Synthetic single stranded DNA molecules and methods of producing and using same

Abstract

Modified single-stranded DNA molecules, as well as methods of cell-free synthesis thereof and their use as therapeutic agents, are disclosed.

Description

[0001] Cross-reference to related applications

[0002] This application claims priority to U.S. Provisional Application No. 63 / 429,461, filed December 1, 2022; U.S. Provisional Application No. 63 / 449,872, filed March 3, 2023; U.S. Provisional Application No. 63 / 529,637, filed July 28, 2023; and U.S. Provisional Application No. 63 / 544,571, filed October 17, 2023. The entire contents of each of the foregoing applications are expressly incorporated herein by reference. Background Art

[0003] Vectors derived from the adeno-associated virus (AAV) (i.e., recombinant AAV (rAAV) or AAV vectors) are attractive for delivering genetic material because (i) they are able to infect ("transduce") a variety of dividing and non-dividing cell types, such as myocytes and neurons; (ii) they lack viral structural genes, thereby reducing host cell responses to viral infection, e.g., interferon-mediated responses; (iii) wild-type AAV is considered non-pathological in humans; and (iv) in contrast to wild-type AAV, which is able to integrate into the host cell genome, replication-defective AAV vectors lack the rep gene and typically exist as episomes, thereby greatly limiting the risk of insertional mutagenesis or genotoxicity.

[0004] However, there are several major disadvantages and deficiencies in using AAV particles as gene delivery vectors, which are derived from traditional AAV production from host cells (e.g., Sf9 insect cells in a large-scale production environment). A major disadvantage associated with rAAV is its limited viral packaging capacity of approximately 4.5 kb of heterologous DNA (Dong et al., 1996; Athanasopoulos et al., 2004; Lai et al., 2010). Therefore, due to this limitation in viral packaging, the use of AAV vectors has been limited to protein coding capacities of less than 150 kDa. The second disadvantage is related to capsid immunogenicity, which prevents re-administration to patients. The patient's immune system can respond to a vector that effectively acts as a booster to stimulate the immune system to produce high titers of anti-AAV antibodies, thereby eliminating further treatment. Recent reports have pointed out concerns about immunogenicity in high-dose situations. Another significant disadvantage is that high-scale production of AAV in host cells (e.g., insect cells) to make viral genomes results in a random mixture of plus (+) and minus (-) strand vectors. This greatly reduces the strand specificity of the transgene for the much-needed therapeutic expression of the sense strand.

[0005] Additionally, conventional AAV virus particles with capsids are produced by introducing one or more plasmids containing AAV genomes, rep genes, and cap genes (Grimm et al., 1998). However, it was found that such encapsidated AAV viral vectors inefficiently transduce certain cell and tissue types, and it was also found that capsids induce severe immune responses in the host. Therefore, due to the patient's immune response, the use of adeno-associated virus (AAV) vectors for gene therapy (including gene editing) is limited to a single administration to the patient, and due to the minimum viral packaging capacity (about 4.5 kb), the scope of transgenic genetic materials suitable for delivery in AAV vectors is limited, and AAV-mediated gene expression is slow. Further, the method for producing such AAV vectors greatly relies on traditional insect cell-dependent production methods. Such methods can be stimulated by pollutants from cells used to produce vectors, which are inconvenient or expensive to remove or purify, and if included in therapeutic formulations, may produce undesirable side effects.

[0006] Therefore, there is a strong need in the field of gene therapy for a technology that is minimally immunogenic, re-administrable, and allows for the production of large quantities of recombinant vectors that also increases expression levels, chain specificity, and purity while increasing transgene size capacity. Summary of the Invention

[0007] The technology described herein generally relates to novel single-stranded deoxyribonucleic acid (ssDNA) molecules (e.g., single-stranded DNA), and methods for producing single-stranded DNA molecules, for example, in the absence of cells or cell lines. Thus, the resulting single-stranded DNA molecules have fewer impurities than comparable vectors prepared using conventional cell-based production methods and exhibit significantly lower immunogenicity in mammalian hosts, which can translate into better in vivo expression that lasts longer after administration. According to some aspects, the present disclosure features a cell-free synthesis method for single-stranded DNA molecules using rolling circle amplification and enzymatic degradation.

[0008] In a first aspect, the present disclosure provides a method for producing a linear single-stranded DNA (ssDNA) molecule comprising at least one nucleic acid sequence of interest, the at least one nucleic acid sequence of interest being flanked by at least one stem-loop structure, the at least one stem-loop structure comprising at least one stem and at least one loop at the 3′ end, the method comprising the following sequential steps: (a) contacting a double-stranded end-blocked DNA (ceDNA) molecule comprising the at least one nucleic acid sequence of interest with an endonuclease; (b) contacting the double-stranded ceDNA with an exonuclease, thereby producing the linear ssDNA molecule. According to some embodiments, the ceDNA molecule further comprises at least one promoter. According to some embodiments, the promoter comprises a transcription start site (TSS).

[0009] According to some embodiments of the present invention, the ceDNA molecule further comprises at least one enhancer. According to some embodiments of the present invention, the promoter is double-stranded in the ssDNA molecule. According to some embodiments of the present invention, the TSS is double-stranded in the ssDNA molecule. According to some embodiments of the present invention, the enhancer is double-stranded in the ssDNA molecule. According to some embodiments of the present invention, the ssDNA molecule further comprises at least one stem-loop structure, wherein the at least one stem-loop structure comprises at least one stem and a loop at the 5' end. According to some embodiments of the present invention, the at least one stem-loop structure at the 3' end comprises at least two stem-loop structures, and / or wherein the at least one stem-loop structure at the 5' end comprises at least two stem-loop structures. According to further embodiments, the ceDNA molecule comprises one or more endonuclease recognition sequences. According to some embodiments of the present invention, the stem-loop structure at the 3' end comprises one or more endonuclease recognition sequences. According to some embodiments of the present invention, the stem-loop structure at the 5' end comprises one or more endonuclease recognition sequences.

[0010] According to aspects of the present invention and some embodiments of the present invention, the one or more nuclease recognition sequences are selected from the group consisting of: 5′-CCAA-3(Nb.BtsI)(Nb.BsrDI)(Nt.CviPII), 5′-CCAAGC-3′(Nb.BbvCI), 5′-CCAACC-3′(Nb.BbvCI), 5′-CCAAGAGTCNNNN-3′(Nt.BstNBI)-N can be A, G, C or T, 5′-CCAAG-3′(Nb.BsmI), 5′-CCAAC-3′(Nb.BssSI), 5′-CCAAGGATCNNNN-3′(Nt.AlwI), CCAAGTCTCN-3′(Nt.BsmAI) and CCAAGCTCTTCN-3′(Nt.BspQI). According to some embodiments of the present invention, the terminal residue of the stem-loop structure at the 3' end is capable of initiating replication and / or transcription inside the nucleus of a host cell. According to some embodiments, the 3' terminal residue comprises a free -OH.

[0011] According to some embodiments of the present invention, the double-stranded ceDNA molecule is contacted with the endonuclease to generate one or more nicks in the sense strand of the nucleic acid sequence of interest, thereby generating a nicked ceDNA molecule. According to further embodiments, the one or more nicks in the sense strand of the nucleic acid sequence of interest are located 5' upstream of the nucleic acid sequence of interest, within the nucleic acid sequence of interest, and / or 3' upstream of the nucleic acid sequence of interest. According to other further embodiments, the one or more nicks in the sense strand of the nucleic acid sequence of interest are located 5' upstream of the nucleic acid sequence of interest. According to still other further embodiments of the present invention, the one or more nicks in the sense strand of the nucleic acid sequence of interest are located 3' downstream of the nucleic acid sequence of interest. According to some embodiments of the present invention, the one or more nicks in the sense strand of the nucleic acid sequence of interest are located within the nucleic acid sequence of interest.

[0012] According to some embodiments of the present invention, the sense strand further comprises at least one phosphorothioate (PS)-modified nucleotide downstream of the expression cassette. According to some embodiments of the present invention, the sense strand further comprises at least two PS-modified nucleotides downstream of the expression cassette. According to some embodiments of the present invention, the sense strand further comprises at least three PS-modified nucleotides downstream of the expression cassette. According to some embodiments of the present invention, the sense strand further comprises at least four PS-modified nucleotides downstream of the expression cassette. According to some embodiments of the present invention, the sense strand further comprises at least five PS-modified nucleotides downstream of the expression cassette. According to some embodiments of the present invention, the sense strand further comprises at least one phosphorothioate (PS)-modified nucleotide upstream of the expression cassette. According to some embodiments of the present invention, the sense strand further comprises at least two PS-modified nucleotides upstream of the expression cassette. According to some embodiments of the present invention, the sense strand further comprises at least three PS-modified nucleotides upstream of the expression cassette. According to some embodiments of the present invention, the sense strand further comprises at least 4 PS-modified nucleotides upstream of the expression cassette. According to some embodiments of the present invention, the sense strand further comprises at least 5 PS-modified nucleotides upstream of the expression cassette.

[0013] According to some embodiments of the present invention, the nicked ceDNA molecule is contacted with an exonuclease to produce an extension of single-stranded DNA (ssDNA) corresponding to the nucleic acid sequence of interest in the double-stranded ceDNA molecule. According to some embodiments of the present invention, the endonuclease is a Type II restriction enzyme. According to some embodiments of the present invention, the endonuclease is selected from the group consisting of: Nb.BtsI, Nb.BsrDI, Nt.CviPII, Nb.BbvC1, Nt.BbvCI, Nt.BstNBI, Nb.BsmI, Nb.BssSI, Nt.AlwI, Nt.BsmA1, Nt.BspQI, and Endonuclease V (Endo V). According to further embodiments, the Type II restriction enzyme is Nb.BbvCI. According to other further embodiments, the endonuclease is Endo V. According to aspects of the present invention and some embodiments of the present invention, the double-stranded ceDNA molecule comprises at least one deoxyinosine residue. According to some embodiments, the deoxyinosine residue is present in the at least one stem-loop structure at the 3′ end, two bases upstream of the desired nicking site. According to aspects of the present invention and some embodiments of the present invention, the double-stranded ceDNA molecule comprises at least one uridine, inosine, xanthosine and / or oxanosine-containing residue, which is nicked by the endonuclease, wherein the endonuclease has enzymatic activity on the uridine, inosine, xanthosine and / or oxanosine-containing residue. According to some embodiments, the endonuclease nicks the DNA at the second phosphodiester bond 3′ of the uridine, inosine, xanthosine and / or oxanosine-containing residue.

[0014] According to some embodiments of the present invention, the exonuclease is a T7 exonuclease. According to some embodiments of the present invention, the exonuclease is an exonuclease III (ExoIII). According to some embodiments of the present invention, the method further comprises the following steps: (1) performing rolling circle amplification (RCA) using a double-stranded DNA (dsDNA) molecule to thereby produce an intermediate dsDNA molecule; and (2) performing cell-free enzymatic synthesis using the intermediate dsDNA molecule to thereby produce the ceDNA molecule, wherein steps (1) and (2) are performed before steps (a) and (b). According to some embodiments, the method further comprises the step (3): purifying the ceDNA molecule after step (2) and before step (a). According to some embodiments of the present invention, the RCA step (1) comprises the following steps: (i) contacting the dsDNA molecule with a primer and a DNA polymerase. According to some embodiments of the present invention, step (2) comprises the following steps: (i) contacting the intermediate dsDNA molecule with a restriction endonuclease to produce a cleaved intermediate dsDNA molecule, and (ii) contacting the cleaved intermediate dsDNA molecule with an oligonucleotide comprising an end compatible with at least one end of the cleaved intermediate dsDNA molecule and a ligase. According to further embodiments, step (ii) further comprises contacting the cleaved intermediate dsDNA molecule with at least two oligonucleotides, each of the at least two oligonucleotides comprising an end compatible with at least one end of the cleaved intermediate dsDNA molecule. According to another further embodiment, each of the at least two oligonucleotides comprises the same end. According to another further embodiment, each of the at least two oligonucleotides comprises a different end. According to some embodiments of the present invention, the at least two oligonucleotides are the same. According to some embodiments of the present invention, the at least two oligonucleotides are different. According to some embodiments of the present invention, step (2) further comprises the following steps: (iii) ligating at least one oligonucleotide to the cleaved dsDNA intermediate.

[0015] According to some embodiments of the present invention, the at least one stem at the 3' end comprises a partial DNA duplex of 4-500 nucleotides. According to some embodiments of the present invention, the at least one stem at the 3' end comprises a partial DNA duplex of 4-5 nucleotides. According to some embodiments of the present invention, the at least one stem at the 5' end comprises 4-500, such as 4-10, 4-20, 4-30, 4-40, 4-50, 4-100, 4-200, 4-300, 4-400, 4-500, 10-500, 20-500, 50-500, 100-500, 200-500, 300-500, 400-500, 10-20, 10 In some embodiments, the at least one stem at the 5' end comprises a partial DNA duplex of 4-5 nucleotides. In some embodiments, the at least one loop at the 3' end comprises 3-500 unbound nucleotides. According to various aspects of this paper and some embodiments in each embodiment, the at least one loop at the 3 ' end comprises a minimum of 3 unbound nucleotides. According to various aspects of this paper and some embodiments in each embodiment, the at least one loop at the 5 ' end comprises 3-500 unbound nucleotides, such as 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 75, 100, 150, 200, 250, 300, 350, 400, 450 or 500 unbound nucleotides. According to various aspects of this paper and some embodiments in each embodiment, the at least one loop at the 5 ' end comprises a minimum of 3 unbound nucleotides.

[0016] According to some embodiments of the present invention, the ssDNA comprises at least two stem-loop structures at the 3′ end. According to some embodiments of the present invention, the ssDNA comprises at least three stem-loop structures at the 3′ end. According to some embodiments of the present invention, the ssDNA comprises at least four or more stem-loop structures at the 3′ end. According to some embodiments of the present invention, the ssDNA comprises at least two stem-loop structures at the 3′ end. According to some embodiments of the present invention, the ssDNA comprises at least three stem-loop structures at the 3′ end. According to some embodiments of the present invention, the ssDNA comprises at least four or more stem-loop structures at the 3′ end. According to some embodiments of the present invention, the ssDNA comprises at least one bubble structure at the 5′ end. According to some embodiments of the present invention, the ssDNA comprises at least two stem-loop structures at the 5′ end. According to some embodiments of the present invention, the ssDNA comprises at least three stem-loop structures at the 5′ end. According to some embodiments of the present invention, the ssDNA comprises at least four or more stem-loop structures at the 5' end. According to some embodiments of the present invention, the at least one stem-loop structure at the 3' end comprises a hairpin DNA structure. According to some embodiments of the present invention, the at least one stem-loop structure at the 3' end comprises a DNA structure selected from the group consisting of a cruciform DNA structure, a hammerhead DNA structure, a quadruplex DNA structure, a bulge DNA structure, a multi-branched loop structure, and a bubble structure.

[0017] According to some embodiments of the present invention, the at least one stem-loop structure at the 3' end does not comprise an A or A' region that would be present in a wild-type AAV ITR. According to some embodiments of the present invention, the at least one stem-loop structure at the 3' end does not comprise an A, A', D, or D' region that would be present in a wild-type AAV ITR. According to some embodiments of the present invention, the at least one stem-loop structure at the 3' end does not comprise an A, A', B, B', C, C', D, or D' region that would be present in a wild-type AAV ITR. According to some embodiments of the present invention, the at least one stem-loop structure at the 5' end does not comprise an A or A' region that would be present in a wild-type AAV ITR. According to some embodiments of the present invention, the at least one stem-loop structure at the 5' end does not comprise an A, A', D, or D' region that would be present in a wild-type AAV ITR. According to some embodiments of the present invention, the at least one stem-loop structure at the 5' end does not include the A, A', B, B', C, C', D or D' regions that would be present in a wild-type AAV ITR. According to some embodiments of the present invention, the at least one stem-loop structure at the 3' end does not include the rep binding element (RBE) that would be present in a wild-type AAV ITR. According to some embodiments of the present invention, the at least one stem-loop structure at the 3' end does not include the terminal resolution site (trs) that would be present in a wild-type AAV ITR. According to some embodiments of the present invention, the at least one stem-loop structure at the 5' end does not include the rep binding element (RBE) that would be present in a wild-type AAV ITR. According to some embodiments of the present invention, the at least one stem-loop structure at the 5' end does not include the terminal resolution site (trs) that would be present in a wild-type AAV ITR. According to some embodiments of the present invention, the at least one stem-loop structure at the 5' end does not include the rep binding element (RBE) that would be present in a wild-type AAV ITR. According to some embodiments of the present invention, the at least one stem-loop structure at the 5' end does not include the terminal resolution site (trs) that would be present in a wild-type AAV ITR. According to some embodiments of the present invention, the ssDNA molecule does not include any viral-derived sequence.

[0018] According to some embodiments of the present invention, the at least one stem-loop structure at the 3' end includes one or more nucleotides modified to be resistant to nuclease exonuclease. According to some embodiments, the nucleotides modified to be resistant to nuclease exonuclease are selected from the group consisting of: phosphorothioate-modified nucleotides, locked nucleic acid (LNA)-modified nucleotides, 2'-O-methyl (m)-modified nucleotides, 2'-O-methoxyethyl (E)-modified nucleotides, 2'-fluoro (F)-modified nucleotides and combinations thereof. According to some embodiments of the present invention, the at least one stem-loop structure at the 3' end and / or the at least one stem-loop structure at the 5' end each independently include a functional portion. According to some embodiments of the present invention, the at least one stem-loop structure at the 5' end includes a hairpin DNA structure. According to some embodiments of the present invention, the at least one stem-loop structure at the 5' end comprises a DNA structure selected from the group consisting of a cruciform DNA structure, a hammerhead DNA structure, a quadruplex DNA structure, a protuberant DNA structure, a multi-branched loop structure, and a bubble structure.

[0019] According to some embodiments of the present invention, the stem structure at the 5' end comprises one or more nucleotides modified to be resistant to nuclease exonucleases. According to some embodiments of the present invention, the nucleotides modified to be resistant to nuclease exonucleases are PS-modified nucleotides. According to some embodiments of the present invention, the at least one loop structure at the 5' end further comprises one or more nucleic acids to stabilize the end. According to some embodiments of the present invention, the at least one loop structure at the 5' end further comprises one or more nucleic acids chemically modified. According to some embodiments of the present invention, the deoxyinosine residue is present at a position of -1i, -2i, -5i or -7i relative to SEQ ID NO:7. According to some embodiments of the present invention, the deoxyinosine residue is present at a position of -1i or -7i relative to SEQ ID NO:7.

[0020] According to some embodiments of the present invention, the ssDNA molecule is capable of being transported from the cytosol across the nuclear membrane into the nucleus of the host cell. According to some embodiments of the present invention, the ssDNA molecule further comprises at least one functional moiety. According to some embodiments of the present invention, the at least one stem-loop structure at the 3′ end comprises at least one functional moiety. According to some embodiments of the present invention, the at least one stem-loop structure at the 5′ end comprises at least one functional moiety. According to some embodiments of the present invention, the at least one functional moiety is an aptamer. According to some embodiments of the present invention, the loop at the 5′ end and / or the 3′ end further comprises one or more aptamers. According to some embodiments of the present invention, the aptamer is encoded in the ceDNA molecule, and the aptamer forms a secondary aptamer structure in the ssDNA molecule. According to some embodiments of the present invention, the aptamer is a CH4-1 aptamer. According to some embodiments of the present invention, the at least one loop at the 3′ end and / or the 5′ end further comprises one or more synthetic ribozymes. According to some embodiments of the present invention, the at least one loop at the 3′ end and / or the 5′ end further comprises one or more antisense oligonucleotides (ASOs). According to some embodiments of the present invention, the at least one loop at the 3′ end and / or the 5′ end further comprises one or more short interfering RNAs (siRNAs). According to some embodiments of the present invention, the at least one loop at the 3′ end and / or the 5′ end further comprises one or more antiviral nucleoside analogs (ANAs). According to some embodiments of the present invention, the at least one loop at the 3′ end and / or the 5′ end further comprises one or more triplex-forming oligonucleotides. According to some embodiments of the present invention, the at least one loop at the 3′ end and / or the 5′ end further comprises one or more gRNAs or gDNAs. According to some embodiments of the present invention, the at least one loop at the 3′ end and / or the 5′ end further comprises one or more molecular probes. According to some embodiments of the present invention, the ssDNA molecule lacks any viral capsid protein coding sequence. According to some embodiments of the present invention, the ssDNA molecule comprises a first ITR and a second ITR, and wherein the ITRs do not comprise any viral-derived sequences.

[0021] According to some embodiments of the present invention, the ssDNA molecule does not contain any virally derived sequences. According to some embodiments of the present invention, the ssDNA molecule comprises a first ITR and a second ITR, and wherein the ITRs are synthetic. According to some embodiments of the present invention, the ssDNA molecule is synthetically produced in vitro. According to some embodiments of the present invention, the ssDNA molecule is synthetically produced in vitro in a cell-free environment. According to some embodiments of the present invention, the ssDNA molecule does not activate or minimally activates an immune pathway. According to some embodiments, the immune pathway is an innate immune pathway. According to other additional embodiments, the immune pathway is an innate immune pathway selected from the group consisting of: a cGAS / STING pathway, a TLR9 pathway, an inflammasome-mediated pathway, and combinations thereof. According to some embodiments of the present invention, the nucleic acid sequence of interest is a therapeutic protein or a therapeutic fragment thereof.

[0022] According to some of the aspects and embodiments herein, the at least one therapeutic protein is selected from the group consisting of an antibody, an enzyme, a coagulation factor, a transcription factor, a replication factor, a growth factor, a hormone, and a fusion protein. According to further embodiments, the at least one therapeutic protein can be used to treat a genetic disorder selected from the group consisting of melanoma, hemophilia A (factor VIII (FVIII) deficiency) and hemophilia B (factor IX (FIX) deficiency), cystic fibrosis (CFTR), familial hypercholesterolemia (LDL receptor deficiency), hepatoblastoma, Wilson disease, phenylketonuria (PKU), congenital hepatic porphyria, inherited liver metabolic disorders, Lesch Nyhan syndrome, sickle cell anemia, thalassemia, xeroderma pigmentosum, Fanconi's anemia, retinitis pigmentosa, ataxia telangiectasia, Bloom's syndrome, retinoblastoma, mucopolysaccharidosis (e.g.,Hurler syndrome (MPS type I), Scheie syndrome (MPS type IS), Hurler-Scheie syndrome (MPS type I HS), Hunter syndrome (MPS type II), Sanfilippo types A, B, C, and D (MPS types III A, B, C, and D), Morquio types A and B (MPS IVA and MPS IVB), Maroteaux-Lamy syndrome (MPS type VI), Sly syndrome (MPS type VII), Hyaluronidase deficiency (MPS type IX), Niemann-Pick disease types A / B, C1, and C2, Fabry disease, Schindler disease, GM2-ganglioside type II (Sandhoff disease), Disease), Tay-Sachs disease, metachromatic leukodystrophy, Krabbe disease, mucolipidosis types I, II / III, and IV, sialidosis types I and II, glycogen storage disease types I and II (Pompe disease), Gaucher disease types I, II, and III, Fabry disease, cystinosis, Batten disease, aspartylglucosaminuria, Salla disease, Danon disease (LAMP-2 deficiency), lysosomal acid lipase (LAL) deficiency, neuronal ceroid lipofuscinosis (CLN1-8, INCL, and LINCL), sphingolipidoses, galactosialidosis, amyotrophic lateral sclerosis (ALS), Parkinson's disease, Alzheimer's disease, Huntington's disease disease), spinocerebellar ataxia, spinal muscular atrophy, Friedreich's ataxia, Duchenne muscular dystrophy (DMD), Becker muscular dystrophy (BMD), dystrophic epidermolysis bullosa (DEB), ectonucleotide pyrophosphatase 1 deficiency, systemic arterial calcification of infancy (GACI), Leber congenital amaurosis, Stargardt macular dystrophy (ABCA4), ornithine transcarbamylase (OTC) deficiency, Usher syndrome, alpha-1 antitrypsin deficiency, progressive familial intrahepatic cholestasis (PFIC) type I (ATP8B1 deficiency), type II (ABCB11), type III (ABCB4), or type IV (TJP2), and cathepsin A deficiency.

[0023] According to another aspect, the present disclosure provides a linear single-stranded DNA (ssDNA) molecule comprising at least one nucleic acid sequence of interest flanked by at least one stem-loop structure at the 3′ end produced by the method of any one of the aspects and embodiments herein.

[0024] According to another aspect, the present disclosure provides a lipid nanoparticle comprising the ssDNA molecule of any aspect and embodiment herein and a lipid.

[0025] According to another aspect, the present disclosure provides a pharmaceutical composition comprising the ssDNA molecule of any aspect or embodiment herein, or the lipid nanoparticle composition of any aspect and embodiment herein, and a pharmaceutically acceptable excipient.

[0026] According to another aspect, the present disclosure provides a host cell comprising the ssDNA molecule of any aspect or embodiment herein or the lipid nanoparticle of any aspect or embodiment herein.

[0027] According to another aspect, the present disclosure provides a method of treating a genetic disorder in a subject, the method comprising administering to the subject a therapeutically effective amount of the ssDNA molecule of any aspect or embodiment herein, the lipid nanoparticle of any aspect or embodiment herein, or the pharmaceutical composition of any aspect or embodiment herein.

[0028] According to another aspect, the present disclosure provides a method of delivering a therapeutic gene and / or therapeutic protein to a subject, the method comprising administering to the subject a therapeutically effective amount of the ssDNA molecule of any aspect or embodiment herein, the lipid nanoparticle of any aspect or embodiment herein, or the pharmaceutical composition of any aspect or embodiment herein.

[0029] According to another aspect, the present disclosure provides a method for delivering a therapeutic gene and / or therapeutic protein to a cell, the method comprising contacting the cell with the ssDNA molecule of any aspect or embodiment herein, the lipid nanoparticle of any aspect or embodiment herein, or the pharmaceutical composition of any aspect or embodiment herein, thereby delivering the therapeutic gene and / or therapeutic protein to the cell.

[0030] According to another aspect, the present disclosure provides a method for delivering a therapeutic gene to a cell nucleus, the method comprising contacting a cell with the ssDNA molecule of any aspect or embodiment herein, the lipid nanoparticle of any aspect or embodiment herein, or the pharmaceutical composition of any aspect or embodiment herein, thereby delivering the therapeutic gene and / or therapeutic protein to the cell nucleus.

[0031] According to another aspect, the present disclosure provides a method of minimizing an immune response in a subject, wherein the subject is being treated with a therapeutic gene or therapeutic protein, the method comprising administering to the subject a therapeutically effective amount of the ssDNA molecule of any aspect or embodiment herein, the lipid nanoparticle of any aspect or embodiment herein, or the pharmaceutical composition of any aspect or embodiment herein, wherein the nucleic acid of interest encodes the therapeutic gene or therapeutic protein. BRIEF DESCRIPTION OF THE DRAWINGS

[0032] The embodiments of the present disclosure, briefly summarized above and discussed in more detail below, may be understood by reference to the illustrative embodiments of the disclosure depicted in the accompanying drawings. However, the drawings illustrate only typical embodiments of the disclosure and are therefore not to be considered limiting of its scope, as the disclosure may admit to other equally effective embodiments.

[0033] Figure 1 Schematic diagrams depicting symmetric and asymmetric inverted terminal repeat (ITR) oligonucleotides.

[0034] Figure 2 The synthesis of single-stranded DNA (ssDNA, SSD) by rolling circle amplification and enzymatic synthesis is shown. The plasmid template (lanes 2 and 7) was subjected to rolling circle amplification to produce the intermediate dsDNA molecule "A" (lane 3). This intermediate molecule was enzymatically synthesized to produce the end-blocked DNA (ceDNA) molecule "C" (lanes 4 and 9). The ceDNA was further processed using Nb.BbvCI (lane 5) or endonuclease V (lane 10) to produce ssDNA "I". oc, open circular plasmid; sc, supercoiled plasmid; A, amplification product; C, ceDNA; I, ssDNA.

[0035] Figure 3AThe design of an endonuclease V substrate for single-stranded DNA (ssDNA) synthesis is shown. Figure 3A As shown, inosine positions -1, -2, -5, and -7 are numbered with reference to the 3' end of the left ITR (see SEQ ID NO: 4). In the RBE region of the left ITR (SEQ ID NO: 4), certain nucleotides (nt) were modified from the AAV2 ITR sequence to minimize CpG sites. This is advantageous for the present invention because CpG sites are known to activate innate immune responses, and methylation of CpG motifs can affect promoter function by, for example, promoter silencing.

[0036] Figure 3B Depicted are exemplary ssDNA molecules containing hairpin ITRs with potential positions for inosine substitutions and having phosphorothioate (PS) linkages.

[0037] Figure 4A Schematic diagram showing the predicted secondary structure of the inosine-modified left ITR. The inosine position affects the second-strand synthesis of ssDNA. The leftmost structure (i) is the standard (unmodified) structure. The designated structures (ii)-(v) demonstrate inosine modification of the left ITR relative to the 3′ end. Red, green, and blue colors indicate high, medium, or low probability of base pairing.

[0038] Figure 4B Schematic diagram showing the predicted secondary structure of an inosine-modified left ITR after endonuclease V-mediated ssDNA synthesis. Designated structures (i)-(iv) show the predicted secondary structure of a left ITR with an inosine modification relative to the 3' end. Red, green, and blue colors indicate high, medium, or low probability of base pairing. The 3' and 5' ends of each ITR are labeled.

[0039] Figure 5 The results of Klenow filling of inosine containing single-stranded DNA are shown, indicating that ssDNA conversion was successful. ceDNA containing no inosine or inosine at various positions within the left ITR (SEQ ID NO:) was generated by RAMP (lanes 2, 5, 8, 11, 14). ceDNA was subjected to endonuclease V-mediated ssDNA synthesis (lanes 3, 7, 10, 15). The resulting product was treated with DNA polymerase I Large (Klenow) fragment exonuclease-(which lacks 3'-->5' and 5'--> exonuclease activity) to promote second-strand synthesis (lanes 4, 7, 10, 13, 16). The products of successful second-strand synthesis of ceDNA and ssDNA co-migrate.

[0040] Figure 6Results showing that a universal Endonuclease V-mediated synthesis protocol enables efficient ssDNA conversion across constructs are shown. Multiple ceDNAs with unique internal sequences were generated by RAMP. All ceDNAs contained a left ITR with inosine at the -1 position and a right ITR with an extended A-stem (SO-238; SEQ ID NO: 14) (lanes 3, 5, 7, 10, 11). ceDNA lacking inosine served as a control for Endonuclease V activity (lane 2). All ceDNAs were subjected to Endonuclease V-mediated ssDNA synthesis (lanes 2, 4, 6, 8, 9, 12).

[0041] Figure 7 An exemplary method for a synthetic process that achieves a minimized, universal synthetic approach through functional moieties is presented. Conventional methods are GOI-guided and therefore GOI-specific and require enzyme / sequence optimization for the GOI. The novel process described herein is left ITR-guided and a universal approach, and utilizes modification-specific enzymes, such as Endonuclease V, a DNA damage repair protein that recognizes and nicks inosine-containing DNA.

[0042] Figure 8 Demonstrated is the process of eliminating various ITR regions to minimize undesirable ssDNA as described herein.

[0043] Figure 9 ssDNA variants were demonstrated to improve metabolic stability and promote higher gene expression.

[0044] Figure 10 Exemplary modifications that inhibit nucleases and / or increase duplex stability in the ITR configuration are shown.

[0045] Figure 11 Depicted are exemplary LNPs encapsulating ssDNA as described herein.

[0046] Figure 12 Demonstrates termination of ssDNA synthesis by T7 exonuclease using a ceDNA precursor with AAV-derived ITRs in the absence of phosphorothioate (PS) bonds. Schematics of the ceDNA precursor are shown on the left and center, respectively, showing conversion to ssDNA with and without PS bonds. A gel is shown on the right, showing efficient conversion of ceDNA to ssDNA with and without PS bonds in the ceDNA precursor after treatment with nickase and T7 exonuclease.

[0047] Figure 13Demonstrates termination of ssDNA synthesis by T7 exonuclease using a ceDNA precursor with simple hairpin-blocked ends in the absence of phosphorothioate (PS) bonds. Schematics of ceDNA precursors with simple hairpin-blocked ends are shown on the left and center, respectively, showing conversion to ssDNA with and without PS bonds. A gel is shown on the right, showing efficient conversion of ceDNA to ssDNA with and without PS bonds in the ceDNA precursor after treatment with nickase and T7 exonuclease.

[0048] Figures 14A-14D Schematic diagram of ssDNA generated by treating ceDNA precursors with and without PS linkages with AAV-derived or simple hairpin ends. Triangles indicate the location of the nicking site. Arrows indicate the location of the priming site for Sanger run-off sequencing. Stars indicate the location of the PS linkage. Figure 14A : AAV-derived ITR end (right side) with PS linkage. Figure 14B : AAV-derived ITR end (right side) without PS linkage. Figure 14C : Simple hairpin end (right side) with PS bond. Figure 14D : Simple hairpin end (right side), no PS key. Figure 14B and Figure 14D The dashed line on the middle right indicates heterogeneity of the endpoint sequence.

[0049] Figure 15 Examples of end-structured oligonucleotides and strategies for testing the sequence and structural requirements for T7 exonuclease termination are shown. At the top are examples of oligonucleotide sequences and predicted dsDNA structures, including the CH4-1 aptamer on the right. At the bottom are schematic diagrams of the predicted fragments generated by RsaI and EcoRI digestion, depending on whether T7 exonuclease terminates in a structured region.

[0050] Figure 16A Shown are the sequence (bottom) and schematic (top) of the full-handle oligonucleotide, which also includes the CH4-1 aptamer on the right.

[0051] Figure 16B Shown are the sequence (bottom) and schematic (top) of the half-handle oligonucleotide, which also includes the CH4-1 aptamer on the right.

[0052] Figure 16C Shown are the sequence (bottom) and schematic (top) of the extended half-handle oligonucleotide, which also includes the CH4-1 aptamer on the right.

[0053] Figure 16DShown are the sequence (bottom) and schematic (top) of the bubble_v1 oligonucleotide, which also includes the CH4-1 aptamer on the right.

[0054] Figure 16E Shown are the sequence (bottom) and schematic (top) of the bubble_v19 oligonucleotide, which also includes the CH4-1 aptamer on the right.

[0055] Figure 16F Shown are the sequence (bottom) and schematic (top) of the circular oligonucleotide, which also includes the CH4-1 aptamer on the right.

[0056] Figure 16G Shown are the sequences (bottom) and schematics (top) of oligonucleotides with PS linkages ("1-5" indicates that the oligonucleotide contains 1, 2, 3, 4, or 5 PS linkages), which also include the CH4-1 aptamer on the right.

[0057] Figure 16H Shown are the sequence (bottom) and schematic (top) of a control (no TS) oligonucleotide that also includes the CH4-1 aptamer on the right.

[0058] Figure 17 Shown are gel analyses of restriction enzyme digestion profiles of Bubble_v1, Bubble_v19, full-stem, half-stem, and extended half-stem oligonucleotides.

[0059] Figure 18 Shown are gel analyses of restriction enzyme digestion profiles of oligonucleotides having 5 PS bonds, 4 PS bonds, 3 bonds, 2 PS bonds, 1 PS bond, or circular oligonucleotides.

[0060] Figure 19 A schematic strategy for generating ssDNA using a full-stalk structured motif to terminate T7 exonuclease is shown. The two sides illustrate the use of a full-stalk structure. Additionally, the right side illustrates an aptamer encoded as double-stranded DNA that folds into a functional aptamer structure only after ssDNA generation.

[0061] Figure 20 A schematic strategy for generating ssDNA using different structured motifs to terminate T7 exonuclease is shown. The two sides show the use of half-handle structures. Additionally, the right side shows an aptamer encoded as double-stranded DNA that folds into a functional aptamer structure only after ssDNA generation.

[0062] Figure 21A schematic strategy for generating ssDNA by degrading the nicked strand in the 3′→5′ direction using exonuclease III (Exo III) is shown. Termination by Exo III is controlled by the specific position of the PS bond (represented by circles connected by curved lines).

[0063] Figure 22 Shown is a gel analysis of ssDNA produced using Exo III compared to T7 exonuclease. The left side shows the results of the two-step method. The right side shows the results of the "one-pot method." DETAILED DESCRIPTION

[0064] I. Definition

[0065] Unless otherwise defined herein, scientific and technical terms used in conjunction with this application shall have the meanings commonly understood by those of ordinary skill in the art of the present disclosure. It should be understood that the present disclosure is not limited to the specific methods, protocols, and reagents described herein and may vary accordingly. The terms used herein are for the purpose of describing specific embodiments only and are not intended to limit the scope of the present disclosure, which is limited only by the claims. Definitions of commonly used terms in immunology and molecular biology can be found in The Merck Manual of Diagnosis and Therapy, 19th ed., Merck Sharp & Dohme Corp., 2011 (ISBN 978-0-911910-19-3); Robert S. Porter et al. (eds.), Fields Virology, 6th ed., Lippincott Williams & Wilkins, Philadelphia, PA, USA (2013); Knipe, DM and Howley, PM (eds.), The Encyclopedia of Molecular Cell Biology and Molecular Medicine, Blackwell Science Ltd. Ltd., 1999–2012 (ISBN 9783527600908); and Robert A. Meyers (ed.), Molecular Biology and Biotechnology: a Comprehensive Desk Reference, VCH Publishers, Inc.), published by Elsevier in 1995 (ISBN 1-56081-569-8); Werner Luttmann, Immunology, published by Elsevier in 2006; Janeway's Immunobiology, Kenneth Murphy, Allan Mowat, Casey Weaver (eds.), published by Taylor & Francis Limited in 2014 (ISBN 0815345305, 9780815345305); Lewin's Genes XI, published by Jones & Bartlett Publishers in 2014 (ISBN 1449659055); Michael Richard Green and Joseph Sambrook, Molecular Cloning: A Laboratory Manual Manual, 4th ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, USA (2012) (ISBN 1936113414); Davis et al., Basic Methods in Molecular Biology, Elsevier Science Publishing, Inc., New York, USA (2012) (ISBN 044460149X); Laboratory Methods in Enzymology: DNA, Jon Lorsch (ed.), Elsevier, 2013 (ISBN 0124199542); Current Protocols in Molecular Biology (CPMB), Frederick M. Ausubel (ed.), John Wiley and Sons, 2013 (ISBN 0124199542); Sons), 2014 (ISBN047150338X, 9780471503385), Current Protocols in Protein Science (CPPS), John E.Coligan (ed.), John Wiley and Sons, Inc., 2005; and Current Protocols in Immunology (CPI) (John E. Coligan, ADA M Kruisbeek, David H Margulies, Ethan M Shevach, Warren Strobe, (eds.), John Wiley and Sons, 2003 (ISBN 0471142735, 9780471142737), the contents of which are incorporated herein by reference in their entirety.

[0066] As used herein, the term "AAV" or "adeno-associated virus" refers to a single-stranded DNA parvovirus that replicates only in cells. Some of the functions of AAV are provided only by co-infection with a helper virus. Thirteen serotypes of AAV have been identified. Basic information and reviews of AAV can be found in, for example, Carter, 1989, Handbook of Parvoviruses, Vol. 1, pp. 169-228 and Berns, 1990, Virology, pp. 1743-1764, Raven Press, (New York).

[0067] As used herein, the phrases "anti-therapeutic nucleic acid immune response," "immune response to therapeutic nucleic acid," "immune response to transfer vector," and the like refer to any immune response to a therapeutic nucleic acid, whether viral or non-viral in origin. For example, in some embodiments, the immune response is specific for the transfer vector, which can be single-stranded DNA, double-stranded DNA, single-stranded RNA, or double-stranded RNA. In other embodiments, the immune response is specific for single-stranded DNA, such as single-stranded synthetic DNA.

[0068] As used herein, the term "aptamer" refers to a nucleic acid molecule that can bind with high affinity and specificity to a particular molecule of interest (Tuerk and Gold, Science 249:505 (1990); Ellington and Szostak, Nature 346:818 (1990)). For example, an aptamer can be composed of DNA or RNA, or can comprise non-natural nucleotides and nucleotide analogs (e.g., locked DNA or peptide nucleic acids [PNA]) that have high affinity for proteins located in the cell nucleus or its membranes.

[0069] As used herein, the terms "cell-free," "cell-free synthesis," "cell-free production," "synthetic end-blocked DNA vector production," and "synthetic production," and all other related counterparts, are used interchangeably and refer to the production of one or more molecules in a manner that does not involve replication or other propagation of the molecules by or within cells or using cell extracts. Synthetic production avoids contamination of the produced molecules with cellular contaminants (e.g., cellular proteins or cellular nucleic acids) and further avoids unwanted cell-specific modifications of the molecules (e.g., methylation or glycosylation or other post-translational modifications) during the production process.

[0070] As used herein, the terms "single-stranded DNA molecule," "ssDNA molecule," or "SSD molecule" refer to a deoxyribonucleic acid (DNA) molecule comprising at least one single-stranded nucleic acid sequence flanked by at least one stem-loop structure at the 3' end. In some embodiments, the single-stranded DNA molecule further comprises at least one stem-loop structure at the 5' end. As used herein, a single-stranded DNA molecule may comprise a region of double-stranded DNA (or partial duplex), such as a stem-loop structure, such as an inverted terminal repeat sequence or portion thereof at an end, such as at the 3' end and / or the 5' end. In some embodiments, the ssDNA molecule is a synthetic ssDNA molecule. In some embodiments, the ssDNA molecule comprises at least one stem-loop structure at the 5' end and at least one stem-loop structure at the 3' end.

[0071] As used herein, the terms "single-stranded (ss) synthetic DNA molecules," "single-stranded (ss) synthetic vectors," "synthetic production of ss DNA molecules," and "synthetic production of ss vectors" refer to single-stranded (ss) synthetic DNA molecules (ssDNA), single-stranded vectors, and methods for synthetic production thereof in a completely cell-free environment. Production can involve one or more molecules in a manner that does not involve replication or other propagation of the molecules by or within cells or using cell extracts. Synthetic production avoids contamination of the produced molecules with cellular contaminants (e.g., cellular proteins or cellular nucleic acids, viral proteins or DNA, insect proteins or DNA), and further minimizes unwanted cell-specific modifications of the molecules (e.g., methylation or glycosylation or other post-translational modifications) during the production process.

[0072] As used herein, the term "gap" refers to an interruption in the synthetic DNA vectors of the present disclosure, thereby generating a stretch of single-stranded DNA in an otherwise double-stranded DNA. The length of the gap can be from 1 nucleotide to 100 nucleotides. Typical gaps designed and produced by the methods described herein and the synthetic vectors produced by the methods can be, for example, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85 , 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, or 60 nucleotides (nt). Exemplary gaps in the present disclosure can be 1 nt to 10 nt long, 1 nt to 20 nt long, 1 nt to 30 nt long, or any length. According to some embodiments, the gap can be present 5' upstream of the expression cassette. According to some embodiments, the gap can be present 3' downstream of the expression cassette. According to some embodiments, the gap can be present both 5' upstream and 3' downstream of the expression cassette.

[0073] As used herein, the term "nicking gap" refers to a discontinuity in a double-stranded DNA molecule in which there is no phosphodiester bond between adjacent nucleotides of a chain, typically by damage or enzymatic action. It will be understood that one or more nicking gaps allow for release of torsion in the DNA chain during replication, and that nicking gaps play a role in promoting the binding of the transcription machinery. According to some embodiments, single-strand breaks ("nicking gaps") in DNA can be formed by hydrolysis and subsequent removal of the phosphate groups within the helical backbone.

[0074] As used herein, the term "ceDNA" refers to linear, double-stranded (ds) duplex DNA without capsid end-blocking for non-viral gene transfer, synthetic or otherwise. A detailed description of ceDNA is described in International Patent Application No. PCT / US2017 / 020828, filed on March 3, 2017 (published as International Patent Publication No. WO2017152149A1), the entire contents of which are expressly incorporated herein by reference. Certain methods for generating ceDNA containing various inverted terminal repeat (ITR) sequences and configurations using cell-based methods are described in Example 1 of International Application PCT / US18 / 49996, filed September 7, 2018 (published as International Patent Publication No. WO 2019 / 051255 A1), and PCT / US2018 / 064242, filed December 6, 2018 (published as International Patent Publication No. WO 2019 / 113310 A1), each of which is incorporated herein by reference in its entirety. Certain methods for generating synthetic ceDNA vectors containing various ITR sequences and configurations are described, for example, in International Application PCT / US2019 / 14122, filed January 18, 2019 (published as International Patent Publication No. WO 2019 / 143885 A1), the entire contents of which are incorporated herein by reference. As used herein, the terms "ceDNA vector" and "ceDNA" are used interchangeably. According to some embodiments, the ceDNA is a closed-end linear duplex (CELiD) CELiD DNA. According to some embodiments, the ceDNA is a DNA-based minicircle. According to some embodiments, the ceDNA is a minimalistic immunologically defined gene expression (MIDGE)-vector. According to some embodiments, the ceDNA is a ministring DNA. According to some embodiments, the ceDNA is a doggybone TM DNA. According to some embodiments, the ceDNA comprises one or more phosphorothioate-modified nucleotides. According to some embodiments, the ceDNA does not comprise phosphorothioate-modified nucleotides.

[0075] As used herein, the term "neDNA" or "nicked ceDNA" refers to end-blocked DNA having a nick or gap of 1-100 base pairs in the stem or spacer region upstream of the open reading frame (e.g., the promoter and transgene to be expressed).

[0076] As used herein, the term "inverted terminal repeat" or "ITR" refers to a nucleic acid sequence located at the 5' end and / or 3' end of an ssDNA molecule disclosed herein that comprises at least one stem-loop structure comprising a partial duplex and at least one loop.

[0077] As used herein, the term "stem-loop structure" refers to a nucleic acid structure comprising at least one double-stranded region (referred to herein as "stem") and at least one single-stranded region (referred to herein as "loop"). In certain embodiments, the stem-loop structure is a hairpin structure. In certain embodiments, the stem-loop structure comprises more than one stem and more than one loop. In certain embodiments, the loop is located at the end of the stem (making a single loop connect the two chains of the duplex stem, for example, as in a hairpin structure). In certain embodiments, the loop can be located between two stems (which can be referred to herein as "bulges" or "bubbles") so that the loop connects the two chains of different stems. In certain embodiments, as described in more detail herein, the stem-loop structure can comprise a more complex secondary structure comprising multiple stems and multiple loops.

[0078] According to some embodiments, the 5' and / or 3' ends of the ssDNA molecules disclosed herein contain inverted terminal repeats (ITRs) of approximately 145 nucleotides at both ends or fragments thereof. The terminal 125 nucleotides in each ITR form a palindromic double-stranded T-shaped hairpin structure, in which the AA' palindrome forms the stem and the two smaller palindromes BB' and CC' form the cross arms of the T. The other 20 nucleotides in the ITR remain single-stranded and are referred to as D sequences. A D(-) sequence (also referred to herein as a "ssD(-) sequence") is at the 3' end, and a complementary D(+) sequence (also referred to herein as a "ssD(+) sequence") is at the 5' end. Second-strand DNA synthesis converts both the ssD(-) and ssD(+) sequences into double-stranded (ds)D(±) sequences, each of which comprises a D region and a D' region. Ling et al., J Virol. 2015 Jan 15;89(2):952-61, WO2016081927A2, which are incorporated herein by reference in their entirety, describe ssAAV genomes with ssD(+)-sequence substitutions. ssD(-) and ssD(+) have been reported to contain one or more transcription factor binding sites and are required for packaging and replication (Ling et al., J Virol. 2015 Jan 15;89(2):952-61; WO2016081927A2, which are incorporated herein by reference in their entirety).

[0079] According to some embodiments, the ITR can be a viral ITR (e.g., AAV or other dependent virus), a sequence derived from a viral ITR or modified therefrom (e.g., truncated, deleted, substituted, inserted and / or added) or a completely artificial sequence (e.g., the ITR does not contain a sequence derived from a virus). The ITR can further comprise a stem-loop structure (e.g., a "hairpin") or more than one stem-loop structure. For example, the ITR can comprise two stem-loop structures (e.g., a "hammerhead," "doggy-bone," or "dumbbell"), three stem-loop structures (e.g., a "cross"), or a more complex structure (e.g., a quadruplex stem-loop structure). The ITR can comprise an aptamer sequence or one or more chemical modifications. The ITR can be made entirely of an aptamer sequence having at least one stem region and at least one loop region.

[0080] According to some embodiments, "ITR" can be artificially synthesized using a group of oligonucleotides comprising one or more desired functional sequences (e.g., palindromic sequences). The ITR sequence can be an artificial AAV ITR, an artificial non-AAV ITR, or an ITR physically derived from a viral AAV ITR (e.g., an ITR fragment removed from the viral genome). For example, ITR can be derived from the Parvoviridae family, which encompasses parvovirus and Dependinovirus (e.g., canine parvovirus, bovine parvovirus, mouse parvovirus, porcine parvovirus, human parvovirus B-19), or the SV40 hairpin serving as the SV40 origin of replication can be used as ITR, which can be further modified by truncation, substitution, deletion, insertion, and / or addition. The Parvoviridae family of viruses consists of two subfamilies: the Parvovirinae family of vertebrate infection and the Densovirinae family of invertebrate infection. The Dependinovirus family includes a virus family of adeno-associated viruses (AAV) that can replicate in vertebrate hosts, including but not limited to humans, primates, cattle, dogs, horses, and sheep species. In general, ITR sequences can be derived not only from AAV, but also from parvovirus, lentivirus, goose virus, B19, in configurations of wild-type, "dog bone" and "dumbbell", symmetrical or even asymmetrical ITR orientations. Although ITRs are typically present in both the 5' and 3' ends of AAV vectors, in single-stranded DNA (ssDNA) molecules, ITRs may be present in only one of the ends of the linear vector. For example, ITRs may only be present at the 5' end. In some other cases, ITRs may only be present at the 3' end in single-stranded DNA (ssDNA) molecules. For convenience herein, the ITR located 5' ("upstream") of the expression cassette in the single-stranded DNA (ssDNA) molecule is referred to as the "5' ITR", and the ITR located 3' ("downstream") of the expression cassette in the single-stranded DNA (ssDNA) molecule is referred to as the "3' ITR".

[0081] As used herein, "wild-type ITR" or "WT-ITR" refers to the sequence of a naturally occurring ITR sequence in the AAV genome or other dependent virus species that retains, for example, Rep binding activity and Rep nicking ability. Due to the degeneracy or drift of the genetic code, the nucleotide sequence of the WT-ITR from any AAV serotype may differ slightly from the typical naturally occurring sequence, and therefore, the WT-ITR sequences contemplated for use herein include WT-ITR sequences that arise due to naturally occurring variations (e.g., replication errors).

[0082] As used herein, the term "substantially symmetric WT-ITR" or "substantially symmetric WT-ITR pair" refers to a pair of WT-ITRs within a single-stranded DNA (ssDNA) molecule that are wild-type ITRs with reverse complementary sequences throughout their entire length. For example, even if an ITR has one or more nucleotides that deviate from a typical, naturally occurring canonical sequence, as long as these changes do not affect the physical and functional properties and overall three-dimensional structure (secondary and tertiary structure) of the sequence, the ITR can be considered a wild-type sequence. In some aspects, the deviated nucleotides represent conservative sequence changes. As a non-limiting example, a sequence has at least 95%, 96%, 97%, 98% or 99% sequence identity to the canonical sequence (as measured, for example, using BLAST at default settings) and also has a symmetric three-dimensional spatial organization with another WT-ITR such that their 3D structures have the same shape in geometric space. Substantially symmetric WT-ITRs have identical ssD(-) / ssD(+), AA', CC' and BB' loops in 3D space. Substantially symmetric WT-ITRs can be functionally confirmed to be WT by confirming that they have an operable Rep binding site (RBE or RBE') and a terminal resolution site (TRS) that pair with the appropriate Rep protein.Other functions can optionally be tested, including transgene expression under permissive conditions.

[0083] As used herein, the phrases "modified ITR" or "mod-ITR" or "mutant ITR" are used interchangeably and refer to an ITR having a mutation in at least one or more nucleotides compared to a WT-ITR from the same serotype. The mutation can result in a change in one or more of the ssD(-) or ssD(+), A, A', C, C', B, B' regions of the ITR, and can result in a change in the three-dimensional organization (i.e., its 3D structure in geometric space) compared to the 3D organization of the WT-ITR of the same serotype.

[0084] As used herein, the term "asymmetric ITR", also referred to as an "asymmetric ITR pair", refers to a pair of ITRs within a single ceDNA vector that are not reverse complementary over their entire length. As a non-limiting example, an asymmetric ITR does not have a symmetrical three-dimensional spatial organization with its cognate ITR, such that its 3D structure has a different shape in geometric space. In other words, the asymmetric ITR pair has a different overall geometric structure, i.e., it has a different organization of its ssD(-) / ssD(+), A, A', C, C', B and B' regions in 3D space (e.g., one ITR may not have ssD(-) and a short CC' arm and / or a short BB' arm and the other ITR may not have ssD(+), but has a normal AAV CC' arm and a truncated BB' arm compared to the cognate ITR). The sequence difference between the two ITRs may be due to one or more nucleotide additions, deletions, truncations or point mutations. According to some embodiments, one ITR in an asymmetric ITR pair can be a wild-type AAV ITR sequence, and the other ITR is a modified ITR as defined herein (e.g., a non-wild-type or synthetic ITR sequence). In another embodiment, neither ITR in an asymmetric ITR pair is a wild-type AAV sequence, and both ITRs are modified ITRs having different shapes in geometric space (i.e., different overall geometric structures). In some embodiments, one mod-ITR in an asymmetric ITR pair can have a short C-C' arm, and the other ITR can have a different modification (e.g., a single arm or a short B-B' arm, etc.) such that it has a different three-dimensional spatial organization than the homologous asymmetric mod-ITR.

[0085] As used herein, the term "symmetric ITR" refers to a pair of ITRs within a ceDNA vector that are mutated or modified relative to a wild-type dependent viral ITR sequence and are reversely complementary over their full length. Neither of these two ITRs is a wild-type ITR AAV2 sequence (i.e., it is a modified ITR, also referred to as a mutant ITR), and is different from the wild-type ITR in sequence due to the addition, deletion, substitution, truncation or point mutation of nucleotides. For convenience herein, the ITR at the 5' (upstream) of the expression cassette in a single-stranded DNA (ssDNA) molecule is referred to as "5' ITR", and the ITR at the 3' (downstream) of the expression cassette in the single-stranded DNA (ssDNA) molecule is referred to as "3' ITR".

[0086] As used herein, the term "substantially symmetrical modified ITRs" or "substantially symmetrical mod-ITR pair" refers to a pair of modified ITRs within a single-stranded DNA (ssDNA) molecule (e.g., a synthetic vector, e.g., a single-stranded (ss) synthetic vector) that have reverse complement sequences throughout their length. For example, even if the modified ITR has some nucleotide sequence that deviates from the reverse complement sequence, it can be considered to be substantially symmetrical as long as these changes do not affect the properties and overall shape. As a non-limiting example, a sequence has at least 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity to a representative sequence (as measured using BLAST at default settings) and also has a symmetrical three-dimensional spatial organization with its cognate modified ITR, such that their 3D structures have the same shape in geometric space. In other words, a substantially symmetrical modified ITR pair has the same stem-loop structure organized in 3D space. In some embodiments, the ITRs from a mod-ITR pair can have different reverse complementary nucleotide sequences but still have the same symmetrical three-dimensional spatial organization, i.e., both ITRs have mutations that produce the same overall 3D shape. For example, in viral ITRs, one ITR (e.g., 5' ITR) in a mod-ITR pair can be from one serotype, and the other ITR (e.g., 3' ITR) can be from a different serotype, however, both can have the same corresponding mutations (e.g., if the 5' ITR has a deletion in the C region, the homologously modified 3' ITR from a different serotype also has a deletion at the corresponding position in the C' region), such that the modified ITR pair has the same symmetrical three-dimensional spatial organization. In such embodiments, each ITR in the modified ITR pair can be from a different serotype (e.g., AAV1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, and 12), such as a combination of AAV2 and AAV6, wherein the modification in one ITR is reflected in the corresponding position in the homologous ITR from the different serotype. According to some embodiments, a substantially symmetrical modified ITR pair refers to a pair of modified ITRs (mod-ITRs) as long as the difference in nucleotide sequence between the ITRs does not affect the properties or overall shape and they have substantially the same shape in 3D space. As non-limiting examples, the mod-ITRs have at least 95%, 96%, 97%, 98% or 99% sequence identity to a typical mod-ITR as determined by standard methods well known in the art, such as BLAST (Basic Local Alignment Search Tool) or BLASTN under default settings, and further have a symmetrical three-dimensional spatial organization such that their 3D structures have the same shape in geometric space.A substantially symmetric mod-ITR pair has identical ssD(-) / ssD(+), A, A', C, C', and B, B' regions in 3D space. For example, if the modified ITR in the substantially symmetric mod-ITR pair lacks the C-C' arm, the corresponding homologous mod-ITR lacks the C-C' loop and also has a similar 3D structure with the remaining A and B-B' loops being the same shape in the geometric space of its cognate mod-ITR.

[0087] As used herein, the term "flanking" refers to the relative position of one nucleic acid sequence relative to another nucleic acid sequence. Typically, in the sequence ABC, B is flanked by A and C. This is also true for the arrangement AxBxC. Thus, a flanking sequence precedes or follows the flanking sequence, but need not be adjacent to or immediately adjacent to the flanking sequence. In one embodiment, the term flanking refers to the terminal repeat sequences at each end of a linear single-stranded DNA (ssDNA) molecule.

[0088] As defined herein, one or more "reporter genes" refer to one or more proteins that can be used to provide a detectable readout number. Reporter genes typically produce measurable signals, such as fluorescence, color or luminescence. Reporter protein coding sequence encoding is present in a cell or organism that is easily observed. For example, fluorescent proteins can cause cells to fluoresce when excited by light of a specific wavelength, luciferase causes cells to catalyze the reaction of producing light, and enzymes such as beta-galactosidase convert substrates into colored products. Exemplary reporter polypeptides that can be used for experiments or diagnostic purposes include but are not limited to beta-lactamase, beta-galactosidase (LacZ), alkaline phosphatase (AP), thymidine kinase (TK), green fluorescent protein (GFP) and other fluorescent proteins, chloramphenicol acetyltransferase (CAT), luciferase and other reporter polypeptides well known in the art.

[0089] As used herein, the term "effector protein" refers to a polypeptide that provides a detectable readout, for example, as a reporter polypeptide, or more appropriately, as a polypeptide that kills cells, such as a toxin, or an agent that renders cells susceptible to a selected agent or killed due to the lack of a selected agent. Effector proteins include any protein or peptide that directly targets or damages the DNA and / or RNA of a host cell. For example, effector proteins may include, but are not limited to, restriction endonucleases that target host cell DNA sequences (whether genomic or on extrachromosomal elements); proteases that degrade polypeptide targets necessary for cell survival; DNA gyrase inhibitors; and ribonuclease-type toxins. In some embodiments, the expression of an effector protein controlled by a synthetic biological circuit as described herein can participate as a factor in another synthetic biological circuit, thereby expanding the response range and complexity of the biological circuit system.

[0090] Transcriptional regulatory factors refer to transcriptional activators and repressors that activate or repress the transcription of a gene of interest. A promoter is a nucleic acid region that initiates transcription of a specific gene. Transcriptional activators typically bind near a transcriptional promoter and recruit RNA polymerase to directly initiate transcription. Repressors bind to transcriptional promoters and spatially hinder RNA polymerase from initiating transcription. Other transcriptional regulatory factors can act as activators or repressors depending on their binding location, cell, and environmental conditions. Non-limiting examples of transcriptional regulatory factor categories include, but are not limited to, homeodomain proteins, zinc finger proteins, winged helix (forkhead) proteins, and leucine zipper proteins.

[0091] As used herein, "carrier" includes any and all solvents, dispersion media, vehicles, coatings, diluents, antibacterial and antifungal agents, isotonic and absorption delaying agents, buffers, carrier solutions, suspensions, colloids, and the like. The use of such media and agents for pharmaceutically active substances is well known in the art. Supplementary active ingredients may also be incorporated into the composition. The phrase "pharmaceutically acceptable" refers to molecular entities and compositions that do not produce toxic, allergic, or similar adverse reactions when administered to a host.

[0092] As used herein, the term "in vivo" refers to an assay or process performed in or within an organism, such as a multicellular animal. In some of the aspects described herein, when a single-cell organism, such as a bacterium, is used, the method or use can be said to occur "in vivo." The term "ex vivo" refers to methods and uses performed using living cells with intact membranes that are outside of a multicellular animal or plant, such as explants, cultured cells, including primary cells and cell lines, transformed cell lines, and extracted tissues or cells, including blood cells, etc. The term "in vitro" refers to assays and methods that do not require the presence of cells with intact membranes, such as cell extracts, and can refer to the introduction of programmable synthetic biological circuits into non-cellular systems, such as media that do not contain cells or cell systems, such as cell extracts.

[0093] As used herein, the term "promoter" refers to any nucleic acid sequence that regulates the expression of another nucleic acid sequence by driving the transcription of a nucleic acid sequence, which can be a heterologous target gene encoding a protein or RNA. A promoter can be constitutive, inducible, repressible, tissue-specific, or any combination thereof. A promoter is a control region of a nucleic acid sequence, where the initiation and transcription rate of the remainder of the nucleic acid sequence are controlled. A promoter can also contain genetic elements that can bind to regulatory proteins and molecules such as RNA polymerase and other transcription factors. A transcription start site will be found within the promoter sequence, as well as a protein binding domain responsible for RNA polymerase binding. Eukaryotic promoters will often, but not always, contain a "TATA" box and a "CAT" box. Various promoters, including inducible promoters, can be used to drive the expression of transgenics in the single-stranded (ssDNA) molecules disclosed herein. The promoter sequence can be defined by a transcription start site at its 3' end and extend upstream (5' direction) to include the minimum number of bases or elements necessary to initiate transcription at a level detectable above background.

[0094] As used herein, the terms "expression cassette" and "expression unit" are used interchangeably and refer to a heterologous DNA sequence operably linked to a promoter or other DNA regulatory sequences sufficient to direct transgene transcription of a DNA vector, such as a single-stranded (ssDNA) molecule. Suitable promoters include, for example, tissue-specific promoters. The promoter can also be of AAV origin.

[0095] As used herein, when referring to a "regenerated double-stranded expression cassette" or a "regenerated double-stranded transgene," the term "regeneration" refers to a double-stranded expression cassette or double-stranded transgene that is formed after the ssDNA molecule has been transported to the nucleus of a host cell and responds to DNA polymerase activity that generates double-stranded DNA from the ssDNA by filling in the single-stranded portions of the ssDNA molecule.

[0096] As used herein, "operably linked" refers to a juxtaposition, wherein the components described in this manner are in a relationship that allows the components to function in their intended manner. For example, if a promoter affects the transcription or expression of a coding sequence, the promoter is operably linked to the coding sequence. A promoter can be considered to drive the expression of the nucleic acid sequence it regulates or to drive its transcription. The phrases "operably linked," "operably positioned," "operably linked," "under control," and "under transcriptional control" indicate that a promoter is in the correct functional position and / or orientation relative to the nucleic acid sequence it regulates, to control the initiation of transcription and / or expression of the sequence. As used herein, a "reverse promoter" refers to a nucleic acid sequence that is in the opposite orientation so that the coding strand now becomes the promoter of the non-coding strand, and vice versa. Reverse promoter sequences can be used in various embodiments to regulate the state of a switch. Additionally, in various embodiments, a promoter can be used in combination with an enhancer.

[0097] The terms "DNA regulatory sequence," "control element," and "regulatory element," used interchangeably herein, refer to transcriptional and translational control sequences, such as promoters, enhancers, polyadenylation signals, terminators, protein degradation signals, and the like, that provide and / or regulate the transcription of a non-coding sequence (e.g., a DNA-targeting RNA) or a coding sequence (e.g., a site-directed modifying polypeptide, or a Cas9 / Csn1 polypeptide) and / or regulate the translation of the encoded polypeptide.

[0098] As used herein, the term "enhancer" refers to a cis-acting regulatory sequence (e.g., 50-1,500 base pairs) that binds to one or more proteins (e.g., activator proteins or transcription factors) to enhance the transcriptional activation of a nucleic acid sequence. Naturally, an enhancer can be positioned up to 1,000,000 base pairs upstream of the gene start site or downstream of the gene start site that it regulates. An enhancer can be positioned within an intron region, or in an exon region of an unrelated gene. Cis-acting enhancer sequences of 20-200 base pairs are typically used to increase the expression of a transgene.

[0099] A promoter may be one naturally associated with a gene or sequence, such as one that can be obtained by isolating 5' non-coding sequences upstream of the coding segment and / or exons of a given gene or sequence. Such promoters may be referred to as "endogenous." Similarly, in some embodiments, an enhancer may be one naturally associated with a nucleic acid sequence, located downstream or upstream of the sequence. In some embodiments, the coding nucleic acid segment is positioned under the control of a "recombinant promoter" or a "heterologous promoter," both of which refer to promoters that are not normally associated with the coding nucleic acid sequence to which they are operably linked in their natural environment. Similarly, a "recombinant or heterologous enhancer" refers to an enhancer that is not normally associated with a given nucleic acid sequence in its natural environment. Such promoters or enhancers may include promoters or enhancers of other genes; promoters or enhancers isolated from any other prokaryotic, viral, or eukaryotic cell; and synthetic promoters or enhancers that are not "naturally occurring," i.e., those that have been engineered to contain different elements of different transcriptional regulatory regions that alter expression and / or have been mutated by methods known in the art. In addition to synthetically generating promoter and enhancer nucleic acid sequences, promoter sequences can also be generated using recombinant cloning and / or nucleic acid amplification techniques, including PCR, in conjunction with the synthetic biology circuits and modules disclosed herein (see, e.g., U.S. Patent No. 4,683,202, U.S. Patent No. 5,928,906, each of which is incorporated herein by reference). Furthermore, it is contemplated that control sequences that direct transcription and / or expression of sequences within non-nuclear organelles, such as mitochondria and chloroplasts, can also be employed.

[0100] As described herein, an "inducible promoter" is a promoter characterized in that when an inducer or inducer is present, affected by it, or contacted by it, transcriptional activity is initiated or enhanced. As defined herein, an "inducer" or "inducer" can be endogenous, or a generally exogenous compound or protein that is administered in a manner capable of inducing transcriptional activity from an inducible promoter. In some embodiments, the inducer or inducer, i.e., a chemical substance, compound, or protein, can itself be the result of transcription or expression of a nucleic acid sequence (i.e., the inducer can be an induced protein expressed by another component or module), and transcription or expression itself can be under the control of an inducible promoter. In some embodiments, an inducible promoter is induced in the absence of certain agents, such as repressors. Examples of inducible promoters include, but are not limited to, tetracycline, metallothionein, ecdysone, mammalian viruses (e.g., adenovirus late promoter; and mouse mammary tumor virus long terminal repeat (MMTV-LTR)) and other steroid-responsive promoters, rapamycin-responsive promoters, and the like.

[0101] As used herein, the term "subject" refers to a human or animal to whom treatment with a single-stranded (ssDNA) molecule according to the present disclosure is provided, including prophylactic treatment. Typically, the animal is a vertebrate, such as, but not limited to, a primate, a rodent, a domestic animal, or a wild animal. Primates include, but are not limited to, chimpanzees, crab-eating macaques, spider monkeys, and macaques, such as rhesus macaques. Rodents include mice, rats, marmots, ferrets, rabbits, and hamsters. Domestic and game animals include, but are not limited to, cattle, horses, pigs, deer, bison, buffalo, feline species (e.g., house cats), canine species (e.g., dogs, foxes, wolves), avian species (e.g., chickens, emus, ostriches), and fish (e.g., trout, catfish, and salmon). In certain embodiments of the aspects described herein, the subject is a mammal, e.g., a primate or a human. The subject can be male or female. Additionally, the subject can be an infant or a child. In some embodiments, the subject can be a newborn or unborn subject, e.g., while the subject is still in utero. Preferably, the subject is a mammal. Mammals can be people, non-human primates, mice, rats, dogs, cats, horses or cattle, but are not limited to these embodiments. Mammals other than people can advantageously be used as the experimenter of the animal model representing disease and illness. In addition, methods and compositions described herein can be used for domestic animals and / or pets. People's experimenters can be any age, sex, race or ethnic group, for example, Caucasians (white people), Asians, Africans, blacks, African Americans, African Europeans, Hispanics, Middle Easterners etc. In certain embodiments, experimenters can be patients or other experimenters in clinical settings. In certain embodiments, experimenters have been treated. In certain embodiments, experimenters are embryos, fetuses, newborns, infants, children, teenagers or adults. In certain embodiments, experimenters are human fetuses, human newborns, human infants, human children, human teenagers or human adults. In certain embodiments, experimenters are animal embryos, or non-human embryos or non-human primate embryos. In certain embodiments, experimenters are human embryos.

[0102] As used herein, the term "host cell" includes any cell type susceptible to transformation, transfection, transduction, etc., of the single-stranded (ssDNA) molecules of the present disclosure. As non-limiting examples, the host cell can be an isolated primary cell, a pluripotent stem cell, a CD34 + Cells, induced pluripotent stem cells or any of many immortalized cell lines (e.g., HepG2 cells). Alternatively, the host cell can be an in situ or in vivo cell in a tissue, organ or organism. In addition, the host cell can be a target cell of, for example, a mammalian individual (e.g., a human patient in need of gene therapy).

[0103] As used herein, the term "exogenous" refers to a substance that is present in a cell other than its natural source. When used herein, the term "exogenous" can refer to a nucleic acid (e.g., a nucleic acid encoding a polypeptide) or a polypeptide that has been introduced into a biological system such as a cell or organism by a process involving human hands, in which the nucleic acid or polypeptide is not typically found, and it is desired to introduce the nucleic acid or polypeptide into such a cell or organism. Alternatively, "exogenous" can refer to a nucleic acid or polypeptide that has been introduced into a biological system such as a cell or organism by a process involving human hands, in which the amount of the nucleic acid or polypeptide is found in the cell or organism is relatively low, and it is desired to increase the amount of the nucleic acid or polypeptide in the cell or organism, for example to produce ectopic expression or levels. In contrast, the term "endogenous" refers to a substance that is natural to a biological system or cell.

[0104] The terms "polynucleotide" and "nucleic acid" used interchangeably herein refer to nucleotides of any length, either ribonucleotides or deoxyribonucleotides in polymeric form. Thus, this term includes single-stranded, double-stranded or multi-stranded DNA or RNA, genomic DNA, cDNA, DNA-RNA hybrids, or polymers comprising purine and pyrimidine bases or other natural, chemically or biochemically modified, non-natural or derived nucleotide bases. "Oligonucleotide" generally refers to a polynucleotide of about 5 to about 100 nucleotides of single-stranded or double-stranded DNA. However, for the purposes of this disclosure, there is no upper limit to the length of an oligonucleotide. Oligonucleotides are also referred to as "oligomers" or "oligos" and can be isolated from genes or chemically synthesized by methods known in the art. It should be understood that the terms "polynucleotide" and "nucleic acid" include single-stranded (e.g., sense or antisense) and double-stranded polynucleotides, if the described embodiments are applicable. According to some embodiments, the nucleic acid is a single-stranded DNA (ssDNA) molecule described in this disclosure. The DNA can be in the form of, for example, an antisense molecule, plasmid DNA, DNA-DNA duplex, precondensed DNA, PCR product, vector (P1, PAC, BAC, YAC, artificial chromosome), expression cassette, chimeric sequence, chromosomal DNA, or derivatives and combinations of these groups. The DNA can be in the form of a minicircle, plasmid, bacmid, minigene, ministring DNA (linear covalently closed DNA vector), end-blocked linear duplex DNA (CELiD or ceDNA), doggybone (dbDNA), or a combination of these groups. TM) DNA, dumbbell-shaped DNA, simple immunologically defined gene expression (MIDGE)-vectors, viral vectors or non-viral vectors. RNA can be in the form of small interfering RNA (siRNA), Dicer substrate dsRNA, small hairpin RNA (shRNA), asymmetric interfering RNA (aiRNA), microRNA (miRNA), mRNA, rRNA, tRNA, viral RNA (vRNA) and combinations thereof. Nucleic acids include nucleic acids containing synthetic, naturally occurring and non-naturally occurring known nucleotide analogs or modified backbone residues or connections, and they have binding properties similar to reference nucleic acids. Examples of such analogs and / or modified residues include but are not limited to phosphorothioates, diamidophosphorothioate morpholino oligomers (morpholinos), phosphoramidates, methylphosphonates, chiral-methylphosphonates, 2'-O-methyl ribonucleotides, locked nucleic acids (LNAs). TM ) and peptide nucleic acids (PNA). Unless otherwise limited, the term encompasses nucleic acids containing known analogs of natural nucleotides that have similar binding properties to the reference nucleic acid. Unless otherwise indicated, a particular nucleic acid sequence also implicitly encompasses conservatively modified variants thereof (e.g., degenerate codon substitutions), alleles, orthologs, SNPs, and complementary sequences, as well as the sequences explicitly indicated.

[0105] As used herein, an "inhibitory polynucleotide" refers to a DNA or RNA molecule that reduces or prevents the expression (transcription or translation) of a second (target) polynucleotide. Inhibitory polynucleotides include antisense polynucleotides, ribozymes, and external guide sequences. The term "inhibitory polynucleotide" further includes DNA and RNA molecules, for example, RNAi molecules that encode the actual inhibitory species, such as DNA molecules that encode ribozymes.

[0106] As used herein, a "nucleotide" contains the sugar deoxynucleoside (DNA) or ribose (RNA), a base, and a phosphate group. The nucleotides are linked together by the phosphate groups.

[0107] "Bases" include purines and pyrimidines, and further include the naturally occurring compounds adenine, thymine, guanine, cytosine, uracil, inosine, and natural analogs, as well as synthetic derivatives of purines and pyrimidines, including but not limited to modifications that place new reactive groups such as, but not limited to, amines, alcohols, thiols, carboxylates, and alkyl halides.

[0108] "Hybridizable" or "complementary" or "substantially complementary" means that a nucleic acid (e.g., RNA) includes a nucleotide sequence that enables it to non-covalently bind to another nucleic acid sequence under appropriate conditions of temperature and solution ionic strength in vitro and / or in vivo, i.e., to form Watson-Crick base pairs and / or G / U base pairs, "anneal" or "hybridize" in a sequence-specific antiparallel manner (i.e., a nucleic acid that specifically binds to a complementary nucleic acid). As is known in the art, standard Watson-Crick base pairs include: adenine (A) pairs with thymidine (T), adenine (A) pairs with uracil (U), and guanine (G) pairs with cytosine (C). In addition, it is also known in the art that for hybridization between two RNA molecules (e.g., dsRNA), a guanine (G) base pairs with uracil (U). For example, in the case of tRNA anticodon base pairing with codons in mRNA, G / U base pairing is partially responsible for the degeneracy (i.e., redundancy) of the genetic code. In the context of the present disclosure, a guanine (G) of the protein-binding segment (dsRNA duplex) of an RNA molecule targeting a subject DNA is considered to be complementary to a uracil (U), and vice versa. Thus, when a G / U base pair can be formed at a given nucleotide position of a protein-binding segment (dsRNA duplex) of an RNA molecule targeting a subject DNA, that position is not considered to be non-complementary, but rather is considered to be complementary.

[0109] As used herein, the term "nucleic acid construct" refers to a single-stranded or double-stranded nucleic acid molecule that is isolated from a native gene or modified to contain a segment of nucleic acid in a manner that does not otherwise exist or synthesize in nature. When the nucleic acid construct contains the control sequences required for expression of the coding sequence of the present disclosure, the term nucleic acid construct is synonymous with the term "expression cassette." An "expression cassette" comprises a DNA coding sequence operably linked to a promoter. The terms "peptide," "polypeptide," and "protein" are used interchangeably herein to refer to a polymeric form of amino acids of any length that may include coded and non-coded amino acids, chemically or biochemically modified or derivatized amino acids, and polypeptides having a modified peptide backbone.

[0110] As used herein, the term "sequence identity" refers to the dependency between two nucleotide sequences. For purposes of the present disclosure, the sequence identity degree between two deoxyribonucleotide sequences is determined using the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, the same), as used in the EMBOSS software package (EMBOSS: European Molecular Biology Open Software Suite, Rice et al., 2000, the same), preferably implemented in the Needle programs such as version 3.0.0 or later. The optional parameters used are gap open penalty 10, gap extension penalty 0.5, and EDNAFULL (EMBOSS version of NCBINUC4.4) substitution matrix. The output of the Needle labeled "longest identity" (obtained using the -nobrief option) is used as identity percentage, and is calculated as follows: (identical deoxyribonucleotides multiplied by 100) / (total number of gaps in the length-alignment of the comparison). The length of the alignment is preferably at least 10 nucleotides, preferably at least 25 nucleotides, more preferably at least 50 nucleotides and most preferably at least 100 nucleotides.

[0111] As used herein, term "homology" or "homology" is defined as the percentage of the nucleotide residues identical with the nucleotide residues in the corresponding sequence on the target chromosome in the alignment sequence and, if necessary, introducing a gap to realize maximum sequence identity percentage. The comparison for the purpose of determining nucleotide sequence homology percentage can be realized in the various ways within the art, for example, using publicly available computer software, such as BLAST, BLAST-2, ALIGN, ClustalW2 or Megalign (DNASTAR) software. Those skilled in the art can determine the appropriate parameters for alignment sequences, including any algorithm that realizes maximum alignment on the full length of the sequence being compared. In some embodiments, a nucleic acid sequence (e.g., a DNA sequence), such as a homology arm of a repair template, is considered "homologous" when the sequence is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or more identical to the corresponding native or unedited nucleic acid sequence (e.g., genomic sequence) of the host cell.

[0112] As used herein, a "vector" or "expression vector" is a replicon that can be a nucleic acid construct designed for delivery to a host cell or for transfer between different host cells. As used herein, a vector can be of viral or non-viral origin in its final form. For the purposes of this disclosure, a "vector" generally refers to a synthetic, capsid-free AAV, such as a single-stranded (ss) synthetic vector or a notched ceDNA vector. Thus, the term "vector" encompasses any genetic element that is capable of replication or expression when associated with appropriate control elements and can transfer a gene sequence to a cell. In some embodiments, a vector can be a recombinant vector or an expression vector. It should be understood that the term "single-stranded (ss) synthetic vector" as used herein is intended to include single-stranded AAV-like vectors that may not have any viral sequences.

[0113] As used herein, the phrase "recombinant vector" means a vector comprising a heterologous nucleic acid sequence or "transgene" that can be expressed in vivo. It should be understood that in some embodiments, the vectors described herein can be combined with other suitable compositions and therapies. In some embodiments, the vector is episomal. The use of suitable episomal vectors provides a method for maintaining the nucleotides of interest to the subject in a high copy number of extrachromosomal DNA, thereby eliminating the potential effects of chromosome fusions.

[0114] As used herein, the term "expression vector" refers to a vector that directs the expression of RNA or polypeptides from sequences linked to transcriptional regulatory sequences on the vector. The expressed sequence will usually, but not necessarily, be heterologous to the host cell. The expression vector may be a recombinant vector.

[0115] As used herein, the term "expression" refers to the cellular processes involved in the production of RNA and protein, and secretion of protein when appropriate, including, but not limited to, transcription, transcript processing, translation, and protein folding, modification, and processing, as applicable.

[0116] As used herein, the phrase "expression product" includes RNA transcribed from a gene (eg, a transgene), as well as polypeptides obtained by translation of mRNA transcribed from a gene.

[0117] As used herein, the term "gene" means a nucleic acid sequence that is transcribed (DNA) into RNA in vitro or in vivo when operably linked to appropriate regulatory sequences. A gene may or may not include regions preceding and following the coding region, for example, a 5' untranslated region (5'UTR) or "leader" sequence and a 3'UTR or "trailer" sequence, as well as intervening sequences (introns) between individual coding segments (exons).

[0118] As used herein, the term "site-specific nuclease" or "sequence-specific nuclease" refers to an enzyme that can specifically recognize and cut a DNA sequence. Site-specific nucleases can be engineered. Examples of engineered site-specific nucleases include zinc finger nucleases (ZFNs), TAL effector nucleases (TALENs), and CRISPR / Cas-based systems using various natural and non-natural Cas enzymes.

[0119] As used herein, the phrase "genetic disease" refers to a disease that is caused, directly or indirectly, in part or in whole, by one or more abnormalities in the genome, particularly conditions that are present from birth and that can be treated by single-stranded (ssDNA) molecules as described herein. The abnormality can be a mutation, insertion, or deletion. The abnormality can affect the coding sequence of a gene or its regulatory sequences. The genetic disease may be, but is not limited to, phenylketonuria (PKU), melanoma, hemophilia A (coagulation factor VIII (FVIII) deficiency) and hemophilia B (coagulation factor IX (FIX) deficiency), cystic fibrosis, Huntington's chorea, familial hypercholesterolemia (LDL receptor deficiency), hepatoblastoma, Wilson's disease, congenital hepatic porphyria, inherited liver metabolic disorders, Lesch-Nyhan syndrome, sickle cell anemia, thalassemia, xeroderma pigmentosum, Fanconi anemia, retinitis pigmentosa, ataxia-telangiectasia, Bloom's syndrome, retinoblastoma, and mucopolysaccharidoses (e.g., Hurler syndrome (MPS type I), Scheherazade syndrome (MPS type IS), Hurler-Scheherazade syndrome (MPS type I HS), Hunter syndrome (MPS type II), Sanfilippo types A, B, C, and D (MPS Type III A, B, C, and D), Morquer type A and B (MPS IVA and MPS IVB), Mara-La syndrome (MPS type VI), Slee syndrome (MPS type VII), hyaluronidase deficiency (MPS Type IX)), Niemann-Pick disease types A / B, C1, and C2, Fabry disease, Schindler disease, GM2-gangliosidosis type II (Sandhoff disease), Tay-Sachs disease, metachromatic leukodystrophy, Krabbe disease, mucolipidosis types I, II / III, and IV, sialidosis types I and II, glycogen storage disease types I and II (Pompe disease), Gaucher disease types I, II, and III, Fabry disease, cystinosis, Batten disease, aspartylglucosaminuria, Sala disease, Danon disease (LAMP-2 deficiency), lysosomal acid lipase (LAL) deficiency, neuronal ceroid lipofuscinosis (CLN1-8, INCL, and LINCL), sphingolipidosis, and galactosialidosis.Also included among the genetic disorders are amyotrophic lateral sclerosis (ALS), Parkinson's disease, Alzheimer's disease, Huntington's disease, spinocerebellar ataxia, spinal muscular atrophy, Friedreich's ataxia, Duchenne muscular dystrophy (DMD), Becker muscular dystrophy (BMD), dystrophic epidermolysis bullosa (DEB), ectonucleotide pyrophosphatase 1 deficiency, generalized arterial calcification of infancy (GACI), Leber congenital amaurosis (LCA, e.g., LCA10 [CEP290]), Stargardt's macular dystrophy (ABCA4), or cathepsin A deficiency.

[0120] As used herein, the terms "increase," "enhance," "elevate" (and similar terms) generally refer to the act of directly or indirectly increasing the concentration, level, function, activity or behavior relative to native conditions, expected conditions or average conditions, or relative to control conditions.

[0121] As used herein, the terms "suppress," "reduce," "interfere with," "inhibit," and / or "reduce" (and similar terms) generally refer to the act of directly or indirectly decreasing the concentration, level, function, activity, or behavior relative to natural, expected, or average conditions, or relative to control conditions.

[0122] As used herein, the terms "synthetic vector," "single-stranded (ss) synthetic vector," and "synthetic production of vector" refer to vectors and methods for their synthetic production in a cell-free environment.

[0123] As used herein, the term "comprising" or "comprises" is used when referring to a composition, method, process, and its corresponding components that are essential to the process, method, or composition, but is open to including unspecified elements, whether essential or not. The use of "comprising" indicates inclusion rather than limitation.

[0124] The term "consisting of refers to the compositions, methods, and corresponding components thereof as described herein, excluding any elements not recited in the description of the embodiment.

[0125] As used herein, the term "consisting essentially of refers to those elements required for a given embodiment. The term permits the presence of elements that do not materially affect the basic and novel or functional characteristics of that embodiment of the disclosure.

[0126] As used in this specification and the appended claims, the singular forms "a / an" and "the" include plural references unless the context clearly dictates otherwise. Thus, for example, reference to "a method" includes one or more methods and / or steps of the type described herein and / or that will become apparent to those skilled in the art after reading this disclosure and so on. Similarly, the word "or" is intended to include "and" unless the context clearly dictates otherwise. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present disclosure, suitable methods and materials are described below.

[0127] The abbreviation "eg" is derived from the Latin exempli gratia and is used herein to indicate a non-limiting example. Thus, the abbreviation "eg" is synonymous with the term "for example".

[0128] Except in the operating examples, or where otherwise indicated, all numbers used herein expressing quantities of ingredients or reaction conditions should be understood as modified by the term "about" in all cases. The term "about" when used with a percentage can mean ±1%. The following examples further explain the present disclosure in detail, but the scope of the present disclosure should not be limited thereto.

[0129] The grouping of the alternative elements of the present disclosure disclosed herein or embodiments should not be construed as limiting.Each group member can be mentioned and claimed individually or with any combination of other elements found by other members of the group or this paper.For convenience and / or patentability reasons, one or more members in a group may be included in a group or deleted therefrom.When any such inclusion or deletion occurs, description described in this article is considered to contain the group of modification, thereby meeting the written description of all Markush groups (Markush group) used in the appended claims.

[0130] In some embodiments of any aspect, the disclosure described herein does not relate to processes for cloning humans, processes for modifying the germline genetic identity of humans, the use of human embryos for industrial or commercial purposes, or processes for modifying the genetic identity of animals that may cause suffering to humans or animals, and animals resulting from such processes, without any substantial medical benefit to them.

[0131] Additional terms are defined herein within the description of various aspects of the disclosure.

[0132] All patents and other publications cited in this application in full, including references, granted patents, published patent applications, and co-pending patent applications, are expressly incorporated herein by reference to describe and disclose, for example, methods that can be used in combination with the technology described herein as described in such publications. These publications are provided solely for their disclosure prior to the filing date of this application. Nothing in this regard should be construed as an admission that the inventor has no right to disclose in advance by means of prior disclosure or for any other reason. All statements about the dates or contents of these documents are based on information available to the applicant and do not constitute an admission of the correctness of the dates or contents of these documents.

[0133] The description of the embodiments of the present disclosure is not intended to be exhaustive or to limit the present disclosure to the precise form disclosed. Although specific embodiments and examples of the present disclosure are described herein for illustrative purposes, various equivalent modifications can be made within the scope of the present disclosure as will be appreciated by those skilled in the relevant art. For example, although method steps or functions are presented in a given order, alternative embodiments can perform functions in a different order or can perform functions substantially simultaneously. The teachings of the present disclosure provided herein can be appropriately applied to other processes or methods. The various embodiments described herein can be combined to provide additional embodiments. If necessary, various aspects of the present disclosure can be modified to provide another embodiment of the present disclosure using the compositions, functions, and concepts in the above-mentioned references and applications. In addition, due to considerations of biological functional equivalence, some changes can be made in the protein structure without affecting the type or quantity of the biological effect. These and other changes can be made to the present disclosure based on the detailed description. All such modifications are intended to be included within the scope of the appended claims.

[0134] The specific elements of any of the foregoing embodiments may be combined with or replace elements in other embodiments. In addition, although the advantages associated with certain embodiments of the present disclosure have been described in the context of these embodiments, other embodiments may also exhibit such advantages and not all embodiments need to exhibit such advantages to fall within the scope of the present disclosure.

[0135] The technology described herein is further illustrated by the following examples, but these examples should not be construed as further limiting. It should be understood that the present disclosure is not limited to the specific methods, protocols, reagents, etc. described herein and can vary accordingly. The terminology used herein is for the purpose of describing specific embodiments only and is not intended to limit the scope of the present disclosure, which is defined solely by the claims.

[0136] II. Single-stranded (ss) DNA molecules

[0137] In some aspects, the disclosure relates to single-stranded (ssDNA) molecules, e.g., synthetic ssDNA molecules, and their generation, e.g., from end-blocked DNA (ceDNA) and / or from plasmid templates using the methods described herein.

[0138] In some embodiments, the ssDNA molecules described herein are linear single-stranded DNA molecules that are completely single-stranded along their entire length (ie, they contain no double-stranded regions).

[0139] A. 3' end stem-loop structure

[0140] In some aspects, the present disclosure provides an ssDNA molecule comprising at least one nucleic acid sequence of interest flanked by at least one stem-loop structure at the 3' end. In some embodiments, the ssDNA molecule may further comprise at least one stem-loop structure at the 5' end. As described herein, the stem-loop structure at the 3' end may comprise a partial DNA duplex (e.g., having a free 3'-OH group) to initiate replication or transcription. The partial DNA duplex serves, in part, to hold the stem-loop structure together.

[0141] According to some embodiments, the partial DNA duplex comprises 4-500 nucleotides, e.g., 4-10 nucleotides, 4-25 nucleotides, 4-50 nucleotides, 4-100 nucleotides, 4-200 nucleotides, 4-300 nucleotides, 4-400 nucleotides, 20-25 nucleotides, 20-50 nucleotides, 20-100 nucleotides, 20-200 nucleotides, 20-300 nucleotides, 20-400 nucleotides, 20-500 nucleotides, 50-100 nucleotides, 50-200 nucleotides, 50-300 nucleotides, 50-400 nucleotides, 50-500 nucleotides, 150-200 nucleotides, 150-300 nucleotides, 150-400 nucleotides, 150-500 nucleotides, 200-300 nucleotides, 200-400 nucleotides, 200-500 nucleotides, 250-300 nucleotides, 250-400 nucleotides, 250-500 nucleotides, 300-400 nucleotides, 300-500 nucleotides, 350-400 nucleotides, 350-500 nucleotides, 400-500 nucleotides or 450-500 nucleotides, and at least one loop on the 3' end. According to some embodiments, the DNA duplex comprises at least 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, 400, 450, or 500 nucleotides, and at least one loop on the 3' end.

[0142] According to some embodiments, the loop structure at the 3' end comprises a minimum of 3-500 unbound nucleotides, such as 3-450 nucleotides, 3-400 nucleotides, 3-350 nucleotides, 3-300 nucleotides, 3-250 nucleotides, 3-200 nucleotides, 3-150 nucleotides, 3-100 nucleotides, 3-90 nucleotides, 3-80 nucleotides, 3-70 nucleotides, 3-60 nucleotides, 3-50 nucleotides, 3-40 nucleotides, 3-30 nucleotides, 3-20 nucleotides, 3-10 nucleotides, 3-5 nucleotides, 1 0-450 nucleotides, 10-400 nucleotides, 10-350 nucleotides, 10-300 nucleotides, 10-250 nucleotides, 10-200 nucleotides, 10-150 nucleotides, 10-100 nucleotides, 10-90 nucleotides, 10-80 nucleotides, 10-70 nucleotides, 10-60 nucleotides, 10-50 nucleotides, 10-40 nucleotides, 10-30 nucleotides, 10-20 nucleotides, 50-450 nucleotides, 50-400 nucleotides, 50-350 nucleotides, 50-300 nucleotides, 50-250 nucleotides, 50-200 nucleotides, 50-150 nucleotides, 50-100 nucleotides, 50-90 nucleotides, 50-80 nucleotides, 50-70 nucleotides, 50-60 nucleotides, 100-450 nucleotides, 100-400 nucleotides, 100-350 nucleotides, 100-300 nucleotides, 100-250 nucleotides, 100-200 nucleotides, 150-450 nucleotides, 150-400 nucleotides, 150-350 nucleotides, 150-300 nucleotides nucleotides, 150-250 nucleotides, 150-200 nucleotides, 200-450 nucleotides, 200-400 nucleotides, 200-350 nucleotides, 200-300 nucleotides, 200-250 nucleotides, 250-450 nucleotides, 250-400 nucleotides, 250-350 nucleotides, 250-300 nucleotides, 300-450 nucleotides, 300-400 nucleotides, 300-350 nucleotides, 350-450 nucleotides, 350-400 nucleotides or 400-450 nucleotides.

[0143] According to some embodiments, the stem portion of the stem-loop is 4-500 nucleotides in length, and the loop portion of the stem-loop is 3-500 nucleotides in length. According to some embodiments, the stem portion of the stem-loop is 4-50 nucleotides in length, and the loop portion of the stem-loop is 3-50 nucleotides in length. According to some embodiments, the stem portion of the stem-loop is 4-20 nucleotides in length, and the loop portion of the stem-loop is 3-20 nucleotides in length. According to some embodiments, the stem portion of the stem-loop is 4-10 nucleotides in length, and the loop portion of the stem-loop is 3-10 nucleotides in length.

[0144] According to some embodiments, the loop further comprises one or more nucleic acids or nucleic acids used to stabilize the ends. According to other embodiments, the loop further comprises one or more nucleic acids that can be used in therapeutic methods. According to other embodiments, the loop further comprises one or more nucleic acids that can be used in diagnostic methods. According to other embodiments, the loop further comprises one or more nucleic acids that can be used for research purposes.

[0145] According to some embodiments, the minimum nucleic acid structure required at the 3' end of the ssDNA is any structure of the loop itself, i.e., a hairpin structure. However, it should be understood that as long as there is at least one stem and one loop, various structures can be envisioned at the 3' end. For example, in some embodiments, the ssDNA described herein may include at least one stem-loop structure at the 3' end. In some embodiments, the ssDNA may include at least two stem-loop structures at the 3' end. In some embodiments, the ssDNA may include at least three stem-loop structures at the 3' end. In some embodiments, the ssDNA may include at least four stem-loop structures at the 3' end. In some embodiments, the ssDNA may include at least five stem-loop structures at the 3' end.

[0146] According to some embodiments, the nucleotides at the 3' end form a cruciform DNA structure. When the two strands form a stem-loop structure at the same position in the molecule, a DNA cruciform structure can be formed, and contains a four-way junction and two closed hairpin-shaped points.

[0147] According to some embodiments, the nucleotides at the 3' end form a hairpin DNA structure.A hairpin loop structure in a nucleic acid consists of a base-paired stem structure and a loop sequence with unpaired or non-Watson-Crick paired nucleotides.

[0148] According to some embodiments, the nucleotides at the 3' end form a hammerhead DNA structure consisting of three base-paired helices separated by short linkers of conserved sequence.

[0149] According to some embodiments, the nucleotides at the 3' end form a quadruplex DNA structure. A G-quadruplex is a four-stranded DNA secondary structure (G4) formed by certain guanine-rich sequences.

[0150] According to some embodiments, the nucleotides at the 3' end form a bulge DNA structure.

[0151] According to some embodiments, the nucleotides at the 3' end form a multi-branched loop.

[0152] According to some embodiments, the nucleotides at the 3' end do not form two stem-loop structures.

[0153] According to some embodiments, the stem structure at the 3' end comprises one or more nucleotides modified for exonuclease resistance. According to some embodiments, the stem structure at the 3' end comprises two or more, 3 or more, 4 or more, 5 or more, 6 or more, 7 or more, 8 or more, 9 or more, 10 or more, or 20 or more nucleotides modified for exonuclease resistance.

[0154] According to some embodiments, the stem structure at the 3' end comprises one or more thiophosphate-modified nucleotides. According to some embodiments, the stem structure at the 3' end comprises about 2 to about 12 thiophosphate-modified nucleotides. According to some embodiments, the stem structure at the 3' end comprises about 4 to about 10 thiophosphate-modified nucleotides, for example, about 4 to about 5, about 4 to about 6, about 4 to about 7, about 4 to about 8, about 4 to about 9, about 4 to about 10, about 5 to about 6, about 5 to about 7, about 5 to about 8, about 5 to about 9, about 5 to about 10, about 6 to about 7, about 6 to about 8, about 6 to about 9, about 6 to about 10, about 7 to about 8, about 7 to about 9, about 7 to about 10, about 8 to about 9, about 8 to about 10 or about 9 to about 10. According to some embodiments, the stem structure comprises more than 10 phosphorothioate-modified nucleotides.

[0155] According to some embodiments, the phosphorothioate modified nucleotides are positioned adjacent to each other.

[0156] According to some embodiments, the one or more phosphorothioate-modified nucleotides at the 3' end are resistant to exonuclease degradation.Borophosphate-modified DNA is also resistant to nuclease degradation and can be considered an alternative to phosphorothioate modification.

[0157] According to another embodiment, the stem structure can include at least one functional portion. In one embodiment, the at least one functional portion is an aptamer sequence. In another embodiment, the aptamer sequence has a high binding affinity for nuclear localization proteins.

[0158] According to some embodiments, the nucleotides in the loop are chemically modified with functional groups in order to alter their properties.

[0159] According to some embodiments, the loop further comprises one or more aptamers. According to some embodiments, the aptamers are identified from the publicly available Apta Index database of aptamers (aptagen.com / apta-index).

[0160] According to some embodiments, the loop further comprises one or more synthetic ribozymes.

[0161] According to some embodiments, the loop further comprises one or more antisense oligonucleotides (ASOs).

[0162] According to some embodiments, the loop further comprises one or more short interfering RNAs (siRNAs).

[0163] According to some embodiments, the ring further comprises one or more antiviral nucleoside analogs (ANA).

[0164] According to some embodiments, the loop further comprises one or more triplex-forming oligonucleotides.

[0165] According to some embodiments, the loop further comprises one or more gRNAs or gDNAs.

[0166] According to some embodiments, the ring further comprises one or more molecular probes, such as nucleic acid-based fluorescent probes.

[0167] According to some embodiments, "click" azide-alkyne cycloaddition (Kolb et al., Angew. Chem. Int. Ed. Engl. 2001, 40, 2004-2021) is used to modify nucleotides in the ring. Click chemistry has been developed to connect organic molecules together under mild conditions in the presence of various functional groups. Most click-mediated modifications are performed on nitrogenous bases by introducing novel base analogs, attaching fluorophores or isotopic elements for molecular imaging, forming interchain connections between oligonucleotides, and for bioconjugation of molecules. The best example of click chemistry is Huisgen's [3+2] azide-alkyne cycloaddition reaction of Cu ICatalytic version (Angew. Chem., Int. Ed. 1963, 2, 633-645), independently discovered by Sharpless and Meldal (CuAAC reaction) (Angew. Chem., Int. Ed. 2002, 41, 2596-2599).

[0168] According to some embodiments, the introduction of reactive amino or thiol groups into synthetic oligonucleotides provides acceptors for, for example, subsequent chemifluorescent labeling.

[0169] According to some embodiments, the stem-loop structure may comprise alternative or modified nucleotides, including but not limited to ribonucleic acid (RNA), peptide-nucleic acid (PNA), locked nucleic acid (LNA). According to some embodiments, the ring portion of the stem-loop structure may comprise a chemical structure that does not comprise a nucleic acid.

[0170] According to some embodiments, the ssDNA molecule does not contain any viral-derived sequences.

[0171] Differences from known ITR structures

[0172] As is known in the art, the typical AAV ITR structure comprises a palindromic double-stranded T-shaped hairpin structure, in which the double-stranded AA' region forms the stem, and the double-stranded BB' and CC' regions form the cross arms of the T-shaped structure (see, for example, Ling et al., J. Virology, 89(2):952-961, 2015). The other nucleotides of a typical AAV ITR remain single-stranded and are referred to as single-stranded D(-) sequences (on the 3' end of the ITR) and single-stranded D(+) sequences (on the 5' end of the ITR). Once in the cell, the single-stranded regions of the D(+) and D(-) regions undergo second-strand DNA synthesis to convert them into double-stranded D and D' regions. Therefore, when generally used herein, the term "D region" refers to single-stranded D(-) and / or D(+) regions, or double-stranded D and / or D' regions, as appropriate in the context of the present disclosure.

[0173] Prior to the present invention, it has been shown that removal of both the ssD(+) and ssD(-) regions from AAV ITRs impairs AAV DNA rescue, replication, and encapsidation (see, e.g., Wang et al., J. Mol. Biol., 250:573-580, 1995; Wang et al., J. Virol., 70:1668-1677, 1996; and Wang et al., J. Virol., 71:3077-3082, 1997), and one of ordinary skill in the art would have believed that at least one of the D(+) or D(-) single-stranded regions is absolutely necessary for AAV replication and encapsidation, and that deletion of either ssD(+) or ssD(-) may also be detrimental to AAV replication and encapsidation. The expression of genomic DNA is negatively affected because it is thought to contain one or more transcription factor binding sites (see, e.g., Ling et al., J. Virol., 89(2):952-961, 2015; WO2016081927A2).

[0174] However, the present inventors have surprisingly discovered that deletion of both the D(+) and D(-) regions from the stem-loop structure of the disclosed single-stranded DNA molecules results in functional single-stranded DNA (ssDNA).

[0175] Thus, in some embodiments, the ssDNA does not comprise a D(-) region or a D(+) region that would be present in a wild-type AAV ITR. In some embodiments, the at least one stem-loop structure at the 3' end of the ssDNA does not comprise a single-stranded D(-) region. In other embodiments, the at least one stem-loop structure at the 3' end of the ssDNA molecule does not comprise any of the A, A', B, B', C, C' and / or D(-) regions that would be present in a wild-type AAV ITR.

[0176] According to some embodiments, the at least one stem-loop structure at the 3' end does not comprise a rep binding element (RBE) as would be present in a wild-type ITR. According to some embodiments, the at least one stem-loop structure at the 3' end does not comprise a terminal resolution site (trs) as would be present in a wild-type ITR.

[0177] In some embodiments, the at least one stem-loop structure at the 3' end lacks any viral capsid protein coding sequence.

[0178] In some embodiments, the nucleotides at the 3' end of the ssDNA do not form an AAV ITR structure.

[0179] B. 5′-terminal stem-loop structure

[0180] In some embodiments, the ssDNA molecule comprising at least one nucleic acid sequence of interest flanked by at least one stem-loop structure at the 3' end further comprises a 5' end comprising at least one stem-loop structure. As described herein, the stem-loop structure at the 5' end can comprise a partial DNA duplex.

[0181] According to some embodiments, the partial DNA duplex comprises 4-500 nucleotides, e.g., 4-10 nucleotides, 4-25 nucleotides, 4-50 nucleotides, 4-100 nucleotides, 4-200 nucleotides, 4-300 nucleotides, 4-400 nucleotides, 20-25 nucleotides, 20-50 nucleotides, 20-100 nucleotides, 20-200 nucleotides, 20-300 nucleotides, 20-400 nucleotides, 20-500 nucleotides, 50-100 nucleotides, 50-200 nucleotides, 50-300 nucleotides, 50-400 nucleotides, 50-500 nucleotides, 150-200 nucleotides, 150-300 nucleotides, 150-400 nucleotides, 150-500 nucleotides, 200-300 nucleotides, 200-400 nucleotides, 200-500 nucleotides, 250-300 nucleotides, 250-400 nucleotides, 250-500 nucleotides, 300-400 nucleotides, 300-500 nucleotides, 350-400 nucleotides, 350-500 nucleotides, 400-500 nucleotides or 450-500 nucleotides, and at least one loop on the 3′ end. According to some embodiments, the DNA duplex comprises at least 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, 400, 450, or 500 nucleotides, and at least one loop on the 5′ end.

[0182] According to some embodiments, the loop structure at the 5′ end comprises a minimum of 3-500 unbound nucleotides, such as 3-450 nucleotides, 3-400 nucleotides, 3-350 nucleotides, 3-300 nucleotides, 3-250 nucleotides, 3-200 nucleotides, 3-150 nucleotides, 3-100 nucleotides, 3-90 nucleotides, 3-80 nucleotides, 3-70 nucleotides, 3-60 nucleotides, 3-50 nucleotides, 3-40 nucleotides, 3-30 nucleotides, 3-20 nucleotides, 3-10 nucleotides, 3-5 nucleotides, 1 0-450 nucleotides, 10-400 nucleotides, 10-350 nucleotides, 10-300 nucleotides, 10-250 nucleotides, 10-200 nucleotides, 10-150 nucleotides, 10-100 nucleotides, 10-90 nucleotides, 10-80 nucleotides, 10-70 nucleotides, 10-60 nucleotides, 10-50 nucleotides, 10-40 nucleotides, 10-30 nucleotides, 10-20 nucleotides, 50-450 nucleotides, 50-400 nucleotides, 50-350 nucleotides, 50-300 nucleotides, 50-250 nucleotides, 50-200 nucleotides, 50-150 nucleotides, 50-100 nucleotides, 50-90 nucleotides, 50-80 nucleotides, 50-70 nucleotides, 50-60 nucleotides, 100-450 nucleotides, 100-400 nucleotides, 100-350 nucleotides, 100-300 nucleotides, 100-250 nucleotides, 100-200 nucleotides, 150-450 nucleotides, 150-400 nucleotides, 150-350 nucleotides, 150-300 nucleotides nucleotides, 150-250 nucleotides, 150-200 nucleotides, 200-450 nucleotides, 200-400 nucleotides, 200-350 nucleotides, 200-300 nucleotides, 200-250 nucleotides, 250-450 nucleotides, 250-400 nucleotides, 250-350 nucleotides, 250-300 nucleotides, 300-450 nucleotides, 300-400 nucleotides, 300-350 nucleotides, 350-450 nucleotides, 350-400 nucleotides or 400-450 nucleotides.

[0183] According to some embodiments, the stem portion of the stem-loop is 4-500 nucleotides in length, and the loop portion of the stem-loop is 3-500 nucleotides in length. According to some embodiments, the stem portion of the stem-loop is 4-50 nucleotides in length, and the loop portion of the stem-loop is 3-50 nucleotides in length. According to some embodiments, the stem portion of the stem-loop is 4-20 nucleotides in length, and the loop portion of the stem-loop is 3-20 nucleotides in length. According to some embodiments, the stem portion of the stem-loop is 4-10 nucleotides in length, and the loop portion of the stem-loop is 3-10 nucleotides in length.

[0184] According to some embodiments, the loop further comprises one or more nucleic acids or nucleic acids used to stabilize the ends. According to other embodiments, the loop further comprises one or more nucleic acids that can be used in therapeutic methods. According to other embodiments, the loop further comprises one or more nucleic acids that can be used in diagnostic methods. According to other embodiments, the loop further comprises one or more nucleic acids that can be used for research purposes.

[0185] According to some embodiments, the minimum nucleic acid structure required at the 5' end of the ssDNA is any structure of the loop itself, i.e., a hairpin structure. However, it should be understood that as long as there is at least one stem and one loop, various structures can be envisioned at the 5' end. For example, in some embodiments, the ssDNA described herein may include at least one stem-loop structure at the 5' end. In some embodiments, the ssDNA may include at least two stem-loop structures at the 5' end. In some embodiments, the ssDNA may include at least three stem-loop structures at the 5' end. In some embodiments, the ssDNA may include at least four stem-loop structures at the 5' end. In some embodiments, the ssDNA may include at least five stem-loop structures at the 5' end.

[0186] According to some embodiments, the nucleotides at the 5' end form a cruciform DNA structure. When the two strands form a stem-loop structure at the same position in the molecule, a DNA cruciform structure can be formed, and contains a four-way junction and two closed hairpin-shaped points.

[0187] According to some embodiments, the DNA structure at the 5' end is the same as the DNA structure at the 3' end. According to some embodiments, the DNA structure at the 5' end is different from the DNA structure at the 3' end.

[0188] For example, in some embodiments, the ssDNA described herein may comprise at least one stem-loop structure at the 5' end. According to some embodiments, the ssDNA may comprise at least two stem-loop structures at the 5' end. According to some embodiments, the ssDNA may comprise at least three stem-loop structures at the 5' end. According to some embodiments, the ssDNA may comprise at least four stem-loop structures at the 5' end. According to some embodiments, the ssDNA may comprise at least five stem-loop structures at the 5' end.

[0189] According to some embodiments, the nucleotides at the 5' end form a cruciform DNA structure.

[0190] According to some embodiments, the nucleotides at the 5' end form a hairpin structure.

[0191] According to some embodiments, the nucleotides at the 5' end form a hammerhead structure.

[0192] According to some embodiments, the nucleotides at the 5' end form a quadruplex structure.

[0193] According to some embodiments, the nucleotides at the 5' end form a bulge structure.

[0194] According to some embodiments, the nucleotides at the 5' end form a multi-branched loop.

[0195] According to some embodiments, the nucleotides at the 5' end do not form two stem-loop structures.

[0196] According to some embodiments, the stem structure at the 5' end comprises one or more nucleotides modified to be resistant to nucleases. According to some embodiments, the stem structure at the 5' end comprises two or more, 3 or more, 4 or more, 5 or more, 6 or more, 7 or more, 8 or more, 9 or more, 10 or more or 20 or more nucleotides modified to be resistant to nucleases.

[0197] According to some embodiments, stem structure comprises one or more thiophosphate-modified nucleotides.According to some embodiments, stem structure comprises approximately 2 to approximately 12 thiophosphate-modified nucleotides.According to some embodiments, stem structure comprises approximately 4 to approximately 10 thiophosphate-modified nucleotides, for example, approximately 4 to approximately 5, approximately 4 to approximately 6, approximately 4 to approximately 7, approximately 4 to approximately 8, approximately 4 to approximately 9, approximately 4 to approximately 10, approximately 5 to approximately 6, approximately 5 to approximately 7, approximately 5 to approximately 8, approximately 5 to approximately 9, approximately 5 to approximately 10, approximately 6 to approximately 7, approximately 6 to approximately 8, approximately 6 to approximately 9, approximately 6 to approximately 10, approximately 7 to approximately 8, approximately 7 to approximately 9, approximately 7 to approximately 10, approximately 8 to approximately 9, approximately 8 to approximately 10 or approximately 9 to approximately 10.According to some embodiments, stem structure comprises more than 10 thiophosphate-modified nucleotides.

[0198] According to some embodiments, the phosphorothioate modified nucleotides are positioned adjacent to each other. According to some embodiments, the one or more phosphorothioate modified nucleotides are resistant to exonuclease degradation.

[0199] According to some embodiments, the loop further comprises one or more nucleic acids or nucleic acids used to stabilize the ends. According to other embodiments, the loop further comprises one or more nucleic acids that can be used in therapeutic methods. According to other embodiments, the loop further comprises one or more nucleic acids that can be used in diagnostic methods. According to other embodiments, the loop further comprises one or more nucleic acids that can be used for research purposes.

[0200] According to some embodiments, the nucleotides in the loop are chemically modified with functional groups in order to alter their properties.

[0201] According to some embodiments, the loop further comprises one or more aptamers. According to some embodiments, the aptamers are identified from the publicly available Apta Index database of aptamers (aptagen.com / apta-index).

[0202] According to some embodiments, the loop further comprises one or more synthetic ribozymes.

[0203] According to some embodiments, the loop further comprises one or more antisense oligonucleotides (ASOs).

[0204] According to some embodiments, the loop further comprises one or more short interfering RNAs (siRNAs).

[0205] According to some embodiments, the ring further comprises one or more antiviral nucleoside analogs (ANA).

[0206] According to some embodiments, the loop further comprises one or more triplex-forming oligonucleotides.

[0207] According to some embodiments, the loop further comprises one or more gRNAs or gDNAs.

[0208] According to some embodiments, the ring further comprises one or more molecular probes, such as nucleic acid-based fluorescent probes.

[0209] According to some embodiments, "click" azide-alkyne cycloaddition (Kolb et al., Applied Chemistry International English Edition 2001, 40, 2004-2021) is used to modify nucleotides in the ring. Click chemistry has been developed to connect organic molecules together under mild conditions in the presence of various functional groups. Most click-mediated modifications are performed on nitrogenous bases by introducing novel base analogs, attaching fluorophores or isotopic elements for molecular imaging, forming interchain connections between oligonucleotides, and for biological conjugation of molecules. The best example of click chemistry is Huisgen's [3+2] azide-alkyne cycloaddition reaction of Cu I Catalytic version (Angewandte Chemie International Edition 1963, 2, 633-645), independently discovered by Sharpless and Meldal (CuAAC reaction) (Angewandte Chemie International Edition 2002, 41, 2596-2599).

[0210] According to some embodiments, the introduction of reactive amino or thiol groups into synthetic oligonucleotides provides acceptors for, for example, subsequent chemifluorescent labeling.

[0211] According to some embodiments, the stem-loop structure may comprise alternative or modified nucleotides, including but not limited to ribonucleic acid (RNA), peptide-nucleic acid (PNA), locked nucleic acid (LNA). According to some embodiments, the ring portion of the stem-loop structure may comprise a chemical structure that does not comprise a nucleic acid.

[0212] Differences from known ITR structures

[0213] As is known in the art, the typical AAV ITR structure comprises a palindromic double-stranded T-shaped hairpin structure, in which the double-stranded A-A' region forms the stem, and the double-stranded B-B' and C-C' regions form the cross arms of the T-shaped structure (see, for example, Ling et al., Journal of Virology, 89(2):952-961, 2015; WO2016081927A2). The other nucleotides of a typical AAV ITR remain single-stranded and are referred to as single-stranded D(-) sequences (at the 3' end of the ITR) and single-stranded D(+) sequences (at the 5' end of the ITR). Once in the cell, the single-stranded regions of the D(+) and D(-) regions undergo second-strand DNA synthesis to convert them into double-stranded D and D' regions.

[0214] Prior to the present invention, it has been shown that removal of both the D(+) and D(-) regions from AAV ITRs impairs AAV DNA salvage, replication, and encapsidation (see, e.g., Wang et al., J. Mol. Biol., 250:573-580, 1995; Wang et al., J. Virol., 70:1668-1677, 1996; and Wang et al., J. Virol., 71:3077-3082, 1997), and one of ordinary skill in the art believed that at least one of the D(+) or D(-) single-stranded regions is absolutely necessary for AAV replication and encapsidation, and that deletion of ssD(+) or ssD(-) may also be detrimental to AAV replication and encapsidation. The expression of genomic DNA is negatively affected because it is thought to contain one or more transcription factor binding sites (see, e.g., Ling et al., J. Virol., 89(2):952-961, 2015; WO2016081927A2).

[0215] However, the present inventors have surprisingly found that deletion of both the ssD(+) and ssD(-) regions from the stem-loop structure of the disclosed single-stranded DNA molecules results in functional single-stranded DNA (ssDNA).

[0216] Thus, in some embodiments, the at least one stem-loop structure of the ssDNA does not comprise a ssD(-) region or a ssD(+) region that would be present in a wild-type AAV ITR. In some embodiments, the at least one stem-loop structure at the 5' end of the ssDNA does not comprise a single-stranded D(+) region. In other embodiments, the at least one stem-loop structure at the 5' end of the ssDNA molecule does not comprise any of the A, A', B, B', C, C', and / or D(+) regions that would be present in a wild-type AAV ITR.

[0217] According to some embodiments, the at least one stem-loop structure at the 5' end does not comprise a rep binding element (RBE) that would be present in a wild-type ITR. According to some embodiments, the at least one stem-loop structure at the 5' end does not comprise a terminal resolution site (trs) that would be present in a wild-type ITR.

[0218] In some embodiments, the at least one stem-loop structure at the 5' end lacks any viral capsid protein coding sequence.

[0219] In some embodiments, the nucleotides at the 5' end of the ssDNA do not form an AAV ITR structure.

[0220] C. Transgenic

[0221] The single-stranded DNA (ssDNA) molecules described herein are free from the packaging constraints imposed by the confined space within the viral capsid. This allows for the insertion of one or more genetic elements, such as single-stranded enhancers, single-stranded introns, single-stranded post-transcriptional regulatory elements, single-stranded polyadenylation signals and single-stranded regulatory switches, large transgenes, multiple transgenes, and the like.

[0222] According to some embodiments, the transgene, eg, nucleic acid sequence of interest, further comprises at least one single-stranded promoter linked to the at least one nucleic acid sequence of interest.

[0223] In other aspects of the disclosure, the single-stranded transgene cassettes can be used in gene editing applications, as described in more detail herein.

[0224] According to some embodiments, the nucleic acid sequence (also referred to as transgenic in this article) encoding recipient experimenter that is not present, does not have active or insufficient protein or the gene of the protein that encodes the biology of expectation or therapeutic effect.Transgenic can encode gene product, and described gene product can play the effect of the expression of correction defective gene or transcript.In principle, expression cassette can include any gene of coding protein, polypeptide or RNA, and described protein, polypeptide or RNA reduces or does not exist due to sudden change, or transmits therapeutic benefit when overexpression is considered within the scope of the present disclosure.

[0225] The nucleic acid sequence of interest may comprise any sequence that can be used to treat a disease or condition in a subject. ssDNA molecules can be used to deliver and express any gene of interest in a subject, including but not limited to nucleic acids encoding polypeptides or non-coding nucleic acids (e.g., RNAi, miR, etc.), as well as exogenous genes and nucleotide sequences, including viral sequences in the genome of the subject, e.g., HIV viral sequences, etc. In some embodiments, the ssDNA molecules disclosed herein are used for therapeutic purposes (e.g., for medical, diagnostic, or veterinary use). In certain embodiments, ssDNA molecules can be used to express any gene of interest in a subject, including one or more polypeptides, peptides, ribozymes, peptide nucleic acids, siRNA, RNAi, antisense oligonucleotides, antisense polynucleotides, or RNA (coding or non-coding; e.g., siRNA, shRNA, microRNA, mRNA, or gRNA, and their antisense counterparts (e.g., antagoMiR)), antibodies, antigen-binding fragments, or any combination thereof.

[0226] The sequence can be codon optimized for the target host cell. As used herein, the term "codon optimized" or "codon optimization" refers to the process of modifying a nucleic acid sequence to enhance its expression in the cells of a vertebrate, such as a mouse or human, by replacing at least one, more than one, or a large number of codons of a native sequence (e.g., a prokaryotic sequence) with codons that are more frequently used or have the highest frequency of use in the genes of the vertebrate being concerned, such as mice or humans. Various species show specific preferences for certain codons for specific amino acids. Typically, codon optimization does not change the amino acid sequence of the original translated protein. Optimized codons can be modified using, for example, Aptagen's The codon optimization and custom gene synthesis platform (Aptagen, Inc., 2190 Fox Mill Rd. Suite 300, Herndon, VA 20171) or other publicly available databases can be used to determine the codon optimization and custom gene synthesis platform.

[0227] In some embodiments, the transgene expressed by the ssDNA molecule is a therapeutic gene. In some embodiments, the therapeutic gene is an antibody, or an antibody fragment or an antigen-binding fragment thereof, such as a neutralizing antibody or antibody fragment.

[0228] Specifically, therapeutic genes are one or more therapeutic agents, including but not limited to proteins, polypeptides, peptides, enzymes, antibodies, antigen-binding fragments, and variants and / or active fragments thereof, for example, for treating, preventing, and / or ameliorating one or more symptoms of a disease, dysfunction, injury, and / or condition. Exemplary therapeutic genes are described in the section entitled "Methods of Treatment" herein.

[0229] According to any of the above aspects and embodiments, the ssDNA molecule is produced synthetically.

[0230] According to any of the above aspects and embodiments, the ssDNA molecule lacks any viral capsid protein coding sequence.

[0231] According to any of the above aspects, the DNA is a peptide nucleic acid (PNA), which is a synthetic mimetic of DNA.

[0232] D. Promoter

[0233] In some embodiments, the ssDNA molecules produced by the methods described herein comprise a promoter (described in more detail below), wherein the promoter comprises a transcription start site (TSS). In some embodiments, the ssDNA molecules produced by the methods described herein comprise an enhancer.

[0234] In some embodiments, the promoter, TSS, and / or enhancer are single-stranded in the ssDNA molecules produced by the methods described herein. In some embodiments, the promoter, TSS, and / or enhancer are double-stranded in the ssDNA molecules produced by the methods described herein.

[0235] Thus, in some embodiments, the length of the double-stranded region comprising a promoter, enhancer, and / or TSS is at least 10 base pairs, at least 20 base pairs, at least 30 base pairs, at least 40 base pairs, at least 50 base pairs, at least 60 base pairs, at least 70 base pairs, at least 80 base pairs, at least 90 base pairs, at least 100 base pairs, at least 110 base pairs, at least 120 base pairs, at least 130 base pairs, at least 140 base pairs, at least 150 base pairs, at least 160 base pairs, at least 170 base pairs, at least 180 base pairs, at least 190 base pairs, at least 200 base pairs, at least 220 base pairs, at least 240 base pairs, at least 260 base pairs, at least 280 base pairs, or at least 300 base pairs. At least 300 base pairs, at least 320 base pairs, at least 340 base pairs, at least 360 base pairs, at least 380 base pairs, at least 400 base pairs, at least 420 base pairs, at least 440 base pairs, at least 460 base pairs, at least 480 base pairs, at least 500 base pairs, at least 550 base pairs, at least 600 base pairs, at least 650 base pairs, at least 700 base pairs, at least 750 base pairs, at least 800 base pairs, at least 850 base pairs, at least 900 base pairs, at least 950 base pairs, at least 1000 base pairs, at least 1100 base pairs, at least 1200 base pairs, at least 1300 base pairs, at least 1400 base pairs, or at least 1500 base pairs.

[0236] In some embodiments, the length of the double-stranded region comprising the promoter, enhancer and / or TSS is less than 1500 base pairs, less than 1400 base pairs, less than 1300 base pairs, less than 1200 base pairs, less than 1100 base pairs, less than 1000 base pairs, less than 950 base pairs, less than 900 base pairs, less than 850 base pairs, less than 800 base pairs, less than 750 base pairs, less than 700 base pairs, less than 650 base pairs, less than 600 base pairs, less than 550 base pairs, less than 500 base pairs, less than 480 base pairs, less than 460 base pairs, less than 440 base pairs, less than 420 base pairs, less than 400 base pairs, less than 380 base pairs, or less than 500 base pairs. base pairs, less than 360 base pairs, less than 340 base pairs, less than 320 base pairs, less than 300 base pairs, less than 280 base pairs, less than 260 base pairs, less than 240 base pairs, less than 220 base pairs, less than 200 base pairs, less than 190 base pairs, less than 180 base pairs, less than 170 base pairs, less than 160 base pairs, less than 150 base pairs, less than 140 base pairs, less than 130 base pairs, less than 120 base pairs, less than 110 base pairs, less than 100 base pairs, less than 90 base pairs, less than 80 base pairs, less than 70 base pairs, less than 60 base pairs, less than 50 base pairs, less than 40 base pairs or less than 30 base pairs.

[0237] In some embodiments, the double-stranded region comprising the promoter, enhancer, and / or TSS is about 30-1500 base pairs in length, about 40-1400 base pairs in length, about 50-1300 base pairs in length, about 60-1200 base pairs in length, about 70-1100 base pairs in length, about 80-1000 base pairs in length, about 90-900 base pairs in length, about 90-10 ... 90 base pairs in length, about 100-800 base pairs in length, about 110-700 base pairs in length, about 120-600 base pairs in length, about 130-500 base pairs in length, about 140-400 base pairs in length, about 150-300 base pairs in length, about 160-200 base pairs in length, about 1381 base pairs in length or about 499 base pairs in length.

[0238] E. Aptamer

[0239] In some embodiments, the ssDNA molecules produced by the methods described herein comprise aptamers, which are described in more detail throughout this disclosure. In some embodiments, the aptamers can be located in the 3' and / or 5' stem-loop structures of the ssDNA molecules produced by the methods described herein. In some embodiments, the aptamers can be located within or adjacent to the nucleic acid sequence of interest. In some embodiments, the aptamers can be encoded in a double-stranded ceDNA molecule, and the aptamers can only fold into secondary structures after one strand of the double-stranded ceDNA molecule is removed to produce the ssDNA molecule (see, e.g., Figure 19 Right and Figure 20 Right). In some embodiments, the aptamer is a CH4-1 aptamer.

[0240] III. End-blocked DNA (ceDNA) intermediate molecules

[0241] As described herein, a cell-free enzymatic method is used to generate synthetic double-stranded end-blocked DNA (ceDNA) intermediate molecules. In one embodiment, the present disclosure provides an isolated end-blocked DNA (ceDNA) construct comprising a double-stranded transgene cassette comprising at least one double-stranded transgene; and a first inverted terminal repeat (ITR) and an optional second ITR each flanking the at least one double-stranded transgene; wherein at least one of the first ITR and the optional second ITR comprises one or more phosphorothioate-modified nucleotides.

[0242] According to embodiments of the present disclosure, the double-stranded transgene cassette further comprises at least one double-stranded promoter operably linked to the at least one double-stranded transgene to control expression of the at least one double-stranded transgene. In further embodiments, the double-stranded transgene cassette further comprises one or more genetic elements selected from the group consisting of a double-stranded enhancer, a double-stranded intron, a double-stranded post-transcriptional regulatory element, a double-stranded polyadenylation signal, and a double-stranded regulatory switch. According to yet further embodiments, the at least one double-stranded transgene is a promoterless double-stranded transgene. As described herein, the at least one double-stranded transgene is a double-stranded donor sequence; and the double-stranded transgene cassette further comprises a double-stranded 5' homology arm and a double-stranded 3' homology arm flanking the double-stranded donor sequence. According to some embodiments, the double-stranded 5' homology arm and the double-stranded 3' homology arm are each between about 10 nt and 2000 nt in length, such as between about 100 nt and 2000 nt in length, or between about 1000 nt and 2000 nt in length, or between about 10 nt and 1000 nt in length, such as between about 100 nt and 1000 nt in length, or between about 10 nt and 500 nt in length, or between about 50 nt and 500 nt in length, or between about 100 nt and 1000 nt in length. nt to 500nt in length, between about 10nt and 50nt in length, or between about 50nt and 500nt in length, or between about 500nt and 1000nt in length, between about 500nt and 1500nt in length, between about 1500nt and 2000nt in length, between about 2nt and 1000nt in length, between about 2nt and 500nt in length, between about 2nt and 100nt in length, or between about 2nt and 50nt in length.

[0243] According to some embodiments, the at least one double-stranded transgene is a double-stranded donor sequence; and the double-stranded transgene cassette lacks a single-stranded 5' homology arm and a single-stranded 3' homology arm. Further, in some embodiments, the double-stranded transgene cassette is cleavable and further comprises at least a first double-stranded guide RNA (gRNA) target sequence (TS); at least a first double-stranded protospacer adjacent motif (PAM); at least a second double-stranded gRNA TS; and at least a second double-stranded PAM.

[0244] Due to the fact that the single-stranded DNA (ssDNA) according to embodiments of the present disclosure is derived from a double-stranded DNA (dsDNA) intermediate, the physical properties of the ds ceDNA vector are also present in the single-stranded DNA (ssDNA) molecule, including, for example, the presence of the at least one functional portion, such as an aptamer sequence, e.g., having a high binding affinity to a nuclear localization protein or a fluorophore chemically conjugated to the ITR oligonucleotide.

[0245] Single-stranded DNA (ssDNA) molecules and dsDNA constructs (e.g., dsceDNA) produced using the synthetic processes described herein do not have the packaging constraints imposed by the confined space within the viral capsid. This allows the insertion of control elements, e.g., regulatory switches, large transgenes, multiple transgenes, etc., as disclosed herein.

[0246] A. Endonuclease recognition nucleotide sequence

[0247] According to some embodiments, the ceDNA construct comprises a nicking endonuclease, such as a nicking endonuclease recognition sequence ("nicking site"). In one embodiment, the dsDNA construct comprises the terminal resolution site (trs) sequence of the AAV ITR, which contains a nicking endonuclease site. According to some embodiments, the dsDNA construct comprises one or more recognition nucleotide sequences of one or more nicking endonucleases, each of which is independently selected from the group consisting of Nb.BbvCI, Nb.BsmI, Nb.BsrDI, Nb.BssSI, Nb.BtsI, Nt.AlwI, Nt.BbvCI, Nt.BsmI, Nt.BspQI, Nt.BstNBI, Nt.CviPII, and an isolytic restriction enzyme of any of the foregoing. According to further embodiments, the one or more recognition nucleotide sequences comprise any one or more of the following sequences shown in Table 1 below:

[0248] Table 1

[0249] sequence Nicking endonuclease 5'-GCTGAGG-3' (Nb.BbvCI) 5'NGCATTC-3' (Nb.BsmI) N can be G, C, A or T 5'-NNCATTGC-3' (Nb.BsrDI) 5'-CTCGTG-3' (Nb.BssSI) 5'-NNCACTGC-3' (Nb.BtsI) 5'-GGATCNNNNN-3' (Nt.AlwI) 5'-CCTCAGC-3' (Nt.BbvCI) 5'-GTCTCNN-3' (Nt.BsmI) 5'-GTCTCNN-3' (Nt.BsmI) 5'-GCTCTTCN-3' (Nt.BspQI) 5'-GAGTCNNNNN-3' (Nt.BstNBI) 5'-CCD-3' (Nt.CviPII)D can be A or G or T

[0250] According to some embodiments, the one or more recognition nucleotide sequences are each an engineered sequence.According to further embodiments, the one or more recognition nucleotide sequences each comprise one or more nicking sites for the one or more nicking endonucleases.

[0251] According to some embodiments in which the ITR comprises a terminal resolution site (trs), the one or more nicking gap sites are about 0 to about 20 nucleotides downstream of the (trs), for example, about 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 nucleotides downstream of the terminal resolution site (trs), or for example about 0 to about 15, about 0 to 10, about 0 to 5, about 5 to 15, about 10 to 20, about 15 to 20, about 10 to 20, about 5 to 20 nucleotides downstream of the terminal resolution site (trs). According to some embodiments, there is only one nicking gap site that serves as an exonuclease entry site. In some embodiments in which the ITR does not comprise a trs, the nicking gap site can be in the stem region upstream of the expression cassette. In some embodiments, the nicking site is at least about 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18 19, 20, 25, 30, 35, or 40 nucleotides upstream of the expression cassette.

[0252] According to some embodiments, the dsDNA construct comprises one or more recognition nucleotide sequences for Nb.BbvCI or its isoschizogenic restriction enzyme. According to some embodiments, the dsDNA construct comprises a single recognition nucleotide sequence for Nb.BbvCI or its isoschizogenic restriction enzyme. According to some embodiments, the dsDNA construct comprises one or more recognition nucleotide sequences for Nb.BtsI or its isoschizogenic restriction enzyme. According to some embodiments, the dsDNA construct comprises a single recognition nucleotide sequence for Nb.BtsI or its isoschizogenic restriction enzyme. According to some embodiments, the dsDNA construct comprises one or more recognition nucleotide sequences for Endonuclease V or its isoschizogenic restriction enzyme.

[0253] According to some embodiments, the double-stranded ceDNA molecule comprises at least one deoxyinosine residue. According to some embodiments, the deoxyinosine residue is present in a stem-loop structure at the 3' end, two bases upstream of the desired nicking site.

[0254] According to some embodiments, the deoxyinosine modification is present at position -1i, -2i, -3i, -4i, -5i, -6i, -7i, -8i, -9i, or -10i relative to the 3' end of the 3' ITR.

[0255] According to some embodiments, the deoxyinosine modification is present at position -1i, -2i, -5i, or -7i relative to the 3' end of the 3' ITR.

[0256] According to some embodiments, the deoxyinosine residue is present at position -1i, -2i, -5i, or -7i relative to SEQ ID NO: 7 as shown below:

[0257] CTCACTGAGGCCGCCCGGGCAAAGCCCGGGCGTCGGGCGACCTTTGGTCGCCCGGCCTCAG (SEQ ID NO: 7).

[0258] According to some embodiments, the position of the inosine modification affects the stability of the secondary structure of the ITR, particularly the 3' ITR.

[0259] According to some embodiments, the double-stranded ceDNA molecule comprises at least one residue containing uridine, inosine, xanthosine, and / or oxanosine. According to further embodiments, the endonuclease has enzymatic activity against residues containing uridine, inosine, xanthosine, and / or oxanosine.

[0260] According to some embodiments, an endonuclease having enzymatic activity against uridine, inosine, xanthosine, and / or oxanosine containing residues can nick the modified DNA at the second phosphodiester bond 3' of the lesion.

[0261] According to some embodiments, the 3' terminal portion of the double-stranded DNA molecule (starting material) comprises a nicking enzyme recognition sequence. In one embodiment, the 3' terminal portion of the dsDNA molecule comprises the sequence 5'-CCAA-3'. In some embodiments, the 3' terminal portion of the dsDNA molecule comprises any one or more of the sequences shown in Table 2 below. Further, since these are unique sequences after the double-stranded ceDNA with a specially engineered nicking site has been nicked by a nicking endonuclease as shown in Table 2, the resulting ssDNA molecule also comprises any one or more of the sequences shown in Table 2 below in its 3' terminal fragment.

[0262] Table 2

[0263] sequence Nicking endonuclease 5'-CCAA-3' (Nb.BtsI)(Nb.BsrDI)(Nt.CviPII) 5'-CCAAGC-3' (Nb.BbvCI) 5'-CCAACC-3' (Nt.BbvCI) 5'-CCAAGAGTCNNNN-3' (Nt.BstNBI) - N can be A, G, C or T 5'-CCAAG-3' (Nb.BsmI) 5'-CCAAC-3' (Nb.BssSI) 5'-CCAAGGATCNNNN-3' (Nt.AlwI) 5'-CCAAGTCTCN-3' (Nt.BsmAI) 5'-CCAAGCTCTTCN-3' (Nt.BspQI)

[0264] B. Phosphorothioate (PS) modification

[0265] Following the contacting step with the endonuclease, the double-stranded ceDNA described herein is then treated with an exonuclease to produce the ssDNA described herein.

[0266] According to some embodiments, the exonuclease is capable of removing the nicked strand of the dsDNA construct starting at the one or more nicking sites and ending at the one or more phosphorothioate modified nucleotides. The exonuclease can be selected from, but is not limited to, T7 exonuclease, lambda exonuclease, T5 exonuclease, and exonuclease V. According to some embodiments, the exonuclease is T7 exonuclease.

[0267] According to some embodiments, the DNA intermediate of double-stranded end sealing comprises thiophosphate (PS) key.PS key replaces the non-bridging oxygen in the phosphate backbone of oligonucleotide with sulfur atom.Advantageously, this modification makes the connection between nucleotides resistant to nuclease degradation, and provides accuracy for the targeting of exonuclease.More specifically, this modification is advantageously located in the ITR region in the space where nuclease is active, and acts as a lock on 5' end and / or 3' end, makes the connection between nucleotides resistant to nuclease degradation, and ensures the accuracy of exonuclease activity.

[0268] According to some embodiments, in methods for generating single-stranded DNA (ssDNA) molecules, PS bonds replace the non-bridging oxygen in the phosphate backbone of an oligonucleotide with a sulfur atom. Advantageously, this modification stabilizes the nucleic acid and renders the internucleotide linkage resistant to nuclease degradation.

[0269] According to some embodiments, the one or more phosphorothioate modified nucleotides of the ssDNA molecule are each independently located in any region selected from A, A', B, B', C, C', D(+), and D(-) of at least one of the first and optional second ITR. According to some embodiments, the one or more phosphorothioate modified nucleotides of the dsDNA construct are each independently located in any region selected from A, A', B, B', C, C', D, and D' of at least one of the first and optional second ITR.

[0270] According to some embodiments, the one or more phosphorothioate modified nucleotides of the ssDNA molecule are each independently located in any region selected from A, A', and D of at least one of the first and optional second ITR. According to some embodiments, the one or more phosphorothioate modified nucleotides of the dsDNA construct are each independently located in any region selected from A, A', and D of at least one of the first and optional second ITR.

[0271] According to some embodiments, the one or more phosphorothioate modified nucleotides of the ssDNA molecule are each independently located in any region selected from A and A' of at least one of the first and optional second ITR. According to some embodiments, the one or more phosphorothioate modified nucleotides of the dsDNA construct are each independently located in any region selected from A and A' of at least one of the first and optional second ITR.

[0272] According to some embodiments, all of the one or more phosphorothioate-modified nucleotides of the ssDNA molecule in the first ITR are located in the A' region and / or the D region of the first ITR. According to some embodiments, all of the one or more phosphorothioate-modified nucleotides of the dsDNA construct in the first ITR are located in the A' region and / or the D region of the first ITR.

[0273] According to some embodiments, all of the one or more phosphorothioate modified nucleotides in the first ITR of the ssDNA molecule are located in region A of the first ITR. According to some embodiments, all of the one or more phosphorothioate modified nucleotides in the first ITR of the dsDNA construct are located in region A of the first ITR.

[0274] According to some embodiments, all of the one or more phosphorothioate-modified nucleotides (if present) in the second ITR of the ssDNA molecule are located in the A' region and / or the D region of the second ITR. According to some embodiments, all of the one or more phosphorothioate-modified nucleotides (if present) in the second ITR of the dsDNA construct are located in the A' region and / or the D region of the second ITR.

[0275] According to some embodiments, all of the one or more phosphorothioate-modified nucleotides in the second ITR of the ssDNA molecule (if present) are located in region A of the second ITR. According to some embodiments, all of the one or more phosphorothioate-modified nucleotides in the second ITR of the ssDNA molecule (if present) are located in region A of the second ITR.

[0276] According to some embodiments, the one or more phosphorothioate modified nucleotides of the ssDNA molecule are adjacent to each other. According to some embodiments, the one or more phosphorothioate modified nucleotides of the dsDNA construct are adjacent to each other.

[0277] According to some embodiments, the one or more phosphorothioate modified nucleotides of the ssDNA molecule are about 1 to 15 nucleotides from the B-B' arm and the C-C' arm (if present) of the first ITR or the optional second ITR. According to some embodiments, the one or more phosphorothioate modified nucleotides of the dsDNA construct are about 1 to 15 nucleotides from the B-B' arm and the CC' arm (if present) of the first ITR or the optional second ITR.

[0278] According to some embodiments, the one or more phosphorothioate-modified nucleotides of the ssDNA molecule are about 1 to 10 nucleotides from the BB' arm and the C-C' arm (if present) of the first ITR or the optional second ITR. According to some embodiments, the one or more phosphorothioate-modified nucleotides of the dsDNA construct are about 1 to 10 nucleotides from the BB' arm and the C-C' arm (if present) of the first ITR or the optional second ITR.

[0279] According to some embodiments, the one or more phosphorothioate-modified nucleotides of the ssDNA molecule are about 1 to 5 nucleotides from the BB' arm and the C-C' arm (if present) of the first ITR or the optional second ITR. According to some embodiments, the one or more phosphorothioate-modified nucleotides of the dsDNA construct are about 1 to 5 nucleotides from the B-B' arm and the C-C' arm (if present) of the first ITR or the optional second ITR.

[0280] According to some embodiments, the one or more phosphorothioate-modified nucleotides of the ssDNA molecule are resistant to exonuclease degradation. According to some embodiments, the one or more phosphorothioate-modified nucleotides containing dsDNA constructs are resistant to exonuclease degradation at the PS-bonded sequence.

[0281] According to some embodiments, at least one of the first and optional second ITR of the ssDNA molecule each comprises about 1 to about 60 phosphorothioate modified nucleotides, e.g., about 1 to about 3, about 1 to about 5, about 1 to about 7, about 1 to about 10, about 1 to about 20, about 1 to about 30, about 1 to about 40, about 1 to about 50, about 10 to about 20, about 10 to about 30, about 10 to about 40, about 10 to about 50, about 20 to about 30, about 20 to about 40, about 20 to about 50, about 30 to about 40, about 30 to about 50, about 40 to about 50, about 25 to about 50, about 5 to about 10, about 5 to about 15, about 5 to about 20, about 5 to about 25. According to some embodiments, at least one of the first and optional second ITR dsDNA constructs each comprises from about 1 to about 60 phosphorothioate-modified nucleotides. According to some embodiments, at least one of the first and optional second ITRs of the ssDNA molecule each comprises from about 1 to about 5 phosphorothioate-modified nucleotides. According to some embodiments, at least one of the first and optional second ITRs of the ssDNA molecule each comprises from about 1 to about 10 phosphorothioate-modified nucleotides. According to some embodiments, at least one of the first and optional second ITRs of the ssDNA molecule each comprises from about 1 to about 15 phosphorothioate-modified nucleotides. According to some embodiments, at least one of the first and optional second ITRs of the ssDNA molecule each comprises from about 1 to about 20 phosphorothioate-modified nucleotides. According to some embodiments, at least one of the first and optional second ITRs of the ssDNA molecule each comprises from about 1 to about 25 phosphorothioate-modified nucleotides. According to some embodiments, at least one of the first and optional second ITR dsDNA constructs each comprises about 1 to about 30 phosphorothioate-modified nucleotides.

[0282] According to some embodiments, the one or more phosphorothioate modified nucleotides are located at the 5' end of the ssDNA molecule. According to some embodiments, the one or more phosphorothioate modified nucleotides are located at the 3' end of the ssDNA molecule. According to some embodiments, the one or more phosphorothioate modified nucleotides are located at the 3' end of the ssDNA molecule, the 5' end of the ssDNA molecule, or both.

[0283] According to some embodiments, the one or more phosphorothioate modified nucleotides are located upstream of each of the one or more nicking endonuclease recognition sequences.

[0284] According to some embodiments, the one or more phosphorothioate modified nucleotides are located at the 5' end of the first ITR and / or the optional second ITR.

[0285] According to some embodiments, the ssDNA molecule comprises at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, or more phosphorothioate modified nucleotides. According to some embodiments, the ssDNA molecule comprises at least 1, 2, 3, 4, 5, or more phosphorothioate modified nucleotides at the 3' end of the ssDNA molecule, the 5' end of the ssDNA molecule, or both. According to some embodiments, the ssDNA molecule comprises at least 1, 2, 3, 4, 5 or more phosphorothioate-modified nucleotides upstream of each of the one or more nicking endonuclease recognition sequences. According to some embodiments, the ssDNA molecule comprises at least 1, 2, 3, 4, 5 or more phosphorothioate-modified nucleotides at the 5' end of the first ITR and / or at least 1, 2, 3, 4, 5 or more phosphorothioate-modified nucleotides at the 5' end of the optional second ITR.

[0286] According to some embodiments, at least one of the first and optional second ITRs of the ssDNA molecule each comprises no more than about 6 phosphorothioate-modified nucleotides. According to some embodiments, at least one of the first and optional second ITRs of the ssDNA molecule each comprises no more than about 5 phosphorothioate-modified nucleotides. According to some embodiments, at least one of the first and optional second ITRs of the ssDNA molecule each comprises no more than about 4 phosphorothioate-modified nucleotides. According to some embodiments, at least one of the first and optional second ITRs of the ssDNA molecule each comprises no more than about 3 phosphorothioate-modified nucleotides. According to some embodiments, at least one of the first and optional second ITRs of the ssDNA molecule each comprises no more than about 2 phosphorothioate-modified nucleotides. According to some embodiments, at least one of the first and optional second ITRs of the ssDNA molecule each comprises no more than about 1 phosphorothioate-modified nucleotide. According to some embodiments, at least one of the first and optional second ITR dsDNA constructs each comprises no more than about 6 phosphorothioate-modified nucleotides. According to some embodiments, at least one of the first and optional second ITR dsDNA constructs each comprises no more than about 5 phosphorothioate-modified nucleotides. According to some embodiments, at least one of the first and optional second ITR dsDNA constructs each comprises no more than about 4 phosphorothioate-modified nucleotides. According to some embodiments, at least one of the first and optional second ITR dsDNA constructs each comprises no more than about 3 phosphorothioate-modified nucleotides. According to some embodiments, at least one of the first and optional second ITR dsDNA constructs each comprises no more than about 2 phosphorothioate-modified nucleotides. According to some embodiments, at least one of the first and optional second ITR dsDNA constructs each comprises no more than about 1 phosphorothioate-modified nucleotides.

[0287] According to some embodiments, at least one of the first and optional second ITR of the ssDNA molecule each comprises about 3, about 4, or about 5 phosphorothioate-modified nucleotides. According to some embodiments, at least one of the first and optional second ITR dsDNA constructs each comprises about 3, about 4, or about 5 phosphorothioate-modified nucleotides.

[0288] C. Transgenic

[0289] ceDNA can comprise a transgene (nucleic acid sequence of interest) and one or more regulatory sequences that allow and / or control expression of the transgene, such as an expression cassette. In one embodiment, the expression cassette can comprise one or more of the following in this order: an enhancer / promoter, an ORF reporter gene (transgene), a post-transcriptional regulatory element (e.g., WPRE), and a polyadenylation and termination signal (e.g., BGH polyA). The expression cassette can also comprise an internal ribosome entry site (IRES) and / or a 2A element. Cis-regulatory elements include, but are not limited to, promoters, riboswitches, insulators, mir-regulatable elements, post-transcriptional regulatory elements, tissue and cell type-specific promoters, and enhancers. In some embodiments, ITRs can serve as promoters for transgenes. In some embodiments, the ssDNA molecules described herein comprise additional components that regulate expression of the transgene or nucleic acid sequence of interest, such as regulatory switches, which are described in the section entitled "Regulatory Switches" herein for controlling and regulating expression of the transgene, and can include regulatory switches, if desired, that are kill switches to cause controlled cell death of cells containing the ssDNA molecules.

[0290] The expression cassette or nucleic acid sequence of interest in the ssDNA construct can comprise more than 4000 nucleotides, 5000 nucleotides, 10,000 nucleotides, or 20,000 nucleotides, or 30,000 nucleotides, or 40,000 nucleotides, or 50,000 nucleotides, or any range between about 4000-10,000 nucleotides or 10,000-50,000 nucleotides, or more than 50,000 nucleotides. In some embodiments, the expression cassette can comprise a transgene having a length ranging from 500 to 50,000 nucleotides. In some embodiments, the expression cassette can comprise a transgene having a length ranging from 500 to 75,000 nucleotides. In some embodiments, the expression cassette can comprise a transgene having a length ranging from 500 to 10,000 nucleotides. In some embodiments, the expression cassette can comprise a transgene having a length ranging from 1000 to 10,000 nucleotides. In some embodiments, the expression cassette can contain a transgene ranging in length from 500 to 5,000 nucleotides. The ssDNA molecules described herein do not have the size limitations of encapsidated AAV vectors and are therefore capable of delivering large expression cassettes to provide efficient transgene delivery. In some embodiments, the ssDNA molecules described herein are modified to minimize prokaryotic-specific methylation.

[0291] Expression cassette can comprise for example expressible exogenous sequence (for example, open reading frame) or transgenic or the nucleotide sequence paid close attention to, its coding recipient experimenter does not exist, does not have active or insufficient protein or the gene of the protein of coding with expected biology or therapeutic effect.Transgenic or the nucleotide sequence paid close attention to can encode gene product, and described gene product can play the effect of the expression of correction defective gene or transcript.In principle, expression cassette can comprise any gene of coded protein, polypeptide or RNA, and described protein, polypeptide or RNA reduce or do not exist due to sudden change, or transmit therapeutic benefit when overexpression is considered within the scope of the present disclosure.

[0292] The expression cassette can contain any transgene or nucleic acid sequence of interest that can be used to treat a disease or condition in a subject. The ssDNA molecules described herein, produced using the synthetic processes described herein, can be used to deliver and express any gene of interest in a subject, including but not limited to nucleic acids encoding polypeptides or non-coding nucleic acids (e.g., RNAi, miR, etc.), as well as exogenous genes and nucleotide sequences, including viral sequences in the genome of the subject, e.g., HIV viral sequences, etc. In some embodiments, the ssDNA molecules described herein are used for therapeutic purposes (e.g., for medical, diagnostic, or veterinary use). In certain embodiments, the ssDNA molecules described herein can be used to express any gene of interest in a subject, including one or more polypeptides, peptides, ribozymes, peptide nucleic acids, siRNA, RNAi, antisense oligonucleotides, antisense polynucleotides, or RNA (coding or non-coding; e.g., siRNA, shRNA, microRNA, mRNA, or gRNA, and their antisense counterparts (e.g., antagoMiR)), antibodies, antigen-binding fragments, or any combination thereof.

[0293] The expression cassette can also encode a polypeptide, a sense or antisense oligonucleotide, or an RNA (coding or non-coding; for example, siRNA, shRNA, microRNA, and their antisense counterparts (e.g., antagoMiR). The expression cassette can include an exogenous sequence encoding a reporter protein for experimental or diagnostic purposes, such as β-lactamase, β-galactosidase (LacZ), alkaline phosphatase, thymidine kinase, green fluorescent protein (GFP), chloramphenicol acetyltransferase (CAT), luciferase, and other reporter proteins well known in the art.

[0294] The sequences provided in the expression cassettes and expression constructs of the ssDNA molecules described herein can be codon-optimized for the target host cell. As used herein, the term "codon optimization" or "codon optimization" refers to the process of modifying a nucleic acid sequence by replacing at least one, more than one, or a large number of codons of a native sequence (e.g., a prokaryotic sequence) with codons that are more frequently used or have the highest frequency of use in the genes of the vertebrate of interest, such as a mouse or a human, to enhance its expression in the cells of the vertebrate. Various species show specific preferences for certain codons for specific amino acids. Generally, codon optimization does not change the amino acid sequence of the originally translated protein. Optimized codons can be used, for example, from Aptagen. The codon optimization and custom gene synthesis platform (Aptagen, Inc., 2190 Fox Mill Road, Suite 300, Herndon, VA 20171) or other publicly available databases can be used to determine the desired sequence.

[0295] In some embodiments, the transgene or nucleic acid sequence of interest expressed by the ssDNA molecule is a therapeutic gene. In some embodiments, the therapeutic gene is an antibody, or an antibody fragment or antigen-binding fragment thereof, such as a neutralizing antibody or antibody fragment.

[0296] Specifically, therapeutic genes are one or more therapeutic agents, including but not limited to proteins, polypeptides, peptides, enzymes, antibodies, antigen-binding fragments, and variants and / or active fragments thereof, for example, for treating, preventing, and / or ameliorating one or more symptoms of a disease, dysfunction, injury, and / or condition. Exemplary therapeutic genes are described in the section entitled "Methods of Treatment" herein.

[0297] There are a number of structural features of the ssDNA molecules described herein that differ from plasmid-based expression vectors. The ssDNA molecules produced by the synthetic processes herein can have one or more of the following features: lack of native (i.e., uninserted) bacterial DNA; lack of a prokaryotic origin of replication; are self-sufficient, i.e., they do not require any sequences other than the two ITRs, including Rep binding and terminal resolution sites (RBS and TRS) and exogenous sequences between the ITRs; the presence of ITR sequences that form hairpins; and the absence of bacterial-type DNA methylation or indeed any other methylation that is associated with production in a given cell type and is considered abnormal by a mammalian host. Generally, it is preferred that the vectors of the present invention do not contain any prokaryotic DNA, but it is contemplated that some prokaryotic DNA may be inserted as an exogenous sequence, as a non-limiting example in a promoter or enhancer region.

[0298] The use of ssDNA molecules described herein has several advantages over plasmid-based expression vectors. Such advantages include, but are not limited to: 1) plasmids contain bacterial DNA sequences and undergo prokaryotic-specific methylation, such as 6-methyladenosine and 5-methylcytosine methylation, while the sequences of the uncapsidated AAV vectors are of eukaryotic origin and do not undergo prokaryotic-specific methylation; therefore, uncapsidated AAV vectors are less likely to induce inflammatory and immune responses than plasmids; 2) while plasmids require the presence of resistance genes during the production process, the ssDNA molecules of the present disclosure do not; 3) while circular plasmids are not delivered to the nucleus after introduction into cells and require overloading to circumvent degradation by cellular nucleases, ssDNA molecules contain viral cis-elements, i.e., ITRs, which confer nuclease resistance and can be designed to be targeted and delivered to the nucleus. The minimal defined elements hypothesized to be essential for ITR function are the Rep binding site (RBS; 5′-GCGCGCTCGCTCGCTC-3′ of AAV2) and the terminal resolution site (TRS; 5′-AGTTGG-3′ of AAV2) plus a variable palindromic sequence that allows hairpin formation; and 4) the ssDNA molecule does not have an overrepresentation of CpG dinucleotides frequently found in prokaryotic plasmids that have been reported to bind to members of the Toll-like receptor family and elicit T cell-mediated immune responses.

[0299] D. Inverted terminal repeats (ITR)

[0300] As described herein, according to some aspects, the present disclosure provides a ceDNA molecule comprising at least one nucleic acid sequence of interest flanked by at least one stem-loop structure comprising a partial DNA duplex and at least one loop at the 3' end. In some embodiments, the ceDNA molecule comprises at least one stem-loop structure comprising a partial DNA duplex and at least one loop at the 5' end.

[0301] According to some aspects, the ceDNA molecule comprises a transgene or heterologous nucleic acid sequence positioned between two inverted terminal repeat (ITR) sequences, wherein the ITR sequence can be an asymmetric ITR pair or a symmetric or substantially symmetric ITR pair, as these terms are defined herein. The ceDNA molecules and dsDNA constructs disclosed herein can comprise an ITR sequence selected from any one of the following: (i) at least one WT ITR and at least one modified AAV inverted terminal repeat sequence (mod-ITR) (e.g., an asymmetric modified ITR); (ii) two modified ITRs, wherein the mod-ITR pair has a different three-dimensional spatial organization relative to each other (e.g., an asymmetric modified ITR); or (iii) a symmetric or substantially symmetric WT-WT ITR pair, wherein each WT-ITR has the same three-dimensional spatial organization; or (iv) a symmetric or substantially symmetric modified ITR pair, wherein each mod-ITR has the same three-dimensional spatial organization, wherein the methods of the present disclosure can further comprise a delivery system, such as, but not limited to, a liposome nanoparticle delivery system.

[0302] In certain embodiments, ITR sequences can be from the virus of the Parvoviridae family, which includes two subfamilies: the Parvovirinae of infecting vertebrates and the Densovirinae of infecting insects. The Parvovirinae (being referred to as Parvovirus) includes the Dependaviridae genus, and its members need to infect with helper viruses such as adenovirus or herpesvirus in most cases to carry out productive infection. The Dependaviridae genus includes adeno-associated viruses (AAVs) that usually infect people (e.g., serotypes 2, 3A, 3B, 5 and 6) or primates (e.g., serotypes 1 and 4), and the related viruses (e.g., adeno-associated viruses of cattle, dogs, horses and sheep) that infect other warm-blooded animals. Other members of Parvoviridae and Parvoviridae are usually described in Kenneth I. Berns, " Field of Virology (FIELDS VIROLOGY) " (3rd edition 1996), chapter 69 " Parvoviridae: Viruses and Their Replication ".

[0303] Although the ITRs exemplified in the specification and examples herein are AAV2 WT-ITRs, one of ordinary skill in the art will appreciate that, as described above, ITRs from any known parvovirus, such as AAV (e.g., AAV1, AAV2, AAV3, AAV4, AAV5, AAV5, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAVrh8, AAVrh10, AAV-DJ, and AAV-DJ8 genomes. For example, NCBI: NC 002077; NC 001401; NC 001729; NC 001829; NC 006152; NC 006260; NC 006261), chimeric ITRs, or ITRs from any synthetic AAV, can be used. In some embodiments, AAV can infect warm-blooded animals, such as avian (AAAV), bovine (BAAV), canine, equine, and ovine adeno-associated viruses. In some embodiments, the ITR is from B19 parvovirus (GenBank Accession No. NC 000883), minute virus of mice (MVM) (GenBank Accession No. NC 001510); goose parvovirus (GenBank Accession No. NC 001701); snake parvovirus 1 (GenBank Accession No. NC 006148). In some embodiments, the 5' WT-ITR can be from one serotype and the 3' WT-ITR from a different serotype, as discussed herein.

[0304] Those of ordinary skill are aware that ITR sequences have a common structure of a double-stranded Holliday junction, which is typically a T-shaped or Y-shaped hairpin structure, wherein each WT-ITR is formed by two palindromic arms or loops (BB' and CC') and a single-stranded D sequence embedded in a larger palindromic arm (AA'), (wherein the order of these palindromic sequences defines the flip or flip orientation of the ITR). See, for example, the structural analysis and sequence comparison of ITRs from different AAV serotypes (AAV1-AAV6) and described in Grimm et al., J. Virol., 2006;80(1);426-439; Yan et al., J. Virol., 2005;364-379; Duan et al., Virol., 1999;261;8-14. Based on the exemplary AAV2 ITR sequences provided herein, one of skill in the art can readily determine the WT-ITR sequence from any AAV serotype for use in ssDNA molecules and dsDNA constructs. See, e.g., the sequence comparison of ITRs from different AAV serotypes (AAV1-AAV6 and avian AAV (AAAV) and bovine AAV (BAAV)) described in Grimm et al., J. Virol., 2006; 80(1); 426-439; which shows the % identity of the 3' ITR of AAV2 with the 3' ITRs from the other serotypes: AAV-1 (84%), AAV-3 (86%), AAV-4 (79%), AAV-5 (58%), AAV-6 (3' ITR) (100%), and AAV-6 (3' ITR) (82%).

[0305] According to some other embodiments, at least one of the first ITR and optional second ITR oligonucleotides comprising one or more phosphorothioate-modified nucleotides of the present invention may further comprise one or more functional moieties. In one embodiment, the at least one functional moiety is an aptamer sequence, optionally wherein the aptamer sequence has a high binding affinity to nuclear localization proteins. In another embodiment, the at least one functional moiety is a nuclear localization peptide conjugated to at least one of the ITR oligonucleotides. In another embodiment, the at least one functional moiety is a fluorophore chemically conjugated to the ITR oligonucleotides.

[0306] E. Regulatory elements

[0307] Single-stranded DNA (ssDNA) molecules as described herein may further include a specific combination of cis-regulatory elements.Cis-regulatory elements include but are not limited to promoters, riboswitches, insulators, miR regulatable elements, post-transcriptional regulatory elements, tissue and cell type specific promoters and enhancers. In certain embodiments, single-stranded DNA (ssDNA) molecules as described herein include other components for regulating the expression of transgenic or nucleic acid of interest, for example, the regulation switch for regulating the expression of transgenic or nucleic acid of interest as described herein, or the kill switch for cells comprising single-stranded DNA (ssDNA) molecules as described herein. In International Application PCT / US18 / 49996 (published as International Patent Publication No. WO2019 / 051255 A1), the regulatory elements including the regulatory switches that can be used for the present disclosure are more fully discussed, and the application is incorporated herein by reference in its entirety.

[0308] According to some embodiments, the second nucleotide sequence includes a regulatory sequence and a nucleotide sequence encoding a nuclease. In certain embodiments, the gene regulatory sequence is operably connected to the nucleotide sequence encoding the nuclease. In certain embodiments, the regulatory sequence is suitable for controlling the expression of the nuclease in the host cell. In certain embodiments, the regulatory sequence includes a suitable promoter sequence, and the suitable promoter sequence can guide the transcription of the gene operably connected to the promoter sequence, and the promoter sequence is such as the nucleotide sequence encoding the nuclease of the present disclosure. In certain embodiments, the second nucleotide sequence includes an intron sequence connected to the 5' end of the nucleotide sequence encoding the nuclease. In certain embodiments, an enhancer sequence is arranged on the promoter upstream to increase the effectiveness of the promoter. In certain embodiments, the regulatory sequence includes an enhancer and a promoter, and wherein the second nucleotide sequence includes an intron sequence upstream of the nucleotide sequence encoding the nuclease, wherein the intron includes one or more nuclease cleavage sites, and wherein the promoter is operably connected to the nucleotide sequence encoding the nuclease.

[0309] The single-stranded DNA (ssDNA) molecules described herein and the dsDNA molecules produced using the synthetic processes described herein may further comprise specific combinations of cis-regulatory elements such as the WHP post-transcriptional regulatory element (WPRE) and BGH poly A. Suitable expression cassettes for use in expression constructs are not limited by packaging constraints imposed by viral capsids.

[0310] (i) Promoter

[0311] Those skilled in the art will appreciate that the promoters used in the synthetically produced single-stranded DNA (ssDNA) molecules described herein and the dsDNA molecules of the present disclosure should be appropriately tailored to the specific sequence they are promoting. For example, a guide RNA may not require a promoter at all, as its function is to form a duplex with a specific target sequence on native DNA to effect a recombination event. In contrast, a nuclease encoded by an ssDNA molecule or dsDNA construct vector will benefit from a promoter so that it can be expressed efficiently from the vector and, optionally, in a regulatable manner.

[0312] The expression cassette of the present disclosure includes promoters that can affect overall expression levels and cell specificity. For transgenic expression, it can include a highly active viral-derived immediate early promoter. The expression cassette can contain a tissue-specific eukaryotic promoter to limit transgenic expression to specific cell types and reduce the toxic effects and immune responses caused by unregulated ectopic expression. In a preferred embodiment, the expression cassette can contain synthetic regulatory elements such as the CAG promoter. The CAG promoter contains (i) a cytomegalovirus (CMV) early enhancer element, (ii) the promoter, first exon and first intron of the chicken β-actin gene, and (iii) a splice acceptor of the rabbit β-globin gene. Alternatively, the expression cassette can contain an α-1-antitrypsin (AAT) promoter, a liver-specific (LP1) promoter, a human elongation factor-1α (EF1a) promoter, or a human transthyretin (TTR) promoter. In some embodiments, the expression cassette includes one or more constitutive promoters, such as the retroviral Rous sarcoma virus (RSV) LTR promoter (optionally with an RSV enhancer) or the cytomegalovirus (CMV) immediate early promoter (optionally with a CMV enhancer). Alternatively, an inducible promoter, a natural promoter of the transgene, a tissue-specific promoter, or various promoters known in the art can be used.

[0313] Suitable promoters including those described above can be derived from viruses and therefore can be referred to as viral promoters, or they can be derived from any organism, including prokaryotic or eukaryotic organisms. Suitable promoters can be used to drive expression by any RNA polymerase (e.g., pol I, pol II, pol III). Exemplary promoters include, but are not limited to, the SV40 early promoter, the mouse mammary tumor virus long terminal repeat (LTR) promoter, the adenovirus major late promoter (Ad MLP), the herpes simplex virus (HSV) promoter, a cytomegalovirus (CMV) promoter such as the CMV immediate early promoter region (CMVIE), the Rous sarcoma virus (RSV) promoter, the human U6 small nuclear promoter (U6) (Miyagishi et al., Nature Biotechnology 20, 497-500 (2002)), the enhanced U6 promoter (e.g., Xia et al., Nucleic Acids Res. 2003 Sep 1; 31(17)), the human H1 promoter (H1), the CAG promoter, the human α1-antitrypsin (HAAT) promoter, etc. In certain embodiments, these promoters are altered at their downstream intron-containing ends to include one or more nuclease cleavage sites. In certain embodiments, the DNA containing the nuclease cleavage site is foreign to the promoter DNA.

[0314] In one embodiment, the promoter used is the native promoter of the gene encoding the therapeutic protein. The promoter and other regulatory sequences of the corresponding gene encoding the therapeutic protein are known and have been characterized. The promoter region used may further include one or more additional regulatory sequences (e.g., natural enhancers). Preferably, the gap is located 5' upstream of the promoter.

[0315] (ii) Polyadenylation sequence

[0316] A sequence encoding a polyadenylation sequence can be included in a synthetically produced vector to stabilize mRNA expressed from a single-stranded DNA (ssDNA) molecule (e.g., a synthetic vector, e.g., a single-stranded (ss) synthetic vector) and to facilitate nuclear export and translation. In one embodiment, the synthetically produced vector does not include a polyadenylation sequence. In other embodiments, the vector includes at least 1, at least 2, at least 3, at least 4, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 40, at least 45, at least 50 or more adenine dinucleotides. In some embodiments, the polyadenylation sequence comprises about 43 nucleotides, about 40-50 nucleotides, about 40-55 nucleotides, about 45-50 nucleotides, about 35-50 nucleotides, or any range therebetween.

[0317] The expression cassette may include a polyadenylation sequence known in the art or a variant thereof, such as a naturally occurring sequence isolated from bovine BGHpA or viral SV40pA, or a synthetic sequence. Some expression cassettes may also include an SV40 late polyA signal upstream enhancer (USE) sequence. In some embodiments, the USE may be used in combination with SV40pA or a heterologous poly-A signal.

[0318] The expression cassette can also include post-transcriptional elements to increase transgene expression. In some embodiments, the woodchuck hepatitis virus (WHP) post-transcriptional regulatory element (WPRE) is used to increase transgene expression. Other post-transcriptional processing elements, such as the thymidine kinase gene from herpes simplex virus or the post-transcriptional element of hepatitis B virus (HBV), can be used. The secretory sequence can be linked to a transgene, such as VH-02 and VK-A26 sequences.

[0319] (iii) Nuclear localization sequence

[0320] In some embodiments, the vector encoding the RNA-guided endonuclease comprises one or more nuclear localization sequences (NLS), such as 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more NLS. In some embodiments, the one or more NLS are located at or near the amino terminus, at or near the carboxyl terminus, or a combination of these (e.g., one or more NLS at the amino terminus and / or one or more NLS at the carboxyl terminus). When there is more than one NLS, each NLS can be selected independently of one another so that a single NLS is present in more than one copy and / or is combined with one or more other NLSs present in one or more copies. Non-limiting examples of NLS are shown in Table 3 below.

[0321] Table 3. Exemplary Nuclear Localization Sequences (NLS)

[0322]

[0323]

[0324] F. Additional Components

[0325] The single-stranded DNA (ssDNA) molecules described herein and the dsDNA molecules produced using the synthetic processes described herein can contain nucleotides encoding other components of gene expression. For example, to select specific gene targeting events, protective shRNAs can be embedded in microRNAs and inserted into recombinant single-stranded DNA (ssDNA) molecules described herein, which are designed to site-specifically integrate into highly active loci such as the albumin locus. Such embodiments can provide systems for in vivo selection and amplification of genetically modified hepatocytes in any genetic background, as described in Nygaard et al., A universal system to select gene-modified hepatocytes in vivo, Gene Therapy, June 8, 2016. The single-stranded DNA (ssDNA) molecules described herein of the present disclosure can contain one or more selectable markers that allow selection of transformed, transfected, transduced, or similar cells. Selectable markers are genes whose products provide biocide or viral resistance, resistance to heavy metals, prototrophy to auxotrophs, NeoR, etc. In certain embodiments, positive selection markers are incorporated into donor sequences such as NeoR. Negative selection markers can be incorporated downstream of the donor sequence, for example, the nucleic acid sequence HSV-tk encoding the negative selection marker can be incorporated into the nucleic acid construct downstream of the donor sequence.

[0326] In embodiments, the single-stranded DNA (ssDNA) molecules described herein and the dsDNA molecules produced using the synthetic processes as described herein can be used for gene editing, e.g., as disclosed in International Application PCT / US2018 / 064242, filed December 6, 2018 (published as International Patent Publication No. WO2019 / 113310A1), which is incorporated herein by reference in its entirety, and can include one or more of the following: a 5' homology arm, a 3' homology arm, a polyadenylation site upstream and proximal to the 5' homology arm. Exemplary homology arms are 5' and 3' albumin homology arms or CCR5 5'- and 3' homology arms.

[0327] G.Switch

[0328] Molecular regulatory switches are switches that respond to signals and produce a measurable state change. Such regulatory switches can be effectively combined with single-stranded DNA (ssDNA) molecules described herein and dsDNA molecules produced using a synthetic process as described herein to control the output of transgenic expression from single-stranded DNA (ssDNA) molecules described herein. In certain embodiments, single-stranded DNA (ssDNA) molecules described herein include regulatory switches that are used to fine-tune transgenic expression. For example, they can serve as the biological sequestration function of single-stranded DNA (ssDNA) molecules described herein. In certain embodiments, the switch is an "on / off" switch that is designed to start or stop (i.e., close) the expression of a gene of interest in synthetic AAV in a controllable and regulatable manner. In certain embodiments, the switch can include a "kill switch," which can instruct cells comprising single-stranded DNA (ssDNA) molecules described herein to undergo programmed cell death after the switch is activated. Exemplary regulatory switches contemplated for use in the single-stranded DNA (ssDNA) molecules described herein can be used to regulate expression of transgenes and are discussed more fully in International Application PCT / US18 / 49996 (published as International Patent Publication No. WO 2019 / 051255A1), which is incorporated herein by reference in its entirety.

[0329] (i) Binary control switch

[0330] In some embodiments, the single-stranded DNA (ssDNA) molecules described herein, produced using a synthetic process as described herein, comprise a regulatory switch that can be used to controllably regulate the expression of a transgene. For example, the expression cassette between the ITRs of the single-stranded DNA (ssDNA) molecules described herein can additionally comprise a regulatory region operably linked to the gene of interest, such as a promoter, cis-element, repressor, enhancer, etc., wherein the regulatory region is regulated by one or more cofactors or exogenous agents. By way of example only, the regulatory region can be regulated by a small molecule switch or an inducible or repressible promoter. Non-limiting examples of inducible promoters are hormone-inducible or metal-inducible promoters. Other exemplary inducible promoter / enhancer elements include, but are not limited to, RU486 inducible promoter, ecdysone-inducible promoter, rapamycin-inducible promoter, and metallothionein promoter.

[0331] (ii) Small molecule control switches

[0332] A variety of art-known small molecule-based regulatory switches are known in the art and can be combined with the synthetically produced single-stranded DNA (ssDNA) molecules described herein and disclosed herein to form the regulatory switch-controlled single-stranded DNA (ssDNA) molecules described herein. In some embodiments, the regulatory switch can be selected from any one or a combination of the following: an orthogonal ligand / nuclear receptor pair, such as retinoid receptor variant / LG335 and GRQCIMFI, and an artificial promoter that controls expression of an operably linked transgene, such as the artificial promoter disclosed in Taylor et al., BMC Biotechnology, 10 (2010): 15; an engineered steroid receptor, such as a modified progesterone receptor with a C-terminal truncation that cannot bind progesterone but binds RU486 (mifepristone) (U.S. Patent No. 5,364,791); an ecdysone receptor from Drosophila and its ecdysteroid ligand (Saez et al., PNAS, 97(26) (2000), 14512-14517; or a switch controlled by the antibiotic trimethoprim (TMP), such as Sando R, 3rd ed.; Nature Methods. Methods. 2013, 10(11): 1085-8. In some embodiments, the regulatory switch that controls expression of a transgene or a single-stranded DNA (ssDNA) molecule (e.g., a synthetic vector, e.g., a single-stranded (ss) synthetic vector) is a prodrug-activated switch, such as the switches disclosed in U.S. Patents 8,771,679 and 6,339,070.

[0333] (iii) “Password” control switch

[0334] In some embodiments, the regulatory switch can be a "code switch" or "code loop." Code switches allow for fine-tuning of the control of transgene expression from the synthetically produced single-stranded DNA (ssDNA) molecules described herein, depending on the occurrence of specific conditions, that is, the combination of conditions that need to be present for transgene expression and / or repression to occur. For example, at least conditions A and B must occur for transgene expression to occur. A code regulatory switch can be any number of conditions, for example, at least two, or at least three, or at least four, or at least five, or at least six, or at least seven, or more conditions must be present for transgene expression to occur. In some embodiments, at least two conditions (e.g., conditions A and B) need to occur, and in some embodiments, at least three conditions (e.g., A, B, and C, or A, B, and D) need to occur. By way of example only, for gene expression to occur from a synthetic AAV having a code "ABC" regulatory switch, conditions A, B, and C must be present. Conditions A, B, and C can be as follows: condition A is the presence of a condition or disease, condition B is a hormonal response, and condition C is a response to transgene expression. For example, if the transgene edits a defective EPO gene, condition A is the presence of chronic kidney disease (CKD), condition B occurs when the subject has hypoxic conditions in the kidneys, and condition C is impaired recruitment of erythropoietin-producing cells (EPCs) in the kidneys; or alternatively, impaired HIF-2 activation. Once oxygen levels rise or the desired EPO level is reached, the transgene is turned off again until all three conditions occur, at which point it is turned back on.

[0335] In some embodiments, the code-regulated switches or "code circuits" contemplated for use in the synthetically produced single-stranded DNA (ssDNA) molecules described herein comprise hybrid transcription factors (TFs) to expand the range and complexity of environmental signals used to define biocontainment conditions. In contrast to disable switches that trigger cell death in the presence of predetermined conditions, "code circuits" allow cell survival or transgene expression in the presence of a specific "code" and can be easily reprogrammed to allow transgene expression and / or cell survival only when the predetermined environmental conditions or codes are present.

[0336] Any and all combinations of the regulatory switches disclosed herein, such as small molecule switches, nucleic acid-based switches, small molecule-nucleic acid hybrid switches, post-transcriptional transgenic regulatory switches, post-translational regulation, radiation-controlled switches, hypoxia-mediated switches, and other regulatory switches known to those of ordinary skill in the art as disclosed herein, can be used in the cryptographic regulatory switches disclosed herein. Regulatory switches contemplated for use are also discussed in the review article Kis et al., JR Soc Interface. 12:20141000 (2015) and summarized in Table 1 of Kis et al. In some embodiments, the regulatory switches used in the cryptographic system can be selected from any switch or combination of the switches listed in Table 4 below.

[0337] (iv) Nucleic acid-based regulatory switches for controlling transgene expression

[0338] In some embodiments, the regulatory switch for controlling the expression of a transgenic single-stranded DNA (ssDNA) molecule produced by the synthesis described herein is based on a nucleic acid-based control mechanism. Exemplary nucleic acid control mechanisms are known in the art and are contemplated for use. For example, such mechanisms include riboswitches, such as those disclosed in US2009 / 0305253, US2008 / 0269258, US2017 / 0204477, WO2018026762A1, U.S. Patent No. 9,222,093, and EP Application No. EP288071, and also disclosed in Villa JK et al., Microbiol Spectr. May 2018; 6(3). Also included are metabolite-responsive transcriptional biosensors, such as those disclosed in WO2018 / 075486 and WO2017 / 147585. Other mechanisms known in the art that are contemplated for use include silencing a transgene using siRNA or RNAi molecules (e.g., miR, shRNA). For example, the single-stranded DNA (ssDNA) molecules described herein can contain a regulatory switch encoding an RNAi molecule that is complementary to a transgene expressed by the single-stranded DNA (ssDNA) molecules described herein. When such RNAi is expressed, the transgene will be silenced by the complementary RNAi molecule even if the transgene is expressed by the single-stranded DNA (ssDNA) molecules described herein, and when RNAi is not expressed, the transgene will not be silenced by RNAi when the transgene is expressed by the single-stranded DNA (ssDNA) molecules described herein.

[0339] In some embodiments, the regulatory switch is a tissue-specific self-inactivating regulatory switch, for example, as disclosed in US 2002 / 0022018, whereby the regulatory switch intentionally switches off transgene expression at sites where transgene expression may otherwise be detrimental. In some embodiments, the regulatory switch is a recombinase reversible gene expression system, for example, as disclosed in US 2014 / 0127162 and U.S. Patent 8,324,436.

[0340] (v) Post-transcriptional and post-translational regulatory switches.

[0341] In some embodiments, the regulatory switch for controlling the expression of a transgenic or gene of interest from a synthetically produced single-stranded DNA (ssDNA) molecule described herein is a post-transcriptional modification system. For example, such a regulatory switch can be an aptamer enzyme riboswitch sensitive to tetracycline or theophylline, as disclosed in the following documents: US2018 / 0119156, GB201107768, WO2001 / 064956A3, EP Patent 2707487, and Beilstein et al., ACS Synthetic Biology (ACS Synth.Biol.), 2015, 4 (5), pp. 526-534; Zhong et al., Elife. November 2, 2016; 5. Pii: e18858. In some embodiments, it is envisioned that one of ordinary skill in the art can encode both a transgenic and an inhibitory siRNA containing a ligand-sensitive (off-switch) aptamer, with the net result being a ligand-sensitive on-switch.

[0342] (vi) Other Exemplary Control Switches

[0343] Any known regulatory switch can be used in synthetically produced ssDNA molecules to control gene expression of transgenes expressed from the single-stranded DNA (ssDNA) molecules described herein, including gene expression triggered by environmental changes. Additional examples include, but are not limited to, the BOC approach of Suzuki et al., Scientific Reports 8;10051 (2018); genetic code expansion and non-physiological amino acids; radiation-controlled or ultrasound-controlled on / off switches (see, e.g., Scott S et al., Gene Ther. 2000 Jul;7(13):1121-5; U.S. Patents 5,612,318; 5,571,797; 5,770,581; 5,817,636; and WO 1999 / 025385 A1. In some embodiments, the regulatory switch is controlled by an implantable system, e.g., as disclosed in U.S. Patents 7,840,263; US 2007 / 0190028 A1, wherein gene expression is controlled by one or more forms of energy, including electromagnetic energy that activates a promoter operably linked to a transgene in a single-stranded DNA (ssDNA) molecule described herein.

[0344] In some embodiments, the regulatory switches contemplated for use in the synthetically produced single-stranded DNA (ssDNA) molecules described herein are hypoxia-mediated or stress-activated switches, for example, as disclosed in WO1999060142A2, U.S. Patents 5,834,306; 6,218,179; 6,709,858; US2015 / 0322410; Greco et al. (2004) Targeted Cancer Therapies 9, S368, as well as FROG, TOAD, and NRSE elements, and conditionally inducible silencing elements, including hypoxia-responsive elements (HREs), inflammatory-responsive elements (IREs), and shear stress-activated elements (SSAEs), for example, as disclosed in U.S. Patent 9,394,526. Such embodiments can be used to turn on expression of transgenes from the single-stranded DNA (ssDNA) molecules described herein after ischemia or in ischemic tissues and / or tumors.

[0345] (vii) Kill switch

[0346] Other embodiments of the present disclosure relate to synthetically produced single-stranded DNA (ssDNA) molecules described herein and dsDNA molecules comprising a kill switch. Kill switches as disclosed herein enable cells comprising single-stranded DNA (ssDNA) molecules as described herein to be killed or undergo programmed cell death as a means of permanently removing the introduced single-stranded DNA (ssDNA) molecules described herein from the subject's system. One of ordinary skill in the art will understand that the use of a kill switch in the synthetically produced single-stranded DNA (ssDNA) molecules described herein in the present disclosure will typically be combined with targeting a limited number of cells that a subject can acceptably lose with the single-stranded DNA (ssDNA) molecules described herein or targeting a cell type (e.g., cancer cells) for which apoptosis is desired. In all aspects, a "kill switch" as disclosed herein is designed to provide rapid and robust cell killing of cells comprising single-stranded DNA (ssDNA) molecules as described herein in the absence of an input survival signal or other specified conditions. In other words, the kill switches encoded by the single-stranded DNA (ssDNA) molecules described herein can restrict the cell survival of cells containing the single-stranded DNA (ssDNA) molecules described herein to an environment defined by a specific input signal. Such kill switches serve as biological biosequestration functions if it is desired to remove the synthetically produced single-stranded DNA (ssDNA) molecules described herein from a subject or to ensure that they do not express the encoded transgene.

[0347] Thus, a kill switch is a synthetic biological circuit in an ssDNA molecule or dsDNA construct that couples an environmental signal to conditional survival of a cell comprising the ssDNA molecule or dsDNA construct. In some embodiments, different ssDNA molecules can be designed to have different kill switches.

[0348] In some embodiments, the single-stranded DNA (ssDNA) molecule described herein may include a kill switch, which is a modular biological sealing circuit. In some embodiments, the kill switch for use in ssDNA molecules or dsDNA constructs is disclosed in WO2017 / 059245, which describes a switch referred to as a "disability kill switch", which comprises a mutual inhibition arrangement of at least two repressor sequences so that the environmental signal represses the activity of the second molecule in the construct (for example, a small molecule binding transcription factor is used to produce a "survival" state that is repressed due to toxin production). In cells comprising single-stranded DNA (ssDNA) molecules described herein that include a disabling kill switch, after the loss of environmental signals, the circuit is permanently switched to a "death" state, in which the toxin is now derepressed, resulting in the production of toxins that kill cells. In another embodiment, a synthetic biological circuit referred to as a "password circuit" or "password kill switch" is provided, which uses hybrid transcription factors (TFs) to construct complex environmental requirements for cell survival. The incapacitating and codon-killing switches described in WO2017 / 059245 are particularly useful in the single-stranded DNA (ssDNA) molecules described herein because they are modular and customizable, both in terms of the environmental conditions that control circuit activation and in the output modules that control cellular fate. By appropriately selecting toxins, including but not limited to nucleases such as EcoRI, the codon-killing circuits present in ssDNA molecules or dsDNA constructs can be used to not only kill host cells containing the ssDNA molecules or dsDNA constructs, but also degrade their genomes and accompanying plasmids.

[0349] Other kill switches known to those of ordinary skill in the art are contemplated for use in the single-stranded DNA (ssDNA) molecules described herein as disclosed herein, for example, as disclosed in US2010 / 0175141; US2013 / 0009799; US2011 / 0172826; US2013 / 0109568, and the kill switches disclosed in Jusiak et al., Reviews in Cell Biology and molecular Medicine; 2014; 1-56; Kobayashi et al., Proceedings of the National Academy of Sciences of the United States of America, 2004; 101; 8419-9; Marchisio et al., Int. Journal of Biochem and Cell Biol., 2011; 43; 310-319; and Reinshagen et al., Science Translational Medicine, 2018, 11.

[0350] Thus, in some embodiments, the single-stranded DNA (ssDNA) molecules described herein may comprise a kill switch nucleic acid construct comprising a nucleic acid encoding an effector toxin or a reporter protein, wherein the expression of the effector toxin (e.g., a death protein) or the reporter protein is controlled by a predetermined condition. For example, the predetermined condition may be the presence of an environmental agent, such as an exogenous agent, in the absence of which the cell will express the effector toxin (e.g., a death protein) by default and be killed. In alternative embodiments, the predetermined condition may be the presence of two or more environmental agents, such as a cell will only survive when two or more necessary exogenous agents are supplied, and in the absence of any one of which the cell comprising the single-stranded DNA (ssDNA) molecule described herein is killed.

[0351] In some embodiments, the single-stranded DNA (ssDNA) molecules described herein are modified to incorporate a kill switch to destroy cells containing the single-stranded DNA (ssDNA) molecules described herein, effectively terminating the in vivo expression of a transgene expressed by the ssDNA molecule or dsDNA construct (e.g., a therapeutic gene, protein, or peptide, etc.). Specifically, the single-stranded DNA (ssDNA) molecules described herein are further genetically engineered to express a switch protein that does not function in mammalian cells under normal physiological conditions. Only upon administration of a drug or environmental condition that specifically targets the switch protein will cells expressing the switch protein be destroyed, thereby terminating expression of the therapeutic protein or peptide. For example, it has been reported that cells expressing HSV-thymidine kinase can be killed upon administration of drugs such as ganciclovir and cytosine deaminase. See, e.g., Dey and Evans, Suicide Gene Therapy by Herpes Simplex Virus-1 Thymidine Kinase (HSV-TK), Targets in Gene Therapy, You ed. (2011); and Beltinger et al., Proc. Natl. Acad. Sci. USA 96(15):8699-8704 (1999). In some embodiments, the ssDNA molecule or dsDNA construct may comprise an siRNA kill switch known as DISE (death induced by survival gene elimination) (Murmann et al., Oncotarget. 2017;8:84643-84658. Induction of DISE in ovarian cancer cells in vivo).

[0352] In some aspects, a disabling kill switch is a biological circuit or system that sensitizes a cellular response to a predetermined condition, such as the absence of an agent, e.g., an exogenous agent, in the cell's growth environment. Such a circuit or system can comprise a nucleic acid construct comprising an expression module that forms a disabling regulatory circuit that is sensitive to the predetermined condition, the construct comprising an expression module that forms a regulatory circuit, the construct comprising: a first repressor protein expression module, wherein the first repressor protein binds to a first repressor protein nucleic acid binding element and represses transcription from a coding sequence comprising the first repressor protein binding element, and wherein the repressive activity of the first repressor protein is sensitive to inhibition by a first exogenous agent, the presence or absence of the first exogenous agent establishing the predetermined condition;

[0353] ii) a second repressor protein expression module, wherein the second repressor protein binds to a second repressor protein nucleic acid binding element and represses transcription from a coding sequence comprising the second repressor protein binding element, wherein the second repressor protein is different from the first repressor protein; and

[0354] iii) an effector expression module comprising a nucleic acid sequence encoding an effector protein operably linked to a genetic element comprising a binding element for a second repressor protein, such that expression of the second repressor protein results in repression of effector expression from the effector expression module, wherein the second expression module comprises a first repressor protein nucleic acid binding element that, when bound by the first repressor protein, permits repression of transcription of the second repressor protein, the respective modules forming a regulatory circuit such that, in the absence of a first exogenous agent, the first repressor protein is produced by the first repressor protein expression module and represses transcription from the second repressor protein expression module, such that repression of effector expression by the second repressor protein is reduced, resulting in expression of the effector protein, but in the presence of the first exogenous agent, the activity of the first repressor protein is inhibited, permitting expression of the second repressor protein, which maintains expression of the effector protein in an "off" state, such that the circuit requires the first exogenous agent to maintain effector protein expression in the "off" state, and removal or absence of the first exogenous agent defaults to effector protein expression.

[0355] In some embodiments, the effector is a toxin or protein that induces a cell death program. Any protein toxic to host cells can be used. In some embodiments, the toxin kills only the cells in which it is expressed. In other embodiments, the toxin kills other cells of the same host organism. Any of a large number of products that will cause cell death can be employed in a disabling kill switch. Agents that inhibit DNA replication, protein translation, or other processes, or that, for example, degrade host cell nucleic acids, are particularly useful. To identify highly effective mechanisms for killing host cells following circuit activation, several toxin genes that directly damage host cell DNA or RNA were tested. The endonuclease ecoRI, the DNA gyrase inhibitor ccdB, and the ribonuclease-type toxin mazF were tested because they are well-characterized, native to E. coli, and offer a range of killing mechanisms. To increase circuit stability and provide an independent method for circuit-dependent cell death, the system can be further adapted to express, for example, targeted proteases or nucleases that further interfere with the repressor that maintains the death gene in an "off" state. Upon loss or withdrawal of the survival signal, the death gene repression can be even more efficiently removed, for example, by active degradation of the repressor protein or its message. As a non-limiting example, the mf-Lon protease is not only used to degrade LacI, but also targets essential proteins for degradation. The mf-Lon degradation tag pdt#1 can be attached to the 3' end of five essential genes whose protein products are particularly sensitive to mf-Lon degradation, and cell viability is measured after removal of aTc. Among the essential gene targets tested, the peptidoglycan biosynthesis gene murC provided the strongest and fastest cell death phenotype (survival ratio <1 x 10 within 6 hours). -4 ).

[0356] As used herein, the term "predetermined input" refers to an agent or condition that affects the activity of a transcription factor polypeptide in a known manner. Typically, such agents can bind to and / or alter the conformation of a transcription factor polypeptide to thereby alter the activity of a transcription factor polypeptide. Examples of predetermined inputs include, but are not limited to, environmental input agents that are not required for the survival of a given host organism (i.e., in the absence of a synthetic biological circuit as described herein). Conditions that may provide predetermined inputs include, for example, temperature, for example, where the activity of one or more factors is temperature sensitive, light of a given spectrum of wavelengths, in the presence or absence of light, and concentrations of gases, salts, metals, or minerals. Environmental input agents include, for example, small molecules, biological agents such as pheromones, hormones, growth factors, metabolites, nutrients, and the like, and the like; concentrations of chemicals, environmental byproducts, metal ions, and other such molecules or agents; light levels; temperature; mechanical stress or pressure; or electrical signals such as current and voltage.

[0357] In some embodiments, a reporter gene is used to quantify the intensity or activity of a signal received by a module or programmable synthetic biological circuit of the present disclosure. In some embodiments, the reporter gene can be fused to other protein-coding sequences to identify the location of a protein in a cell or organism. For various embodiments described herein, luciferase can be used as an effector protein, for example, to measure low levels of gene expression, as cells tend to have little or no background luminescence in the absence of luciferase. In other embodiments, enzymes that produce colored substrates can be quantified using a spectrophotometer or other instrumentation that can obtain absorbance measurements, including a plate reader. Enzymes similar to luciferase, such as β-galactosidase, can be used to measure low levels of gene expression, as they tend to amplify low signals. In some embodiments, the effector protein can be an enzyme that can degrade or otherwise destroy a given toxin. In some embodiments, the effector protein can be an odorant that converts a substrate into an odorant product. In some embodiments, the effector protein can be an enzyme that phosphorylates or dephosphorylates small molecules or other proteins, or an enzyme that methylates or demethylates other proteins or DNA.

[0358] In some embodiments, the effector protein can be a receptor, a ligand, or a lytic protein. Receptors often have three domains: an extracellular domain for binding to a ligand such as a protein, peptide, or small molecule; a transmembrane domain; and an intracellular or cytoplasmic domain that can often participate in certain signal transduction events such as phosphorylation. In some embodiments, a transporter, channel, or pump gene sequence is used as the effector protein. Non-limiting examples and sequences of effector proteins for use with the kill switches described herein can be found in the Registry of Standard Biological Parts on the World Wide Web at parts.igem.org.

[0359] As used herein, "regulatory protein" is a protein that regulates the expression of a target nucleic acid sequence. Regulatory proteins include, for example, transcription factors, including transcriptional activators and repressors, and proteins that bind to or modify transcription factors and affect their activity. In certain embodiments, regulators include, for example, proteases that degrade protein factors involved in regulating expression from target nucleic acid sequences. Preferred regulators include modular proteins, in which, for example, DNA binding and input agent binding or responsive elements or domains are separable and transferable, such that, for example, the fusion of the DNA binding domain of a first regulator with the input agent responsiveness domain of a second regulator produces a new protein that is sensitive to the input agent that is normally responded to by the second protein but is bound to the DNA sequence recognized by the first protein. Therefore, as used herein, in addition to the specified polypeptide, the term "regulatory polypeptide" and more specifically "repressor polypeptide" include, for example, "LacI (repressor) polypeptide", variants, or derivatives of such polypeptides that respond to different or variant input agents. Therefore, for LacI polypeptides, LacI mutants or variants that are combined with agents other than lactose or IPTG are included. A wide range of such agents are known in the art.

[0360] Table 4: Exemplary regulatory switches. b On-switchability by effector, except for removal of the effector conferring the off-state. c Off-switchability by effector, except for removal of the effector conferring the on-state. d A ligand or other physical stimulus (e.g., temperature, electromagnetic radiation, electricity) that stabilizes the switch in its on or off state. e refers to the reference numbers cited in Kis et al., J. Royal Society Interface 12:20141000 (2015), which article and the references cited therein are incorporated herein by reference in their entirety.

[0361] Table 4.

[0362]

[0363]

[0364]

[0365]

[0366] IV. Cell-free Methods for Preparing Single-Stranded DNA Molecules

[0367] Conventional methods for producing viruses and virus-derived DNA typically use eukaryotic cells, such as mammalian or insect cells. A commonly used insect cell line is Sf9. However, these cells not only contain enzymes and other proteins that may have a deleterious effect on the DNA to be replicated, but also introduce cellular nucleic acids into the process of purifying the desired DNA from cell lysates, and the presence of the cellular nucleic acids can make the purification of the desired DNA product more difficult. In addition, such impurities or contaminants can have a series of harmful and / or unwanted effects on the experimenter administering the desired DNA. Additionally, such traditional cell-based production methods may have problems in terms of the amount of the DNA vector product produced, and the significant engineering of the cell line itself or the production technology required for producing the desired yield are not uncommon.

[0368] The present disclosure relates to a cell-free method for preparing single-stranded DNA molecules ("ssDNA", "SSD", all of which are used interchangeably herein). The inventors of the present disclosure have surprisingly found that the cell-free method as disclosed herein can be applied to produce ssDNA molecules of desired yield and desired quality. This specifically refers to the case where the cell-free method of the present invention is compared with a method that relies on using cells to produce end-blocked DNA molecules, and is compared with a method that produces ssDNA molecules without the step of a double-stranded ceDNA intermediate. Certain methods for producing double-stranded ceDNA vectors containing various ITR configurations using a cell-based method are described in Example 1 of International Patent Application Publication Nos. WO2019 / 051255 and WO2019 / 113310, the contents of which are incorporated herein by reference in their entirety. Another significant advantage provided by the cell-free synthesis method provided herein is that, in addition to higher yields, the method described herein is a small reaction (about 1 mL) that is easily scalable and at most at least moderate (>40 mL), and further does not affect purity.

[0369] In some aspects, the present disclosure provides a method for producing linear single-stranded DNA (ssDNA) molecules, the method comprising contacting double-stranded end-blocked DNA (ceDNA) molecules with an endonuclease, followed by contacting with an exonuclease, thereby producing linear ssDNA molecules (described in Section II herein). According to some embodiments, the method further comprises the following steps prior to the step of contacting with the endonuclease: a) performing rolling circle amplification (RCA) using the double-stranded DNA (dsDNA) molecules, thereby producing an intermediate dsDNA product (described in Section III herein); and b) performing cell-free enzymatic synthesis using the intermediate dsDNA product, thereby producing ceDNA molecules. According to some embodiments, prior to the step of contacting with the endonuclease, an additional step of purifying the ceDNA molecules is performed. In some embodiments, ssDNA molecules are produced from ceDNA, followed by an additional step of purifying the molecules (described herein). Each of the above steps is described in more detail in the subsections below.

[0370] According to some embodiments, the methods and / or production steps of the present disclosure are performed entirely in a cell-free environment. According to some embodiments, the methods and / or production steps of the present disclosure are performed partially in a cell-free environment. According to some embodiments, the ssDNA molecules are produced by synthesis in vitro. According to some embodiments, the ssDNA molecules are produced by synthesis in vitro in a cell-free environment.

[0371] A. Generation of single-stranded DNA from end-blocked DNA (ceDNA)

[0372] In some aspects, the present disclosure provides a method for producing a linear single-stranded DNA (ssDNA) molecule, the method comprising contacting a double-stranded end-blocked DNA (ceDNA) molecule with an endonuclease followed by an exonuclease, thereby producing a linear ssDNA molecule.

[0373] (i) Endonuclease step

[0374] In some embodiments, the ceDNA molecule is contacted with an endonuclease.

[0375] According to some embodiments, the endonuclease is endonuclease V. Endonuclease V, often referred to as deoxyinosine 3' endonuclease, recognizes DNA containing deoxyinosine (paired or unpaired) on double-stranded DNA, single-stranded DNA containing deoxyinosine, and, to a lesser extent, DNA containing abasic sites (ap) or ureas, base mismatches, insertion / deletion mismatches, hairpins or unpaired loops, flaps, and pseudo-Y structures. Endonuclease V cleaves the second phosphodiester bond 3' to a mismatched deoxysarcosine (Yao, M. and Kow, YW (1995). J. Biol. Chem. 270, 28609-28616), leaving a nick with a 3'-hydroxyl group and a 5'-phosphate (He, B., Qing, H. and Kow, YW (2000). Mutat. Res. 459, 109-114).

[0376] In other embodiments, the endonuclease is Nb.BbvCI. In one embodiment, the endonuclease is Nb.BsmI. In one embodiment, the endonuclease is Nb.BsrDI. In one embodiment, the endonuclease is Nb.BssSI. In one embodiment, the endonuclease is Nb.BtsI. In one embodiment, the endonuclease is Nt.AlwI. In one embodiment, the endonuclease is Nt.BbvCI. In one embodiment, the endonuclease is Nt.BsmI. In one embodiment, the endonuclease is Nt.BspQI. In one embodiment, the endonuclease is Nt.BstNBI. In one embodiment, the endonuclease is Nt.CviPII. In one embodiment, the endonuclease is Endo V.

[0377] According to further embodiments, the endonuclease has enzymatic activity against residues containing uridine or inosine. In one embodiment, the endonuclease has enzymatic activity against residues containing xanthosine. In one embodiment, the endonuclease has enzymatic activity against residues containing oxanosine. According to some embodiments, an endonuclease having enzymatic activity against residues containing uridine, inosine, xanthosine, and / or oxanosine can nick the modified DNA at the second phosphodiester bond 3' to the lesion.

[0378] According to some embodiments, the ceDNA comprises a nicking enzyme recognition sequence ("nicking site") for an endonuclease. In one embodiment, the ceDNA comprises a terminal resolution site (trs) sequence of an AAV ITR containing a nicking site for an endonuclease. According to some embodiments, the ceDNA comprises one or more recognition nucleotide sequences for one or more nicking endonucleases, each of which is independently selected from the group consisting of Nb.BbvCI, Nb.BsmI, Nb.BsrDI, Nb.BssSI, Nb.BtsI, Nt.AlwI, Nt.BbvCI, Nt.BsmI, Nt.BspQI, Nt.BstNBI, Nt.CviPII, and an isolytic restriction enzyme of any of the foregoing. According to further embodiments, the one or more recognition nucleotide sequences comprise any one or more of the following sequences shown in Table 5 below:

[0379] Table 5.

[0380] Identify nucleotide sequences Nicking endonuclease 5'-GCTGAGG-3' (Nb.BbvCI) 5'NGCATTC-3' (Nb.BsmI) N can be G, C, A or T 5'-NNCATTGC-3' (Nb.BsrDI) 5'-CTCGTG-3' (Nb.BssSI) 5'-NNCACTGC-3' (Nb.BtsI) 5'-GGATCNNNNN-3' (Nt.AlwI) 5'-CCTCAGC-3' (Nt.BbvCI) 5'-GTCTCNN-3' (Nt.BsmI) 5'-GTCTCNN-3' (Nt.BsmI) 5'-GCTCTTCN-3' (Nt.BspQI) 5'-GAGTCNNNNN-3' (Nt.BstNBI) 5'-CCD-3' (Nt.CviPII)D can be A or G or T

[0381] According to some embodiments, the one or more recognition nucleotide sequences are each an engineered sequence. According to further embodiments, the one or more recognition nucleotide sequences each comprise one or more nicking sites for the one or more nicking endonucleases. According to some embodiments, the 3' terminal portion of the double-stranded ceDNA molecule comprises a nicking enzyme recognition sequence. In one embodiment, the 3' terminal portion of the ceDNA molecule comprises the sequence 5'-CCAA-3'. In some embodiments, the 3' terminal portion of the ceDNA molecule comprises any one or more of the sequences shown in Table 6 below. Further, since these are unique sequences after the double-stranded ceDNA with a specially engineered nicking site has been nicked by a nicking endonuclease as shown in Table 6, the resulting ssDNA molecule also comprises any one or more of the sequences shown in Table 6 below in its 3' terminal fragment.

[0382] Table 6.

[0383] sequence Nicking endonuclease 5'-CCAA-3' (Nb.BtsI)(Nb.BsrDI)(Nt.CviPII) 5'-CCAAGC-3' (Nb.BbvCI) 5'-CCAACC-3' (Nt.BbvCI) 5'-CCAAGAGTCNNNN-3' (Nt.BstNBI) - N can be A, G, C or T 5'-CCAAG-3' (Nb.BsmI) 5'-CCAAC-3' (Nb.BssSI) 5'-CCAAGGATCNNNN-3' (Nt.AlwI) 5'-CCAAGTCTCN-3' (Nt.BsmAI) 5'-CCAAGCTCTTCN-3' (Nt.BspQI)

[0384] According to some embodiments, the one or more nicking gap sites are about 0 to about 20 nucleotides downstream of the terminal resolution site (trs), for example, about 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18 19 or 20 nucleotides downstream of the terminal resolution site (trs), or for example about 0 to about 15, about 0 to 10, about 0 to 5, about 5 to 15, about 10 to 20, about 15 to 20, about 10 to 20, about 5 to 20 nucleotides downstream of the terminal resolution site (trs). According to some embodiments, there is only one nicking gap site that serves as an exonuclease entry site.

[0385] In some embodiments, the double-stranded ceDNA molecule may comprise more than one nicking site. For example, the nicking site may be located in the 5′ sense strand of the nucleic acid sequence of interest. In another embodiment, the nicking site may be located within the nucleic acid sequence of interest. In other embodiments, the double-stranded ceDNA molecule may comprise multiple nicking sites 3′ and / or 5′ of the nucleic acid sequence of interest, and / or within the nucleic acid sequence of interest. In some embodiments, the nicking site is located near and / or upstream of the promoter and / or TSS.

[0386] According to some embodiments, the ceDNA construct comprises one or more recognition nucleotide sequences for Nb.BbvCI or its isoschizogenic restriction enzyme. According to some embodiments, the ceDNA construct comprises a single recognition nucleotide sequence for Nb.BbvCI or its isoschizogenic restriction enzyme. According to some embodiments, the ceDNA construct comprises one or more recognition nucleotide sequences for Nb.BtsI or its isoschizogenic restriction enzyme. According to some embodiments, the ceDNA construct comprises a single recognition nucleotide sequence for Nb.BtsI or its isoschizogenic restriction enzyme. According to some embodiments, the ceDNA construct comprises one or more recognition nucleotide sequences for Endonuclease V or its isoschizogenic restriction enzyme.

[0387] In some embodiments, an additional step of purifying the ceDNA molecules is performed prior to the step of contacting with the endonuclease. For example, if the ceDNA is generated using rolling circle amplification (as described in Section IV(B) herein) and enzymatic synthesis (as described in Section IV(C) herein), the ceDNA can be purified prior to the step of contacting with the endonuclease.

[0388] (ii) Exonuclease step

[0389] In some embodiments, the ceDNA molecule is contacted with an endonuclease, which is then contacted with an exonuclease. The exonuclease is capable of removing the nicked strand of the ceDNA construct starting at the one or more nicking sites and ending at the one or more phosphorothioate-modified nucleotides or another one or more nicking sites. The exonuclease can be selected from, but is not limited to, T7 exonuclease, lambda exonuclease, T5 exonuclease, exonuclease V, and exonuclease III.

[0390] In one embodiment, the exonuclease is T7 exonuclease. In one embodiment, the exonuclease is lambda exonuclease. In one embodiment, the exonuclease is T5 exonuclease. In one embodiment, the exonuclease is exonuclease V. In one embodiment, the exonuclease is exonuclease III.

[0391] As discussed more extensively in Section III(B) of this article, the double-stranded end-blocked DNA can comprise a phosphorothioate (PS) bond. The PS bond replaces the non-bridging oxygen in the phosphate backbone of the oligonucleotide with a sulfur atom. Advantageously, this modification renders the internucleotide connection resistant to nuclease degradation and provides accuracy for targeting of exonucleases. More specifically, this modification is advantageously located in an ITR region in a space where exonucleases are active and acts as a lock on the 5' end and / or the 3' end, rendering the internucleotide connection resistant to nuclease degradation and ensuring accuracy of exonuclease activity.

[0392] According to some embodiments, in methods for generating single-stranded DNA (ssDNA) molecules, PS bonds replace the non-bridging oxygen in the phosphate backbone of an oligonucleotide with a sulfur atom. Advantageously, this modification stabilizes the nucleic acid and renders the internucleotide linkage resistant to nuclease degradation.

[0393] According to some embodiments, the exonuclease train can be terminated by including a structured region located in at least one strand of the double-stranded ceDNA molecule. In some embodiments, the structured region is a stem-loop structure. In some embodiments, the structured region is a bubble. In some embodiments, the structured region is a loop.

[0394] In some embodiments, the structured region is located near or adjacent to a stem-loop structure that will become the 5' stem-loop structure in the ssDNA molecules produced by the methods disclosed herein.

[0395] In some embodiments, the structured region is a "full stem" structure comprising two stem-loop structures on opposite strands of a double-stranded ceDNA molecule (see, e.g., Figure 16AIn some embodiments, each stem in the full stem structure is at least 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50 or more base pairs in length. In some embodiments, each loop in the full stem structure is at least 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50 or more unpaired nucleotides in length.

[0396] In some embodiments, the structured region is a "half-handle" structure comprising a stem-loop structure on one strand of a double-stranded ceDNA molecule (see, e.g., Figure 16B ). In some embodiments, each stem in the half-stem structure is at least 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50 or more base pairs in length. In some embodiments, each loop in the full-stem structure is at least 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50 or more unpaired nucleotides in length. In some embodiments in which the stem is at least 8 base pairs in length, the half-stem structure may also be referred to herein as an "extended half-stem" (see, e.g., Figure 16C ).

[0397] In some embodiments, the structured region may be referred to as a "bubble" structure comprising two unpaired regions on opposite strands of a double-stranded ceDNA molecule flanked on both sides by double-stranded DNA (see, e.g., Figure 16D and 16E In some embodiments, the unpaired nucleotides in the bubble structure are at least 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50 or more base pairs in length.

[0398] In some embodiments, the structured region may be referred to as a "loop" structure comprising a single unpaired region looping out from one strand of a double-stranded ceDNA molecule, flanked on both sides by double-stranded DNA (see, e.g., Figure 16F In some embodiments, the unpaired nucleotides in the loop structure are at least 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50 or more base pairs in length.

[0399] According to some embodiments, the structured region used to terminate the exonuclease train remains in the ssDNA molecule after the exonuclease reaction is complete. In some embodiments, the structured region can be removed by other enzymatic means.

[0400] B. Generation of dsDNA intermediates using rolling circle amplification (RCA)

[0401] According to some embodiments, the method described in Section IV(A) further comprises the following steps prior to the contacting step with the endonuclease: a) performing rolling circle amplification (RCA) using a double-stranded DNA (dsDNA) molecule, such as a plasmid, thereby producing a first intermediate molecule, such as an intermediate dsDNA molecule, such as a dsDNA molecule that is not an end-blocked DNA molecule; and then b) performing cell-free enzymatic synthesis using the first intermediate dsDNA molecule, thereby producing a second intermediate molecule, such as an intermediate ceDNA molecule.

[0402] In one embodiment, a first dsDNA intermediate is generated using a template, such as a plasmid template, by rolling circle amplification (RCA) to produce a first intermediate, such as a dsDNA intermediate. In one embodiment, the dsDNA intermediate is not end-blocked DNA. According to some embodiments, the RCA step comprises contacting the dsDNA molecule with a primer and a DNA polymerase.

[0403] The term "plasmid DNA" refers to a circular nucleic acid molecule, preferably an artificial nucleic acid molecule. Such plasmid DNA constructs can be storage vectors, expression vectors, cloning vectors, transfer vectors, and the like. Preferably, plasmid DNA within the meaning of the present invention, in addition to the elements described herein, optionally contains a selection marker such as an antibiotic resistance factor, and sequences suitable for the propagation of the vector, such as an origin of replication. Typical plasmid backbones are, for example, pUC19 and pBR322.

[0404] RCA uses circular DNA (e.g., plasmid) as a template and random hexamer primers that anneal to the circular template DNA at multiple sites. Therefore, sequence-specific primers are not required. The reaction requires two components: (a) a free 3' end; and (b) a rolling circle polymerase. Typically, Phi29 DNA polymerase is used to extend each of the primers. The reaction is carried out at 30°C and therefore does not require thermal cycling (i.e., using different temperatures in different steps). When the DNA polymerase reaches the downstream extended primer, chain displacement synthesis occurs, and the displaced chain is single-stranded and can be used to initiate with more hexamer primers. The process continues and results in exponential isothermal amplification.

[0405] Numerous references disclose primers, primer design, and amplification techniques, including U.S. Patent Nos. 5,871,921, 5,648,245, 5,866,377, and 5,854,033, all of which are incorporated by reference. RCA is described, for example, in Dean et al. (Genome Res. 2001 Jun; 11(6): 1095-9) and Kumar and Chernaya (Biotechniques. 2009 Jul; 47(1): 637-9), the contents of which are incorporated herein by reference in their entirety.

[0406] C. Generation of end-blocked DNA from double-stranded DNA intermediates

[0407] As described herein, a first intermediate dsDNA molecule generated using, for example, rolling circle amplification (described in Section IV(B)) is subjected to an additional step of cell-free enzymatic synthesis to produce a second intermediate, for example, a double-stranded end-capped DNA (ceDNA) molecule.

[0408] The cell-free process for producing double-stranded ceDNA is described in International Patent Application No. PCT / US2022 / 053868 (published as International Patent Publication No. WO 2023122303 A3), the contents of which are herein incorporated by reference in their entirety.

[0409] An overview of an exemplary embodiment of a cell-free synthetic method for preparing ceDNA vectors is shown in Figure 4 of International Patent Application No. PCT / US2022 / 053868 (published as International Patent Publication No. WO 2023122303 A3). Briefly, at least one restriction endonuclease is used to excise the transgene expression cassette (in diagonal stripes) from the double-stranded DNA construct, and the insert is subsequently ligated to inverted terminal repeat (ITR) oligonucleotides to form ceDNA. ITR oligonucleotides are single-stranded oligonucleotides that self-anneal to form an ITR-like three-dimensional configuration. The restriction endonucleases used in the methods described herein, such as but not limited to Type IIS restriction endonucleases, cut DNA at different sites and not within the recognition site. These restriction endonucleases used in the cell-free synthesis methods disclosed herein also recognize non-palindromic nucleotide sequences, such that the recognition sequence for the enzyme, which is also the binding site, is encoded on only one strand (see, e.g., International Patent Application No. PCT / US2022 / 053868, published as International Patent Publication No. WO2023122303 A3). Figure 5Thus, unlike other restriction endonucleases most commonly used in molecular biology, such as EcoRI, cleavage by this class of restriction endonucleases is directional, occurring upstream or downstream of the recognition site, but not within the recognition site itself (see International Patent Application No. PCT / US2022 / 053868, published as International Patent Publication No. WO2023122303 A3). Figure 5 ). The chain encoding the recognition sequence determines which side of the sequence (i.e., downstream or upstream) is cut. In short, the unique activity of the restriction endonuclease used in the method described herein allows any sequence within a predetermined distance from the specific recognition site to be cut by the restriction endonuclease, and therefore produces any overhang sequence. Digestion with a special restriction endonuclease produces cohesive overhangs compatible with the overhangs of the ITR oligonucleotides at both the 5' end and the 3' end of the excised insert. In other words, the design of the ITR oligonucleotide and the insert overhang drives the high specificity of the connection process, making the ITR oligonucleotide overhangs and the insert overhangs compatible with each other. Once connected, the desired ceDNA product is not easily digested with a restriction endonuclease because the recognition site will not be regenerated. However, when the excised insert and plasmid fragment are reconnected to the original construct, the recognition site is regenerated and the construct is therefore allowed to be cut.

[0410] In some embodiments, intermediate dsDNA molecules produced by digestion with restriction endonucleases may be referred to herein as "cleaved dsDNA molecules" or "cleaved intermediate dsDNA molecules."

[0411] In certain embodiments, by excising the transgenic expression cassette from double-stranded (ds) DNA (dsDNA) construct, the end of the insert is subsequently connected to the first oligonucleotide comprising one or more hairpin structures and the second oligonucleotide comprising one or more hairpin structures to form ds ceDNA to produce a double-stranded end-closed DNA vector. In certain embodiments, each of the oligonucleotides independently includes 1, 2, 3, 4 or more stem-loop regions. In certain embodiments, each of the oligonucleotides independently includes 2 or 3 stem-loop regions. In certain embodiments, the first oligonucleotide comprising one or more hairpin structures and the second oligonucleotide comprising one or more hairpin structures are each self-annealing to form a single-stranded oligonucleotide of a three-dimensional configuration. In further embodiments, the three-dimensional configuration is a T-shaped or Y-shaped stem-loop structure.

[0412] On the other hand, dsDNA (e.g., ceDNA) is produced by excising the transgenic expression cassette from a double-stranded DNA construct and subsequently connecting the ends of the insert to ITR oligonucleotides to form ds ceDNA. Connection can be achieved by a ligase (e.g., T4 ligase) or AAV Rep protein. In one embodiment, the reaction mixture is unpurified before connection. In such embodiments, excision and connection of the transgenic expression cassette (e.g., with one or more restriction endonucleases) occur simultaneously in a single reaction vessel. In an alternative embodiment, the reaction mixture is purified before connection.

[0413] In one embodiment, the restriction endonuclease used in the synthetic methods provided herein is a Type IIS restriction endonuclease. Non-limiting examples of Type IIS restriction endonucleases include AcuI, AlwI, Alw26I, BasI, BbsI, BbvI, BceAI, BcgI, BCiVI, BcoDI, BruAI, BmrI, BpiI, BpuEI, BsaI, BsaXI, BseGI, BseRI, BsgI, BsmAI, BsmBI, BsmFI, BsmI, BspCNI, BspMI, BspQI , BsrDI, BsrI, BtgZI, BtsCI, BtsI, MutI, CspCI, EarI, EciI, Eco31I, Esp3I, FauI, FokI, HgaI, HphI, HpyAV, LguI, MboII, MlyI, MmeI, MnlI, Mva1269I, NmeAIII, PaqCI, PleI, SapI, SfaNI, and the isolytic restriction enzymes of any of the foregoing. Isolytic restriction enzymes are a pair of restriction endonucleases that are specific for the same recognition sequence. For example, BcoDI and BsmAI are isolytic restriction enzymes of each other, and both have specificity for the recognition sequence of 5'-GTCTC-3'. In one embodiment, the IIS type endonuclease is selected from BbsI, BsaI, Esp3I and SapI and their isolytic restriction enzymes. In one embodiment, the IIS type endonuclease is BbsI or its isolytic restriction enzyme. In one embodiment, the IIS type endonuclease is BsaI or its isolytic restriction enzyme. In one embodiment, the IIS type endonuclease is BbsI or its isolytic restriction enzyme. In one embodiment, the IIS type endonuclease is Esp3I or its isolytic restriction enzyme. In one embodiment, the IIS type endonuclease is SapI or its isolytic restriction enzyme.

[0414] D. Separation and purification

[0415] Single-stranded DNA (ssDNA) molecules as described herein are superior to other vectors because they can be used more safely to express transgenes in cells, tissues or subjects compared to DNA vectors produced in a cell culture environment (e.g., insect cell lines such as Sf9 cell lines, yeast cells or mammalian cell lines such as HEK 293). That is, since the resulting vectors do not contain bacterial or insect cell contaminants, the production of linear vectors by such cell-free methods can potentially minimize undesirable side effects. Synthetic production methods can also result in higher purity of the desired vectors. Synthetic production methods can also be more efficient and / or more cost-effective than traditional cell-based production methods for such vectors. Vectors synthesized as described herein can express any desired transgene, such as a transgene, to treat or cure a given disease. One of ordinary skill in the art will readily recognize that any transgene used in conventional gene therapy methods with conventional recombinant vectors can be adapted for expression by single-stranded DNA (ssDNA) molecules, such as those prepared by the methods described herein, particularly where the size capacity of the transgenic insert is not limited.

[0416] In the present disclosure, it should be understood that the production process of the present disclosure can potentially be carried out in a completely cell-free environment if desired. However, depending on the starting material, some DNA components can be derived from nucleotide fragments initially prepared in cells (e.g., plasmid-ceDNA, AAV vectors produced by insect cells).

[0417] Those skilled in the art will appreciate that one or more of the one or more enzymes or oligonucleotide components used in the synthetic production method can be produced by cells and used in the methods of the present disclosure in purified form. Thus, in some embodiments, the synthetic production method is a cell-free method, however, the restriction enzyme and / or ligase can be produced by cells.

[0418] In one embodiment, the restriction endonuclease and / or the protein having ligation ability can be expressed or provided from an expression vector in a cell, such as a bacterial cell. In one embodiment, a cell, such as a bacterial cell, containing an expression vector expressing one or more of the restriction endonuclease or ligase can be present. Thus, while the methods disclosed herein primarily relate to cell-free synthetic methods for producing the ssDNA molecules disclosed herein, in some embodiments, synthetic production methods are also encompassed, in which cells, such as bacterial cells, are present but insect cells are absent and can be used to express one or more of the enzymes required in the method. In such embodiments, the cell expressing the restriction endonuclease and / or the protein having ligation ability is not an insect cell. In all embodiments in which a cell is present and expresses one or more restriction endonucleases or proteins having ligation ability, the cell does not replicate single-stranded DNA (ssDNA) molecules. In other words, the cell's intracellular machinery does not replicate or participate in the replication of single-stranded DNA (ssDNA) molecules.

[0419] Methods for producing and isolating single-stranded DNA (ssDNA) molecules are described herein. For example, single-stranded DNA (ssDNA) molecules as described herein, produced by the synthetic methods described herein, are harvested or collected at an appropriate time and can be optimized to achieve high yield production of the vector. The ssDNA molecules can be purified by any means known to those skilled in the art for purifying DNA. In one embodiment, the ssDNA molecules are purified as DNA molecules. Generally, any nucleic acid purification method known in the art, as well as commercially available DNA extraction kits, can be used.

[0420] Purification can be performed by subjecting the reaction mixture to chromatography. As a non-limiting example, the process can be performed as follows: the reaction mixture is loaded onto an ion exchange column (e.g., SARTOBIND ) and then eluted (e.g., using 1.2 M NaCl solution) and further chromatographically purified on a gel filtration column (e.g., 6 fast-flow GE). The DNA vector is then recovered by, for example, precipitation.

[0421] The presence of ssDNA molecules can be readily confirmed by digesting the vector DNA with a restriction enzyme that has a single recognition site for the DNA vector and analyzing the digested and undigested DNA material using gel electrophoresis to confirm the presence of characteristic bands of linear and continuous DNA, as compared to linear and non-continuous single-stranded DNA known in the art.

[0422] In some embodiments, ssDNA molecules can be delivered to target cells in vitro or in vivo by various suitable methods as discussed herein. The vector can be applied alone or injected. The vector can be delivered to cells without the aid of a transfection agent or other physical means. Alternatively, the vector can be delivered using a transfection agent or other physical means that facilitates DNA entry into cells, such as liposomes, alcohols, polylysine-rich compounds, arginine-rich compounds, calcium phosphate, microvesicles, microinjection, and the like.

[0423] According to some aspects, the present disclosure provides a linear single-stranded DNA (ssDNA) molecule comprising at least one nucleic acid sequence of interest, the at least one nucleic acid sequence of interest being flanked by at least one stem-loop structure at the 3' end produced by the methods described herein. According to some embodiments, the ssDNA molecule further comprises at least one stem-loop structure at the 5' end. According to further embodiments, the stem-loop structure at the 3' end comprises a first inverted terminal repeat (ITR), and the stem-loop structure at the 5' end comprises a second ITR. In some embodiments, the stem-loop structure at the 3' end comprises one or more aptamers. In some other embodiments, the stem-loop structure at the 5' end comprises one or more aptamers. In some other embodiments, the stem-loop structures at the 3' end and the 5' end comprise one or more aptamers. In some other embodiments, the stem-loop structures at the 3' end and the 5' end lack viral-derived sequences. In one embodiment, the stem-loop structures at the 3' end and the 5' end do not comprise 20nt-long D(-) and D(+) sequences or any transcription binding sites.

[0424] V. Pharmaceutical Compositions

[0425] In another aspect, a pharmaceutical composition is provided, comprising a single-stranded DNA (ssDNA) molecule as described herein and a pharmaceutically acceptable carrier or diluent.

[0426] The single-stranded DNA (ssDNA) molecules described herein can be incorporated into pharmaceutical compositions suitable for administration to a subject for in vivo delivery to a subject's cells, tissues, or organs. Typically, pharmaceutical compositions comprise single-stranded DNA (ssDNA) molecules as disclosed herein and a pharmaceutically acceptable carrier. For example, single-stranded DNA (ssDNA) molecules can be incorporated into pharmaceutical compositions suitable for a desired therapeutic route of administration (e.g., parenteral administration). Passive tissue transduction by high-pressure intravenous or intraarterial infusion and intracellular injections such as intranuclear microinjection or intracytoplasmic injection is also contemplated. Pharmaceutical compositions for therapeutic purposes can be formulated into solutions, microemulsions, dispersions, liposomes, or other ordered structures suitable for the concentration of synthetically produced single-stranded DNA (ssDNA) molecules. Sterile injectable solutions can be prepared by incorporating the desired amount of synthetically produced single-stranded DNA (ssDNA) molecules and one or a combination of the above ingredients in an appropriate buffer, followed by filter sterilization of the single-stranded DNA (ssDNA) molecules, as needed, to deliver the transgene in the nucleic acid to the cells of the recipient, thereby therapeutically expressing the transgene or donor sequence therein. The composition may also include a pharmaceutically acceptable carrier.

[0427] Pharmaceutically active compositions comprising single-stranded DNA (ssDNA) molecules can be formulated to deliver a transgene to cells, such as cells of a subject, for various purposes.

[0428] Pharmaceutical compositions for therapeutic purposes generally must be sterile and stable under the conditions of preparation and storage. Compositions can be formulated as solutions, microemulsions, dispersions, liposomes, or other ordered structures suitable for high concentrations of synthetically produced single-stranded DNA (ssDNA) molecules. Sterile injectable solutions can be prepared by incorporating the desired amount of the synthetically produced single-stranded DNA (ssDNA) molecules described herein with one or a combination of the above-mentioned ingredients in an appropriate buffer, as needed, followed by filter sterilization.

[0429] The single-stranded DNA (ssDNA) molecules described herein can be incorporated into pharmaceutical compositions suitable for topical, systemic, intra-amniotic, intrathecal, intracranial, intra-arterial, intravenous, intralymphatic, intraperitoneal, subcutaneous, tracheal, intratissue (e.g., intramuscular, intracardiac, intrahepatic, intrarenal, intracerebral), intrathecal, intravesical, conjunctival (e.g., extra-orbital, intra-orbital, retro-orbital, intraretinal, subretinal, choroidal, subchoroidal, intrastromal, intracameral, and intravitreal), intracochlear, and mucosal (e.g., oral, rectal, nasal) administration. Passive tissue transduction by high-pressure intravenous or intra-arterial infusion, as well as intracellular injection such as intranuclear microinjection or intracytoplasmic injection, is also contemplated.

[0430] In some respects, the method provided herein comprises that one or more single-stranded DNA (ssDNA) molecules described herein are delivered to a host cell. This paper also provides cells produced by such methods, and organisms (such as animals, plants or fungi) comprising such cells or produced by such cells. The delivery method of nucleic acid can include lipofection, nuclear transfection, microinjection, microprojectile bombardment (biolistics), liposomes, immunoliposomes, polycations or lipids: the medicament of nucleic acid conjugates, naked DNA and DNA enhances uptake. Lipofection is described in, for example, U.S. Patent No. 5,049,386, No. 4,946,787 and No. 4,897,355, and lipofection reagents are available on the market (for example, TRANSFECTAM TM and LIPOFECTIN TM Delivery can be to cells (eg, in vitro administration or ex vivo administration) or to target tissues (eg, in vivo administration).

[0431] Various techniques and methods for delivering nucleic acids to cells are known in the art. For example, single-stranded DNA (ssDNA) molecules described herein can be formulated into lipid nanoparticles (LNPs), lipids, liposomes, lipid nanoparticles, lipid complexes, or core-shell nanoparticles. Typically, LNPs are composed of nucleic acid (e.g., ssDNA molecules as described herein), one or more ionizable or cationic lipids (or salts thereof), one or more nonionic or neutral lipids (e.g., phospholipids), molecules that prevent aggregation (e.g., PEG or PEG-lipid conjugates), and optionally sterols (e.g., cholesterol).

[0432] Another method for delivering single-stranded DNA (ssDNA) molecules to cells is to conjugate nucleic acids to ligands internalized by cells. For example, ligands can bind to receptors on the cell surface and be internalized by endocytosis. Ligands can be covalently linked to nucleotides in nucleic acids. Exemplary conjugates for delivering nucleic acids to cells are described in, for example, WO2015 / 006740, WO2014 / 025805, WO2012 / 037254, WO2009 / 082606, WO2009 / 073809, WO2009 / 018332, WO2006 / 112872, WO2004 / 090108, WO2004 / 091515, and WO2017 / 177326.

[0433] The single-stranded DNA (ssDNA) molecules described herein can also be delivered to cells by transfection. Useful transfection methods include, but are not limited to, lipid-mediated transfection, cationic polymer-mediated transfection, or calcium phosphate precipitation. Transfection reagents are well known in the art and include, but are not limited to, TurboFect transfection reagent (ThermoFisher Scientific), Pro-Ject reagent (ThermoFisher Scientific), TRANSPASS TM P protein transfection reagent (New England Biolabs), CHARIOT TM Protein delivery reagents (Active Motif), PROTEOJUICE TM Protein transfection reagent (EMD Millipore), 293fectin, LIPOFECTAMINE TM 2000、LIPOFECTAMINE TM 3000 (Thermo Fisher Scientific), LIPOFECTAMINE TM (Thermo Fisher Scientific), LIPOFECTIN TM (Thermo Fisher Scientific), DMRIE-C, CELLFECTIN TM (Thermo Fisher Scientific), OLIGOFECTAMINE TM (Thermo Fisher Scientific), LIPOFECTACE TM FUGENE TM (Roche, Basel, Switzerland), FUGENE TM HD (Roche), TRANSFECTAM TM (Transfectamine, Promega, Madison, Wis.), TFX-10 TM (Promega Corporation), TFX-20 TM (Promega Corporation), TFX-50 TM (Promega Corporation), TRANSFECTIN TM (BioRad, Hercules, Calif.), SILENTFECT TM (Bole Company), Effectene TM (Qiagen, Valencia, Calif.), DC-chol (Avanti Polar Lipids), GENEPORTERTM (Gene Therapy Systems, San Diego, Calif.), DHARMAFECT 1 TM (Dharmacon, Lafayette, Colo.), DHARMAFECT 2 TM (Dalmarken), DHARMAFECT 3 TM (Dalmarken), DHARMAFECT 4 TM (Dalmacan), ESCORT TM III (Sigma, St. Louis, Mo.) and ESCORT TM IV (Sigma Chemical Co.) Nucleic acids such as ssDNA molecules or dsDNA constructs can also be delivered to cells by microfluidic methods known to those skilled in the art.

[0434] Methods for non-viral delivery of nucleic acids in vivo or ex vivo include electroporation, lipofection (see U.S. Pat. Nos. 5,049,386; 4,946,787, and commercially available reagents such as Transfectam TM and Lipofectin TM), microinjection, microprojectile bombardment, virosomes, liposomes (see, e.g., Crystal, Science 270:404-410 (1995); Blaese et al., Cancer Gene Ther. 2:291-297 (1995); Behr et al., Bioconjugate Chemistry 2:291-297 (1995); Chem. 5:382-389 (1994); Remy et al., Bioconjugate Chem. 5:647-654 (1994); Gao et al., Gene Therapy 2:710-722 (1995); Ahmad et al., Cancer Res. 52:4817-4820 (1992); U.S. Pat. Nos. 4,186,183, 4,217,344, 4,235,871, 4,261,975, 4,485,054, 4,501,728, 4,774,085, 4,837,028, and 4,946,787), immunoliposomes, polycationic or lipid:nucleic acid conjugates, naked DNA, and agent-enhanced DNA uptake. Sonoporation using, for example, the Sonitron 2000 system (Rich-Mar) can also be used for delivery of nucleic acids.

[0435] The single-stranded DNA (ssDNA) molecules described herein can also be administered directly to an organism to transduce cells in vivo. Administration is by any route normally used to introduce molecules into ultimate contact with blood or tissue cells, including but not limited to injection, infusion, topical application, and electroporation. Suitable methods for administering such nucleic acids are available and well known to those skilled in the art, and although more than one route may be used to administer a particular composition, a particular route can often provide a more direct and more effective response than another route.

[0436] Methods for introducing single-stranded DNA (ssDNA) molecules can be delivered into hematopoietic stem cells, for example, by methods as described, for example, in US Patent No. 5,928,638.

[0437] Delivery agents such as liposomes, nanocapsules, microparticles, microspheres, lipid particles, vesicles, etc. can be used to introduce the compositions of the present disclosure into suitable host cells. Specifically, nucleic acids can be formulated for delivery encapsulated in lipid particles, liposomes, vesicles, nanospheres, nanoparticles, gold particles, etc. Such formulations may be preferred for pharmaceutically acceptable formulations for introducing nucleic acids disclosed herein.

[0438] Various delivery methods known in the art or improvements thereof can be used to deliver single-stranded DNA (ssDNA) molecules described herein in vitro or in vivo. For example, in some embodiments, single-stranded DNA (ssDNA) molecules are delivered by allowing cell membranes to be instantly infiltrated so that DNA enters the target cells through mechanical, electrical, ultrasonic, fluid dynamic or laser-based energy. For example, single-stranded DNA (ssDNA) molecules can be delivered by squeezing cells through a size-restricted channel or by instantaneously destroying the cell membrane through other means known in the art. In some cases, individual single-stranded DNA (ssDNA) molecules are directly injected into skin, thymus, myocardium, skeletal muscle or liver cells as naked DNA. In some cases, single-stranded DNA (ssDNA) molecules are delivered by gene guns. Gold or tungsten spherical particles (1-3 μm in diameter) coated with AAV vectors without capsids can be accelerated to high speeds by pressurized gas and penetrate into target tissue cells.

[0439] In some embodiments, electroporation is used to deliver end-blocked DNA vectors, including single-stranded DNA (ssDNA) molecules. Electroporation causes temporary instability of the cell membrane target cell tissue by inserting a pair of electrodes into the tissue, so that the DNA molecules in the surrounding medium of the unstable membrane will be able to penetrate into the cytoplasm and nucleoplasm of the cell. Electroporation has been used in vivo for many types of tissues, such as skin, lungs, and muscles.

[0440] In some cases, single-stranded DNA (ssDNA) molecules are delivered by hydrodynamic injection, a simple and efficient method for the intracellular delivery of any water-soluble compounds and particles directly into visceral organs and skeletal muscles throughout the limbs.

[0441] In some cases, single-stranded DNA (ssDNA) molecules are delivered by ultrasound to create nanopores in the membrane to facilitate intracellular delivery of DNA particles into cells of internal organs or tumors, so the size and concentration of the plasmid DNA play an important role in the efficiency of the system. In some cases, single-stranded DNA (ssDNA) molecules are delivered by magnetofection using a magnetic field to concentrate the nucleic acid-containing particles into target cells.

[0442] In some cases, a chemical delivery system can be used, for example, by using a nanocomplex comprising compacting negatively charged nucleic acids with polycationic nanoparticles that are cationic liposomes / micelles or cationic polymers. Cationic lipids used in delivery methods include, but are not limited to, monovalent cationic lipids, multivalent cationic lipids, guanidine-containing compounds, cholesterol-derived compounds, cationic polymers, (e.g., poly(ethyleneimine), poly-L-lysine, protamine, other cationic polymers), and lipid-polymer hybrids.

[0443] Compositions comprising single-stranded DNA (ssDNA) molecules as described herein and pharmaceutically acceptable carriers are particularly contemplated herein. In some embodiments, single-stranded DNA (ssDNA) molecules are formulated with lipid delivery systems, e.g., liposomes as described herein. In some embodiments, such compositions are administered by any route desired by the skilled artisan. The compositions can be administered to a subject by various routes including oral, parenteral, sublingual, transdermal, rectal, transmucosal, topical, by inhalation, buccal, intrapleural, intravenous, intraarterial, intraperitoneal, subcutaneous, intramuscular, intranasal, intrathecal, and intraarticular, or a combination thereof. For veterinary use, the compositions can be administered as a suitably acceptable formulation according to normal veterinary practice. Veterinarians can readily determine the dosage regimen and route of administration that is most suitable for a particular animal. The compositions can be administered by conventional syringes, needle-free injection devices, "microparticle bombardment gene guns," or other physical methods such as electroporation ("EP"), hydrodynamic methods, or ultrasound.

[0444] In some cases, single-stranded DNA (ssDNA) molecules are delivered by hydrodynamic injection, a simple and efficient method for the intracellular delivery of any water-soluble compounds and particles directly into visceral organs and skeletal muscles throughout the limbs.

[0445] In some cases, single-stranded DNA (ssDNA) molecules are delivered by ultrasound to create nanopores in a membrane to facilitate intracellular delivery of DNA particles into cells of internal organs or tumors, whereby the size and concentration of the ssDNA molecules play an important role in the efficiency of the system. In some cases, single-stranded DNA (ssDNA) molecules are delivered by magnetofection using a magnetic field to concentrate particles containing nucleic acids into target cells.

[0446] In some cases, a chemical delivery system can be used, for example, by using a nanocomplex comprising compacting negatively charged nucleic acids with polycationic nanoparticles that are cationic liposomes / micelles or cationic polymers. Cationic lipids used in delivery methods include, but are not limited to, monovalent cationic lipids, multivalent cationic lipids, guanidine-containing compounds, cholesterol-derived compounds, cationic polymers, (e.g., poly(ethyleneimine), poly-L-lysine, protamine, other cationic polymers), and lipid-polymer hybrids.

[0447] A.Exosomes

[0448] In some embodiments, the single-stranded DNA (ssDNA) molecules described herein are delivered by packaging in exosomes. Exosomes are small membrane vesicles of endocytic origin that are released into the extracellular environment after fusion of multivesicular bodies with the plasma membrane. Its surface is composed of a lipid bilayer from the cell membrane of donor cells, which contains the cytosol from the cells that produce exosomes and displays membrane proteins from parent cells on the surface. Exosomes are produced by various cell types including epithelial cells, B and T lymphocytes, mast cells (MCs), and dendritic cells (DCs). Some embodiments envision the use of exosomes with a diameter between 10 nm and 1 μm, between 20 nm and 500 nm, between 30 nm and 250 nm, between 50 nm and 100 nm. Using donor cells of exosomes or by introducing specific nucleic acids into exosomes, exosomes can be isolated for delivery to target cells. Various methods known in the art can be used to produce exosomes containing the capsid-free vector disclosed herein.

[0449] B. Microparticles / Nanoparticles

[0450] In some aspects, the present disclosure provides a kind of lipid nanoparticle, described lipid nanoparticle comprises DNA carrier, and described carrier includes single-stranded DNA (ssDNA) molecule and ionizable lipid as described herein.For example, a kind of lipid nanoparticle formulation is prepared and is loaded with the synthetic AAV obtained by the process disclosed in the international application PCT / US2018 / 050042 (published as International Patent Publication No. WO2019 / 051289A1) submitted on September 7, 2018, and described document is incorporated herein.This can be achieved by high-energy mixing of ethanol lipid and aqueous synthetic AAV at low pH, which makes ionizable lipid protonated and provides favorable energy for the nucleation of synthetic AAV / lipid association and particle.Particles can be further stabilized by water dilution and removal of organic solvent.Particles can be concentrated to the desired level.

[0451] Typically, lipid particles are prepared with a total lipid to synthetic AAV (mass or weight) ratio of about 10: 1 to 30: 1. In some embodiments, the ratio of lipid to ssDNA molecules or dsDNA constructs (mass / mass ratio; w / w ratio) can be in the following ranges: about 1: 1 to about 25: 1, about 10: 1 to about 14: 1, about 3: 1 to about 15: 1, about 4: 1 to about 10: 1, about 5: 1 to about 9: 1, or about 6: 1 to about 9: 1. The amount of lipid and synthetic AAV can be adjusted to provide a desired N / P ratio, such as 3, 4, 5, 6, 7, 8, 9, 10 or higher N / P ratios. Typically, the total lipid content of the lipid particle formulation can be in the range of about 5 mg / ml to about 30 mg / mL.

[0452] Exemplary lipid nanoparticle (LNP) formulations encapsulating ssDNA molecules as described herein are Figure 11 Depicted in.

[0453] Ionizable lipids are often used to condense nucleic acid cargo, e.g., ssDNA as described herein, under low pH conditions and to drive membrane association and fusogenicity. Typically, ionizable lipids are lipids comprising at least one amino group that is positively charged or protonated under acidic conditions, e.g., at a pH of 6.5 or lower. Ionizable lipids are also referred to herein as cationic lipids.

[0454] Exemplary ionizable lipids are disclosed in International PCT Patent Publications WO2015 / 095340, WO2015 / 199952, WO2018 / 011633, WO2017 / 049245, WO2015 / 061467, WO2012 / 040184, WO2012 / 000104, WO2015 / 074085, WO2016 / 081029, WO2017 / 004143, WO2017 / 075531, WO2017 / 117528, WO2011 / 022460, WO2013 / 148541, WO2013 / 116126, WO2011 / 153120, WO2012 W O2013 / 049328, WO2013 / 086322, WO2013 / 086373, WO2011 / 071860, WO2009 / 132131, WO2010 / 048536, WO2010 / 088537, WO2010 / 054401, WO2010 / 054406 , WO2010 / 054405, WO2010 / 054384, WO2012 / 016184, WO2009 / 086558, WO2010 / 042877, WO2011 / 000106, WO2011 / 000107, WO2005 / 120152, WO2011 / 141 705, WO2013 / 126803, WO2006 / 007712, WO2011 / 038160, WO2005 / 121348, WO2011 / 066651, WO2009 / 127060, WO2011 / 141704, WO2006 / 069782, WO2012 / 0 31043, WO2013 / 006825, WO2013 / 033563, WO2013 / 089151, WO2017 / 099823, WO2015 / 095346, and WO2013 / 086354, and U.S. Patent Publications US2016 / 0311759, US2015 / 0376115, US2016 / 0151284, US2017 / 0210697, US2015 / 0140070, US2013 / 0178541, US2013 / 0303587, US2015 / 0141678, US2015 / 0239926, US2016 / 0376224,US2017 / 0119904, US2012 / 0149894, US2015 / 0057373, US2013 / 0090372, US2013 / 0274523, US2 013 / 0274504、US2013 / 0274504、US2009 / 0023673、US2012 / 0128760、US2010 / 0324120、US2014 / 0200257, US2015 / 0203446, US2018 / 0005363, US2014 / 0308304, US2013 / 0338210, US2012 / 010 1148、US2012 / 0027796、US2012 / 0058144、US2013 / 0323269、US2011 / 0117125、US2011 / 0256175 , US2012 / 0202871, US2011 / 0076335, US2006 / 0083780, US2013 / 0123338, US2015 / 0064242, US 2006 / 0051405, US2013 / 0065939, US2006 / 0008910, US2003 / 0022649, US2010 / 0130588, US2013 / 0116307, US2010 / 0062967, US2013 / 0202684, US2014 / 0141070, US2014 / 0255472, US2014 / 0039032, US2018 / 0028664, US2016 / 0317458, and US2013 / 0195920, the disclosures of all of which are incorporated herein by reference in their entirety.

[0455] In some embodiments, the ionizable lipid is MC3 (6Z,9Z,28Z,31Z)-heptatriacontano-6,9,28,31-tetraen-19-yl-4-(dimethylamino)butyrate (DLin-MC3-DMA or MC3) having the following structure:

[0456]

[0457] The lipid DLin-MC3-DMA is described in Jayaraman et al., Angewandte Chemie Int. Engl. Ed. (2012), 51(34):8529-8533, the contents of which are incorporated herein by reference in their entirety.

[0458] In some embodiments, the ionizable lipid is lipid ATX-002 as described in WO 2015 / 074085, the contents of which are herein incorporated by reference in their entirety.

[0459] In some embodiments, the ionizable lipid is (13Z,16Z)-N,N-dimethyl-3-nonyldocosa-13,16-dien-1-amine as described in WO2012 / 040184, the contents of which are herein incorporated by reference in their entirety.

[0460] In some embodiments, the ionizable lipid is Compound 6 or Compound 22 as described in WO 2015 / 199952, the contents of which are herein incorporated by reference in their entirety.

[0461] Without limitation, the ionizable lipids can comprise 20-90 mol% of the total lipids present in the lipid nanoparticles. For example, the ionizable lipid molar content can be 20-70 mol%, 30-60 mol%, or 40-50 mol% of the total lipids present in the lipid nanoparticles. In some embodiments, the ionizable lipids comprise about 50 mol% to about 90 mol% of the total lipids present in the lipid nanoparticles.

[0462] In some aspects, the lipid nanoparticles can further comprise non-cationic lipids. Non-ionic lipids include amphipathic lipids, neutral lipids and anionic lipids. Therefore, non-cationic lipids can be neutral, uncharged, zwitterionic or anionic lipids. Non-cationic lipids are generally used to enhance fusogenicity.

[0463] Exemplary non-cationic lipids contemplated for use in methods and compositions comprising DNA vectors, including synthetic vectors produced using the synthetic processes described herein, are described in International Applications PCT / US2018 / 050042, filed September 7, 2018 (published as International Patent Publication No. WO 2019 / 051289 A1), and PCT / US2018 / 064242, filed December 6, 2018 (published as International Patent Publication No. WO 2019 / 113310 A1), each of which is incorporated herein by reference in its entirety.

[0464] Exemplary non-cationic lipids are described in International Application Publication No. WO 2017 / 099823 and U.S. Patent Publication No. US 2018 / 0028664, the contents of both of which are incorporated herein by reference in their entirety.

[0465] The non-cationic lipids can account for 0-30% (mol) of the total lipids present in the lipid nanoparticles. For example, the non-cationic lipid content can be 5-20% (mol) or 10-15% (mol) of the total lipids present in the lipid nanoparticles. In various embodiments, the molar ratio of ionizable lipids to neutral lipids is in the range of about 2:1 to about 8:1.

[0466] In some embodiments, the lipid nanoparticles do not comprise any phospholipids. In some aspects, the lipid nanoparticles may further comprise components such as sterols to provide membrane integrity.

[0467] An exemplary sterol that can be used in lipid nanoparticles is cholesterol and its derivatives. Exemplary cholesterol derivatives are described in International Application WO 2009 / 127060 and US Patent Publication US 2010 / 0130588, the contents of both of which are incorporated herein by reference in their entirety.

[0468] Components such as sterols that provide membrane integrity can comprise 0-50 mol% of the total lipids present in the lipid nanoparticles. In some embodiments, such components are 20-50 mol% 30-40 mol% of the total lipid content of the lipid nanoparticles.

[0469] In some aspects, lipid nanoparticle can further comprise polyethylene glycol (PEG) or the lipid molecule of putting together.Usually, these are used to suppress the gathering of lipid nanoparticle and / or provide spatial stabilization.Exemplary put together lipid includes but is not limited to PEG-lipid conjugates, polyoxazoline (POZ)-lipid conjugates, polyamide-lipid conjugates (such as ATTA-lipid conjugates), cationic polymer lipid (CPL) conjugates and its mixture.In certain embodiments, the lipid molecule of putting together is PEG-lipid conjugates, for example (methoxy polyethylene glycol)-lipid of putting together. Exemplary PEG-lipid conjugates include, but are not limited to, PEG-diacylglycerol (DAG) (e.g., 1-(monomethoxy-polyethylene glycol)-2,3-dimyristoylglycerol (PEG-DMG)), PEG-dialkoxypropyl (DAA), PEG-phospholipids, PEG-ceramide (Cer), PEGylated phosphatidylethanolamine (PEG-PE), PEG succinate diacylglycerol (PEGS-DAG) (e.g., 4-O-(2',3'-di-tetradecanoyloxy)propyl-1-O-(w-methoxy(polyethoxy)ethyl)succinate (PEG-S-DMG)), PEG dialkoxypropyl carbamate, N-(carbonyl-methoxy) In some embodiments, the present invention relates to a PEG-lipid conjugate comprising: ...

[0470] In some embodiments, the PEG-lipid is a compound disclosed in US2018 / 0028664, the contents of which are herein incorporated by reference in their entirety.

[0471] In some embodiments, the PEG-lipids are disclosed in US20150376115 or US2016 / 0376224, both of which are herein incorporated by reference in their entirety.

[0472] The PEG-DAA conjugate can be, for example, PEG-dilaurylpropyl, PEG-dimyristyloxypropyl, PEG-dipalmityloxypropyl, or PEG-distearyloxypropyl. The PEG-lipid can be one or more of the following: PEG-DMG, PEG-dilauroylglycerol, PEG-dipalmitoylglycerol, PEG-ditert-glycerol, PEG-dilauroylglyceramide, PEG-dimyristoylglyceramide, PEG-dipalmitoylglyceramide, PEG-diglycerol diester, PEG-cholesterol (1-[8'-(cholest-5-en-3[β]-oxy)formamido-3',6'-dioxaoctyl]carbamoyl-[ω]-methyl-poly(ethylene glycol)), PEG-DMB (3,4-tetracosylbenzyl-[ω]-methyl-poly(ethylene glycol) ether), and 1,2-dimyristoyl-sn-glycero-3-phosphoethanolamine-N-[methoxy(polyethylene glycol)-2000]. In some examples, the PEG-lipid can be selected from the group consisting of PEG-DMG, 1,2-dimyristoyl-sn-glycero-3-phosphoethanolamine-N-[methoxy(polyethylene glycol)-2000].

[0473] Lipids conjugated to molecules other than PEG can also be used to replace PEG-lipids. For example, polyoxazoline (POZ)-lipid conjugates, polyamide-lipid conjugates (such as ATTA-lipid conjugates) and cation-polymer lipid (CPL) conjugates can be used to replace or add PEG-lipids. Exemplary conjugated lipids, i.e., PEG-lipids, (POZ)-lipid conjugates, ATTA-lipid conjugates, and cationic polymer-lipids are disclosed in International Patent Application Publications WO1996 / 010392, WO1998 / 051278, WO2002 / 087541, WO2005 / 026372, WO2008 / 147438, WO2009 / 086558, WO2012 / 000104, WO2017 / 117528, WO2017 / 099823, WO2015 / 199952, WO2017 / 004143, WO2015 / 095346, WO2012 / 000104, WO2012 / 000104, and WO2010 / 006282, U.S. Pat. The invention relates to an anti-cancer drug that has been applied to a pharmaceutical composition of the present invention and to a pharmaceutical composition of the present invention. The invention relates to an anti-cancer drug that has been applied to a pharmaceutical composition of the present invention and to a pharmaceutical composition of the present invention. The invention relates to an anti-cancer drug that has been applied to a pharmaceutical composition of the present invention and to a pharmaceutical composition of the present invention.

[0474] In some embodiments, one or more additional compounds can be therapeutic agents. The therapeutic agent can be selected from any category suitable for the therapeutic purpose. In other words, the therapeutic agent can be selected from any category suitable for the therapeutic purpose. In other words, the therapeutic agent can be selected based on the therapeutic purpose and the desired biological effect. For example, if the synthetic AAV in the LNP can be used to treat cancer, the additional compound can be an anticancer agent (e.g., a chemotherapeutic agent, a targeted cancer therapy (including but not limited to a small molecule, an antibody, or an antibody-drug conjugate). In another example, if the LNP containing synthetic AAV can be used to treat infection, the additional compound can be an antimicrobial agent (e.g., an antibiotic or an antiviral compound). In yet another example, if the LNP containing synthetic AAV can be used to treat an immune disease or disorder, the additional compound can be a compound that regulates the immune response (e.g., an immunosuppressant, an immunostimulatory compound, or a compound that regulates one or more specific immune pathways). In some embodiments, different mixtures of different lipid nanoparticles containing different compounds, such as synthetic AAV encoding different proteins or different compounds, such as therapeutic agents can be used in the compositions and methods of the present disclosure.

[0475] In some embodiments, the additional compound is an immunomodulator. For example, the additional compound is an immunosuppressant. In some embodiments, the additional compound is an immunostimulator.

[0476] Also provided herein is a pharmaceutical composition comprising a synthetically produced single-stranded DNA (ssDNA) molecule encapsulated by a lipid nanoparticle as described herein, and a pharmaceutically acceptable carrier or excipient.

[0477] In some aspects, the present disclosure provides a lipid nanoparticle formulation further comprising one or more pharmaceutical excipients. In some embodiments, the lipid nanoparticle formulation further comprises sucrose, tris, trehalose and / or glycine.

[0478] The single-stranded DNA (ssDNA) molecules described herein can be complexed with the lipid portion of the particle or encapsulated in the lipid sites of the lipid nanoparticle. In some embodiments, the DNA vector comprising the single-stranded DNA (ssDNA) molecule can be completely encapsulated in the lipid sites of the lipid nanoparticle, thereby protecting it from degradation by nucleases, for example in aqueous solution. In some embodiments, the DNA vector comprising the single-stranded DNA (ssDNA) molecule in the lipid nanoparticle is not substantially degraded after the lipid nanoparticle is exposed to a nuclease at 37° C. for at least about 20 minutes, 30 minutes, 45 minutes, or 60 minutes. In some embodiments, the synthetic AAV in the lipid nanoparticles is not substantially degraded after incubation of the particles in serum at 37°C for at least about 30 minutes, 45 minutes, or 60 minutes, or at least about 2 hours, 3 hours, 4 hours, 5 hours, 6 hours, 7 hours, 8 hours, 9 hours, 10 hours, 12 hours, 14 hours, 16 hours, 18 hours, 20 hours, 22 hours, 24 hours, 26 hours, 28 hours, 30 hours, 32 hours, 34 hours, or 36 hours.

[0479] In certain embodiments, the lipid nanoparticles are substantially non-toxic to a subject, eg, to a mammal such as a human. In some aspects, the lipid nanoparticle formulation is a lyophilized powder.

[0480] In certain embodiments, lipid nanoparticle is the solid core particle with at least one lipid bilayer.In other embodiments, lipid nanoparticle has non-double layer structure, i.e. non-lamellar (that is, non-double layer) form.Unrestricted, non-double layer form can comprise for example three-dimensional tube, rod, cubic symmetry etc.For example, can use for example, as described in US2010 / 0130588 Cryo-TEM analysis easily assesses and characterizes the form (lamellar and non-lamellar) of lipid nanoparticle, the content of described document is incorporated to herein by reference with its entirety.

[0481] In some other embodiments, the lipid nanoparticles with non-lamellar structure are electron dense. In some aspects, the present disclosure provides a kind of lipid nanoparticles, and described lipid nanoparticles are unilamellar or multilamellar in structure. In some aspects, the present disclosure provides a kind of lipid nanoparticle formulation, and described lipid nanoparticle formulation comprises multivesicular particles and / or foam-based particles.

[0482] By controlling the composition and concentration of the lipid components, the rate at which the lipid conjugates are exchanged from the lipid particles can be controlled, and the rate at which the control lipid nanoparticles become fused can be controlled. In addition, other variables including, for example, pH, temperature, or ionic strength can be used to change and / or control the rate at which the lipid nanoparticles become fused. Based on this disclosure, it will be apparent to those of ordinary skill in the art that other methods of controlling the rate at which the lipid nanoparticles become fused can be used to control the lipid conjugates. It will also be apparent that, by controlling the composition and concentration of the lipid conjugates, the lipid particle size can be controlled.

[0483] The pKa of the formulated cationic lipid can be correlated with the effectiveness of the LNP in delivering nucleic acids (see Jayaraman et al., Angewandte Chemie, International Edition (2012), 51(34), 8529-8533; Semple et al., Nature Biotechnology 28, 172-176 (2010), both of which are incorporated by reference in their entireties). The preferred range of pKa is from about 5 to about 7. The pKa of the cationic lipid can be determined in lipid nanoparticles using an assay based on the fluorescence of 2-(p-tolylamino)-6-naphthalenesulfonic acid (TNS). Typically, lipid nanoparticles comprise an ionizable amino lipid (e.g., 4-(dimethylamino)butyric acid heptatriacontac-6,9,28,31-tetraen-19-yl ester, DLin-MC3-DMA, phosphatidylcholine (1,2-distearoyl-sn-glycero-3-phosphocholine, DSPC), cholesterol, and a coat lipid (polyethylene glycol-dimyristoylglycerol, PEG-DMG), as disclosed, for example, in Tam et al. (2013). Advances in Lipid Nanoparticles for siRNA delivery. Pharmaceuticals 5(3):498-507.

[0484] In some embodiments, the average diameter of the lipid nanoparticles is between about 10 nm and about 1000 nm. In some embodiments, the diameter of the lipid nanoparticles is less than 300 nm. In some embodiments, the diameter of the lipid nanoparticles is between about 10 nm and about 300 nm. In some embodiments, the diameter of the lipid nanoparticles is less than 200 nm. In some embodiments, the diameter of the lipid nanoparticles is between about 25 nm and about 200 nm. In some embodiments, the lipid nanoparticle preparation (e.g., a composition comprising a plurality of lipid nanoparticles) has a size distribution wherein the average size (e.g., diameter) is about 40 nm to about 200 nm, and more typically the average size is about 100 nm or less (e.g., a diameter of 100 nm, 90 nm, 85 nm, 80 nm, 75 nm, 70 nm, 65 nm, 60 nm, 55 nm, 50 nm, and 45 nm).

[0485] Various lipid nanoparticles known in the art can be used to deliver single-stranded DNA (ssDNA) molecules. For example, various delivery methods using lipid nanoparticles are described in U.S. Patents Nos. 9,404,127, 9,006,417, and 9,518,272.

[0486] In some embodiments, single-stranded DNA (ssDNA) molecules are delivered via gold nanoparticles. Typically, nucleic acids can be covalently bound to gold nanoparticles or non-covalently bound to gold nanoparticles (e.g., bound by charge-charge interactions), as described, for example, in Ding et al. (2014). Gold Nanoparticles for Nucleic Acid Delivery. Mol. Ther. 22(6); 1075-1083. In some embodiments, gold nanoparticle-nucleic acid conjugates are produced using methods such as those described in U.S. Patent No. 6,812,334.

[0487] In some embodiments, the ssDNA molecules described herein can be easily formulated in high concentration chitosan-nucleic acid polyplex compositions and orally administered in DNA enteric-coated pellets as described in U.S. Patent Nos. 8,846,102; 9,404,088; and 9,850,323, each of which is incorporated herein in its entirety. In some embodiments, the lipid nanoparticles described herein are conjugated (e.g., covalently bound) to agents that increase cellular uptake. "Agents that increase cellular uptake" are molecules that promote the transport of nucleic acids or lipid nanoparticles across lipid membranes. For example, lipid nanoparticles can be conjugated to cell penetrating peptides (CPPs) (e.g., penetratin, TAT, Syn1B, etc.) and / or polyamines (e.g., spermine). Further examples of agents that increase cellular uptake are disclosed, for example, in Winkler (2013). Oligonucleotide conjugates for therapeutic applications. Ther. Deliv. 4(7); 791-809.

[0488] In certain embodiments, lipid nanoparticles described herein are conjugated to polymers (e.g., polymer molecules) or folic acid molecules (e.g., folic acid molecules). Generally, the delivery of nucleic acids, lipids, and lipid nanoparticles conjugated to polymers is known in the art, for example, as described in WO2000 / 34343 and WO2008 / 022309. In certain embodiments, lipids and / or lipid nanoparticles are conjugated to poly (amide) polymers, for example, as described in U.S. Patent No. 8,987,377. In certain embodiments, lipids and / or lipid nanoparticles described in the present disclosure are conjugated to folic acid molecules, as described in U.S. Patent No. 8,507,455.

[0489] In some embodiments, the lipids and / or lipid nanoparticles are conjugated to carbohydrates, e.g., as described in U.S. Patent No. 8,450,467. In some embodiments, the lipids and / or lipid nanoparticles are conjugated to GalNAc. In some embodiments, the lipids and / or lipid nanoparticles are conjugated to antibodies, e.g., single-chain antibodies, such as scFv.

[0490] C. Nanocapsules

[0491] Alternatively, nanocapsule formulations of single-stranded DNA (ssDNA) molecules as described herein can be used. Nanocapsules can generally entrap substances in a stable and reproducible manner. In order to avoid side effects due to intracellular polymer overload, such ultrafine particles (approximately 0.1 μm in size) should be designed using polymers that can degrade in vivo. Biodegradable polyalkyl-cyanoacrylate nanoparticles that meet these requirements are contemplated for use.

[0492] D.Liposomes

[0493] Single-stranded DNA (ssDNA) molecules described herein can be added to liposomes for delivery to cells or target organs of a subject. Liposomes are vesicles having at least one lipid bilayer. In the context of pharmaceutical research and development, liposomes are commonly used as vehicles for drug / therapeutic agent delivery. They work by fusing with cell membranes and repositioning their lipid structure to deliver drugs or active pharmaceutical ingredients (APIs). Liposomal compositions for such delivery are composed of phospholipids, particularly compounds having phosphatidylcholine groups, but these compositions may also include other lipids.

[0494] The formation and use of liposomes are generally known to those skilled in the art. Liposomes with improved serum stability and circulation half-life have been developed (U.S. Patent No. 5,741,516). Further, various methods of liposomes and liposome-like formulations as potential drug carriers have been described (U.S. Patent Nos. 5,567,434; 5,552,157; ​​5,565,213; 5,738,868 and 5,795,587).

[0495] Single-stranded DNA (ssDNA) molecules described herein can be added to liposomes for delivery to cells, such as cells in which transgene expression is desired. Liposomes are vesicles having at least one lipid bilayer. In the context of pharmaceutical research and development, liposomes are commonly used as vehicles for drug / therapeutic agent delivery. They work by fusing with the cell membrane and repositioning their lipid structure to deliver drugs or active pharmaceutical ingredients (APIs). Liposomal compositions for such delivery are composed of phospholipids, particularly compounds having phosphatidylcholine groups, but these compositions may also include other lipids.

[0496] According to some aspects, the present disclosure provides a liposome formulation comprising one or more compounds having a polyethylene glycol (PEG) functional group (so-called "PEGylated compound"), which can reduce the immunogenicity / antigenicity of the compound, provide it with hydrophilicity and hydrophobicity, and reduce dosage frequency. Alternatively, the liposome formulation comprises only a polyethylene glycol (PEG) polymer as an additional component. In such aspects, the molecular weight of the PEG or PEG functional group can be from 62 Da to about 5,000 Da.

[0497] In some aspects, the present disclosure provides a liposome formulation that delivers an API with an extended release or controlled release profile over a period of hours to weeks. In some related aspects, the liposome formulation can comprise an aqueous cavity bounded by a lipid bilayer. In other related aspects, the liposome formulation encapsulates the API along with components that undergo a physical transformation at elevated temperatures to release the API over a period of hours to weeks.

[0498] In some aspects, the liposomal formulation comprises sphingomyelin and one or more lipids disclosed herein. In some aspects, the liposomal formulation comprises a photosensitizer.

[0499] In some aspects, the present disclosure provides a liposome formulation comprising one or more lipids selected from the group consisting of: N-(carbonyl-methoxypolyethylene glycol 2000)-1,2-distearoyl-sn-glycero-3-phosphoethanolamine sodium salt, (distearoyl-sn-glycero-phosphoethanolamine), MPEG (methoxypolyethylene glycol) conjugated lipids, HSPC (hydrogenated soybean phosphatidylcholine); PEG (polyethylene glycol); DSPE (distearoyl-sn-glycero-phosphoethanolamine); DSPC (distearoylphosphatidylcholine); DOPC (dioleoylphosphatidylcholine); DPPG (dipalmitoylphosphatidylcholine); glycerol); EPC (ovine phosphatidylcholine); DOPS (dioleoylphosphatidylserine); POPC (palmitoyloleoylphosphatidylcholine); SM (sphingomyelin); MPEG (methoxypolyethylene glycol); DMPC (dimyristoylphosphatidylcholine); DMPG (dimyristoylphosphatidylglycerol); DSPG (distearoylphosphatidylglycerol); DEPC (dieserucylphosphatidylcholine); DOPE (dioleoyl-sn...

Claims

1. A method for producing a linear single-stranded DNA (ssDNA) molecule comprising at least one nucleic acid sequence of interest flanked by at least one stem-loop structure comprising at least one stem and at least one loop at the 3′ end, the method comprising the following sequential steps: (a) contacting a double-stranded end-blocked DNA (ceDNA) molecule comprising the at least one nucleic acid sequence of interest with an endonuclease; (b) contacting the double-stranded ceDNA with an exonuclease, The linear ssDNA molecule is thereby produced.

2. The method of claim 1, wherein the ceDNA molecule further comprises at least one promoter.

3. The method of claim 2, wherein the promoter comprises a transcription start site (TSS).

4. The method according to any one of claims 1 to 3, wherein the ceDNA molecule further comprises at least one enhancer.

5. The method according to any one of claims 2 to 4, wherein the promoter is double-stranded in the ssDNA molecule.

6. The method of any one of claims 3 to 5, wherein the TSS is double-stranded in the ssDNA molecule.

7. The method of any one of claims 4 to 6, wherein the enhancer is double-stranded in the ssDNA molecule.

8. The method according to any one of claims 1 to 7, wherein the ssDNA molecule further comprises at least one stem-loop structure comprising at least one stem and a loop at the 5' end.

9. The method according to any one of claims 1 to 8, wherein the at least one stem-loop structure at the 3' end comprises at least two stem-loop structures, and / or wherein the at least one stem-loop structure at the 5' end comprises at least two stem-loop structures.

10. The method according to any one of claims 1 to 9, wherein the ceDNA molecule comprises one or more endonuclease recognition sequences. 11 . The method according to claim 1 , wherein the stem-loop structure at the 3′ end comprises one or more endonuclease recognition sequences. 12 . The method according to claim 8 , wherein the stem-loop structure at the 5′ end comprises one or more endonuclease recognition sequences.

13. The method according to any one of claims 10 to 12, wherein the one or more nuclease recognition sequences are selected from the group consisting of: 5'-CCAA-3'(Nb.BtsI)(Nb.BsrDI)(Nt.CviPII), 5'-CCAAGC-3'(Nb.BbvCI), 5'-CCAACC-3'(Nb.BbvCI), 5'-CCAAGAGTCNNNN-3'(Nt.BstNBI) -N can be A, G, C or T, 5'-CCAAG-3'(Nb.BsmI), 5'-CCAAC-3'(Nb.BssSI), 5'-CCAAGGATCNNNN-3'(Nt.AlwI), CCAAGTCTCN-3'(Nt.BsmAI) and CCAAGCTCTTCN-3'(Nt.BspQI).

14. The method according to any one of claims 1 to 13, wherein the terminal residues of the stem-loop structure at the 3' end are capable of initiating replication and / or transcription inside the nucleus of a host cell.

15. The method of claim 14, wherein the 3' terminal residue comprises a free -OH group.

16. The method according to any one of claims 1 to 15, wherein contacting the double-stranded ceDNA molecule with the nuclease generates one or more nicks in the sense strand of the nucleic acid sequence of interest, thereby generating a nicked ceDNA molecule.

17. The method of claim 16, wherein the one or more nicks in the sense strand of the nucleic acid sequence of interest are located 5' upstream of the nucleic acid sequence of interest, within the nucleic acid sequence of interest, and / or 3' upstream of the nucleic acid sequence of interest.

18. The method of any one of claims 16 to 17, wherein the one or more nick nicks in the sense strand of the nucleic acid sequence of interest are located 5' upstream of the nucleic acid sequence of interest.

19. The method of any one of claims 16 to 18, wherein the one or more nick nicks in the sense strand of the nucleic acid sequence of interest are located 3' downstream of the nucleic acid sequence of interest.

20. The method of any one of claims 16 to 19, wherein the one or more nick nicks in the sense strand of the nucleic acid sequence of interest are located within the nucleic acid sequence of interest.

21. The method of any one of claims 1 to 20, wherein the sense strand further comprises at least one phosphorothioate (PS) modified nucleotide downstream of the expression cassette.

22. The method of any one of claims 1 to 21, wherein the sense strand further comprises at least 2 PS-modified nucleotides downstream of the expression cassette.

23. The method of any one of claims 1 to 22, wherein the sense strand further comprises at least 3 PS-modified nucleotides downstream of the expression cassette.

24. The method of any one of claims 1 to 23, wherein the sense strand further comprises at least 4 PS-modified nucleotides downstream of the expression cassette.

25. The method of any one of claims 1 to 24, wherein the sense strand further comprises at least 5 PS-modified nucleotides downstream of the expression cassette.

26. The method of any one of claims 1 to 25, wherein the sense strand further comprises at least one phosphorothioate (PS) modified nucleotide upstream of the expression cassette.

27. The method of any one of claims 1 to 26, wherein the sense strand further comprises at least 2 PS modified nucleotides upstream of the expression cassette.

28. The method of any one of claims 1 to 27, wherein the sense strand further comprises at least 3 PS-modified nucleotides upstream of the expression cassette.

29. The method of any one of claims 1 to 28, wherein the sense strand further comprises at least 4 PS-modified nucleotides upstream of the expression cassette.

30. The method of any one of claims 1 to 29, wherein the sense strand further comprises at least 5 PS modified nucleotides upstream of the expression cassette.

31. The method of any one of claims 1 to 30, wherein contacting the nicked ceDNA molecule with an exonuclease produces an extension of single-stranded DNA (ssDNA) corresponding to the nucleic acid sequence of interest in the double-stranded ceDNA molecule.

32. The method of any one of claims 1 to 31, wherein the endonuclease is a Type II restriction enzyme.

33. The method of any one of claims 1 to 32, wherein the endonuclease is selected from the group consisting of: Nb.BtsI, Nb.BsrDI, Nt.CviPII, Nb.BbvC1, Nt.BbvCI, Nt.BstNBI, Nb.BsmI, Nb.BssSI, Nt.AlwI, Nt.BsmA1, Nt.BspQI and Endonuclease V (Endo V).

34. The method of any one of claims 32 to 33, wherein the Type II restriction enzyme is Nb.BbvCI.

35. The method of any one of claims 32 to 33, wherein the endonuclease is Endo V.

36. The method of any one of claims 1 to 35, wherein the double-stranded ceDNA molecule comprises at least one deoxyinosine residue.

37. The method of claim 36, wherein the deoxyinosine residue is present in the at least one stem-loop structure at the 3' end, two bases upstream of the desired nicking site.

38. The method of any one of claims 1 to 37, wherein the double-stranded ceDNA molecule comprises at least one uridine-, inosine-, xanthosine- and / or oxanosine-containing residue that is nicked by the endonuclease, wherein the endonuclease has enzymatic activity towards the uridine-, inosine-, xanthosine- and / or oxanosine-containing residue.

39. The method of any one of claims 36 to 38, wherein the endonuclease nicks the DNA at the second phosphodiester bond 3' to a uridine, inosine, xanthosine and / or oxanosine containing residue.

40. The method of any one of claims 1 to 39, wherein the exonuclease is T7 exonuclease.

41. The method of any one of claims 1 to 39, wherein the exonuclease is exonuclease III (Exo III).

42. The method according to any one of claims 1 to 41, further comprising the steps of: (1) performing rolling circle amplification (RCA) using double-stranded DNA (dsDNA) molecules, thereby generating intermediate dsDNA molecules; and (2) using the intermediate dsDNA molecule to perform cell-free enzymatic synthesis, thereby producing the ceDNA molecule, Wherein steps (1) and (2) are performed before steps (a) and (b).

43. The method according to claim 42, further comprising the steps of: (3) Purifying the ceDNA molecule after step (2) and before step (a).

44. The method according to any one of claims 42 to 43, wherein the RCA step (1) comprises the following steps: (i) contacting the dsDNA molecule with a primer and a DNA polymerase.

45. The method according to any one of claims 42 to 44, wherein step (2) comprises the following steps: (i) contacting the intermediate dsDNA molecule with a restriction endonuclease to produce a cleaved intermediate dsDNA molecule, (ii) contacting the cleaved intermediate dsDNA molecule with an oligonucleotide comprising an end that is compatible with at least one end of the cleaved intermediate dsDNA molecule and a ligase.

46. ​​The method of claim 45, wherein step (ii) further comprises contacting the cleaved intermediate dsDNA molecule with at least two oligonucleotides, each of the at least two oligonucleotides comprising an end that is compatible with at least one end of the cleaved intermediate dsDNA molecule.

47. The method of claim 46, wherein each of the at least two oligonucleotides comprises the same end.

48. The method of claim 46, wherein each of the at least two oligonucleotides comprises a different end.

49. The method of any one of claims 46 to 47, wherein the at least two oligonucleotides are identical.

50. The method of any one of claims 46 or 48, wherein the at least two oligonucleotides are different.

51. The method according to any one of claims 45 to 50, wherein step (2) further comprises the following steps: (iii) ligating at least one oligonucleotide to the cleaved dsDNA intermediate.

52. The method of any one of claims 1 to 51, wherein the at least one stem at the 3' end comprises a partial DNA duplex of 4-500 nucleotides.

53. The method of any one of claims 1 to 52, wherein the at least one stem at the 3' end comprises a partial DNA duplex of 4-5 nucleotides.

54. The method of any one of claims 8 to 53, wherein the at least one stem at the 5' end comprises a partial DNA duplex of 4-500 nucleotides.

55. The method of any one of claims 8 to 54, wherein the at least one stem at the 5' end comprises a partial DNA duplex of 4-5 nucleotides.

56. The method of any one of claims 1 to 55, wherein the at least one loop at the 3' end comprises 3-500 unbound nucleotides.

57. The method of any one of claims 1 to 56, wherein the at least one loop at the 3' end comprises a minimum of 3 unbound nucleotides.

58. The method of any one of claims 8 to 57, wherein the at least one loop at the 5' end comprises 3-500 unbound nucleotides.

59. The method of any one of claims 8 to 58, wherein the at least one loop at the 5' end comprises a minimum of 3 unbound nucleotides.

60. The method of any one of claims 1 to 59, wherein the ssDNA comprises at least two stem-loop structures at the 3' end.

61. The method of any one of claims 1 to 60, wherein the ssDNA comprises at least three stem-loop structures at the 3' end.

62. The method of any one of claims 1 to 61, wherein the ssDNA comprises at least four or more stem-loop structures at the 3' end.

63. The method of any one of claims 1 to 62, wherein the ssDNA comprises at least two stem-loop structures at the 3' end.

64. The method of any one of claims 1 to 63, wherein the ssDNA comprises at least three stem-loop structures at the 3' end.

65. The method of any one of claims 1 to 64, wherein the ssDNA comprises at least four or more stem-loop structures at the 3' end.

66. The method of any one of claims 8 to 65, wherein the ssDNA comprises at least one bubble structure at the 5' end.

67. The method of any one of claims 8 to 66, wherein the ssDNA comprises at least two stem-loop structures at the 5' end.

68. The method of any one of claims 8 to 67, wherein the ssDNA comprises at least three stem-loop structures at the 5' end.

69. The method of any one of claims 8 to 68, wherein the ssDNA comprises at least four or more stem-loop structures at the 5' end.

70. The method of any one of claims 1 to 69, wherein the at least one stem-loop structure at the 3' end comprises a hairpin DNA structure.

71. The method of any one of claims 1 to 70, wherein the at least one stem-loop structure at the 3' end comprises a DNA structure selected from the group consisting of a cruciform DNA structure, a hammerhead DNA structure, a quadruplex DNA structure, a bulge DNA structure, a multi-branched loop structure, and a bubble structure.

72. The method of any one of claims 1 to 71, wherein the at least one stem-loop structure at the 3' end does not comprise an A or A' region as would be present in a wild-type AAV ITR.

73. The method of any one of claims 1 to 72, wherein the at least one stem-loop structure at the 3' end does not comprise an A, A', D, or D' region that would be present in a wild-type AAV ITR.

74. The method of any one of claims 1 to 73, wherein the at least one stem-loop structure at the 3' end does not comprise an A, A', B, B', C, C', D, or D' region as would be present in a wild-type AAV ITR.

75. The method of any one of claims 8 to 74, wherein the at least one stem-loop structure at the 5' end does not comprise an A or A' region as would be present in a wild-type AAV ITR.

76. The method of any one of claims 8 to 75, wherein the at least one stem-loop structure at the 5' end does not comprise an A, A', D, or D' region that would be present in a wild-type AAV ITR.

77. The method of any one of claims 8 to 76, wherein the at least one stem-loop structure at the 5' end does not comprise an A, A', B, B', C, C', D or D' region as would be present in a wild-type AAV ITR.

78. The method of any one of claims 1 to 77, wherein the at least one stem-loop structure at the 3' end does not comprise a rep binding element (RBE) that would be present in a wild-type AAV ITR.

79. The method of any one of claims 1 to 78, wherein the at least one stem-loop structure at the 3' end does not comprise a terminal resolution site (trs) that would be present in a wild-type AAV ITR.

80. The method of any one of claims 8 to 79, wherein the at least one stem-loop structure at the 5' end does not comprise a rep binding element (RBE) that would be present in a wild-type AAV ITR.

81. The method of any one of claims 8 to 80, wherein the at least one stem-loop structure at the 5' end does not comprise a terminal resolution site (trs) that would be present in a wild-type AAV ITR.

82. The method of any one of claims 1 to 81, wherein the ssDNA molecule does not comprise any viral-derived sequences.

83. The method of any one of claims 1 to 82, wherein the at least one stem-loop structure at the 3' end comprises one or more nucleotides modified to be exonuclease-resistant.

84. The method of claim 83, wherein the nucleotides modified to be resistant to nuclease exonucleases are selected from the group consisting of phosphorothioate-modified nucleotides, locked nucleic acid (LNA)-modified nucleotides, 2′-O-methyl (m)-modified nucleotides, 2′-O-methoxyethyl (E)-modified nucleotides, 2′-fluoro (F)-modified nucleotides, and combinations thereof.

85. The method of any one of claims 1 to 84, wherein the at least one stem-loop structure at the 3' end and / or the at least one stem-loop structure at the 5' end each independently comprises a functional moiety.

86. The method of any one of claims 8 to 85, wherein the at least one stem-loop structure at the 5' end comprises a hairpin DNA structure.

87. The method of any one of claims 8 to 86, wherein the at least one stem-loop structure at the 5′ end comprises a DNA structure selected from the group consisting of a cruciform DNA structure, a hammerhead DNA structure, a quadruplex DNA structure, a bulge DNA structure, a multi-branched loop structure, and a bubble structure.

88. The method of any one of claims 8 to 87, wherein the stem structure at the 5' end comprises one or more nucleotides modified to be exonuclease-resistant.

89. The method of claim 88, wherein the nucleotides modified to be exonuclease-resistant are PS-modified nucleotides.

90. The method of any one of claims 8 to 89, wherein the at least one loop structure at the 5' end further comprises one or more nucleic acids to stabilize the end.

91. The method of any one of claims 8 to 90, wherein the at least one loop structure at the 5' end further comprises one or more chemically modified nucleic acids.

92. The method of any one of claims 36 to 91, wherein the deoxyinosine residue is present at position -1i, -2i, -5i, or -7i relative to SEQ ID NO:

7.

93. The method of any one of claims 36 to 92, wherein the deoxyinosine residue is present at position -1i or -7i relative to SEQ ID NO:

7.

94. The method of any one of claims 1 to 93, wherein the ssDNA molecule is capable of being transported across the nuclear membrane from the cytosol into the nucleus of the host cell.

95. The method of any one of claims 1 to 94, wherein the ssDNA molecule further comprises at least one functional moiety.

96. The method of any one of claims 1 to 94, wherein the at least one stem-loop structure at the 3' end comprises at least one functional moiety.

97. The method of any one of claims 8 to 96, wherein the at least one stem-loop structure at the 5' end comprises at least one functional moiety.

98. The method of any one of claims 95 to 97, wherein the at least one functional moiety is an aptamer.

99. The method of any one of claims 8 to 98, wherein the loop at the 5' end and / or the 3' end further comprises one or more aptamers.

100. The method of any one of claims 98 to 99, wherein the aptamer is encoded in the ceDNA molecule, and wherein the aptamer forms a secondary aptamer structure in the ssDNA molecule.

101. The method of any one of claims 98 to 100, wherein the aptamer is a CH4-1 aptamer.

102. The method of any one of claims 1 to 101, wherein the at least one loop at the 3' end and / or the 5' end further comprises one or more synthetic ribozymes.

103. The method of any one of claims 101 to 102, wherein the at least one loop at the 3' end and / or the 5' end further comprises one or more antisense oligonucleotides (ASOs).

104. The method of any one of claims 1 to 103, wherein the at least one loop at the 3' end and / or the 5' end further comprises one or more short interfering RNAs (siRNAs).

105. The method of any one of claims 1 to 104, wherein the at least one loop at the 3' end and / or the 5' end further comprises one or more antiviral nucleoside analogs (ANAs).

106. The method of any one of claims 1 to 105, wherein the at least one loop at the 3' end and / or the 5' end further comprises one or more triplex-forming oligonucleotides.

107. The method of any one of claims 1 to 106, wherein the at least one loop at the 3' end and / or the 5' end further comprises one or more gRNAs or gDNAs.

108. The method of any one of claims 1 to 107, wherein the at least one loop at the 3' end and / or the 5' end further comprises one or more molecular probes.

109. The method of any one of claims 1 to 108, wherein the ssDNA molecule lacks any viral capsid protein coding sequence.

110. The method of any one of claims 1 to 109, wherein the ssDNA molecule comprises a first ITR and a second ITR, and wherein the ITRs do not comprise any viral-derived sequences.

111. The method of any one of claims 1 to 110, wherein the ssDNA molecule does not comprise any viral-derived sequences.

112. The method of any one of claims 1 to 111, wherein the ssDNA molecule comprises a first ITR and a second ITR, and wherein the ITRs are synthetic.

113. The method of any one of claims 1 to 112, wherein the ssDNA molecule is synthetically produced in vitro.

114. The method of any one of claims 1 to 113, wherein the ssDNA molecule is synthetically produced in vitro in a cell-free environment.

115. The method of any one of claims 1 to 114, wherein the ssDNA molecule does not activate or minimally activates an immune pathway.

116. The method of claim 115, wherein the immune pathway is an innate immune pathway.

117. The method of any one of claims 115 to 116, wherein the immune pathway is an innate immune pathway selected from the group consisting of a cGAS / STING pathway, a TLR9 pathway, an inflammasome-mediated pathway, and combinations thereof.

118. The method of any one of claims 1 to 117, wherein the nucleic acid sequence of interest is a therapeutic protein or a therapeutic fragment thereof.

119. The method of claim 118, wherein the at least one therapeutic protein is selected from the group consisting of an antibody, an enzyme, a coagulation factor, a transcription factor, a replication factor, a growth factor, a hormone, and a fusion protein.

120. The method of any one of claims 118 to 119, wherein the at least one therapeutic protein is useful for treating a genetic disorder selected from the group consisting of melanoma, hemophilia A (factor VIII (FVIII) deficiency) and hemophilia B (factor IX (FIX) deficiency), cystic fibrosis (CFTR), familial hypercholesterolemia (LDL receptor deficiency), hepatoblastoma, Wilson disease, phenylketonuria (PKU), congenital hepatic porphyria, inherited disorders of liver metabolism, Lesch Nyhan syndrome, sickle cell anemia, thalassemia, xeroderma pigmentosum, Fanconi's anemia, retinitis pigmentosa, ataxia telangiectasia, Bloom's syndrome, retinoblastoma, mucopolysaccharidoses (e.g.,Hurler syndrome (MPS type I), Scheie syndrome (MPS type IS), Hurler-Scheie syndrome (MPS type I HS), Hunter syndrome (MPS type II), Sanfilippo types A, B, C, and D (MPS types III A, B, C, and D), Morquio types A and B (MPS IVA and MPS IVB), Maroteaux-Lamy syndrome (MPS type VI), Sly syndrome (MPS type VII), Hyaluronidase deficiency (MPS type IX), Niemann-Pick disease types A / B, C1, and C2, Fabry disease, Schindler disease, GM2-ganglioside type II (Sandhoff disease), Disease), Tay-Sachs disease, metachromatic leukodystrophy, Krabbe disease, mucolipidosis types I, II / III, and IV, sialidosis types I and II, glycogen storage disease types I and II (Pompe disease), Gaucher disease types I, II, and III, Fabry disease, cystinosis, Batten disease, aspartylglucosaminuria, Salladisease, Danon disease (LAMP-2 deficiency), lysosomal acid lipase (LAL) deficiency, neuronal ceroid lipofuscinosis (CLN1-8, INCL, and LINCL), sphingolipidoses, galactosialidosis, amyotrophic lateral sclerosis (ALS), Parkinson's disease, Alzheimer's disease disease), Huntington's disease, spinocerebellar ataxia, spinal muscular atrophy, Friedreich's ataxia, Duchenne muscular dystrophy (DMD), Becker muscular dystrophy (BMD), dystrophic epidermolysis bullosa (DEB), ectonucleotide pyrophosphatase 1 deficiency, systemic arterial calcification of infancy (GACI), Leber congenital amaurosis, Stargardt macular dystrophy (ABCA4), ornithine transcarbamylase (OTC) deficiency, Usher syndrome, alpha-1 antitrypsin deficiency, progressive familial intrahepatic cholestasis (PFIC) type I (ATP8B1 deficiency), type II (ABCB11), type III (ABCB4), or type IV (TJP2), and cathepsin A deficiency.

121. A linear single-stranded DNA (ssDNA) molecule comprising at least one nucleic acid sequence of interest flanked by at least one stem-loop structure at the 3' end produced by the method of any one of claims 1 to 120.

122. A lipid nanoparticle comprising the ssDNA molecule of claim 121 and a lipid.

123. A pharmaceutical composition comprising the ssDNA molecule of claim 121 or the lipid nanoparticle composition of claim 122 and a pharmaceutically acceptable excipient.

124. A host cell comprising the ssDNA molecule of claim 121 or the lipid nanoparticle of claim 122.

125. A method of treating a genetic disorder in a subject, the method comprising administering to the subject a therapeutically effective amount of the ssDNA molecule of claim 121, the lipid nanoparticle of claim 122, or the pharmaceutical composition of claim 123.

126. A method of delivering a therapeutic gene and / or therapeutic protein to a subject, the method comprising administering to the subject a therapeutically effective amount of the ssDNA molecule of claim 121, the lipid nanoparticle of claim 122, or the pharmaceutical composition of claim 123.

127. A method for delivering a therapeutic gene and / or therapeutic protein to a cell, the method comprising contacting the cell with the ssDNA molecule according to claim 121, the lipid nanoparticle according to claim 122, or the pharmaceutical composition according to claim 123, thereby delivering the therapeutic gene and / or therapeutic protein to the cell.

128. A method for delivering a therapeutic gene to a cell nucleus, the method comprising contacting the cell with the ssDNA molecule of claim 121, the lipid nanoparticle of claim 122, or the pharmaceutical composition of claim 123, thereby delivering the therapeutic gene and / or therapeutic protein to the cell nucleus.

129. A method of minimizing an immune response in a subject, wherein the subject is being treated with a therapeutic gene or therapeutic protein, the method comprising administering to the subject a therapeutically effective amount of the ssDNA molecule of claim 121, the lipid nanoparticle of claim 122, or the pharmaceutical composition of claim 123, wherein the nucleic acid of interest encodes the therapeutic gene or therapeutic protein.

Images