced by 40.6%. ​ Heterologous overexpression in strains ​ The expression of these genes could increase the biofilm production by 64.3% and 176.3%, respectively, indicating that BscR has a positive regulatory effect on biofilm formation.

[0049] Example 2 Knockout ​ Detection of gene effects on bacterial motility The WT strain and Δ ​ Knockout strains and complement Δ ​ ( ​ ) Dilute the culture in fresh LB broth to OD600 = 1.0, use a sterile spotting needle to draw 1 μL of the bacterial solution, and inoculate it into two motility test plates: (1) Swarming motility plate (composition: 8 g / L nutrient broth, 5 g / L D-glucose, 5 g / L Bacto agar); (2) Swimming motility plate (composition: 5 g / L Bacto peptone, 3 g / L Bacto yeast extract, 2.5 g / L Bacto agar).

[0050] After inoculation, the plates were placed in a 37°C constant temperature incubator for 14 h, and the migration ability of the strains was quantitatively analyzed by measuring the diffusion diameter of the colony edge (three biological replicates).

[0051] like ​ As shown, the experimental results show that Δ ​ The Swarming and Swimming migration diameters of the knockout strain increased significantly by 29.6% and 33.7% compared to WT, respectively, indicating that BscR deficiency leads to enhanced bacterial motility. ​ Overexpression in knockout strains ​ The gene can further inhibit the motility phenotype, and the swarming and swimming diameters are reduced by 71.3% and 93.6% compared with the control group, respectively, demonstrating that BscR has a negative regulatory effect on swarming and swimming motility.

[0052] Example 3 ​ Genetic regulation of bacterial flagellar assembly Based on the differences in swimming motility phenotypes in Example 2, this example further analyzed the regulatory mechanism of BscR on flagellar assembly, and selected WT strains and ​ Overexpression strain WT ( ​ ) were observed under transmission electron microscopy. After the two strains were cultured to an OD600 of 1.0, the cells were harvested by centrifugation (4,000 rpm, 4°C, 5 min), washed three times with PBS buffer (pH 7.4), and resuspended to a final concentration of 1×105 CFU / mL.

[0053] 10 μL of bacterial suspension was added to a 300-mesh copper grid coated with carbon film. After adsorption for 5 min, 2% phosphotungstic acid (pH 7.4) was used for negative staining for 20 min. After natural drying, the flagellar structure was observed under a transmission electron microscope. ​ Knockout strains and complement Δ ​ ( ​ ) total RNA, which was then converted into cDNA. Real-time fluorescence quantitative PCR (RT-qPCR) was used to detect the expression of flagellar synthesis-related genes in the three samples ( ​ 、 ​ 、 ​ 、 ​ 、 ​ 、 ​ 、 ​、 ​ 、 ​ ) transcription levels.

[0054] like ​ As shown, transmission electron microscopy analysis showed that overexpression ​ The average length of the flagella of the WT strain was significantly shorter than that of the WT (WT: 5.62 ± 0.65 μm vs WT ( ​ ): 4.30 ± 0.36 μm)( ​ AB in ). RT-qPCR results showed that Δ ​ The mRNA expression levels of 9 flagellar synthesis-related genes in the knockout strains were upregulated by 45%-82% compared with those in the WT strains, while complement Δ ​ ( ​ ) gene expression levels were restored to WT levels ( ​ These data demonstrate that BscR negatively regulates bacterial flagellar assembly and motility by inhibiting the transcription of flagellar synthesis genes.

[0055] Example 4 Knockout ​ Effects of Genes on Pyocyanin Production in Bacteria Take the WT strain and Δ ​ Knockout strains and complement Δ ​ ( ​ ) were inoculated into 3 mL of fresh LB liquid medium and cultured at 37°C and 200 rpm for 16 hours. The supernatant was collected after centrifugation and the residual bacteria were removed by 0.22 μm sterile filter membrane. The pyocyanin content was determined by spectrophotometry: 200 μL of filtered supernatant was added to a 96-well plate and the absorbance value A695 was measured at a wavelength of 695 nm on a microplate reader. The A695 value was used to represent the relative production of pyocyanin. WT and Δ ​ Knockout strains and complement Δ ​ ( ​ ) in pyocyanin synthesis-related genes ( ​ 、 ​ 、 ​ ) expression level.

[0056] like ​ As shown, phenotypic observation showed that the culture fluid of WT strain showed typical blue-green characteristics, while Δ ​ The color of the knockout strain culture medium became significantly lighter ( ​ A in Figure 1 suggests that the ability to synthesize pyocyanin is impaired. Quantitative analysis confirmed that Δ ​ The A695 value of the strain was 45.5% lower than that of WT, while the complement Δ ​ ( ​) of pyocyanin production returned to the WT baseline. RT-qPCR analysis showed that Δ ​ Knockout strains of core genes for pyocyanin synthesis ​ 、 ​ 、 ​ Affiliation ​ - ​ operon) were down-regulated by 34%, 30% and 36% respectively compared with WT; while the expression levels of the three in complement bodies returned to WT levels ( ​ These results indicate that BscR positively regulates the biosynthesis of pyocyanin by directly or indirectly regulating the phenazine metabolic pathway.

[0057] Example 5 Effects of BscR on Multiple Cellular Metabolic Pathways In order to fully explore the regulatory role of BscR in Pseudomonas aeruginosa, this example used the Illumina platform to analyze the expression of BscR in Pseudomonas aeruginosa WT and Δ ​ The knockout strains were subjected to whole-transcriptome sequencing (RNA-Seq). Significantly differentially expressed genes were screened using DESeq2 analysis (|log2FC| ≥ 1, padj < 0.05), and functional enrichment analysis of the differentially expressed genes was performed using GOATOOLS (GO term, P < 0.01).

[0058] like ​ As shown in Figure 2, transcriptome analysis identified a total of 174 significantly differentially expressed genes (Δ ​ vs WT), of which 95 genes were up-regulated and 79 genes were down-regulated ( ​ GO enrichment analysis showed that the differentially expressed genes were associated with a series of biological functions, such as iron response, iron uptake, iron regulation, etc. ( ​ It should be noted that the differentially expressed genes include those related to biofilm, flagella, and pyocyanin synthesis, which correspond to the phenotypes of decreased biofilm formation ability, increased flagella length, and decreased pyocyanin synthesis ability in Examples 1, 3, and 4.

[0059] Example 6 Knockout ​ Genetic influence on siderophore synthesis Based on transcriptome sequencing RNA-Seq and RT-qPCR verification, it was found that Δ ​ Siderophore synthesis genes in knockout strains ( ​ 、 ​ 、 ​ 、 ​ 、 ​ 、 ​ 、 ​ 、 ​ ) mRNA expression was significantly downregulated by 1.75-2.13 times compared with WT.​ Pseudomonas aeruginosa responds to host iron restriction by secreting high-affinity iron carriers Pyoverdine (PVD) and Pyochelin (PCH) and relying on TonB to transport iron into the cell. To quantitatively evaluate the effect of BscR on iron carrier synthesis, PVD production was dynamically monitored by fluorescence spectrophotometry: WT, Δ ​ and complement Δ ​ ( ​ ) were inoculated into iron-deficient medium and cultured at 37°C. The fluorescence intensity was measured every 2 hours at an excitation wavelength of 400 nm and an emission wavelength of 460 nm.

[0060] like ​ As shown in the dynamic monitoring results, the PVD production of the WT strain reached its peak after 22 hours of culture. ​ The PVD production of the knockout strain was significantly reduced, and the complement Δ ​ ( ​ ) PVD yield is higher than WT, e.g. ​ The above results indicate that BscR inhibits bacterial siderophore-mediated iron uptake by negatively regulating the expression of PVD / PCH synthesis genes.

[0061] Example 7 BscR is localized at the cell pole To analyze the subcellular localization characteristics of BscR, this example constructed a BscR-GFP fusion expression system with green fluorescent protein (GFP) fused to the C-terminus. The expression plasmid pUCP20 carrying the BscR-GFP fusion gene was transformed into the WT strain and the Δ ​ Knockout strains were also constructed, along with an empty GFP control plasmid. Experimental strains were cultured in LB medium until the logarithmic phase (OD600 = 0.6), and the fluorescence signal distribution was observed using a laser confocal microscope (Leica LSM 900).

[0062] like ​ As shown, laser confocal microscopy imaging showed that the control group: empty GFP in WT and Δ ​ The knockout strains all showed uniform cytoplasmic distribution characteristics, such as ​ As shown in A; Experimental group: BscR-GFP fusion protein showed significant polar localization pattern in both genetic backgrounds, specifically: WT strain: 35% of bacteria showed unipolar aggregation, and 62.0% showed bipolar distribution (n = 100); Δ ​ Knockout strain: 28.0% unipolar aggregation, 67.0% bipolar distribution (n = 100), e.g. ​ B in FIG.

[0063] Example 8 The regulatory function of BscR depends on its polar localization BscR interacting protein encoding gene ​ and its key binding site mutants ​ E280A,N328A,E419A Clone into expression vector pUCP20 and transform into complement Δ ​ ( ​ ) and WT( ​ ) strains, and obtain engineered bacteria Δ ​ ( ​ , ​ ),Δ ​ ( ​ E280A,N328A,E419A , ​ )、PAO1( ​ , ​ ) and PAO1( ​ E280A,N328A,E419A , ​ The intracellular distribution of BscR was observed using confocal laser scanning microscopy. The bacterial biofilm production was determined by crystal violet staining, and the swimming motility of the bacteria was determined using the soft agar plate method.

[0064] like ​ As shown, confocal microscopy results showed that PAO1( ​ , ​ ) strain, the fluorescence signal of BscR-GFP changed from polar distribution (control group) to cytoplasmic diffuse pattern, while PAO1( ​ E280A,N328A,E419A , ​ ) strains, BscR still maintains polar localization, such as ​ A in the figure is shown. ​ ( ​ , ​ ) strains had a higher biofilm production than Δ ​ ( ​ ) decreased by 44.9%, while Δ ​ ( ​ E280A,N328A,E419A , ​ ) and the biofilm production and Δ ​ ( ​ ) had no significant difference, such as ​ B in Figure 2 shows the difference between the two groups. ​ ( ​ ), Δ ​ ( ​ , ​ ) strain increased its motility by 318%, while Δ ​ ( ​ E280A,N328A,E419A , ​ ) strains showed no significant changes in motility, such as​ The above results indicate that BscR regulation of biofilm and swimming motility depends on its intracellular polar localization.

[0065] It can be seen that the present invention provides a new virulence regulatory factor ​ Genes and their applications in anti-infection therapy. Aiming at the technical problems of the complex virulence regulatory network of Pseudomonas aeruginosa and the limited efficacy of existing antibacterial targets, targeted regulation is proposed. ​ The gene or its encoded product BscR protein simultaneously inhibits key pathogenic pathways such as bacterial biofilm formation, motility and pyocyanin synthesis, providing a new strategy for the development of multi-functional synergistic antibacterial drugs.

[0066] This study identified a regulatory factor BscR in the genome of Pseudomonas aeruginosa for the first time and constructed it through scarless gene knockout technology. ​ Phenotypic analysis of gene deletion mutants revealed a significant reduction in biofilm formation ability, by 40.6%, compared to the wild-type strain, while significantly enhanced motility, with swarming and swimming increasing by 29.6% and 33.7%, respectively. Transmission electron microscopy combined with real-time quantitative PCR analysis confirmed that BscR affects flagellar assembly and the expression of flagellar-related genes. Further studies revealed that BscR also regulates the synthesis of siderophores (pyoverdine and pyochelin), significantly limiting bacterial iron uptake. This study reveals for the first time the molecular mechanism by which BscR drives bacterial infection by integrating and regulating multiple virulence modules, including biofilm formation, motility, iron metabolism, and pyocyanin. Based on this finding, targeted inhibition of BscR protein function can simultaneously impair bacterial environmental adaptability, immune evasion, and nutrient acquisition efficiency, providing a specific molecular target for the development of novel antimicrobial drugs with synergistic anti-biofilm and anti-virulence effects, which is of great significance for the prevention and control of acquired Pseudomonas aeruginosa infections.

[0067] Throughout this specification, references to terms such as "one embodiment," "example," or "specific example" indicate that the specific features, structures, materials, or characteristics described in conjunction with that embodiment or example are included in at least one embodiment or example of the present invention. In this specification, schematic representations of these terms do not necessarily refer to the same embodiment or example. Furthermore, the specific features, structures, materials, or characteristics described may be combined in any suitable manner in any one or more embodiments or examples.

[0068] Unless otherwise defined, the technical terms or scientific terms involved in this application should have the usual meanings understood by people with ordinary skills in the technical field to which this application belongs. The words "one", "the" and similar words involved in this application do not indicate quantity restrictions and can indicate the singular or plural. The terms "include", "comprise", "have" and any variations thereof involved in this application are intended to cover non-exclusive inclusions. The words "connect", "connected", "coupled" and similar words involved in this application are not limited to physical or mechanical connections, but include electrical connections, whether direct or indirect. The "multiple" involved in this application refers to two or more, and "and / or" describes the association relationship of associated objects, indicating that three relationships can exist. The character " / " generally indicates that the previous and next associated objects are in an "or" relationship. The terms "first", "second", "third" and the like involved in this application are merely to distinguish similar objects and do not represent a specific ordering of objects.

[0069] The above embodiments merely illustrate several implementation methods of the present application. While the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the present invention. It should be noted that a person skilled in the art could make several modifications or improvements without departing from the spirit of the present application, all of which fall within the scope of protection of the present application. Therefore, the scope of protection of the present patent application shall be determined by the appended claims.

Claims

1. A Pseudomonas aeruginosa bsc A gene characterized by described bsc The gene includes the nucleotide sequence shown in SEQ ID No.

1.

2. A method according to claim 1 bscR The application of genes is characterized in that The application is any one of F1) - F2): F1) Application in regulating the virulence of Pseudomonas aeruginosa; F2) Application in the development or preparation of drugs for treating Pseudomonas aeruginosa infection.

3. The use according to claim 2, characterized in that By knocking out or overexpressing the bscR Genes realize the application of F1)-F2).

4. The use according to claim 2, characterized in that The regulation of the virulence of Pseudomonas aeruginosa includes: positively regulating the biofilm production, pyocyanin production and siderophore biosynthesis of Pseudomonas aeruginosa; and / or negatively regulating the motility of Pseudomonas aeruginosa.

5. A method for regulating the virulence of Pseudomonas aeruginosa, characterized in that: By transforming the Pseudomonas aeruginosa genome into the bsc Gene knockout or overexpression is achieved through genetic engineering methods.

6. An engineered Pseudomonas aeruginosa, characterized in that: The engineered bacteria is a knockout bacteria according to claim 1 bsc Pseudomonas aeruginosa or overexpressing the gene bscR genes of Pseudomonas aeruginosa.

7. A method for preparing the engineered bacteria according to claim 6, characterized in that: Knockout was prepared using M1 method bscR aeruginosa, or, using the M2 method, to overexpress bscR genes of Pseudomonas aeruginosa, wherein: M1) The method comprises the following steps: using gene knockout technology to knock out the bsc Gene knockout, knockout bscR genes of Pseudomonas aeruginosa; M2) The method comprises the following steps: bsc The gene expression vector was transformed into Pseudomonas aeruginosa to overexpress bsc genes of Pseudomonas aeruginosa.

8. A BscR protein, characterized in that According to claim 1 bsc The amino acid sequence of the BscR protein is shown in SEQ ID No.

2.

9. A use of the BscR protein according to claim 8, characterized in that: The application is any one of P1)-P2): P1) Application in regulating the virulence of Pseudomonas aeruginosa; P2) Application in the development or preparation of drugs against Pseudomonas aeruginosa infection.

10. A drug for resisting Pseudomonas aeruginosa infection, characterized in that: The target of the drug is the one described in claim 1 bscR Gene or bsc The gene encodes the BscR protein.

Images