Primer probe composition and kit for detecting HER2 gene amplification and application of primer probe composition and kit

Abstract

The invention provides a primer probe composition and a kit for detecting HER2 gene amplification and application of the primer probe composition and the kit. The primer probe composition comprises a first primer with a nucleotide sequence as shown in SEQ ID NO: 1, a second primer with a nucleotide sequence as shown in SEQ ID NO: 2 and a first probe with a nucleotide sequence as shown in SEQ ID NO: 3. The use method is simple and rapid, is suitable for various types of to-be-detected samples, and also has good detection capability and excellent amplification efficiency for fragmented and low-content free DNA in the to-be-detected samples. Through detection, the primer probe composition also has high accuracy and high sensitivity, can continuously and dynamically detect the HER2 gene amplification condition in the HER2 targeted drug treatment process, and is used for guiding the treatment of patients.

Description

Technical Field

[0001] The present invention relates to the field of molecular biotechnology, and in particular to a primer-probe combination, a kit and applications thereof for detecting HER2 gene amplification. Background Art

[0002] The HER2 gene is a proto-oncogene located on the long arm of human chromosome 17. It encodes the human epidermal growth factor receptor-2 (HER2) transmembrane glycoprotein with receptor tyrosine kinase (PTK) activity. It is a member of the epidermal growth factor receptor family and needs to combine with other receptors in the family to form a heterodimer to exert its signal transduction function.

[0003] The HER2 gene is one of the most thoroughly studied genes in breast cancer to date. HER2 overexpression is not only associated with tumor development and progression, but also serves as an important clinical treatment monitoring and prognostic indicator, and a key target for the selection of targeted cancer therapy drugs. Studies have shown that HER2 overexpression occurs in cancers other than breast cancer, including gastric cancer. Therefore, accurately assessing HER2 overexpression is crucial for targeted therapy.

[0004] Currently, the main methods for detecting HER2 gene overexpression include next-generation sequencing (NGS), fluorescence in situ hybridization (FISH), immunohistochemistry (IHC), and digital PCR (dPCR). NGS can simultaneously analyze multiple samples, but it is costly, requires long experimental cycles, and involves complex data analysis. FISH offers high specificity, but it also requires long sample processing cycles and high costs, particularly due to the high price of probes, and the interpretation of results is subjective and specialized. IHC, while highly specific, struggles to provide accurate quantitative information on protein expression levels and is technically complex and time-consuming. dPCR, as a method capable of absolute nucleic acid quantification, is widely used in tumor detection and holds great promise for detecting gene overexpression, specifically gene amplification. Therefore, how to accurately and sensitively determine HER2 gene amplification using dPCR remains a pressing challenge for those skilled in the art. Summary of the Invention

[0005] The present invention provides a primer-probe combination and a kit for detecting HER2 gene amplification, which have high accuracy and high sensitivity and can continuously and dynamically detect HER2 gene amplification during HER2 targeted drug treatment to guide patient treatment.

[0006] The present invention provides an application of the primer-probe combination or the kit in detecting HER2 gene amplification.

[0007] The present invention provides a method for detecting HER2 gene amplification. Using a primer-probe combination or a kit, HER2 gene amplification can be detected quickly and conveniently through digital PCR technology. The method has good repeatability and reliability, and has the advantages of high accuracy, good sensitivity, and high specificity. Furthermore, the method requires a low amount of DNA sample, is independent of a standard curve, and can directly provide the absolute number of target DNA molecules, which is critical for accurately assessing HER2 gene amplification.

[0008] The present invention provides a primer-probe combination for detecting HER2 gene amplification, wherein the primer-probe combination comprises a first primer having a nucleotide sequence as shown in SEQ ID NO: 1, a second primer having a nucleotide sequence as shown in SEQ ID NO: 2, and a first probe having a nucleotide sequence as shown in SEQ ID NO: 3.

[0009] The primer-probe combination as described above, wherein the primer-probe combination further comprises an internal reference primer-probe combination for detecting amplification of an internal reference gene.

[0010] The primer-probe combination as described above, wherein the internal reference gene is the RPPH1 gene; the internal reference primer-probe combination includes a third primer whose nucleotide sequence is shown in SEQ ID NO: 4, a fourth primer whose nucleotide sequence is shown in SEQ ID NO: 5, and a second probe whose nucleotide sequence is shown in SEQ ID NO: 6.

[0011] The primer-probe combination as described above, wherein the nucleotide sequence of the first probe is labeled with a fluorescent group at the 5' end and a quencher group at the 3' end;

[0012] And / or, the 5' end of the nucleotide sequence of the second probe is labeled with a fluorescent group, and the 3' end is labeled with a quencher group.

[0013] The primer-probe combination as described above, wherein the fluorescent group is selected from at least one of FAM, HEX, ROX, CY5, and CY5.5;

[0014] And / or, the quenching group is selected from at least one of BHQ1, BHQ2, and BHQ3.

[0015] The present invention provides a kit for detecting HER2 gene amplification, which comprises a reagent for detecting HER2 gene amplification, and the reagent comprises the above-mentioned primer-probe combination.

[0016] The kit as described above, wherein, when the reagent is in liquid form, the reagent further comprises: at least one of water, dPCR buffer, dNTPs, dUTPs, DNA polymerase, UNG enzyme, reverse transcriptase, magnesium ions, and non-ionic surfactant;

[0017] When the reagent is in solid state, the reagent also includes a first freeze-dried component and a second freeze-dried component, the first freeze-dried component includes at least one of dNTPs, dUTPs, DNA polymerase, UNG enzyme, reverse transcriptase, magnesium ions, non-ionic surfactant, and pH regulator; the second freeze-dried component includes sorbitol, trehalose and mannitol.

[0018] The kit as described above, wherein, based on the total volume of the reagent, the second lyophilized component comprises 1%-8% (w / v) sorbitol, 1%-8% (w / v) trehalose and 1%-3% (w / v) mannitol.

[0019] The present invention provides an application of the primer-probe combination or the kit in detecting HER2 gene amplification.

[0020] The present invention provides a method for detecting HER2 gene amplification, which comprises the following steps:

[0021] Using the DNA of the sample to be tested as a template, digital PCR amplification is performed using the above-mentioned primer-probe combination or the above-mentioned kit to obtain a digital PCR amplification result;

[0022] The copy numbers of the HER2 gene and the internal reference gene were counted based on the digital PCR amplification results, and the ratio of the HER2 gene copy number to the internal reference gene copy number was calculated. The ratio was used to determine whether gene amplification occurred.

[0023] As described above, the method of determining whether gene amplification occurs according to the ratio includes: when the ratio of the HER2 gene copy number to the internal reference gene copy number is less than 1.5, determining that the HER2 gene is not amplified; when the ratio of the HER2 gene copy number to the internal reference gene copy number is greater than or equal to 1.5, determining that the HER2 gene is amplified.

[0024] The present invention provides a primer-probe composition for detecting HER2 gene amplification, the primer-probe composition comprising a first primer having a nucleotide sequence as shown in SEQ ID NO: 1, a second primer having a nucleotide sequence as shown in SEQ ID NO: 2, and a first probe having a nucleotide sequence as shown in SEQ ID NO: 3. The primer-probe composition of the present invention is obtained through long-term design and a large amount of optimization and screening. The method of use is simple and fast, and it is applicable to various types of samples to be detected. It also has good detection capability and excellent amplification efficiency for fragmented and low-content free DNA in the samples to be detected. After testing, the primer-probe composition also has high accuracy and high sensitivity, and can continuously and dynamically detect HER2 gene amplification during HER2 targeted drug treatment, for guiding the treatment of patients. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 This is a one-dimensional scatter plot of the HER2 gene amplification results in Example 3 of the present invention;

[0026] Figure 2 This is a one-dimensional scatter plot of the results of RPPH1 gene amplification in Example 3 of the present invention;

[0027] Figure 3 This is a one-dimensional scatter plot of the results of HER2 gene amplification in Example 4 of the present invention;

[0028] Figure 4 This is a one-dimensional scatter plot of the RPPH1 gene amplification results in Example 4 of the present invention. DETAILED DESCRIPTION

[0029] In order to enable those skilled in the art to better understand the scheme of the present invention, the present invention is further described in detail below. The specific embodiments listed below are only for describing the principles and features of the present invention. The examples are only used to explain the present invention and are not intended to limit the scope of the present invention. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without making creative efforts are within the scope of protection of the present invention.

[0030] The human epidermal growth factor receptor-2 (HER2) gene is located on chromosome 17q21 and is a proto-oncogene. The HER2 gene encodes a 185kD transmembrane protein composed of 1255 amino acids. Positions 720-987 belong to the tyrosine kinase region, making HER2 a transmembrane protein with tyrosine kinase activity and a member of the HER family.

[0031] Overexpression of the HER2 gene leads to excessive signaling, stimulating cancer cell growth and metastasis. Therefore, detecting HER2 overexpression is of great significance in medicine, particularly in the diagnosis and treatment of cancer. For example, HER2 overexpression is common in certain types of breast cancer, so testing HER2 expression can help determine the breast cancer subtype and guide treatment decisions. Patients with HER2 overexpression may respond to specific targeted therapies (such as trastuzumab, pertuzumab, and lapatinib). Because these drugs specifically target the HER2 receptor, testing HER2 expression can help select the most appropriate treatment option. Patients with HER2 overexpression generally have a poor prognosis, while targeted therapies can significantly improve outcomes. Therefore, HER2 expression can effectively assess disease progression and patient prognosis. Besides breast cancer, HER2 overexpression can also occur in other cancer types, such as gastric and ovarian cancers, and therefore, testing HER2 expression has potential applications in the diagnosis and treatment of these cancers. In short, the detection of HER2 gene overexpression is an important part of personalized cancer treatment, which can help optimize treatment plans, improve treatment effects and improve patient survival.

[0032] To achieve real-time detection of HER2 gene overexpression, circulating tumor DNA (ctDNA) detection can be used. ctDNA refers to somatic DNA released into the circulation by tumor cells after shedding or undergoing apoptosis. It is a characteristic tumor biomarker. ctDNA detection can reflect tumor burden in the body over a short period of time, enabling real-time, dynamic monitoring of drug efficacy. It effectively complements tissue sample testing and helps avoid false-negative results due to tumor heterogeneity. Furthermore, because ctDNA testing is a liquid biopsy, which is easily accessible, it can be used to dynamically monitor and manage treatment efficacy and optimize treatment plans for patients with advanced cancer who cannot obtain tissue samples. This has significant implications for alleviating clinical symptoms, prolonging survival, and improving quality of life for these patients. For example, plasma samples can be collected and processed from patients' peripheral blood. ctDNA can then be extracted from these plasma samples and analyzed to determine whether HER2 gene overexpression is present in the patient's plasma.

[0033] Digital PCR (dPCR) technology currently shows promising application prospects in the field of ctDNA detection and analysis, thanks to its ability to absolutely quantify the copy number of specific DNA sequences with high sensitivity and accuracy. The core concept of dPCR is to dilute and evenly distribute template DNA molecules into tens of thousands of independent reaction chambers for PCR amplification. The presence or absence of a PCR endpoint signal is used to achieve single-molecule absolute quantification independent of standard curves and reference samples. Existing dPCR technology mainly uses microdroplets or microwells as independent reaction chambers. Taking droplet digital PCR (ddPCR) as an example, the working principle is as follows: (1) The PCR reaction system (containing template DNA, fluorescent dye or probe) is divided into tens of thousands of uniform microdroplets; (2) Most of the microdroplets contain 0 or 1 template DNA; (3) These microdroplets are collected for PCR reaction, and the microdroplets containing template DNA will produce amplification products with strong fluorescence; (4) After the PCR reaction is completed, the fluorescence signal in each microdroplet is detected in turn, and the peak height of the microdroplet signal is recorded; (5) The fluorescence intensity in the microdroplet is digitized through a reasonable fluorescence classification threshold, and the positive microdroplets "1" with strong fluorescence and the negative microdroplets "0" with weak fluorescence are judged. The number of "1" and "0" is counted, and the Poisson distribution model is used for correction to achieve absolute quantification.

[0034] Therefore, in order to accurately and sensitively obtain the HER2 gene amplification status using dPCR technology, the first aspect of the present invention provides a primer-probe combination for detecting HER2 gene amplification, wherein the primer-probe combination includes a first primer having a nucleotide sequence as shown in SEQ ID NO: 1, a second primer having a nucleotide sequence as shown in SEQ ID NO: 2, and a first probe having a nucleotide sequence as shown in SEQ ID NO: 3.

[0035] The primer-probe combination of the present invention was developed through extensive design, optimization, and screening. It is simple and quick to use and is applicable to a wide range of sample types. It also exhibits excellent detection and amplification efficiency for fragmented, low-content free DNA in the sample. Testing has also shown that the primer-probe combination exhibits high accuracy and sensitivity, enabling continuous and dynamic detection of HER2 gene amplification during HER2-targeted drug therapy, useful for guiding patient treatment.

[0036] Specifically, the primer-probe combination of the present invention is applicable not only to tissue samples, but also to a variety of liquid biopsy samples, including blood, urine, and pleural fluid. Compared to commonly used clinical techniques such as IHC and FISH, the present invention causes minimal or no invasiveness during sample collection, making it more acceptable to patients and potentially applicable to a wide range of medical testing applications.

[0037] The primer-probe combination of the present invention is also suitable for detecting free DNA in various liquid biopsy samples such as blood samples, urine samples, and pleural fluid samples. Since the free DNA has a high degree of fragmentation and a low total content, during the design process of the primer-probe combination, the length of the amplification product of the HER2 gene by the primer-probe combination is controlled to be less than 80 bp, thereby making more full use of the highly fragmented free DNA in the sample to be tested, and furthermore, more accurately and sensitively detecting and analyzing the sample to be tested.

[0038] Experimental validation demonstrated that the primer-probe combination of the present invention, when used to amplify free DNA in 14 human plasma samples, yielded results that were consistent with those obtained using commonly used clinical techniques such as IHC and FISH, demonstrating exceptionally high accuracy. Furthermore, the primer-probe combination demonstrated a detection limit of 3.4 cps / reaction, indicating a high sensitivity.

[0039] Furthermore, in order to improve the reliability of the primer-probe combination, the primer-probe combination of the present invention also includes an internal reference primer-probe combination for detecting amplification of an internal reference gene.

[0040] Reference genes are typically genes with stable expression under different experimental conditions. Simultaneously detecting the target gene (i.e., HER2) and the reference gene can correct for inter-sample variations, such as differences in DNA extraction efficiency or sample addition, thereby helping to improve the reliability of experimental results. In quantitative analysis, reference genes can be used to normalize the copy number of the target gene, thereby eliminating errors caused by changes in sample processing or experimental conditions and enabling direct comparison of results between different samples or different experimental batches.

[0041] Commonly used internal reference genes include glyceraldehyde-3-phosphate dehydrogenase (GAPDH), β-actin (ACTB), 18S ribosomal RNA (18S rRNA), hypoxanthine phosphoribosyltransferase 1 (HPRT1), ribosomal protein large subunit P0 (RPLP0), TATA box binding protein (TBP), ribonuclease P RNA component H1 (RPPH1), etc.

[0042] Among them, experiments have found that the RPPH1 gene used as the internal reference gene has strong expression stability and is suitable for ctDNA detection technology and dPCR technology. At the same time, it can produce a good matching effect with the expression level of the HER2 gene, which can avoid bias in the PCR reaction.

[0043] When the RPPH1 gene is used as the internal reference gene, the internal reference primer-probe composition includes a third primer having a nucleotide sequence as shown in SEQ ID NO: 4, a fourth primer having a nucleotide sequence as shown in SEQ ID NO: 5, and a second probe having a nucleotide sequence as shown in SEQ ID NO: 6.

[0044] Like the above-mentioned primer-probe combination, this internal reference primer-probe combination is obtained through long-term design, extensive optimization, and screening. It is simple and quick to use and is suitable for various types of samples to be tested. It also has good detection capabilities and excellent amplification efficiency for fragmented and low-content free DNA in the samples to be tested, and has high accuracy and high sensitivity.

[0045] Furthermore, the internal reference primer-probe combination matches the amplification efficiency of the aforementioned primer-probe combination, further avoiding bias in the PCR reaction that can lead to inaccurate quantitative results. Furthermore, the amplification product of the RPPH1 gene is less than 80 bp in length, making it suitable for detecting free DNA in a variety of liquid biopsy samples.

[0046] In the above technical solution, the 5' end of the nucleotide sequence of the first probe is labeled with a fluorescent group, and the 3' end is labeled with a quencher group; the 5' end of the nucleotide sequence of the second probe is labeled with a fluorescent group, and the 3' end is labeled with a quencher group.

[0047] A fluorophore is a molecule that absorbs light within a specific wavelength range (excitation light) and emits light at a longer wavelength (emission light). A quencher is a molecule that absorbs or diverts the light energy emitted by a fluorophore, thereby reducing or eliminating fluorescence.

[0048] In detail, in the dPCR reaction, the first probe or the second probe specifically binds to the target DNA sequence. Since the 5' end of the nucleotide sequence of the first probe or the second probe is labeled with a fluorescent group, and the 3' end of the nucleotide sequence of the first probe or the second probe is labeled with a quenching group, the fluorescent group and the quenching group are close to each other, and the fluorescent signal will be quenched, that is, the fluorescent signal cannot be detected; when the DNA polymerase synthesizes a new chain along the DNA chain, its 5' to 3' exonuclease activity can degrade the first probe or the second probe bound to the target DNA sequence. At this time, the fluorescent group is separated from the quenching group, and the fluorescent signal is released and detected; by detecting and counting the fluorescent signal released in each reaction droplet, the absolute quantification of the target DNA copy number can be achieved. Through the above mechanism, the fluorescent group and the quenching group can further improve the sensitivity and specificity of the primer probe combination.

[0049] Furthermore, the fluorescent group is selected from at least one of FAM, HEX, ROX, CY5, and CY5.5; and the quenching group is selected from at least one of BHQ1, BHQ2, and BHQ3.

[0050] In a specific embodiment, the nucleotide sequence of the first probe is as shown in SEQ ID NO: 3, the 5' end of the nucleotide sequence of the first probe is labeled with a FAM fluorescent group, and the 3' end of the nucleotide sequence of the first probe is labeled with a BHQ1 quencher group, that is, the structure of the first probe is as follows:

[0051] 5'-[FAM]ACTGCAGAGGCTGCGGATTGTG[BHQ1]-3';

[0052] The nucleotide sequence of the second probe is shown in SEQ ID NO: 6. The 5' end of the nucleotide sequence of the second probe is labeled with a HEX fluorescent group, and the 3' end of the nucleotide sequence of the first probe is labeled with a BHQ1 quenching group. That is, the structure of the second probe is as follows:

[0053] 5'-[HEX]TCCCCTGCGGGGTACCTCACCTC[BHQ1]-3'.

[0054] A second aspect of the present invention provides a kit for detecting HER2 gene amplification, comprising a reagent for detecting HER2 gene amplification, wherein the reagent comprises the above-mentioned primer-probe combination.

[0055] Since the kit includes reagents for detecting HER2 gene amplification, including the above-mentioned primer-probe combination, the kit provided by the present invention is also simple and quick to use, and is applicable to various types of samples to be tested. It has good detection capabilities and excellent amplification efficiency for fragmented and low-content free DNA in the samples to be tested, and has high accuracy and high sensitivity. It can continuously and dynamically detect HER2 gene amplification during HER2 targeted drug treatment to guide patient treatment.

[0056] In an optional embodiment, when the above reagent is in liquid form, the reagent further comprises: at least one of water, dPCR buffer, dNTPs, dUTPs, DNA polymerase, UNG enzyme, reverse transcriptase, magnesium ions, and non-ionic surfactant.

[0057] Water provides the necessary ionic environment and molecular mediator for the dPCR reaction, enabling smooth interactions between various molecules. It also helps maintain a stable temperature in the reaction system, ensuring reliable and accurate reactions. The dPCR buffer regulates the pH of the reaction system. dNTPs, four free deoxyribonucleoside triphosphates (dATP, dGTP, dTTP, and dCTP), are essential raw materials for PCR amplification. dUTP (deoxyuridine triphosphate) can be used in conjunction with the enzyme UNG, which recognizes and cleaves dUTP-incorporated sites, to reduce false positives in PCR amplification caused by contamination. DNA polymerases are enzymes that catalyze the polymerization of substrate dNTPs to form daughter DNA using parent DNA as a template. DNA polymerases used in dPCR are generally thermostable. UNG (uracil-N-glycosylase) selectively hydrolyzes uracil glycosidic bonds in double-stranded or single-stranded DNA containing dU, forming DNA strands with missing bases. Therefore, it can be used to prevent contamination in dPCR amplification products. Reverse transcriptase is an enzyme used to reverse transcribe RNA into cDNA (complementary DNA). Magnesium ions can affect the specificity of the reaction and the yield of the amplified fragment. Nonionic surfactants are surfactants whose molecules contain an ether group as the primary hydrophilic group, which does not dissociate in aqueous solution. They can reduce nonspecific binding, stabilize enzyme activity, reduce secondary structure of the template DNA, and improve reaction uniformity.

[0058] Currently, reagents (such as PCR buffers and DNA polymerases) or kits used to detect gene amplification are primarily formulated and stored in liquid form, requiring refrigeration and transportation. These demanding storage conditions increase shipping and storage costs, and some primary healthcare facilities lack adequate storage facilities, hindering their use within the primary healthcare system. Furthermore, repeated freezing and thawing can cause reagent or kit instability.

[0059] To address the transportation and storage challenges of these reagents or kits, freeze-drying technology has emerged. Freezing these reagents or kits in a vacuum freeze-dryer allows the solid water to slowly sublime and evaporate, while the dry matter remains within the original solid framework. This results in a freeze-dried reagent or kit that maintains a constant volume and exhibits a porous structure. The entire freeze-drying process is performed under vacuum and low temperature conditions, minimizing the loss of enzyme activity with excipients. The freeze-dried reagent or kit can be stored at room temperature without deterioration.

[0060] However, in the prior art, the following problems often exist in the process of preparing freeze-dried reagents for PCR reactions: (1) The enzyme activity is easily reduced during the freeze-drying sublimation process, resulting in reduced detection sensitivity or abnormal amplification curves; (2) Pre-mixing the PCR reaction solution with the enzyme is likely to cause non-specific amplification reactions, resulting in reduced detection sensitivity or non-specific reactions; (3) Some PCR reaction systems (such as dPCR reaction systems) contain surfactants, which makes freeze-drying difficult.

[0061] Therefore, to solve the above problems, the present invention provides an optional embodiment, when the reagent is in solid state, the reagent also includes a first freeze-dried component and a second freeze-dried component, the first freeze-dried component includes at least one of dNTPs, dUTPs, DNA polymerase, UNG enzyme, reverse transcriptase, magnesium ions, non-ionic surfactant, and pH regulator; the second freeze-dried component includes sorbitol, trehalose and mannitol.

[0062] The dNTPs, dUTPs, DNA polymerase, UNG enzyme, reverse transcriptase, magnesium ions, non-ionic surfactant, and pH adjuster in the first freeze-dried component are freeze-dried powders formed after freeze-drying of liquid dNTPs, dUTPs, DNA polymerase, UNG enzyme, reverse transcriptase, magnesium ions, non-ionic surfactant, and dPCR buffer.

[0063] The second freeze-dried component is actually a lyoprotectant. Sorbitol is a sugar alcohol with good hydration and protective properties. During the freeze-drying process, it can help protect biomolecules (such as proteins and enzymes) from denaturation caused by freezing and drying, improve the stability of the freeze-dried product, and prevent product degradation due to humidity changes during storage and transportation. Trehalose is a non-reducing disaccharide that can form a glassy structure, encapsulate and protect biomolecules, and prevent them from losing activity during the freeze-drying process. It also has antioxidant properties, which can further protect biomolecules from oxidative damage. Mannitol is a commonly used filler and stabilizer that can help form the structure of the freeze-dried product and improve its physical stability. It can also help improve the solubility of the freeze-dried powder during the reconstitution process, making it easier to dissolve in water or other solvents.

[0064] Experimental studies have demonstrated that sorbitol, trehalose, and mannitol exhibit a synergistic effect when used together. Mannitol, a readily crystallizing excipient, promotes ice crystal formation during freezing. Crystallization reduces the activity of residual water, further stabilizing solid proteins and acting as a bulking agent to improve the mechanical strength of lyophilized products. Trehalose, an amorphous preservative, prevents mechanical damage to proteins caused by crystallization. It significantly increases the glass transition temperature of the solution, reducing the risk of transition from a vitreous to a crystalline state during lyophilization. It also inhibits moisture absorption and oxidation during long-term storage. When mannitol and trehalose are used together, trehalose remains amorphous after mannitol crystallizes and inhibits excessive ice crystal growth by increasing solution viscosity. Together, they maintain the thermodynamic stability of proteins and solid-state molecular dynamics. As a polyol, sorbitol can regulate osmotic pressure and solution viscosity, helping to inhibit excessive ice crystal growth. However, its protective properties are relatively weak. Therefore, it is used as an auxiliary ingredient alongside mannitol and trehalose to optimize the reconstitution properties of lyophilized products and assist with viscosity regulation with surfactants, thereby improving the quality of lyophilized products. Therefore, the second freeze-dried component as a freeze-drying protectant can solve the pre-mix stability and specificity problems of the enzyme and PCR reaction solution to the greatest extent, protect the functions of each component in the reagent from being damaged, and solve the freeze-drying difficulties caused by surfactants.

[0065] Specifically, liquid dNTPs, dUTPs, DNA polymerase, UNG enzyme, reverse transcriptase, magnesium ions, non-ionic surfactant, and dPCR buffer can be mixed with liquid sorbitol, trehalose, and mannitol, and the mixture can be placed in a freeze dryer for freeze-drying to obtain a solid test kit including a first freeze-dried component and a second freeze-dried component.

[0066] When in use, the DNA of the sample to be tested in a liquid state can be added to the solid state reagent kit to redissolve the solid state reagent kit, and then the redissolved mixed solution can be subjected to dPCR amplification detection.

[0067] In addition, to further improve the freeze-drying efficiency, the present invention also provides a freeze-drying program, which can promote the effective freeze-drying of a PCR reaction system that is difficult to freeze-dry through multi-segment temperature control. The specific freeze-drying program is shown in Table 1.

[0068] Table 1

[0069]

[0070] The freeze-drying procedure of the present invention can be used in conjunction with the above-mentioned second freeze-dried component. During the pre-freezing stage, an annealing step (isothermal insulation at -14°C) in section 3 is provided to promote complete crystallization of mannitol and optimize the ice crystal structure, thereby reducing the proportion of residual water in the frozen concentrate. At the same time, combined with the amorphous properties of trehalose, mechanical damage to the protein caused by crystallization can also be avoided. During the above-mentioned pre-freezing stage, mannitol dominates ice crystal formation, and trehalose inhibits excessive ice crystal growth by increasing the viscosity of the solution. Subsequently, during the first and second drying stages, trehalose replaces water molecules and binds to the polar groups of the protein, and sorbitol assists in maintaining osmotic pressure to prevent protein denaturation caused by dehydration.

[0071] The solid-state kit provided by the present invention has the advantages of uniform morphology and good resolubility. Compared with conventional liquid-state kits, it has no significant difference in amplification efficiency and can be stably stored for 1 year at room temperature and for 2 years at 2-8°C without affecting its amplification activity.

[0072] Furthermore, long-term experiments have shown that adjusting the content of sorbitol, trehalose, and mannitol in the reagent can further improve the freeze-drying effect and further protect the functions of each component in the reagent. Specifically, based on the total volume of the reagent, the second freeze-dried component includes 1%-8% (w / v) sorbitol, 1%-8% (w / v) trehalose, and 1%-3% (w / v) mannitol. It will be appreciated that, based on the total volume of the reagent, the content of sorbitol may be selected from any value of 1%-8% (w / v), for example, 1% (w / v), 2% (w / v), 3% (w / v), 4% (w / v), 5% (w / v), 6% (w / v), 7% (w / v), and 8% (w / v); based on the total volume of the reagent, the content of trehalose may be selected from any value of 1%-8% (w / v), for example, 1% (w / v), 2% (w / v), 3% (w / v), 4% (w / v), 5% (w / v), 6% (w / v), 7% (w / v), and 8% (w / v); based on the total volume of the reagent, the content of mannitol may be selected from any value of 1%-3% (w / v), for example, 1% (w / v), 1.5% (w / v), 2% (w / v), 2.5% (w / v), and 3% (w / v).

[0073] It can be understood that when the total volume of the reagent is 20 μL, 3% (w / v) sorbitol is 600 μg, 5% (w / v) trehalose is 1000 μg, and 1% (w / v) mannitol is 200 μg.

[0074] A third aspect of the present invention provides a use of the above-mentioned primer-probe combination or the above-mentioned kit in detecting HER2 gene amplification.

[0075] The primer-probe combination or kit provided by the present invention can be used as a reagent for detecting HER2 gene amplification. It is simple and quick to use, capable of high-throughput testing of various types of samples. It has good detection capabilities and excellent amplification efficiency for fragmented and low-content free DNA in the samples, with high accuracy and sensitivity. It can continuously and dynamically monitor HER2 gene amplification during HER2-targeted drug treatment, thus guiding patient treatment.

[0076] A fourth aspect of the present invention provides a method for detecting HER2 gene amplification, comprising the following steps:

[0077] Using the DNA of the sample to be tested as a template, digital PCR amplification is performed using the above-mentioned primer-probe combination or the above-mentioned kit to obtain a digital PCR amplification result;

[0078] The copy numbers of the HER2 gene and the internal reference gene were counted based on the digital PCR amplification results, and the ratio of the HER2 gene copy number to the internal reference gene copy number was calculated. The ratio was used to determine whether gene amplification occurred.

[0079] The present invention utilizes the primer-probe combination provided in the first aspect or the kit provided in the second aspect to rapidly and conveniently detect HER2 gene amplification using digital PCR (dPCR). This method exhibits excellent repeatability and reliability, and offers advantages such as high accuracy, sensitivity, and specificity. Furthermore, it requires a low amount of DNA sample, does not rely on a standard curve, and can directly provide the absolute number of target DNA molecules, making it crucial for accurately assessing HER2 gene amplification.

[0080] First, the present invention can extract free DNA (i.e., cfDNA) from tissue samples, or blood samples, urine samples, pleural fluid samples, and liquid biopsy samples to obtain the DNA of the sample to be tested.

[0081] The present invention does not limit the method for extracting cell-free DNA; those skilled in the art can perform extraction according to conventional methods. In one specific embodiment, a human plasma sample can be obtained, and then the cell-free DNA can be extracted using a cell-free DNA extraction reagent produced by Medcaptain. The concentration and purity of the cell-free DNA can then be measured using a Qubit 4.0 nucleic acid quantifier to obtain the DNA of the sample to be tested.

[0082] Subsequently, the present invention can use the DNA of the sample to be detected as a template and the above-mentioned primer-probe combination or the above-mentioned kit to perform digital PCR amplification processing to obtain a digital PCR amplification result.

[0083] The digital PCR reaction system can be a liquid system with a total volume of 15 μL, including 10 μL of Digital PCR Mix, a first primer with a final concentration of 200 nM, a second primer with a final concentration of 200 nM, a first probe with a final concentration of 100 nM, a third primer with a final concentration of 200 nM, a fourth primer with a final concentration of 200 nM, and a second probe with a final concentration of 100 nM, and water added to 15 μL. During use, 5 μL of a DNA sample at 10 copies / μL can be added to the liquid system and mixed before performing digital PCR.

[0084] The digital PCR reaction system can also be a solid-state system, consisting of 10 μL of Medcaptain Digital PCR Mix, a first primer at a final concentration of 200 nM, a second primer at a final concentration of 200 nM, a first probe at a final concentration of 100 nM, a third primer at a final concentration of 200 nM, a fourth primer at a final concentration of 200 nM, a second probe at a final concentration of 100 nM, and a 20 μL volume of 3% (w / v) sorbitol, 5% (w / v) trehalose, and 1% (w / v) mannitol. The solution is then lyophilized to a volume of 20 μL. Upon use, the solid-state system can be reconstituted by adding 15 μL of water and 5 μL of DNA sample at 10 copies / μL, yielding a total volume of 20 μL for reaction.

[0085] Specifically, the liquid-based digital PCR reaction system can be prepared using the GeneXDA Pro digital PCR instructions from Medcaptain for droplet preparation, digital PCR amplification, and fluorescence signal reading. The digital PCR amplification procedure includes treatment with uracil-N-glycosylase (UNG) at 50°C for 2 minutes, followed by pre-denaturation at 95°C for 10 minutes, followed by 40 cycles of denaturation at 95°C for 30 seconds and annealing and extension at 58.5°C for 1 minute, and finally, enzyme inactivation at 98°C for 10 minutes.

[0086] Finally, the present invention can count the copy numbers of the HER2 gene and the internal reference gene according to the digital PCR amplification results, calculate the ratio of the HER2 gene copy number to the internal reference gene copy number, and determine whether gene amplification occurs according to the ratio.

[0087] Specifically, the copy numbers of the HER2 gene and the internal reference gene can be counted based on the reading results of the fluorescence signal. When the ratio of the HER2 gene copy number to the internal reference gene copy number is less than 1.5, it is determined that there is no gene amplification of the HER2 gene; when the ratio of the HER2 gene copy number to the internal reference gene copy number is greater than or equal to 1.5, it is determined that there is gene amplification of the HER2 gene.

[0088] In a specific embodiment, the internal reference gene is the RPPH1 gene. When the ratio of the copy numbers of the HER2 gene and the RPPH1 gene is less than 1.5, it is determined that no gene amplification occurs in the HER2 gene, that is, the corresponding sample to be tested is a negative sample; when the ratio of the copy numbers of the HER2 gene and the RPPH1 gene is ≥1.5, it is determined that gene amplification occurs in the HER2 gene, that is, the corresponding sample to be tested is a positive sample.

[0089] The technical solutions of this application are further explained below with reference to specific examples. Experimental methods in the following examples, where specific conditions are not specified, were generally performed under conventional conditions or as recommended by the manufacturer. All reagents used, unless otherwise specified, were commercially available or publicly available.

[0090] Example 1: Design of primer-probe combination

[0091] According to the design of the HER2 gene and the RPPH1 gene, a primer probe composition including a primer pair and a probe is obtained, as shown in Table 2. The primer probe composition includes a first primer having a nucleotide sequence as shown in SEQ ID NO: 1, a second primer having a nucleotide sequence as shown in SEQ ID NO: 2, and a first probe having a nucleotide sequence as shown in SEQ ID NO: 3, which can be used to amplify the HER2 gene. The primer probe composition also includes a third primer having a nucleotide sequence as shown in SEQ ID NO: 4, a fourth primer having a nucleotide sequence as shown in SEQ ID NO: 5, and a second probe having a nucleotide sequence as shown in SEQ ID NO: 6, which can be used to amplify the RPPH1 gene. Among them, the first primer having a nucleotide sequence as shown in SEQ ID NO: 1 and the third primer having a nucleotide sequence as shown in SEQ ID NO: 4 are upstream primers, and the second primer having a nucleotide sequence as shown in SEQ ID NO: 2 and the fourth primer having a nucleotide sequence as shown in SEQ ID NO: 5 are downstream primers.

[0092] The nucleotide sequence of the first probe is shown in SEQ ID NO: 3. The 5' end of the nucleotide sequence of the first probe is labeled with a FAM fluorescent group, and the 3' end of the nucleotide sequence of the first probe is labeled with a BHQ1 quenching group. That is, the structure of the first probe is as follows:

[0093] 5'-[FAM]ACTGCAGAGGCTGCGGATTGTG[BHQ1]-3';

[0094] The nucleotide sequence of the second probe is shown in SEQ ID NO: 6. The 5' end of the nucleotide sequence of the second probe is labeled with a HEX fluorescent group, and the 3' end of the nucleotide sequence of the first probe is labeled with a BHQ1 quenching group. That is, the structure of the second probe is as follows:

[0095] 5'-[HEX]TCCCCTGCGGGGTACCTCACCTC[BHQ1]-3'.

[0096] In addition, during the design and screening of primer-probe combinations, another set of primer-probe combinations was obtained as a control group, as shown in Table 2. This primer-probe combination includes an upstream primer HER2-F2, a downstream primer HER2-R2, and a probe HER2-P2 for amplifying the HER2 gene, and an upstream primer RPPH1-F2, a downstream primer RPPH1-R2, and a probe RPPH1-P2 for amplifying the RPPH1 gene; the HER2-P2 probe is labeled with a FAM fluorescent group at its 5' end and a BHQ1 quencher at its 3' end; and the RPPH1-P2 probe is labeled with a HEX fluorescent group at its 5' end and a BHQ1 quencher at its 3' end.

[0097] Table 2

[0098]

[0099] Example 2: Preparation of a digital PCR reaction freeze-dried system

[0100] The primer-probe combination provided by the present invention is formulated into a digital PCR reaction system 1 with a total volume of 20 μL, wherein the digital PCR reaction system 1 is composed of 10 μL of digital PCR Mix produced by Medcaptain, a first primer with a final concentration of 200 nM, a second primer with a final concentration of 200 nM, a first probe with a final concentration of 100 nM, a third primer with a final concentration of 200 nM, a fourth primer with a final concentration of 200 nM, a second probe with a final concentration of 100 nM, and 3% (w / v) sorbitol (600 μg), 5% (w / v) trehalose (1000 μg), and 1% (w / v) mannitol (200 μg), based on the volume of the digital PCR reaction system 1, and the volume is supplemented with water to obtain 20 μL.

[0101] The primer-probe combination of the control group was prepared into a digital PCR reaction system 2 with a total volume of 20 μL, wherein the digital PCR reaction system 2 was composed of 10 μL of Digital PCR Mix produced by Medcaptain, HER2-F2 with a final concentration of 200 nM, HER2-R2 with a final concentration of 200 nM, HER2-P2 with a final concentration of 100 nM, RPPH1-F2 with a final concentration of 200 nM, RPPH1-R2 with a final concentration of 200 nM, RPPH1-P2 with a final concentration of 100 nM, and 3% (w / v) sorbitol, 5% (w / v) trehalose, and 1% (w / v) mannitol based on the volume of the digital PCR reaction system 2, and the mixture was added with water to make up to 20 μL.

[0102] Add 20 μL of the prepared digital PCR reaction system 1 or digital PCR reaction system 2 to eight tube strips, and place the eight tube strips in a freeze dryer for freeze drying to obtain digital PCR freeze-dried reaction system 1 or digital PCR freeze-dried reaction system 2. The freeze-drying procedure is shown in Table 1.

[0103] Example 3: Digital PCR reaction

[0104] The HER2 gene and RPPH1 gene were inserted into the plasmid vector to obtain a recombinant plasmid containing the HER2 gene and RPPH1 gene. The recombinant plasmid was used as a normal synthetic DNA sample without amplification. 15 μL of water and 5 μL of 70 copies / μL of the synthetic DNA sample were added to the digital PCR reaction freeze-dried system 1 or the digital PCR reaction freeze-dried system 2 for reconstitution. Droplet preparation, digital PCR amplification, and fluorescence signal reading were performed according to the instructions of the GeneX DA Pro digital PCR produced by Medcaptain. The amplification results are shown in the figure. Figure 1 and Figure 2 The digital PCR amplification procedure included treatment with uracil-N-glycosylase (UNG) at 50°C for 2 min, pre-denaturation at 95°C for 10 min, denaturation at 95°C for 30 s, annealing and extension at 58.5°C for 1 min, for a total of 40 cycles, and finally enzyme inactivation at 98°C for 10 min.

[0105] Figure 1 This is the result of HER2 gene amplification. Figure 2 This is a diagram showing the results of RPPH1 gene amplification, where D04 was amplified using digital PCR reaction freeze-drying system 1, and E01 was amplified using digital PCR reaction freeze-drying system 2. Figure 1 and Figure 2 The results showed that the HER2 gene copy number and RPPH1 gene copy number obtained using the digital PCR reaction freeze-drying system 1 were much higher than those obtained using the digital PCR reaction freeze-drying system 2, indicating that the primer amplification efficiency of the primer probe composition provided by the present invention is better than that of the control group.

[0106] Example 4: Verifying the performance of the digital PCR reaction freeze-drying system

[0107] The primer-probe combination provided by the present invention is formulated into a digital PCR reaction liquid system with a total volume of 20 μL, wherein the digital PCR reaction liquid system is composed of 10 μL of digital PCR Mix, a first primer with a final concentration of 200 nM, a second primer with a final concentration of 200 nM, a first probe with a final concentration of 100 nM, a third primer with a final concentration of 200 nM, a fourth primer with a final concentration of 200 nM, and a second probe with a final concentration of 100 nM, and the volume is supplemented with water to 15 μL.

[0108] 5 μL of the synthetic DNA sample at 70 copies / μL was added to the above digital PCR reaction liquid system and mixed to obtain a 20 μL liquid control group. 15 μL of water and 5 μL of the synthetic DNA sample at 70 copies / μL were added to the digital PCR reaction freeze-dried system 1 for reconstitution to obtain a 20 μL freeze-dried experimental group. Referring to the digital PCR reaction process in Example 3, the above liquid control group or freeze-dried experimental group was subjected to droplet preparation, digital PCR amplification, and fluorescence signal reading. The amplification results are shown in FIG. Figure 3 、 Figure 4 shown.

[0109] Figure 3 This is the result of HER2 gene amplification. Figure 4 The figure shows the results of RPPH1 gene amplification, where A04 is the liquid control group and B04 is the freeze-dried experimental group. Figure 3 and Figure 4 The results showed that there was no significant difference in the HER2 gene copy number and RPPH1 gene copy number obtained between the liquid control group and the freeze-dried experimental group, indicating that there is almost no difference in amplification efficiency between the digital PCR reaction freeze-dried system provided by the present invention and the conventional digital PCR reaction liquid system.

[0110] Example 5: Verifying the Accuracy of the Digital PCR Reaction Freeze-Drying System

[0111] Fourteen human plasma samples were obtained, and free DNA was extracted from each sample using a free DNA extraction reagent produced by Medcaptain. The concentration and purity of the free DNA were determined using a Qubit 4.0 nucleic acid quantifier to obtain the DNA samples to be tested. 15 μL of water and 5 μL of the DNA sample to be tested were added to the digital PCR reaction freeze-dried system 1 for reconstitution. Droplet preparation, digital PCR amplification, and fluorescence signal reading were performed according to the digital PCR reaction process described in Example 3. The copy numbers of the HER2 and RPPH1 genes were counted based on the fluorescence signal reading results, and the copy number ratio of the HER2 and RPPH1 genes was calculated. When the copy number ratio of the HER2 and RPPH1 genes was <1.5, the HER2 gene was determined to be negative, indicating that the corresponding plasma sample was negative. When the copy number ratio of the HER2 and RPPH1 genes was ≥1.5, the HER2 gene was determined to be positive, indicating that the HER2 gene was amplified. The amplification results are shown in Table 3. Among them, the same human plasma sample is detected using IHC technology and FISH technology to detect whether the HER2 gene is amplified, and the amplification result is used as the clinical diagnosis result to determine the consistency with the amplification result obtained using the digital PCR reaction freeze-drying system 1 of the present invention.

[0112] Table 3

[0113]

[0114] The results in Table 3 show that when the digital PCR reaction freeze-drying system provided by the present invention is used to detect clinical samples, the detection results are consistent with the clinical diagnosis results and have extremely high accuracy.

[0115] Example 6: Detecting the sensitivity of the digital PCR reaction freeze-dried system

[0116] HER2 genomic DNA reference material (GBW09116-GBW09120) was used according to the manufacturer's instructions. GBW09116 was diluted with HER2-negative genomic DNA to 6800, 680, and 68 copies / mL, respectively, to obtain the DNA samples to be tested. 15 μL of water and 5 μL of the DNA sample to be tested were mixed and added to the digital PCR freeze-dried system 1 for reconstitution. Droplet preparation, digital PCR amplification, and fluorescence signal reading were performed according to the digital PCR reaction process described in Example 3.

[0117] Based on the fluorescence signal readings, the detection limit of the digital PCR freeze-dried system provided by the present invention was 680 copies / mL (3.4 cps / reaction), indicating a sensitivity of 680 copies / mL (3.4 cps / reaction). This experimental result demonstrates the extremely high sensitivity of the digital PCR freeze-dried system provided by the present invention.

[0118] In summary, the present invention provides a primer-probe combination, a kit and its application for detecting HER2 gene amplification. The primer-probe combination includes a first primer having a nucleotide sequence as shown in SEQ ID NO: 1, a second primer having a nucleotide sequence as shown in SEQ ID NO: 2, and a first probe having a nucleotide sequence as shown in SEQ ID NO: 3. The primer-probe combination of the present invention is obtained through long-term design and a large number of optimizations and screenings; the method of use is simple and quick, and is suitable for various types of samples to be tested, such as tissue samples, blood samples, urine samples, and pleural fluid; because the length of the amplified product obtained is less than 80 bp, it has good detection ability and excellent amplification efficiency for fragmented and low-content free DNA in the sample to be tested. At the same time, compared with the IHC technology and FISH technology commonly used in clinical diagnosis, the primer-probe combination of the present invention has the advantages of less trauma or non-invasive sample collection, which is conducive to being accepted by patients, thereby contributing to wide application. After testing, the primer-probe combination also has high accuracy and high sensitivity, and can continuously and dynamically detect HER2 gene amplification during HER2 targeted drug treatment, which is used to guide patient treatment.

[0119] The present invention also introduces an internal reference primer-probe combination capable of amplifying the RPPH1 gene (i.e., an internal reference gene) into the aforementioned primer-probe combination, further improving the reliability of HER2 gene detection. This internal reference primer-probe combination includes a third primer having a nucleotide sequence as set forth in SEQ ID NO:4, a fourth primer having a nucleotide sequence as set forth in SEQ ID NO:5, and a second probe having a nucleotide sequence as set forth in SEQ ID NO:6.

[0120] In addition, the present invention provides a method for preparing the aforementioned primer-probe combination and other reagents required for digital PCR into an integrated lyophilized reagent by providing a lyoprotectant. This lyoprotectant effectively addresses the stability and specificity issues of the premix of enzyme and dPCR reaction solution, ensuring the stability of the production process and the excellent performance of the reagent. The resulting integrated lyophilized reagent has a uniform morphology and good resolubility, and can be stably stored at room temperature for one year and at 2-8°C for two years without affecting amplification activity.

[0121] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the above embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the above embodiments, or replace some or all of the technical features therein with equivalents. However, these modifications or replacements do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. A primer-probe combination for detecting HER2 gene amplification, characterized in that: The primer-probe combination includes a first primer whose nucleotide sequence is shown in SEQ ID NO: 1, a second primer whose nucleotide sequence is shown in SEQ ID NO: 2, and a first probe whose nucleotide sequence is shown in SEQ ID NO:

3.

2. The primer-probe combination according to claim 1, wherein The primer-probe combination also includes an internal reference primer-probe combination for detecting amplification of an internal reference gene.

3. The primer-probe combination according to claim 2, wherein The internal reference gene is the RPPH1 gene; the internal reference primer-probe composition includes a third primer whose nucleotide sequence is shown in SEQ ID NO: 4, a fourth primer whose nucleotide sequence is shown in SEQ ID NO: 5, and a second probe whose nucleotide sequence is shown in SEQ ID NO:

6.

4. The primer-probe combination according to claim 1 or 3, characterized in that The nucleotide sequence of the first probe is labeled with a fluorescent group at the 5' end and a quencher group at the 3' end; And / or, the 5' end of the nucleotide sequence of the second probe is labeled with a fluorescent group, and the 3' end is labeled with a quencher group.

5. The primer-probe combination according to claim 4, characterized in that The fluorescent group is selected from at least one of FAM, HEX, ROX, CY5, and CY5.5; And / or, the quenching group is selected from at least one of BHQ1, BHQ2, and BHQ3.

6. A kit for detecting HER2 gene amplification, characterized in that: A reagent for detecting HER2 gene amplification is provided, wherein the reagent comprises the primer-probe combination according to any one of claims 1 to 5.

7. The kit according to claim 6, characterized in that When the reagent is in liquid form, the reagent further comprises: at least one of water, dPCR buffer, dNTPs, dUTPs, DNA polymerase, UNG enzyme, reverse transcriptase, magnesium ions, and non-ionic surfactant; When the reagent is in solid state, the reagent further includes a first freeze-dried component and a second freeze-dried component, the first freeze-dried component includes at least one of dNTPs, dUTPs, DNA polymerase, UNG enzyme, reverse transcriptase, magnesium ions, non-ionic surfactant, and pH regulator; the second freeze-dried component includes sorbitol, trehalose and mannitol.

8. The kit according to claim 7, characterized in that Based on the total volume of the reagent, the second lyophilized component comprises 1%-8% (w / v) sorbitol, 1%-8% (w / v) trehalose and 1%-3% (w / v) mannitol.

9. Use of the primer-probe combination according to any one of claims 1 to 5 or the kit according to any one of claims 6 to 8 in detecting HER2 gene amplification.

10. A method for detecting HER2 gene amplification, characterized in that: The steps include: Using the DNA of the sample to be tested as a template, digital PCR amplification is performed using the primer-probe combination according to any one of claims 1 to 5 or the kit according to any one of claims 6 to 8 to obtain a digital PCR amplification result; The copy numbers of the HER2 gene and the internal reference gene are counted according to the digital PCR amplification results, the ratio of the HER2 gene copy number to the internal reference gene copy number is calculated, and whether gene amplification occurs is determined based on the ratio.

11. The method according to claim 10, characterized in that The determining whether gene amplification occurs based on the ratio includes: when the ratio of the HER2 gene copy number to the internal reference gene copy number is less than 1.5, determining that the HER2 gene is not amplified; when the ratio of the HER2 gene copy number to the internal reference gene copy number is greater than or equal to 1.5, determining that the HER2 gene has gene amplification.

Images