Detection primer and probe for conodontes stenotabanus and application thereof

Abstract

The application belongs to the technical field of microorganism detection, and particularly relates to detection primers and probes for Euryphallus sinensis and application thereof. The application establishes a real-time fluorescent quantitative PCR method for the pathogen based on TaqMan-MGB probes according to the small subunit ribosomal RNA (SSUrRNA) gene of Euryphallus sinensis, and designs detection primers based on isothermal amplification technology. With the constructed recombinant plasmid standard as a template, the detection sensitivity of the quantitative PCR detection method for the target gene is 9.58 copies / reaction. The detection primers for isothermal amplification can be detected under simple constant temperature conditions, and the color change of the detection product after adding nucleic acid dye can realize on-site rapid diagnosis of the pathogen.

Description

Technical Field

[0001] This invention belongs to the field of microbial detection technology, specifically relating to detection primers and probes for trypanosomes in large yellow croaker and their applications. Background Technology

[0002] Large yellow croaker is an important marine aquaculture fish with high production volumes. Frequent outbreaks of various bacterial, viral, and parasitic diseases pose a major threat to the healthy development of the large yellow croaker aquaculture industry. Trypanosomiasis, as a newly emerging parasitic pathogen, has a long epidemic period and causes extremely high mortality rates in large yellow croaker, resulting in huge economic losses to the industry and making it a significant parasitic pathogen. Currently, detection of this pathogen mainly relies on microscopic examination or comparative analysis based on gene nucleic acid sequences, which cannot meet the requirements for sensitive and rapid diagnosis in production. Furthermore, the quantitative PCR detection method based on SYBR Green I dyes suffers from low specificity. Given the serious harm this pathogen poses to the large yellow croaker aquaculture industry, establishing a sensitive, specific, and rapid molecular detection method for it has become an urgent requirement for the healthy development of the industry. Summary of the Invention

[0003] The purpose of this invention is to provide large yellow croaker ( Larimichthys crocea Trypanosoma ( Trypanosoma The detection primers and probes for sp. are provided, along with methods for applying the primers and probes.

[0004] The nucleotide sequences of the detection primers and probes for trypanosomes in large yellow croaker described in this invention are as follows:

[0005] (1) Nucleotide sequences of 4 sets of primers and probes for real-time PCR detection:

[0006] The nucleotide sequences of the first set of primers and probes:

[0007] 1) Primer 1: Tr _F: 5'-TTCGAATTTGGTGACCCAGG-3', as shown in SEQ ID NO: 1;

[0008] 2) Primer 2: Tr _R: 5'-ACATGCGAAAATCAGGAAGG-3', as shown in SEQ ID NO: 2;

[0009] 3) Probe: Tr _Probe: 5'-TCCGTGAACACATTCAGAA-3', as shown in SEQ ID NO: 3;

[0010] The nucleotide sequences of the second set of primers and probes:

[0011] 1) Primer 1:Tr _F: 5'-CGGGCGCCTAGTTTTATCTG-3', as shown in SEQ ID NO: 4;

[0012] 2) Primer 2: Tr _R: 5'-TGCACCGAGAGGAAAAGACAA-3', as shown in SEQ ID NO: 5;

[0013] 3) Probe: Tr _Probe: 5'-TACCGATGCAGGAGGGA-3', as shown in SEQ ID NO: 6;

[0014] The nucleotide sequences of the third set of primers and probes:

[0015] 1) Primer 1: Tr _F: 5'-GTCGCCTTTGTGGGAAACC-3', as shown in SEQ ID NO: 7;

[0016] 2) Primer 2: Tr _R: 5'-GCAGTGAGTTGAGGGAATGCA-3', as shown in SEQ ID NO: 8;

[0017] 3) Probe: Tr _Probe: 5'-TCGGCTTGTCTTTTC-3', as shown in SEQ ID NO: 9;

[0018] The nucleotide sequences of the fourth set of primers and probes:

[0019] 1) Primer 1: Tr _F: 5'-TTATGGAGTTGTGCGACAAGC-3', as shown in SEQ ID NO: 10;

[0020] 2) Primer 2: Tr _R: 5'-CTCCCTCCTGCATCGGTAC-3', as shown in SEQ ID NO: 11;

[0021] 3) Probe: Tr _Probe: 5'-TATCTGGTGCCCGTCGC-3', as shown in SEQ ID NO: 12.

[0022] The first set of fluorescent quantitative PCR detection primers and probes were designed based on the highly conserved and species-specific 90bp nucleotide sequence of the trypanosome SSUrRNA gene of large yellow croaker, which is: TTCGAATTTGGTGACCCAGGCCCTTGTGGTCCGTGAACACATTCAGAAACAAGAAACACGGGAGTGGTTCCCTTCCTGATTTTCGCATGT, as shown in SEQ ID NO: 13.

[0023] When using the aforementioned quantitative real-time PCR detection primers and probes, primers and probes can be used simultaneously, or only primers can be used. When using probes, the 5' and 3' ends of the probe are labeled with a fluorescent reporter group and a fluorescent quencher group, respectively. Preferably, the probe can be a Taqman-MGB probe, with the 5' end modified with the fluorescent reporter group 6-carboxyfluorescein (6-FAM) and the 3' end modified with MGB (Minor Groove Binder)-NFQ (Nonfluorescent Quencher). When not using probes, in addition to the primers… Tr _F and Tr In addition to _R, a chimeric fluorescent dye is added to the detection system.

[0024] The final concentrations of the primers and probes in the detection system are 0.1-0.8 μmol / L and 0.1-0.5 μmol / L, respectively, preferably 0.3 μmol / L and 0.2 μmol / L.

[0025] The reaction procedure for real-time PCR is as follows: 95℃ pre-denaturation for 30s; 95℃ denaturation for 5s; 58-63℃ (preferably 60℃) for 30-34s, 40 cycles.

[0026] Interpretation of test results: In the absence of contamination in the negative control, positive samples show an amplification curve in probe-based quantitative PCR detection; in probe-free quantitative PCR detection, positive samples show an amplification curve with a single peak in their melting curve. In the quantitative analysis of pathogens, the pathogen load in the sample can be calculated based on the linear relationship between the logarithm of the nucleic acid copy number (x) of the constructed recombinant plasmid standard and its corresponding threshold cycle number (Ct) (y), as well as the Ct value of the test sample. In the first set of quantitative PCR detection based on the Taqman-MGB probe, the linear expression is y = -3.169x + 39.784.

[0027] (2) Nucleotide sequences of two sets of isothermal amplification detection primers:

[0028] Nucleotide sequences of the first set of isothermal amplification primers:

[0029] 1) Primer 1:Tr _F3: 5'-AGGAGCAGCCTATGAGCT-3', as shown in SEQ ID NO: 14;

[0030] 2) Primer 2: Tr _B3: 5'-CATTCCTGGAAGCAGTGAGT-3', as shown in SEQ ID NO: 15;

[0031] 3) Primer 3: Tr _FIP:

[0032] 5'-CCGCTTGTCGCACAACTCCATATTTTCCGTTTCGGCTTTTGTTGG-3', as shown in SEQ ID NO: 16;

[0033] 4) Primer 4: Tr _BIP:

[0034] 5'-CCGTCGCCTTTGTGGGAAACCTTTTGGGAATGCACCGAGAGGA-3', as shown in SEQ ID NO: 17;

[0035] 5) Primer 5: Tr _LB: 5'-CCGTACCGATGCAGGAGGGA-3', as shown in SEQ ID NO: 18;

[0036] The nucleotide sequences of the second set of isothermal amplification primers are as follows:

[0037] 1) Primer 1: Tr _F3: 5'-GCACTGGTATGTCCCGTTC-3', as shown in SEQ ID NO: 19;

[0038] 2) Primer 2: Tr _B3: 5'-CTCATAGGCTGCTCCTTTGT-3', as shown in SEQ ID NO: 20;

[0039] 3) Primer 3: Tr _FIP:

[0040] 5'-AAGGGAACCACTCCCGTGTTTCTTTTACTTCGAATTTGGTGACCCA-3', as shown in SEQ ID NO: 21;

[0041] 4) Primer 4: Tr _BIP:

[0042] 5'-TCGCATGTCATGCATGCCAGGTTTTAAGTCGGATGACTGCTTTGG-3', as shown in SEQ ID NO: 22;

[0043] 5) Primer 5: Tr _LF:5'-TGTTCACGGACCACAAGGG-3',as shown in SEQ ID NO:23;

[0044] 6) Primer 6: Tr _LB: 5'-GGGCGCCCGTGATTTTT-3', as shown in SEQ ID NO: 24.

[0045] When using isothermal amplification detection primers for detection (Loop-mediated isothermal amplification, LAMP), the following primer combinations can be used:

[0046] Tr _F3、 Tr _B3、 Tr _FIP and Tr_ BIP;

[0047] It can also be Tr_ F3 Tr_ B3 Tr_ FIP, Tr_ BIP and Tr_ LF;

[0048] It can also be Tr_ F3 Tr_ B3 Tr_ FIP, Tr_ BIP and Tr_ LB;

[0049] It can also be used for Tr_ F3 Tr_ B3 Tr_ FIP, Tr_ BIP Tr_ LF and Tr_ LB.

[0050] The LAMP reaction temperature was 60.0℃-68.0℃, and the reaction was carried out for 60 cycles, with each cycle lasting 1 minute.

[0051] The LAMP detection reaction system comprises the following components: 2.5 μL of 10× isothermal amplification buffer, MgSO4 at a final concentration of 4.0–12.0 mM, betaine at a final concentration of 0.1–1.4 mM, dNTPs at a final concentration of 0.8–1.8 mM, and 20 μmol / L... Tr _FIP / Tr 2 μL of BIP, 10 μmol / L Tr _F3 / Tr _B3 0.5μL, 20μmol / L Tr _LF / Tr 1 μL of LB yields a final concentration of 0.128-0.576 U / μL. Bst 2.0 WarmStart ® DNA polymerase (8000 U / mL, New England BioLabs), 1 μL of trypanosome DNA template from large yellow croaker, and EvaGreen can be added to the above system to a final concentration of 0.5-2.5 μmol / L. ® Dye (Biotium), the detection system was finally replenished with water to 25μL.

[0052] When adding EvaGreen ® During dyeing, the detection was performed using a quantitative PCR instrument. The detection temperature and reagent usage were determined based on a comprehensive consideration of factors such as the low Ct value and the need for optimized reagent costs. In the quantitative analysis of pathogen detection, the pathogen load in the sample could be calculated based on the linear relationship between template amount and Ct value. When EvaGreen was not added... ® During dyeing, detection can be performed in a PCR instrument or under simple constant temperature conditions (such as a metal bath or water bath). The detection temperature and reagent usage in the system are determined by considering factors such as the intensity of the step-like bands in the product electrophoresis and the cost of the reagents to be optimized. In the analysis of the detection results, in addition to judging by electrophoresis results, the color change of the reaction product after adding a chimeric fluorescent dye can also be used for visual diagnosis of the sample.

[0053] The detection primers and probes for trypanosomes in large yellow croaker described in this invention can be used for the detection and quantitative analysis of trypanosomes in large yellow croaker for non-disease diagnosis and treatment purposes, including for the preparation of detection reagents or kit products.

[0054] Compared with the prior art, the present invention has the following beneficial effects:

[0055] 1. Short detection time, high sensitivity, and strong specificity:

[0056] The present invention provides a real-time quantitative PCR method based on the Taqman-MGB probe, which can complete the reaction within 1 hour and has a detection sensitivity of 9.58 copies / reaction. No cross-reaction was observed with various trypanosomes and aquaculture pathogens. The primers used in this invention for isothermal amplification can complete the reaction within 15-60 minutes.

[0057] 2. The test can be applied to on-site diagnosis:

[0058] The isothermal amplification detection primers provided by this invention can complete the detection under simple constant temperature conditions (such as a water bath or metal bath). After the detection reaction is completed, a chimeric fluorescent dye such as SYBR Green or GeneFinder is added to the reaction tube. TM Alternatively, by adding self-luminous fluorescent dyes such as calcein or hydroxynaphthol blue, rapid on-site diagnosis of pathogens can be achieved through color changes in the reaction tube. Attached Figure Description

[0059] Figure 1 This is the Taqman-MGB real-time PCR amplification curve of Trypanosoma simulans from large yellow croaker in Example 4, where 1-10: 9.58×10 9 -9.58×10 0 copies / μL, 11: negative control;

[0060] Figure 2 This is the standard curve of Taqman-MGB real-time PCR for trypanosomes from large yellow croaker in Example 4;

[0061] Figure 3 This is an amplification curve of the Taqman-MGB real-time PCR detection of Trypanosoma spp. in large yellow croaker in Example 5. In the figure, 1: plasmid standard, 2-15: other pathogens in Table 2 except Trypanosoma spp., 16: negative control, 17: blank control.

[0062] Figure 4 This is the amplification curve of Taqman-MGB real-time PCR for detecting Trypanosoma cruzi in large yellow croaker samples in Example 5. Where 1: Trypanosoma plasmid standard 9.58 × 10⁻⁶. 5 1: Samples / μL, 2: Sample 20241211010, 3: Sample 20241211037, 4: Sample 20241211003, 5: Sample 20241211030, 6: Sample 20241211031, 7: Sample 20241211026, 8: Sample 20241211041, 9: Sample 20241211011, 10: Trypanosoma plasmid standard 9.58×10 2 copies / μL, 11-12: negative control, 13: blank control;

[0063] Figure 5 This is the amplification curve for the Taqman-MGB real-time PCR specificity verification of Trypanosoma spp. in Example 5, where 1-2: Trypanosoma plasmid standard 1.29 × 10⁻⁶. 5 copies / μL, 3-5: blank control, 6-7: recombinant plasmid pUC57_T_86 (114ng / μL);

[0064] Figure 6 The amplification curves for LAMP detection of Trypanosoma simulans from large yellow croaker are shown. Among them, 1-3: positive Trypanosoma simulans samples 20240921001, 20240921002 and 20240921003, 4: sample 20250511001, 5: sample 20250516029, 6: sample 20250711006, 7: sample 20250711007, and 8 and 9: blank controls. Detailed Implementation

[0065] To further illustrate the method and effects of the present invention, the following embodiments are provided for further explanation. Unless otherwise specified, all pharmaceuticals and materials used in the following embodiments are commercially available.

[0066] Example 1: Sample collection and primer and probe design for trypanosomes in large yellow croaker

[0067] From 2024 to 2025, we collected over 200 samples of trypanosomes from large yellow croaker farming cages in the waters off Ningde City, Fujian Province. Based on the SSUrRNA gene sequence alignment analysis of the samples, we designed four sets of primers and probes for real-time PCR detection. Their nucleotide sequences are as follows:

[0068] The nucleotide sequences of the first set of primers and probes:

[0069] 1) Primer 1: Tr _F:5'-TTCGAATTTGGTGACCCAGG-3',

[0070] 2) Primer 2: Tr _R: 5'-ACATGCGAAAATCAGGAAGG-3',

[0071] 3) Probe: Tr _Probe:5'-TCCGTGAACACATTCAGAA-3';

[0072] The nucleotide sequences of the second set of primers and probes:

[0073] 1) Primer 1: Tr_F: 5'-CGGGCGCCTAGTTTTATCTG-3',

[0074] 2) Primer 2: Tr _R: 5'-TGCACCGAGAGGAAAAGACAA-3',

[0075] 3) Probe: Tr _Probe:5'-TACCGATGCAGGAGGGA-3';

[0076] The nucleotide sequences of the third set of primers and probes:

[0077] 1) Primer 1: Tr _F: 5'-GTCGCCTTTGTGGGAAACC-3',

[0078] 2) Primer 2: Tr _R: 5'-GCAGTGAGTTGAGGGAATGCA-3',

[0079] 3) Probe: Tr _Probe:5'-TCGGCTTGTCTTTTTC-3';

[0080] The nucleotide sequences of the fourth set of primers and probes:

[0081] 1) Primer 1: Tr _F: 5'-TTATGGAGTTGTGCGACAAGC-3',

[0082] 2) Primer 2: Tr _R: 5'-CTCCCTCCTGCATCGGTAC-3',

[0083] 3) Probe: Tr _Probe:5'-TATCTGGTGCCCGTCGC-3'.

[0084] The first set of Taqman-MGB real-time PCR detection primers Tr _F / Tr The _R corresponds to the nucleotide sequence shown in SEQ ID NO: 13 in the SSUrRNA gene of *Tridentica davidii* from large yellow croaker. Sequencing of this gene in our collected samples and comparison with the nucleotide sequence of the published gene show that the nucleotide sequence is highly conserved and species-specific, and can be used for the specific detection of *Tridentica davidii* from large yellow croaker.

[0085] Taking the first set of Taqman-MGB fluorescent quantitative PCR detection primers and probes as an example, we will further explain their application in the detection of trypanosomes in large yellow croaker.

[0086] Example 2: Recombinant plasmid standard pMD18 in the detection of trypanosomes in large yellow croaker Tr Construction

[0087] Standard primers were designed based on the SSUrRNA gene of trypanosomes from large yellow croaker. Tr_ P_F(5'-TCTGTTTCGGGTGGTGGG-3', as shown in SEQ ID NO: 25) and Tr_ P_R (5'-TTCGTCTTGGTGCGGTCT-3', as shown in SEQ ID NO: 26). PCR amplification was performed using a 25 μL PCR system with a 10 μmol / L solution. Tr_ P_F / Tr_ 0.5 μL each of P and R, 12.5 μL of Premix Ex Taq Mix (TaKaRa, Dalian), 1 μL of template, and 10.5 μL of sterile water were added. The PCR program was 95℃ for 5 min; 95℃ for 30 s, 63℃ for 30 s, 72℃ for 50 s, for a total of 35 cycles; extension at 72℃ for 8 min. A 997 bp PCR product was obtained, which was recovered from the gel and ligated into the pMD18-T vector (TaKaRa, Dalian) to obtain the recombinant plasmid standard pMD18_ Tr pMD18 was measured using a nucleic acid concentration analyzer (NanoDrop 2000c). Tr The concentration was then calculated and converted into the target gene copy number, and stored at -20℃ for later use.

[0088] Example 3: Optimization of primers and probe concentrations for quantitative real-time PCR detection of trypanosomes in large yellow croaker

[0089] Primers from the first set of real-time PCR were used. Tr _F / Tr _R and probe Tr Use _Probe to conduct experiments.

[0090] Using Premix Ex Taq TM (Probe qPCR) kit (TakaRa, Dalian), primers in the system Tr _F / Tr The probe was used at final concentrations of 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, and 0.8 μmol / L. Tr The final concentrations of the probe were 0.1, 0.2, 0.3, 0.4, and 0.5 μmol / L, respectively. Premix ExTaq (Probe qPCR) (2×) 10 μL, 0.2 μL ROXReference Dye II (50×), 1 μL DNA template, and ddH2O to a final volume of 20 μL. Quantitative PCR was performed using an Applied Biosystems QuantStudio 3 (Thermo Fisher Scientific, USA). The reaction conditions were: 95℃ pre-denaturation for 30 s; 95℃ denaturation for 5 s; detection temperature 60℃ for 34 s, for 40 cycles. Based on factors such as detection Ct value, fluorescence intensity increase (ΔRn), and reagent cost, the optimal primer and probe concentrations were determined to be 0.3 μmol / L and 0.2 μmol / L, respectively. These results were used in subsequent detections using this method.

[0091] Example 4: Standard curve, detection sensitivity and repeatability evaluation of the real-time PCR method

[0092] (1) Standard curve and detection sensitivity

[0093] The recombinant plasmid standard pMD18 was serially diluted 10-fold using EASY Dilution (for Real Time PCR). Tr We get 9.58 × 10 9 -9.58×10 0 Using copies / μL as a template, the first set of Taqman-MGB real-time PCR primers and probes for detecting Trypanosoma largeum was used for amplification. The results showed that the detection sensitivity was 9.58 copies / reaction within 40 cycles. Figure 1 The linear expression for the logarithm of nucleic acid copy number (x) and Ct value (y) is y = -3.169x + 39.784, R0 2 =1, E=106.822% ( Figure 2 ).

[0094] (2) Repeatability assessment

[0095] With 9.58×10 9 -9.58×10 0 pMD18 copies / μL Tr Using the template as a guide, the first set of Taqman-MGB fluorescent quantitative PCR primers and probes for detecting trypanosomes from large yellow croaker were used for intra-batch and inter-batch detection. Each concentration was set up in triplicate. The intra-batch and inter-batch coefficients of variation (CV) were calculated based on the mean Ct and standard deviation (SD) as 0.02%-0.63% and 0.40%-1.22% respectively (Table 1), indicating that this method can provide stable detection results within this template concentration range.

[0096] Table 1. Repeatability detection of Taqman-MGB real-time quantitative PCR for Trypanosoma brevis in large yellow croaker

[0097]

[0098] Example 5: Specificity of real-time quantitative PCR detection of trypanosomes in large yellow croaker

[0099] shrimp hepatic enterocolitis ( Enterocytozoon Hepatopenaei EHP), Myosodium ( Amesonportunus ), grouper enterospora ( Enterospora epinepheli ), Hemangiomaejasminoides ( Hematodinium perezi White Spot Syndrome Virus (WSSV), Infectious Myonecrosis Virus (IMNV), Decapod Iridescent Virus 1 (DIV1), Vibrio harveyi ( Vibrio harveyi ), Vibrio parahaemolyticus ( V. parahaemolyticus ), Vibrio kansei ( V.campbellii ) 、 Mermaid bioluminescent bacteria, mermaid subspecies ( Photobacterium damselae subsp. damselae ), Nocardia sp.、Neobenedeniasp.、 Aestabdella Using DNA from aquatic animal pathogens such as *Sp.* as templates (Table 2), pMD18_ Tr As a positive control, nucleic acid from healthy large yellow croaker tissue was used as a negative control, and sterile, enzyme-free water was used as a blank control. The first set of Taqman-MGB real-time PCR methods was used for specific analysis of *Trypanosoma macranthum* in large yellow croaker, with the detection repeated three times. The results showed that this method can specifically detect *Trypanosoma macranthum*, and there was no cross-reactivity with the DNA of other common aquatic pathogens. Figure 3 In actual sample testing, positive samples of trypanosomes can also be detected. Figure 4 ).

[0100] Table 2. Pathogens used for specific detection

[0101]

[0102] In specific detection, additional synthesis Trypanosoma The 86bp nucleotide sequence of sp. T_86 is as follows: TTCGAATTGGTGACCCAGGCCCTTGTGGTCCGTGAACATTCAGAAACAAGAAACACGGGAGTGGTTCCTTCCTGATTTTCGCATGT, as shown in SEQ ID NO: 27. This synthetic sequence is similar to... T.carassii (OL963935.1, OL963934.1, OQ130039.1, OQ130042.1, OL963926.1), T.remakii (OQ130040.1) T. ophiocephali (EU185634.1) T.siniperca (DQ494415.1) T. granulosum (AJ620551.1) T. cobitis (AJ009143.1) and T. murmanensis (DQ016616.1) and other trypanosomes have sequences that are completely identical, but there are four inconsistent bases in the highly conserved and species-specific 90 bp nucleotide sequence shown in SEQ ID NO: 13 of the trypanosome SSUrRNA gene from large yellow croaker. Two of these inconsistent bases are located in the probe nucleotide sequence of the first set of fluorescent quantitative PCR detection primers and probes of this invention. The above-synthesized sequence SEQ ID NO: 27 was ligated to the pUC57 vector and transformed into Escherichia coli (E. coli). Escherichia Coli From the TOP10, pUC57 was obtained. T _86 recombinant plasmid, with pUC57_ T Using recombinant plasmid _86 (114 ng / μL) as a template, the first set of Taqman-MGB real-time PCR methods was used to detect pUC57 in three replicates of Trypanosoma simulans derived from large yellow croaker. T No cross-reactivity was observed in any of the 86 recombinant plasmid templates. Figure 5 This result demonstrates that the present invention has excellent detection specificity.

[0103] Example 6: Detection of Trypanosoma japonicum in clinical samples by real-time PCR in large yellow croaker

[0104] pMD18- Tr As a positive control, the first set of Taqman-MGB fluorescent quantitative PCR primers and probes for detecting trypanosomes from large yellow croaker were used to test 44 blood samples collected from large yellow croaker (collected from cage culture in the waters off Ningde, Fujian Province). The results are shown in Table 3. Of the 44 samples, 36 were positive and 8 were negative, with a positive rate of 81.82%, which translates to a copy number of 3.23 × 10⁻⁶. 3 -1.93×10 5 copies / μL.

[0105] Table 3 Clinical Sample Testing

[0106]

[0107] Example 7: Primer design for isothermal amplification of trypanosomes in large yellow croaker

[0108] Based on the conserved region of the SSUrRNA gene from trypanosomes of large yellow croaker that we collected, we designed two sets of detection primers for isothermal amplification as follows:

[0109] Composition and nucleotide sequence of the first set of isothermal amplification primers:

[0110] 1) Primer 1 Tr _F3: 5'-AGGAGCAGCCTATGAGCT-3',

[0111] 2) Primer 2 Tr _B3:5'-CATTCCTGGAAGCAGTGAGT-3',

[0112] 3) Primer 3 Tr _FIP:

[0113] 5'-CCGCTTGTCGCACAACTCCATATTTTCCGTTTCGGCTTTTGTTGG-3',

[0114] 4) Primer 4 Tr _BIP:

[0115] 5'-CCGTCGCCTTTGTGGGAAACCTTTTGGGAATGCACCGAGAGGA-3',

[0116] 5) Primer 5 Tr _LB: 5'-CCGTACCGATGCAGGAGGGA-3'.

[0117] Composition and nucleotide sequence of the second set of isothermal amplification primers:

[0118] 1) Primer 1 Tr _F3: 5'-GCACTGGTATGTCCCGTTC-3',

[0119] 2) Primer 2 Tr _B3: 5'-CTCATAGGCTGCTCCTTTGT-3',

[0120] 3) Primer 3 Tr _FIP:

[0121] 5'-AAGGGAACCACTCCCGTGTTTCTTTTACTTCGAATTTGGTGACCCA-3',

[0122] 4) Primer 4 Tr _BIP:

[0123] 5'-TCGCATGTCATGCATGCCAGGTTTTAAGTCGGATGACTGCTTTGG-3',

[0124] 5) Primer 5 Tr _LF:5'-TGTTCACGGACCACAAGGG-3',

[0125] 6) Primer 6 Tr _LB:5'-GGGCGCCCGTGATTTTT-3'.

[0126] Example 8: Isothermal amplification detection of trypanosomes in large yellow croaker

[0127] The detection of trypanosomes in large yellow croaker using LAMP was performed in a real-time quantitative PCR instrument (Bio-Rad, USA). Taking the first set of isothermal amplification primers as an example: the 25 μL LAMP reaction system contained 2.5 μL of 10×Isothermal amplification buffer (containing 2.0 mM Mg). 2+ ), 100mM MgSO41.0μL, 5.0M Betaine 1.0μL, 10mM dNTPs3.0μL, 20μM Tr_ FIP / BIP 2.0μL, 10μM Tr_ F3 / B3 0.5μL, 20μM Tr_ 1.0 μL LB, 1.6 μL 8000 U / mL Bst2.0 WarmStart® DNA polymerase (New England BioLabs, USA), 0.75 μL 20×EvaGreen® Dye (25 μM, Biotium, USA), 1.0 μL DNA template, and RNase-free water to a final volume of 25 μL were added. For the LAMP assay of trypanosomes in large yellow croaker, the DNA template from the test sample, denatured at 95°C, was added to the reaction system. Based on previous optimization results, the reaction temperature was set at 65°C. 60 cycles were performed, each lasting 1 min. After the reaction, the system was incubated at 80°C for 5 min to terminate the reaction.

[0128] In specific detection, trypanosomiasis from large yellow croaker ( Trypanosoma sp.), Pseudomonas aeruginosa (sp.), Pseudomonas aeruginosa ( Pseudomonas plecoglossicida ) 、Vibrio harveyi ( V.harveyi ), Neobenedenia sp.、 Aestabdella Using DNA from aquatic animal pathogens such as *Sp.* as templates (Table 4), the detection specificity of the first LAMP set based on isothermal amplification of *Trektella maculata* from *Large Yellow Croaker* was analyzed. The detection was repeated three times. The results showed that the LAMP detection method based on isothermal amplification technology of this invention can specifically detect *Trektella maculata* from *Large Yellow Croaker* within 40 minutes. Figure 6 ).

[0129] Table 4. Pathogens used for specific detection

[0130]

Claims

1. A primer and probe for detecting trypanosomes in large yellow croaker, characterized in that: The nucleotide sequences of the primers and probes are as follows: (1) Nucleotide sequences of primers and probes for real-time PCR detection: 1) Primer 1: Tr _F: 5’-TTCGAATTTGGTGACCCAGG-3’, 2) Primer 2: Tr _R: 5'-ACATGCGAAAATCAGGAAGG-3', 3) Probe: Tr _Probe:5'-TCCGTGAACACATTCAGAA-3'; (2) Nucleotide sequence of the isothermal amplification detection primers: 1) Primer 1: Tr _F3:5'-AGGAGCAGCCTATGAGCT-3', 2) Primer 2: Tr _B3: 5'-CATTCCTGGAAGCAGTGAGT-3', 3) Primer 3: Tr _FIP: 5'-CCGCTTGTCGCACAACTCCATATTTTCCGTTTCGGCTTTTGTTGG-3', 4) Primer 4: Tr _BIP: 5'-CCGTCGCCTTTGTGGGAAACCTTTTGGGAATGCACCGAGAGGA-3', 5) Primer 5: Tr _LB: 5'-CCGTACCGATGCAGGAGGGA-3'.

2. The detection primers and probes for trypanosomes in large yellow croaker as described in claim 1, characterized in that: The primers and probes for real-time PCR detection were designed based on the highly conserved and species-specific nucleotide sequence of the trypanosome SSUrRNA gene of large yellow croaker. The nucleotide sequence is TTCGAATTTGGTGACCCAGGCCCTTGTGGTCCGTGAACACATTCAGAAACAAGAAACACGGGAGTGGTTCCCTTCCTGATTTTCGCATGT.

3. The application of the detection primers and probes for Trypanosoma simulans in large yellow croaker as described in claim 1 in the detection and quantitative analysis of Trypanosoma simulans in large yellow croaker for non-disease diagnosis and treatment purposes.

4. The application as described in claim 3, characterized in that: The probe is modified with a fluorescent reporter group 6-FAM at its 5' end and a fluorescent quencher group MGB-NFQ at its 3' end.

5. The application as described in claim 3, characterized in that: The final concentrations of primers and probes in the detection system were 0.1–0.8 μmol / L and 0.1–0.5 μmol / L, respectively.

6. The application as described in claim 3, characterized in that: When using isothermal amplification detection primers for detection, the primers used are: Tr _F3、 Tr _B3、 Tr _FIP and Tr _BIP, or Tr _F3、 Tr _B3、 Tr _FIP、 Tr _BIP and Tr _LB.

7. The application as described in claim 6, characterized in that: The reaction temperature was 60.0-68.0℃, the concentration of MgSO4 in the reaction system was 4.0-12.0 mM, the concentration of betaine was 0.1-1.4 mM, the concentration of dNTPs was 0.8-1.8 mM, and the Bst concentration was 2.0 mM. ® The concentration of DNA polymerase was 0.128-0.576 U / μL.

8. The application as described in claim 7, characterized in that: The reaction system also includes EvaGreen at a final concentration of 0.5-2.5 μmol / L. ® Dye.

9. The application as described in claim 3, characterized in that: This includes products used to prepare diagnostic reagents or kits.

Images