An integrated electrochemical biosensor capable of highly sensitive detection of dual miRNAs

By assembling an Au/TiO2-FTO electrode and a Y-shaped probe in an electrochemical biosensor and combining it with a catalytic hairpin amplification reaction, the problems of uncontrollable sites and stability in dual miRNA detection were solved, achieving highly sensitive, stable and accurate detection results, especially demonstrating high accuracy in breast cancer diagnosis.

CN120651941BActive Publication Date: 2026-01-30WUHAN UNIV OF SCI & TECH
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510776953.5
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-06-11
Publication Date
2026-01-30
Estimated Expiration
2045-06-11

AI Technical Summary

Technical Problem

Existing electrochemical biosensors suffer from problems such as uncontrollable probe modification sites, large fluctuations in detection results, and low accuracy in dual-target miRNA detection. Furthermore, the instability of nanomaterial modification affects electrode performance.

Method used

The method employs Au/TiO2-FTO electrode fabrication, Y-shaped trapping probe assembly, catalytic hairpin amplification, and microdroplet chip electrochemical sensor integration. TiO2 nanorod arrays are grown via hydrothermal reaction, Au nanoparticles are reduced by UV light, and combined with Y-shaped probes and CHA reaction, to achieve highly sensitive detection of dual miRNAs.

Benefits of technology

It achieves highly reliable, stable, and sensitive detection of dual miRNAs, improving detection accuracy, especially in breast cancer diagnosis, and can also be used for the diagnosis of other miRNA-related diseases, demonstrating broad applicability.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120651941B_ABST
    Figure CN120651941B_ABST
Patent Text Reader

Abstract

This invention provides an integrated electrochemical biosensor capable of highly sensitive detection of dual miRNAs. Constructed through Y-shaped capture probe self-assembly, Au / TiO2-FTO array electrode preparation, catalytic hairpin amplification (CHA), and microdroplet chip electrochemical biosensor construction, it can simultaneously and sensitively detect dual miRNA biomarkers. It combines the advantages of homogenized capture probe sites for dual-target miRNAs, excellent electrode performance, reliable signal amplification, and low sample consumption. The linear range for detecting miRNA21 and miRNA155 is 10 fM–100 nM, with detection limits of 5.00 fM and 5.17 fM, respectively. The accuracy of detecting miRNA21 and miRNA155 dual biomarkers for breast cancer diagnosis reaches 98%. Furthermore, by modifying the recognition sequences at both ends of the Y-shaped scaffold probe, this sensor can be used for the diagnosis of other miRNA biomarker-related diseases. The integrated microdroplet chip electrochemical biosensor constructed in this invention has significant clinical diagnostic value and outstanding practical application prospects.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the fields of materials, biosensing, and medical detection, specifically to an integrated electrochemical biosensor capable of highly sensitive detection of dual miRNAs. Background Technology

[0002] MicroRNAs (miRNAs) are a class of endogenous non-coding short single-stranded RNAs composed of 21-23 nucleotides. They play a crucial role in gene expression regulation and have become important biomarkers for clinical diagnosis, disease treatment, and prognostic assessment. However, the short sequence length, high homology, easy degradation, low abundance, and complex composition of clinical biological samples make accurate detection of miRNAs extremely challenging. Currently, traditional detection methods such as quantitative polymerase chain reaction (PCR), Northern blotting, and DNA microarrays have good reliability in miRNA detection and quantification, but their high cost, complex procedures, and the need for professional operators limit their application in early disease diagnosis. Fortunately, electrochemical biosensors offer new hope for convenient and accurate detection of miRNAs in clinical biological samples due to their high sensitivity, low cost, and ease of operation.

[0003] Currently, most reported electrochemical biosensors focus on the detection of single-target miRNAs. Although these sensors exhibit excellent specificity and sensitivity, single-miRNA detection inevitably results in a high number of false positives. Therefore, developing strategies for the simultaneous detection of dual-target miRNAs has become a new research hotspot. Reported detection strategies mainly involve sequentially immobilizing different capture probes on the electrode surface and then combining them with hybridization chain reaction (HCR), catalytic hairpin assembly (CHA), and chain shift amplification (SDA) for signal amplification to achieve simultaneous detection of dual miRNAs. However, while modifying dual capture probes achieves the goal of simultaneous detection of dual miRNAs to some extent, the independent modification of the two capture probes on the electrode surface makes the number of probe modification sites uncontrollable during batch preparation of the electrode, leading to large fluctuations and low accuracy in the detection results. In addition, modifying electrodes with nanomaterials with large specific surface area and high conductivity (such as graphene, carbon nanotubes, and metal composites) can significantly improve the charge transfer efficiency at the electrode interface and the nucleic acid probe binding sites, thereby improving the sensor signal output performance. However, when nanomaterials are applied to the electrode surface via drop-coating, not only does the electrode stability decrease due to operational variability, but the role of the microstructure in sensor signal amplification is also ignored. Summary of the Invention

[0004] To address the shortcomings of existing technologies, the present invention aims to provide an integrated electrochemical biosensor capable of highly sensitive detection of dual miRNAs, thereby solving the problems mentioned in the background section. This invention demonstrates high reliability, stability, and sensitivity in the simultaneous detection of dual-target miRNAs. Furthermore, compared to single-marker miRNAs, dual-target miRNA detection exhibits higher accuracy in breast cancer diagnosis. Moreover, by changing the Y-shaped probe recognition sequence, this sensor can be extended to the diagnosis of other miRNA-related diseases, highlighting its broad applicability and clinical diagnostic value.

[0005] To achieve the above objectives, the present invention provides an integrated electrochemical biosensor capable of highly sensitive detection of dual miRNAs, comprising the following steps: Au / TiO2-FTO electrode fabrication, Y-shaped trapping probe assembly, catalytic hairpin amplification, and microdroplet chip electrochemical sensor integration.

[0006] Step 1: A TiO2 nanorod array is vertically grown on the FTO surface via hydrothermal reaction to provide abundant binding sites for probe immobilization. Au nanoparticles are then modified on the TiO2 nanorods by UV reduction to reduce the charge transfer impedance at the electrode interface and immobilize the captured probe.

[0007] Step 2: Incubate and assemble the three DNA strands Y1, Y2, and Y3 to form a Y-shaped capture probe. The end with the thiol group is fixed to the Au / TiO2-FTO electrode by Au-S covalent bond, and the other two ends are used for target miRNA detection.

[0008] Step 3: This involves two sets of CHAs: miRNA21, H1, H2 and miRNA155, H3, H4. When miRNA21 is present, the hairpin H1 is opened, and H2 then replaces miRNA21 to form a more stable H1-H2 double strand. miRNA21 then enters the next CHA cycle. miRNA155 first opens the H3 strand and then forms the H3-H4 double strand.

[0009] Step 4: Using the Au / TiO2-FTO electrode as the microdroplet chip substrate and working electrode, two layers of PDMS approximately 0.5 cm thick are bonded sequentially onto the Au / TiO2-FTO electrode, with the reference electrode and counter electrode placed between the two PDMS layers. The CHA products triggered by miRNA21 and miRNA155 are added to the detection chamber, allowing the Y-shaped capture probe to incubate and hybridize with CHA21 and CHA155 for detection.

[0010] Furthermore, the TiO2 nanorod array preparation conditions in step one are a mixture of 15 mL hydrochloric acid, 15 mL pure water and 0.9 mL tetrabutyl titanate, reacted at 150 °C for 5 h.

[0011] Furthermore, the reaction process of Au nanoparticles being reduced and deposited on TiO2 nanorods is as follows: the TiO2-FTO electrode is immersed in tetrachloroauric acid aqueous solution and irradiated with a 254 nm ultraviolet lamp for 5 h.

[0012] Furthermore, in step two, Y1, Y2, and Y3 are mixed in a 1:1:1 ratio and incubated at 37°C for 1 h to complete the assembly of the Y-shaped scaffold. The assembled Y-shaped scaffold solution is then dropped onto the surface of the Au / TiO2-FTO electrode and incubated at 4°C for 12 h to fix the Y-shaped scaffold probe onto the Au / TiO2-FTO electrode.

[0013] Furthermore, in step two, after the Y-shaped scaffold probe is fixed on the Au / TiO2-FTO electrode, MCH solution is dropped onto the electrode surface and incubated at 25°C for 1 h. Unless specific DNA is adsorbed, the electrode is repeatedly washed three times with 0.01 M PBS buffer to obtain the working electrode.

[0014] Furthermore, in step three, one end of the H2 and H4 DNA strands is connected to methylene blue and ferrocene electrochemical signaling molecules, respectively, to indicate the concentration of the target miRNA.

[0015] Furthermore, in step three, the four DNA strands H1, H2, H3, and H4 are first denatured at 95°C for 15 min, then annealed at -20°C for 5 min to form hairpin structures respectively. Then, miRNA21 and miRNA155 are added and incubated at 37°C for 3 h to complete the CHA reaction.

[0016] Furthermore, in step four, the detection chamber consists of two layers of PDMS, with cubic cells measuring 1 cm long × 0.8 cm wide × 0.5 cm high fabricated on each layer of PDMS. The total volume of the detection cells is 0.8 mL.

[0017] Furthermore, in step four, after incubation at 37 °C for 1 h, the Y-shaped capture probe hybridizes with CHA21 and CHA155 and is then washed three times with 0.01 M PBS buffer.

[0018] Furthermore, the DPV test was performed in a three-electrode system in 0.01 M PBS buffer.

[0019] The beneficial effects of this invention are:

[0020] 1. This highly sensitive integrated electrochemical biosensor for detecting dual miRNAs employs a Y-shaped scaffold for capturing probes, ensuring the uniformity of recognition probe sites for the dual target miRNAs. This avoids the increased false positives and reduced accuracy of detection results caused by the capture probes being independently modified on the electrode surface and the uncontrollable nature of the two probe sites.

[0021] 2. This invention cleverly combines a three-dimensional Au / TiO2-FTO array electrode with a catalytic hairpin amplification reaction, which not only significantly improves the binding sites of the capture probe and effectively enhances the signal output, but also reduces the detection limits of miRNA21 and miRNA155 to as low as 5.00 fM and 5.17 fM, respectively.

[0022] 3. This invention effectively solves the problems of low sample volume and high detection interference by constructing an integrated microdroplet chip electrochemical sensor, achieving the goal of constructing a portable, fast and accurate sensor. In clinical breast cancer diagnosis, the accuracy rate is as high as 98%. Attached Figure Description

[0023] Figure 1 This is a schematic diagram illustrating the fabrication process of the three-dimensional Au / TiO2-FTO array electrode and the principle of simultaneous detection of dual miRNAs in this invention.

[0024] Figure 2 This is a scanning electron microscope image of the Au / TiO2-FTO electrode of the present invention;

[0025] Figure 3 This is the electrochemical impedance spectroscopy (EIS) diagram of the Au / TiO2-FTO electrode of the present invention.

[0026] Figure 4 (A) Self-assembly of the Y-shaped scaffold; (B) Hybridization of the Y-shaped scaffold with CHA products triggered by miRNA21 and miRNA155, respectively, by polyacrylamide gel electrophoresis.

[0027] Figure 5 Cyclic voltammetry curves of nucleic acid chains progressively modified on Au / TiO2-FTO electrodes (a: Au / TiO2-FTO electrode; b: Y-Au / TiO2-FTO electrode; c: CHA21-Y-Au / TiO2-FTO electrode; d: CHA155-Y-Au / TiO2-FTO electrode; e: CHA155-CHA21-Y-Au / TiO2-FTO electrode).

[0028] Figure 6 (A) DPV response curves for different concentrations of miRNA21 and miRNA155 (a → h: 10 fM, 100 fM, 1 pM, 10 pM, 100 pM, 1 nM, 10 nM and 100 nM); (B) Linear relationship between DPV current value and the logarithm of target miRNA concentration.

[0029] Figure 7 Stability diagram of Au / TiO2-FTO electrode;

[0030] Figure 8 This is a repeatability diagram of the integrated microdroplet chip electrochemical biosensor;

[0031] Figure 9 This is a diagram illustrating the specificity of the integrated microdroplet chip electrochemical biosensor.

[0032] Figure 10 (A) Subject curves for the diagnosis of breast cancer using a single miRNA21 or miRNA155; (B) Subject curves for the diagnosis of breast cancer using both miRNA21 and miRNA155. Detailed Implementation

[0033] To make the technical means, creative features, objectives and effects of this invention easier to understand, the invention will be further described below in conjunction with specific embodiments.

[0034] Please see Figures 1 to 10 This invention provides the following technical solution: an integrated electrochemical biosensor capable of highly sensitive detection of two miRNAs. In this embodiment, a Y-shaped probe with dual recognition domains was designed and assembled, an array structure electrode (Au / TiO2-FTO) modified with gold nanoparticles was prepared, and these were integrated to construct a portable, highly precise microdroplet chip electrochemical biosensor. Furthermore, given that miRNA21 and miRNA155 are both highly expressed in breast cancer patients and are closely related to the occurrence of breast cancer, they can serve as biomarkers for the early diagnosis of breast cancer.

[0035] The specific steps are as follows:

[0036] Step 1: Preparation of Au nanoparticle-modified TiO2 nanorod array electrode. TiO2 nanorod arrays are grown in situ on the FTO surface through hydrothermal reaction, and Au nanoparticles are then modified on the TiO2 nanorods by electrodeposition to construct a high-performance three-dimensional Au / TiO2-FTO array electrode.

[0037] Step 2: Y-shaped probe scaffold assembly. The Y-shaped scaffold is formed by the self-assembly of the three DNA nucleic acid strands Y1, Y2 and Y3 to capture the probe.

[0038] Step 3: Immobilize the capture probe. Drop the Y-shaped capture probe onto the surface of the Au / TiO2-FTO electrode for incubation and immobilization.

[0039] Step 4: Seal the electrode to seal the non-specific adsorption sites and obtain the working electrode.

[0040] Step 5: Catalytic hairpin assembly amplification reaction, triggered by miRNA21 and miRNA155, involves two sets of catalytic hairpin amplification reactions to amplify the signal.

[0041] Step 6: Construction of integrated electrochemical biosensor. Using a three-dimensional Au / TiO2-FTO array electrode as a substrate, two layers of PDMS are placed on it in sequence, with the reference electrode and counter electrode placed between the two layers of PDMS, and a detection cell of 1 cm long × 0.8 cm wide × 1 cm high is set up.

[0042] The fabrication process of the three-dimensional Au / TiO2-FTO array electrode in step one above includes: First, FTO is sequentially immersed in ultrapure water, ethanol, and ultrapure water, and ultrasonically cleaned for 3 min. Then, the FTO is placed at a 45° angle with the conductive side facing down in a 50 mL polytetrafluoroethylene liner, and 30 mL of the mixed reaction solution is added. The reaction is carried out at 150 °C for 5 h, allowing the TiO2 nanorod array to grow in situ on the FTO surface. Finally, the surface is irradiated under a UV lamp for 5 h to modify the TiO2 nanorod surface with Au nanoparticles.

[0043] The reaction solution for preparing the TiO2 nanorod array in step one above is 15 mL of ultrapure water + 15 mL of concentrated hydrochloric acid + 0.9 mL of tetrabutyl titanate, and the reaction solution for UV reduction of Au nanoparticles is 15 mL of ultrapure water + 20 μL (2.5 mM) tetrachloroauric acid.

[0044] During the assembly of the Y-shaped probe scaffold in step two above, the sequences of Y1, Y2 and Y3 are shown in Table 1, where the concentration of each is 2 μmol / L, the incubation temperature is 37℃ and the incubation time is 60 min.

[0045] In step three above, during the Y-shaped probe immobilization process, one end of the Y3 DNA nucleic acid chain is modified with a thiol group, so that the Y-shaped probe is connected to the surface of Au nanoparticles through Au-S covalent bonds.

[0046] In step four above, during the electrode sealing process, non-specific adsorption sites are blocked using MCH, and the electrode is rinsed with PBS buffer to obtain the working electrode. The PBS solution consists of 0.01 M NaH2PO4, 0.01 M Na2HPO4, 0.01 M MgCl2, and 0.01 M KCl.

[0047] In the hairpin assembly amplification reaction of step five above, H1, H2, H3, and H4 (base sequences shown in Table 1) were denatured at 95℃ for 15 min and annealed at -20℃ for 5 min to form hairpin structures, with the concentrations of H1, H2, H3, and H4 all being 2 μmol / L. Then, the formed hairpin probes H1, H2, H3, and H4 were mixed in a 1:1:1:1 ratio, incubated at 37℃ for 3 h, and miRNA21 and miRNA155 were added to trigger two sets of catalytic hairpin reactions, yielding CHA21 and CHA155 products.

[0048] Table 1 DNA probe sequences

[0049] name Base sequence (5' → 3') Y1 GAATGCCGCTTACAGTACGCCTAGGTTACTCTACACAT Y2 TCCGACTAAGCCAGTAAGCGGCATTCATCACATCTCTA Y3 ACCTAGGCGTACTTGGCTTAGTCGGAGGGAAGGAGAGC-SH H1 TCAACATCAGTCTGATAAGCTACCATGTGTAGATAGCTTATCAGACTGATCCAAGTCAGACCAC H2 TAAGCTATCTACACATGGTAGCTTATCAGACTGATCCATGTGTAGAGTA-Mb H3 CCCCTATCACGATTAGCATTAACCTAGAGATGTTTAATGCTAATCGTGATCCATAACTGTCCTG H4 GCATTAAACATCTCTAGGTTAATGCTAATCGTGATCCTAGAGATGTGAT-Fc

[0050] In the process of constructing the integrated electrochemical biosensor described above, the constructed Au / TiO2-FTO serves as both the substrate of the microdroplet chip sensor and the working electrode, with the reference electrode being an Ag / AgCl electrode and the counter electrode being a platinum wire electrode, respectively. The monolayer PDMS cubic cell has dimensions of 1 cm (length) × 0.8 cm (width) × 0.5 cm (height).

[0051] This embodiment also provides a further detailed description of the technical solution based on the above steps, as follows:

[0052] All chemical reagents used in this embodiment were purchased from Sinopharm Group, and the target miRNA and probe DNA nucleic acid sequences were purchased from Shanghai Sangon Biotech Co., Ltd. The ultrapure water used was from Jinlan Water Purification System (Sichuan Jinlan Technology Co., Ltd.). All electrochemical tests in this invention were performed in a three-electrode system, and data were collected using a CHI760E electrochemical workstation (Shanghai Chenhua Instrument Co., Ltd., Shanghai, China). The constructed Au / TiO2-FTO was used as the working electrode, Ag / AgCl as the reference electrode, and platinum wire as the counter electrode.

[0053] Example 1: Preparation of Au / TiO2-FTO electrode and principle of simultaneous high-sensitivity detection of two miRNAs

[0054] like Figure 1 The fabrication process of the Au / TiO2-FTO electrode shown involves growing a TiO2 nanorod array on the conductive side of the FTO glass via a hydrothermal reaction, followed by UV reduction to deposit Au nanoparticles onto the TiO2 nanorods, thus creating a three-dimensional Au / TiO2-FTO array electrode. This can be clearly observed under a scanning electron microscope. Figure 2 TiO2 nanorods are vertically aligned on the FTO surface, and Au nanoparticles are uniformly attached to the TiO2 nanorods. This provides abundant attachment sites for the Y-shaped probe, allowing it to be firmly fixed to the electrode surface via Au-S covalent bonds. The interfacial charge transfer capability of the Au / TiO2-FTO electrode can be characterized by EIS measurements. EIS was performed in 10 mM and 0.1 M KCl aqueous solutions. The semicircle diameter of the obtained curve represents the interfacial charge transfer resistance (R0). ct The smaller the diameter of the semicircle, the stronger its charge transfer capability. For example... Figure 3 As shown, the FTO bare electrode has the largest semicircular diameter, indicating that its R... ctThe largest, followed by TiO2-FTO and Au / TiO2-FTO electrodes, indicates that modification with TiO2 nanorods and Au nanoparticles can significantly improve the charge transfer capability at the electrode interface. The signal amplification principle of this sensor is based on two sets of catalytic hairpin assembly amplification reactions to achieve highly sensitive detection of miRNA21 and miRNA155. Figure 1 As shown, when the target miRNA21 is present, the hairpin H1 is opened, and H2 then competes to remove miRNA21 from H1. miRNA21 then enters the next CHA21 cycle. The H1-H2 double strand is captured by the Y-shaped probe, where the methylene blue (Mb) attached to one end of H2 acts as an electrical signal indicator reflecting the miRNA21 concentration. Similarly, the presence of miRNA155 triggers CHA155. The electrical signal from the ferrocene (Fc) attached to one end of H4 reflects the miRNA155 concentration. The significant difference in redox potential between Mb and Fc ensures that the detection of miRNA21 and miRNA155 does not interfere with each other. In summary, the integrated electrochemical biosensor constructed in this invention, by combining the abundant probe binding sites and excellent interfacial charge transfer capabilities of the Au / TiO2-FTO array electrode with CHA signal amplification, shows outstanding application prospects and clinical application value in breast cancer diagnosis.

[0055] Example 2: Feasibility Analysis of Simultaneous Detection of Dual miRNAs Using Au / TiO2-FTO Array Electrodes Combined with Y-shaped Scaffold Probes

[0056] Y-shaped scaffold capture probe assembly is crucial to ensuring the simultaneous detection of two miRNAs in this invention, such as... Figure 4 As shown in (A), channels 4, 5, and 6 represent the pairwise assembly of Y1+Y2, Y2+Y3, and Y1+Y3, respectively. Channel 7 shows the electrophoretic bands after the assembly of the three DNA strands Y1+Y2+Y3. It can be seen that the bands in channels 4, 5, and 6 are similarly positioned, while the band in channel 7 moves the slowest, indicating that Y1+Y2+Y3 can self-assemble to form a Y-shaped scaffold probe. When the Y-shaped probe is incubated with the CHA products triggered by miRNA21 and miRNA155, respectively, as shown... Figure 4 As shown in (B), the electrophoretic bands in channels 4 and 5 exhibit similar positions. However, when the Y-shaped probe was simultaneously incubated with CHA21 and CHA155, a slower-moving band appeared in channel 6, indicating that the Y-shaped probe can independently or simultaneously recognize crosslinked CHA21 and CHA155. Cyclic voltammetry was then used to characterize the Y-shaped probe modification on the Au / TiO2-FTO electrode surface and the process of hybridization between the Y-shaped probe and CHA21 and CHA155. Figure 5As shown, the bare Au / TiO2-FTO electrode exhibits the highest redox peak current. The peak current decreases after the Y-shaped probe is immobilized on the electrode surface via Au-S covalent bonds. Similar current decreases are observed after CHA21 and CHA155 are dropped onto the electrode surface and incubated, with the largest decrease occurring when both CHA21 and CHA155 bind to the Y-shaped probe simultaneously. This is because the negative charge on the nucleic acid strand surface inhibits electron transfer at the electrode interface, demonstrating the feasibility of simultaneously detecting dual miRNAs using an Au / TiO2-FTO array electrode and a Y-shaped scaffold probe.

[0057] Example 3: Standard Curve Plotting

[0058] The steps for plotting a standard curve are as follows:

[0059] (1) First, Y1, Y2, and Y3 were mixed in a 1:1:1 ratio and incubated at 37°C for 1 h to complete the assembly of the Y-shaped scaffold. Then, 20 μL of the assembled Y-shaped scaffold solution was dropped onto the surface of the Au / TiO2-FTO electrode and incubated in Tris-HCl buffer at 4°C for 12 h to fix the Y-shaped scaffold probe onto the electrode via Au-S covalent bonds. Next, 20 μL of MCH solution was dropped onto the electrode surface and incubated at 25°C for 1 h to remove non-specific DNA adsorption. Finally, the electrode was washed three times with 0.01 M PBS buffer to obtain the working electrode.

[0060] (2) The target miRNA triggers the hairpin amplification reaction. First, the H1, H2, H3, and H4 DNA strands are kept at 95 °C for 15 min, and then annealed at -20 °C for 5 min to form hairpin structures respectively. Then, the formed H1, H2, H3, and H4 hairpin probes are mixed in a 1:1:1:1 ratio and incubated at 37 °C for 3 h. Then, miRNA21 and miRNA155 are added to trigger two sets of catalytic hairpin reactions to obtain CHA21 and CHA155 products. Finally, the obtained CHA21 and CHA155 products are dropped onto the working electrode described in step (1) and incubated at 37 °C for 1 h. After the Y-shaped capture probe recognizes and hybridizes with CHA21 and CHA155, the electrodes are washed three times with 0.01 M PBS buffer to collect DPV electrical signals.

[0061] (3) Based on the different DPV current responses of target miRNAs at different concentrations, a standard curve was plotted with the logarithm of concentration on the x-axis and the DPV current value on the y-axis. For example... Figure 6As shown, the peak current intensity of DPV increased with increasing target miRNA concentration (a→h: 10 fM, 100 fM, 1 pM, 10 pM, 100 pM, 1 nM, 10 nM and 100 nM), and the peak current intensity had a good linear relationship with the logarithm of the target miRNA concentration. The detection limits for miRNA21 and miRNA155 were as low as 5.00 fM and 5.17 fM, respectively.

[0062] Example 4: Reliability and Specificity Evaluation of Integrated Electrochemical Sensor

[0063] (1) Stability test

[0064] Au / TiO2-FTO working electrodes were prepared according to Examples 1 and 3, and stored at 4°C. The levels of 1 nM miRNA21 and miRNA155 were detected every 4 hours. Figure 7 As shown, during the 40-hour test, the DPV current response values ​​of miRNA21 and miRNA155 did not fluctuate significantly, and the standard deviations (RSDs) of miRNA21 and miRNA155 were 2.8% and 3.4%, respectively, indicating that the sensor has good stability.

[0065] (2) Repeatability experiment

[0066] Au / TiO2-FTO working electrodes were prepared according to Examples 1 and 3, and stored at 4°C. The electrodes were then used in six batches, with three replicates per batch, to detect 1 nM miRNA21 and miRNA155. Figure 8 As shown, in the six batches of detection, the DPV current response values ​​of miRNA21 and miRNA155 did not fluctuate significantly, and the standard deviations (RSD) of miRNA21 and miRNA155 were 3.9% and 2.6%, respectively, indicating that the sensor has good repeatability.

[0067] (3) Specificity test

[0068] Since real biological samples often contain multiple miRNAs with high homology, specific detection is one of the key performance characteristics of biosensors. This invention, according to Example 3, detected target miRNA21 and miRNA155, as well as five other different oligonucleotides (miRNA sequences are shown in Table 2). Figure 9As shown, the DPV current response is significant when the target miRNA is present, while the DPV electrical signals of other oligonucleotides are almost identical to those of the blank group, indicating that the electrochemical sensor constructed in this invention has good specificity for the target miRNA.

[0069] Table 2 miRNA base sequences

[0070] name Base sequence (5' → 3') miRNA-21 TAGCTTATCAGACTGATGTTGA miRNA-155 TTAATGCTAATCGTGATAGGGGT miRNA-122 TGGAGTGTGACAATGGTGTTTG miRNA-141 TAACACTGTCTGGTAAAGATGG miRNA-214 ACAGCAGGCGCAGACAGGCAGT miRNA-let7a TGAGGTAGTAGGTTGTATAGTT miRNA-210 CTGTGCGTGTGACAGCGGCTGA

[0071] Example 5: Verification of the accuracy of this integrated electrochemical biosensor in clinical breast cancer diagnosis.

[0072] This study collected 40 clinical blood samples, including 30 breast cancer patients and 10 healthy individuals. Two mL of venous blood was collected from each patient and centrifuged at 3000 rpm for 15 min. 20 µL of the supernatant serum was added to the CHA reaction system for signal amplification. Then, 20 µL of the CHA product was incubated with a Y-scaffold probe in a detection cell, and the DPV signal was acquired. Comparison with MRI and tissue section results showed that miRNA21 and miRNA155 had 96% and 93% accuracy in breast cancer diagnosis, respectively. When both target miRNAs were used simultaneously for breast cancer diagnosis, the accuracy reached as high as 98%, indicating that the integrated microdroplet chip electrochemical sensor constructed in this invention has good clinical application prospects.

[0073] The foregoing has shown and described the basic principles and main features of the present invention and its advantages. It will be apparent to those skilled in the art that the present invention is not limited to the details of the above exemplary embodiments, and that the present invention can be implemented in other specific forms without departing from the spirit or basic features of the present invention.

[0074] Furthermore, it should be understood that although this specification describes embodiments, not every embodiment contains only one independent technical solution. This narrative style is merely for clarity. Those skilled in the art should consider the specification as a whole, and the technical solutions in each embodiment can also be appropriately combined to form other embodiments that can be understood by those skilled in the art.

Claims

1. A method for preparing an integrated electrochemical biosensor for detecting dual miRNAs, characterized in that, The method comprises the following steps: Step one: Au / TiO2-FTO electrode preparation, vertically growing TiO2 nanorod arrays on the surface of FTO through a hydrothermal reaction to provide abundant binding sites for probe fixation, and modifying Au nanoparticles on the TiO2 nanorod through UV reduction to reduce the electrode interface charge transfer impedance and fix the capture probe; Step two: Y-shaped capture probe assembly, incubating Y1, Y2 and Y3 to assemble a Y-shaped capture probe, and fixing the end connected with a thiol group to the Au / TiO2-FTO electrode through an Au-S covalent bond, and using the other two ends for miRNA detection; Step three: catalytic hairpin amplification, containing two groups of CHA, miRNA21, H1 and H2, and miRNA155, H3 and H4, triggering H1 hairpin opening when miRNA21 exists, and then replacing miRNA21 with H2 to form a relatively stable H1-H2 double strand, and miRNA21 entering the next round of CHA cycle, and miRNA155 opening the H3 chain first, and then forming an H3-H4 double strand; one end of the H2 and H4 DNA chains is connected with methylene blue and ferrocene electrical signal molecules, respectively, for indicating the concentration of the target miRNA; Step four: microdroplet chip electrochemical sensor integration, using the Au / TiO2-FTO electrode as a microdroplet chip substrate and a working electrode, bonding two layers of 0.5 cm-thick PDMS on the Au / TiO2-FTO electrode in sequence, and placing the reference electrode and the counter electrode in the middle of the two layers of PDMS, and setting a detection pool with a length of 1 cm, a width of 0.8 cm and a height of 1 cm.

2. The production method according to claim 1, characterized by, In step one, the preparation conditions of the TiO2 nanorod array are as follows: mixing 15 mL of hydrochloric acid, 15 mL of pure water and 0.9 mL of tetrabutyl titanate mixed solution, and reacting at 150℃ for 5 h.

3. The method of claim 1, wherein: The reaction process of Au nanoparticle reduction and deposition on the TiO2 nanorod is as follows: immersing the TiO2-FTO electrode in an aqueous solution of tetrachloroauric acid, and irradiating with a 254 nm UV lamp for 5 h.

4. The method of claim 1, wherein: In step two, Y1, Y2 and Y3 are mixed at a ratio of 1:1:1, incubated at 37℃ for 1 h to complete Y-shaped scaffold assembly, and then the assembled Y-shaped scaffold solution is dropped on the surface of the Au / TiO2-FTO electrode and incubated at 4℃ for 12 h to fix the Y-shaped scaffold probe on the Au / TiO2-FTO electrode.

5. The method of claim 4, wherein: In step two, after the Y-shaped scaffold probe is fixed on the Au / TiO2-FTO electrode, MCH solution is dropped on the electrode surface and incubated at 25℃ for 1 h, unless specific DNA adsorption, the electrode is repeatedly washed with 0.01 M PBS buffer for 3 times to obtain the working electrode.

6. The method of claim 1, wherein: In step three, H1, H2, H3 and H4 are first denatured at 95℃ for 15 min, and then annealed at -20℃ for 5 min to form hairpin structures, respectively, and then miRNA21 and miRNA155 are added and incubated at 37℃ for 3 h to complete the CHA reaction.

7. The method of claim 1, wherein: The step four incubates at 37 ℃ for 1 h, and after the Y-shaped capture probe recognizes and hybridizes with CHA21 and CHA155, 0.01 M PBS buffer is repeatedly washed for three times.