Application of dsRNA targeting to Tollip gene of tetranychus urticae to prevention and treatment of tetranychus urticae

By targeting the dsRNA silencing of the Tollip gene of the two-spotted spider mite, the problem of the two-spotted spider mite's high tolerance to Beauveria bassiana was solved, the control effect of Beauveria bassiana was improved, and a precise and environmentally friendly control method was achieved.

CN120648684APending Publication Date: 2025-09-16SOUTHWEST UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510698629.6
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-05-28
Publication Date
2025-09-16

AI Technical Summary

Technical Problem

The two-spotted spider mite has a high tolerance to Beauveria bassiana. Existing biological control methods, such as Beauveria bassiana spraying strategies, are limited by environmental conditions and lack precise targeting, resulting in poor control effects.

Method used

RNAi technology is used to target the Tollip gene of the two-spotted spider mite. By designing and delivering dsRNA, the Tollip gene is silenced to reduce the tolerance of the two-spotted spider mite to Beauveria bassiana. Targeted silencing is achieved by delivering dsRNA in combination with leaf feeding.

Benefits of technology

It significantly increased the mortality rate of Beauveria bassiana to Tetranychus urticae, reduced the tolerance of Tetranychus urticae to Beauveria bassiana, enhanced the prevention and control effect, and reduced the dependence on chemical pesticides.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120648684A_ABST
    Figure CN120648684A_ABST
Patent Text Reader

Abstract

The invention relates to the technical field of prevention and control of tetranychus urticae, in particular to application of dsRNA targeting a Tollip gene of the tetranychus urticae to prevention and control of the tetranychus urticae. According to the dsRNA targeting the Tollip gene of the tetranychus urticae, disclosed by the invention, the dsRNA is a nucleotide sequence as shown in SEQ ID NO: 1. The dsRNA fragment is delivered into the tetranychus urticae through a leaf feeding method, the silencing efficiency of the target Tollip gene is high, and the dsRNA specifically targeted to the Tollip gene of the tetranychus urticae can remarkably reduce the tolerance of the tetranychus urticae to beauveria bassiana and improve the lethal effect of the beauveria bassiana on the dsRNA. The dsRNA provided by the invention is high in practicability and good in effect.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of control of spider mites, and in particular to the application of dsRNA targeting the Tollip gene of spider mites in control of spider mites. Background Art

[0002] The two-spotted spider mite, Tetranychus urticae Koch, is a worldwide pest mite that infests over 1,000 plant species across more than 250 families and is a pest of numerous vegetables and cash crops. Its high fecundity, inbreeding, asexual reproduction, and extremely short life cycle have led to a rapid increase in its resistance to chemical pesticides. Due to the rapid development of resistance to acaricides by spider mites and growing concerns about the environmental and health risks associated with pesticide use, the development of alternatives to chemical control has garnered widespread attention. Currently, research and development of biological control strategies for spider mites primarily focuses on the protection of natural enemies and the release of predatory mites. However, this approach is not sufficient, and field control of spider mites requires supplemental spraying with acaricides such as Beauveria bassiana.

[0003] Beauveria bassiana belongs to the phylum Ascomycota, order Hypocreales, family Cordyceps. As a broad-spectrum entomopathogenic fungus, Beauveria bassiana can host a variety of agricultural and forestry pests, including small piercing-sucking insects. Due to its strong pathogenicity, broad insecticide spectrum, low residue, and pollution-free properties, it has become a widely used biocontrol agent for agricultural and forestry pests. Due to its wide host range and ease of production, Beauveria bassiana is often used in the field as a flood-spraying strategy for pest control. However, a major drawback of using Beauveria bassiana in this strategy is that it requires suitable environmental conditions. Low humidity and high temperatures (which favor the two-spotted spider mite) are not conducive to its growth. Therefore, a green, pollution-free, and precisely targeted control method is needed to enhance the effectiveness of Beauveria bassiana against two-spotted spider mites.

[0004] RNA interference (RNAi) technology achieves targeted pest control by delivering double-stranded RNA (dsRNA) to specifically silence key genes in pests. It exploits the body's natural RNA degradation mechanism to inhibit target gene expression, disrupting the pest's response to the target gene and causing loss of normal physiological function. RNAi is highly targeted, environmentally friendly, and reduces reliance on chemical pesticides, making it widely used in agricultural pest, nematode, and fungus control.

[0005] By targeting the two-spotted spider mite immune gene Tollip through RNAi technology, we significantly reduced the two-spotted spider mite's tolerance to Beauveria bassiana and increased the mortality rate of Beauveria bassiana to two-spotted spider mites, which is of great significance for the control of two-spotted spider mites with Beauveria bassiana biocontrol agents. Summary of the Invention

[0006] The present invention aims to provide an application of the Tollip gene in reducing the tolerance of two-spotted spider mites to Beauveria bassiana, and to provide a method for accurately interfering with two-spotted spider mite immune genes and reducing the tolerance of two-spotted spider mites to Beauveria bassiana. The method targets the two-spotted spider mite immune gene Tollip through RNAi technology, significantly reduces the tolerance of two-spotted spider mites to Beauveria bassiana, and increases the mortality rate of Beauveria bassiana to two-spotted spider mites, which is of great significance for the control of two-spotted spider mites by Beauveria bassiana biocontrol agents.

[0007] In order to achieve the above object, the present invention adopts the following technical solutions:

[0008] A dsRNA targeting the Toll ip gene of Tetranychus urticae is used to enhance the control effect of Beauveria bassiana on Tetranychus urticae. The nucleotide sequence of the dsRNA is shown in SEQ ID NO: 1.

[0009] SEQ ID NO: 1dsTollip

[0010] TGGCAAACAAGGTGATGGTAAAGAAGGAACAATTTGTTTGATTCTTTCATTTGCACCCATTTCTAGATTGATTGGCCAACAACCACGATTAGCTTATGTAAATTTTAACCAGCAGCCACAGATGGTCATGCCTGTTAATCAACAAATAGTTCAACAGC AACAACCGCCAGTACAAGTTACCATCACGGAGGAAGAAGTTGACCAAATTCAAGAAATGTTTCCAAATGTTGACAGAGAGGTTATTAAAAGCATTTTGGAAGACCAAAATGGAAACAAGGAAAGAACAATCAATGCATTGATTCTGGTCAACAGCGAA

[0011] Furthermore, by silencing the Tollip gene of the two-spotted spider mite, the two-spotted spider mite's tolerance to Beauveria bassiana was reduced.

[0012] Furthermore, the dsRNA is delivered to the two-spotted spider mite by leaf feeding to achieve silencing of the target Tollip gene.

[0013] Furthermore, the dsRNA is prepared by the following steps:

[0014] Specific primers targeting the Tollip gene were designed. The upstream and downstream primer sequences were as follows:

[0015] Upstream primer: TAATACGACTCACTATAGGG TGGCAAACAAGGTGATGGTA;

[0016] Downstream primer: TAATACGACTCACTATAGGG TTCGCTGTTGACCAGAATCA;

[0017] Total RNA of Tetranychus urticae was extracted and reverse transcribed into cDNA;

[0018] Using cDNA as template, the Toll ip gene fragment was amplified by PCR;

[0019] dsRNA was synthesized by in vitro transcription and purified.

[0020] A composition for controlling spider mites, comprising a dsRNA having a nucleotide sequence as shown in SEQ ID NO: 1.

[0021] The present invention has at least the following beneficial effects:

[0022] The dsTollip proposed in the present invention can effectively promote the death of two-spotted spider mites, or reduce their tolerance to the biocontrol agent of Beauveria bassiana; it can accurately target the immune genes of two-spotted spider mites, reducing the potential harm to non-target species in actual production operations; it has a good silencing effect on the target Tollip, and its combined use with the biocontrol agent of Beauveria bassiana is low-cost, effective, and highly practical. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the following briefly introduces the drawings required for use in the description of the embodiments. Obviously, the drawings described below are some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0024] Figure 1 Schematic diagram of the leaf disc feeding of two-spotted spider mites;

[0025] Figure 2 is the experimental data of dsTollip interference efficiency;

[0026] Figure 3 The data are the survival rate experimental data of dsTollip two-spotted spider mite. DETAILED DESCRIPTION

[0027] In order to make the purpose, technical solutions and advantages of the present invention more clearly understood, the present invention will be further described in detail below with reference to the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not intended to limit the present invention.

[0028] Example 1

[0029] 1. Experimental Materials and Methods

[0030] 1. Two-spotted spider mite test strain

[0031] Two-spotted spider mites were provided by the Laboratory of Biological Pest Control and Ecological Control at Southwest University. They feed on cowpea seedlings and are maintained in an artificial climate chamber at 25 ± 1°C, 70–80% relative humidity, and a 14 L:10 D photoperiod. To maintain a centralized culture, the mites were placed in a metal tray planted with cowpea seedlings and surrounded by mosquito netting to prevent escape and contamination by other mites. The cowpea seedlings were watered every 1.5 days, and the growth of the mites was observed.

[0032] 2 Experimental strains

[0033] Beauveria bassiana (Bb025) was provided by the Biotechnology Center of Southwest University and cultured in PDA medium for 15 days until a large amount of spore powder was grown. The mycelium was then gently scraped off with a sterile blade and placed in a 50 mL conical flask. An appropriate amount of 0.05% sterile Tween 80 was added. The flask was wrapped with sealing film and thoroughly mixed on a vortex oscillator to disperse the spores. The suspension was then filtered through three layers of sterile gauze to obtain a suspension of Beauveria bassiana spores. The concentration of the suspension was calculated using a hemocytometer to be 1 × 10 7 spores / ml and stored at 4°C.

[0034] 3 Main reagents

[0035]

[0036]

[0037] 4 Main instruments

[0038]

[0039] 5 Experimental methods

[0040] 5.1 RNAi Primer Design

[0041] According to the data of the two-spotted spider mite gene bank in NCBI (www.ncbi.nlm.nih.gov), the gene sequence of the two-spotted spider mite immune gene Toll ip and the green fluorescent protein (GFP) gene were screened and the primers were designed using the online primer design software Primer3 ( http: / / bioinfo.ut.ee / primer3–0.4.0 / ) and Prmimer 5 were used to design RT-qPCR primers, which were then synthesized by Sangon Biotech (Shanghai) Co., Ltd., and a T7 promoter sequence (in bold) was added to the 5' end of the RNAi primer.

[0042] The dsTollip snippet is as follows:

[0043]

[0044] Table 1 Primer sequences

[0045]

[0046] 5.2 Total RNA extraction from Tetranychus urticae (Trizol method)

[0047] After collecting the samples, remove them from the -80°C freezer and refreeze them with liquid nitrogen. Shake the spider mites off the tube walls into the bottom of a 1.5ml centrifuge tube. Add 200μL of TRIzol lysis buffer to each sample. Homogenize the spider mites in a 1.5mL centrifuge tube using an electric motor and a plastic pestle. Grind until the spider mite tissue is completely lysed. Extract total RNA from the samples in a clean bench according to the TRIzol kit instructions. The specific steps are as follows:

[0048] (1) Add 800 μL of TRIzol lysis buffer to the ground sample mixture, cover the lid and invert to mix thoroughly.

[0049] (2) Add 200 μL of chloroform, shake vigorously for 15 seconds using a vortexer to mix thoroughly, incubate at room temperature for 5 minutes, and then centrifuge at 12,000 g and 4°C for 15 minutes; tilt the centrifuge tube to 45°, and use 200 μL and 100 μL pipettes to aspirate the aqueous phase into a new centrifuge tube, trying to avoid aspirating the mixed phase or organic layer during this process;

[0050] (3) Add 500 μL of isopropanol to the previously removed aqueous phase, incubate at room temperature for 10 min, and then centrifuge at 12,000 g for 10 min at 4°C. Discard the supernatant and retain the RNA precipitate.

[0051] (4) Add 1 mL of 75% alcohol, gently shake to mix, and then centrifuge at 7500 g for 5 min at 4°C. Discard the supernatant.

[0052] (5) First use a 100uL pipette to absorb the alcohol at the bottom, centrifuge briefly at low speed, and then use a 10uL pipette to completely absorb the alcohol at the bottom (do not let the RNA dry completely, as this will cause it to lose its solubility, and the A260 / 280 of partially dissolved RNA is <1.6)

[0053] (6) Add 20-50 μL of nuclease-free water according to the RNA precipitate and use a pipette to repeatedly pipette to dissolve the RNA precipitate;

[0054] (7) Take 2uL and measure its concentration on a nucleic acid concentration meter; then take 3-6uL according to the concentration and perform electrophoresis to confirm its integrity.

[0055] (8) After the experiment, the qualified RNA solution was stored in a -80℃ ultra-low temperature refrigerator for subsequent reverse transcription and cDNA synthesis.

[0056] 5.3 De-genome

[0057] Remove the RNA solution that meets the extraction quality standards and use Promega's RQ1 RNAse-free DNase kit to remove genomic DNA from the total RNA sample. This should be done on a clean bench. The specific steps are as follows:

[0058] Add the following reagents in sequence to a 200 μL RNAse-free PCR tube to make a total volume of 1 μL.

[0059] Table 2 Genome removal reaction system

[0060]

[0061] (1) The solution was shaken and mixed, centrifuged, and incubated at 37°C for 30 min;

[0062] (2) Add 1 μl of stop solution to terminate the reaction; shake, mix, and centrifuge. (3) Inactivate the DNase at 65°C for 10 min.

[0063] (4) Take all the genome-free RNA and perform reverse transcription.

[0064] 5.4 Reverse Transcription (First-Strand cDNA Synthesis)

[0065] First-strand cDNA is mainly used for amplification of intermediate gene fragments. It is synthesized by reverse transcription using TaKaRa's Prime ScriptTM RTReagent Kit Perfect Real Time. This needs to be done on a clean bench. The specific steps are as follows:

[0066] (1) Add the following reagents in sequence to a 200 μL RNAse-free PCR tube to make a total volume of 20 μL.

[0067] Table 3 Reverse transcription reaction system

[0068]

[0069]

[0070] (2) The mixture was shaken and centrifuged, and then placed in a PCR instrument at 37°C for 30 minutes;

[0071] Then react at 85°C for 5 seconds.

[0072] (3) After the reaction is complete, 20 μL of the mixture is the cDNA synthesized by reverse transcription. Take 2 μL to measure the concentration of the cDNA and dilute it with RNAse-free water to ensure that the concentration of the solution is between 400–600 ng / μL. Store it in a refrigerator at –20°C.

[0073] Using the two-spotted spider mite cDNA obtained in the quantitative analysis as a template, PCR amplification was performed according to Table 4 using specific primers containing T7 promoter.

[0074] Table 4 Conventional PCR reaction system

[0075]

[0076] Table 5 Conventional PCR reaction system

[0077]

[0078]

[0079] After amplification, the amplified product is detected by agarose gel electrophoresis. The electrophoresis pattern determines whether the amplified fragment is approximately 200 bp, allowing for the next step of the experiment. After amplifying the corresponding DNA fragment, the fragment is cloned and linked to Promega's pGEMT Easy vector. Once the link is successful, the linked product is transformed with competent Trans5α and the concentration is increased to obtain a bacterial solution. 200 μL of the bacterial solution that has successfully tested the bacteria is taken for testing. The positive bacteria that have been sequenced accurately are cultured and the recombinant plasmid is extracted. Using the recombinant plasmid as a template, a high-concentration DNA fragment containing the T7 promoter is amplified. The PCR product is purified and recovered to serve as the DNA template for dsRNA synthesis.

[0080] 5.5dsRNA Synthesis

[0081] The DNA template purified and recovered in the previous step was used to synthesize dsRNA. The synthesis reaction system was 20uL, as follows:

[0082] Table 6 dsRNA synthesis reaction system

[0083]

[0084] Mix well and react at 37°C for 6-8h (top cover temperature 60°C). White flocs will be visible after the reaction.

[0085] 5.6 Purification and dilution of dsRNA

[0086] The synthesized dsRNA was purified according to the instructions of the Transcript Aid T7 High Yield Transcription Kit.

[0087] (1) Add 2 μL of DNase to the obtained dsRNA product and place it in a PCR instrument at 37°C for 15 minutes. After the reaction, add 2 μL of ETA and react at 65°C for 10 minutes.

[0088] (2) Transfer the reaction solution to a 1.5 mL enzyme-free centrifuge tube, add 115 μL of nuclease-free water and 15 μL of Sodium Acetate Solution, and mix well.

[0089] (3) Add 150 μL of water-saturated phenol / chloroform mixture (75 μL each) and then add 300 μL of chloroform, and mix well on a vortex shaker.

[0090] (4) Centrifuge at 12000g for 10 min at 4°C. Transfer the supernatant to a new 1.5 mL enzyme-free centrifuge tube, add 350 μL of anhydrous ethanol, mix well, and freeze at -20°C for at least 2 h.

[0091] (5) After completion, centrifuge at 12000g at 4°C for 10 min in a low-temperature high-speed centrifuge, discard the supernatant, and add 500 μL of ice-cold 70% ethanol solution.

[0092] (6) Centrifuge at 75,000 g for 5 min at 4°C, discard the supernatant, remove residual ethanol, and air-dry at room temperature for 5 min.

[0093] (7) Add 50 μL of nuclease-free water and mix thoroughly by pipetting to dissolve the precipitate.

[0094] (8) Take 1 μL and dilute it 10 times before performing gel electrophoresis to check the quality. Take 2 μL to determine the concentration. The remaining dsRNA should be frozen at -80°C for future use.

[0095] 5.7ds Tollip feeding and testing of the tolerance of Tetranychus urticae to Beauveria bassiana

[0096] 1. Preparation of interfering solution

[0097] Dilute dsRNA to a concentration of 1000 ng / μL in interfering buffer. Prepare fresh and keep on ice to prevent dsRNA degradation. Prepare dsGFP at the same dilution concentration as a control group.

[0098] 2. Interference feeding method of Tollip two-spotted spider mite ( Figure 1 )

[0099] (1) Select adult female spider mites for interference experiments, place them in 2.0 ml centrifuge tubes (50 mites per tube), and starve them for 1 day.

[0100] (2) Cut fresh cowpea leaves into rectangles of approximately 3.5 cm in length, place them in a Petri dish, and dry them in a 60°C oven for 3-5 minutes. Once the leaves are slightly curled, place them face down in a Petri dish containing 500 ng / ul of dsRNA (20-30 ul of dsRNA per leaf). Seal the edges of the leaves evenly with 10 ul of dsRNA solution and let them stand at room temperature for 3-5 hours to ensure that the leaves fully absorb the dsRNA. Use clean water as a blank control.

[0101] (3) Make leaf discs, place 4 treated cowpea leaves on each disc (with the back of the leaves facing up), select 30 starvation-treated spider mites and place them on the leaf surface, then place them in a greenhouse for 48 hours and finally collect them.

[0102] (4) Set up 4 biological replicates.

[0103] 2. Results and Analysis

[0104] Figure 2 In a study, dsRNA was delivered by leaf feeding to successfully silence the two-spotted spider mite immune gene Tollip, with a silencing efficiency of approximately 50%.

[0105] Figure 3 In a study published in the journal Nature Communications, silencing Tollip significantly reduced the survival rate of two-spotted spider mites by 15.93% nine days after infection with Beauveria bassiana. Therefore, the Tollip gene is an ideal RNAi target for combined control of two-spotted spider mites with Beauveria bassiana.

[0106] The above shows and describes the basic principles, main features, and advantages of the present invention. Those skilled in the art should understand that the present invention is not limited to the above embodiments. The above embodiments and descriptions merely illustrate the principles of the present invention. Various changes and modifications may be made to the present invention without departing from the spirit and scope of the present invention. Such changes and modifications are intended to fall within the scope of the present invention. The scope of protection claimed by the present invention is defined by the appended claims and their equivalents.

Claims

1. A use of a dsRNA targeting the Toll ip gene of Tetranychus urticae in enhancing the control effect of Beauveria bassiana on Tetranychus urticae, characterized in that: The nucleotide sequence of the dsRNA is shown in SEQ ID NO:

1.

2. The use according to claim 1, characterized in that By silencing the Tollip gene of the two-spotted spider mite, the two-spotted spider mite's tolerance to Beauveria bassiana is reduced.

3. The use according to claim 2, characterized in that The dsRNA is delivered to the two-spotted spider mite by leaf feeding to achieve silencing of the target Tollip gene.

4. The use according to claim 1, characterized in that The dsRNA was prepared by the following steps: Specific primers targeting the Tollip gene were designed. The upstream and downstream primer sequences were as follows: Upstream primer: TAATACGACTCACTATAGGG TGGCAAACAAGGTGATGGTA; Downstream primer: TAATACGACTCACTATAGGG TTCGCTGTTGACCAGAATCA; Total RNA of Tetranychus urticae was extracted and reverse transcribed into cDNA; Using cDNA as template, the Toll ip gene fragment was amplified by PCR; dsRNA was synthesized by in vitro transcription and purified.

5. A composition for controlling Tetranychus urticae, characterized in that: The composition includes a dsRNA having a nucleotide sequence as shown in SEQ ID NO: 1.