Pharmaceutical composition for preventing and treating hepatic fibrosis

By targeting M2b macrophages in Kupffer cells and using CCL1 inhibitors such as antibodies and antisense oligodeoxynucleotides, the difficulties in preventing and treating liver fibrosis were solved, and effective improvement of liver fibrosis was achieved.

CN120659622APending Publication Date: 2025-09-16EDUCATIONAL FOUND OF OSAKA MEDICAL & PHARMA UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202480008773.6
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Priority Date
2023-02-03
Filing Date
2024-01-31
Publication Date
2025-09-16

AI Technical Summary

Technical Problem

Currently, there is no effective drug that can specifically prevent and treat liver fibrosis, and existing treatments often affect the entire body and cause side effects.

Method used

A pharmaceutical composition has been developed to inhibit the production or action of CCL1 by targeting M2b macrophages in Kupffer cells, including CCL1 inhibitors such as antibodies and antisense oligodeoxynucleotides for inhibiting the effects of CCL1.

Benefits of technology

Effectively prevent and treat liver fibrosis, reduce side effects, and significantly improve liver inflammation and fibrosis.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120659622A_ABST
    Figure CN120659622A_ABST
Patent Text Reader

Abstract

The present invention provides a pharmaceutical composition which is targeted to various cells (e.g., macrophages, Kupffer cells, T cells, etc.), has few side effects, and is useful for effective prevention and treatment of hepatic fibrosis. The pharmaceutical composition provided by the invention is used for preventing and treating hepatic fibrosis, and is characterized by containing a CCL1 inhibitor.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to a pharmaceutical composition for preventing and treating liver fibrosis, and in particular to a pharmaceutical composition for inhibiting the effect of CCL1 as a chemokine. Background Art

[0002] It is well known that cirrhosis of the liver has a poor prognosis due to the various complications it causes. The actual state of cirrhosis is liver fibrosis caused by various causes such as viruses, alcohol, and non-alcoholic steatohepatitis (NASH). Although there are different treatments for these various causes and there are indirect methods to prevent liver fibrosis, there are currently no approved drugs for the prevention and treatment of liver fibrosis itself, which is a common cause. Liver fibrosis is caused by chronic inflammation of the liver, which activates hepatic stellate cells and myofibroblasts, excessive production of extracellular matrix such as collagen, and inhibition of matrix metalloproteinases (collagen fiber decomposition enzymes), resulting in a combination of these. To date, research on the hepatic stellate cells and myofibroblasts that cause fibrosis is ongoing, but an effective treatment method has not yet been found. This is because various attempts to inhibit liver fibrosis have not targeted the specific cells and substances that affect liver fibrosis. Therefore, these treatments affect the whole body, reducing their effectiveness and causing various side effects.

[0003] As one of the cells present in the microtissue constituting the liver, macrophages are called Kupffer cells. As is well known, these cells are immune cells that are responsible for the center of chronic inflammation of the liver. In response to chronic inflammation of the liver, various cytokines are produced, which activate hepatic stellate cells and myofibroblasts, and play an important role in the process of liver fibrosis. There are macrophages that are specifically activated for various diseases in macrophages. The activated macrophages are generally divided into M1 macrophages and M2 macrophages, and M1 macrophages secrete cytokines such as Interleukin (IL) -12 and Interferon (INF) -γ, causing inflammation. On the other hand, M2 macrophages produce cytokines such as Transforming Growth Factor (TGF) -β and IL-10, activate myofibroblasts, and work on tissue repair. In addition, M2 macrophages are subdivided into M2a macrophages, M2b macrophages, and M2c macrophages. It is well known that M2a and M2c macrophages link their fate to the rise and fall of IL-4, but M2b macrophages are independent of environmental changes and continue to function for a long time while producing CCL1, a chemokine known as CCL1 (Non-Patent Document 1). Recently, it has been discovered that Kupffer cells in some patients with liver damage or cirrhosis have the characteristics of M2b macrophages (Non-Patent Documents 2 and 3).

[0004] [Non-patent document 1] Journal of Leukocyte Biology, Vol. 92 (2012), pp. 859-867. [Non-patent document 2] Journal of Leukocyte Biology, Vol. 109 (2021), p943-952. [Non-patent document 3] Oncoimmunology, Vol. 6 (2017), e1299301. Summary of the Invention -Problems to be solved by the invention-

[0005] As described above, although the relationship between Kupffer cells and liver fibrosis is well known, effective drugs for preventing and treating liver fibrosis have not yet been created by utilizing this relationship.

[0006] In view of the above problems, the object of the present invention is to provide a pharmaceutical composition that targets multiple cells such as Kupffer cells, other macrophages and T cells, has fewer side effects, and is used to effectively prevent and treat liver fibrosis.

[0007] To achieve the above-mentioned purpose, the inventors of this case conducted in-depth research and found that the Kupffer cells in the liver tissue of patients with cirrhosis are almost all M2b macrophages that produce IL-10 and C-C motifchemokine ligand 1 (CCL1). + CCL1 + cells), and found that liver fibrosis can be prevented and liver fibrosis can be improved by inhibiting CCL1 (inhibiting the production of CCL1 or inhibiting the effect of produced CCL1), thereby completing the present invention.

[0008] Specifically, the pharmaceutical composition of the present invention is a pharmaceutical composition for preventing and treating liver fibrosis, characterized by comprising a substance that inhibits CCL1 (eg, an antibody to CCL1, an antisense oligodeoxynucleotide, a nucleic acid containing RNA, etc.). -Effects of the Invention-

[0009] According to the pharmaceutical composition of the present invention, since it contains a substance that inhibits CCL1, it can inhibit the production of CCL1 from various cells (including Kupffer cells) or the effect of already produced CCL1, and as a result, can prevent and treat liver fibrosis. BRIEF DESCRIPTION OF THE DRAWINGS

[0010] Figure 1These are photographs showing the results of Hematoxylin-Eosin (HE) staining of liver tissue sections prepared from mice with chronic liver injury in the Examples, showing the results of the carbon tetrachloride-administered group. Figure 2 These are photographs showing the results of Sirius red staining of liver tissue sections prepared from mice with chronic liver injury in the Examples, and show the results of the carbon tetrachloride-administered group. Figure 3 These are photographs showing the results of Hematoxylin-Eosin (HE) staining of liver tissue sections prepared from mice with chronic liver injury in the Examples, and show the results of the CCL1 inhibitor-administered group. Figure 4 These are photographs showing the results of Sirius red staining of liver tissue sections prepared from mice with chronic liver injury in the Examples, and show the results of the CCL1 inhibitor-administered group. Figure 5 It shows that according to Figures 1 to 4 The staining results of tissue sections shown are used to evaluate the inflammatory activity and fibrosis stage of each type based on Modified HAlgrading, and the results are graphically evaluated to evaluate the liver fibrosis rate. Figure 6 This graph shows the results of comparison of liver fibrosis rates in cirrhotic mice in two CCL1 inhibitor-administered groups (anti-CCL1 antibody or CCL1 antisense oligodeoxynucleotide (AS ODN)) and a phosphate-buffered saline (PBS)-administered control group in the Examples. DETAILED DESCRIPTION

[0011] The following description of preferred embodiments is merely illustrative and is not intended to limit the present invention, its application methods, or its uses.

[0012] One embodiment of the present invention is a pharmaceutical composition for preventing and treating liver fibrosis, characterized in that the pharmaceutical composition contains a target substance for inhibiting CCL1.

[0013] As mentioned above, liver fibrosis is caused by chronic inflammation in the liver, which activates hepatic stellate cells and myofibroblasts, overproduces extracellular matrix such as collagen, and inhibits matrix metalloproteinases, which are enzymes that degrade collagen fibers. In addition, Kupffer cells are well known as immune cells related to chronic inflammation of the liver. Kupffer cells produce various cytokines in response to chronic inflammation of the liver, activate hepatic stellate cells and myofibroblasts, and play an important role in the process of liver fibrosis. Kupffer cells present in the liver tissue of patients with cirrhosis are almost all M2b macrophages that produce IL-10 and CCL1 (IL-10 + CCL1 + cell).

[0014] There are macrophages that are specifically activated for various diseases in macrophages. The activated macrophages are generally divided into M1 macrophages and M2 macrophages. M1 macrophages secrete cytokines such as IL-12 and lNF-γ, causing inflammation. On the other hand, M2 macrophages produce cytokines such as TGF-β and IL-10, activate myofibroblasts, and play a role in tissue repair. In addition, M2 macrophages are subdivided into M2a macrophages, M2b macrophages, and M2c macrophages. It is well known that M2a macrophages and M2c macrophages link their fate to the rise and fall of IL-4, but M2b macrophages do not rely on environmental changes. While they produce the necessary cytokines (CCL1) themselves, they continue to be active for a long time. Because Kupffer cells, which possess characteristics of M2b macrophages, are prominently expressed in the liver tissue of patients with cirrhosis, they are believed to control liver fibrosis. The inventors of this case conceived of the possibility that drug development targeting only these M2b macrophages could lead to fewer side effects due to their high specificity.

[0015] Nearly all activated Kupffer cells in chronically inflamed livers are derived from peripheral blood monocytes that reactively infiltrate in response to inflammation. These Kupffer cells possess the characteristics of M2b macrophages. M2a and M2c macrophages, other activated M2 macrophages, can calm inflammation even when temporarily activated, but their activity ultimately decreases and their characteristics disappear within a short period of time. However, M2b macrophages, which comprise the majority of Kupffer cells in cirrhotic patients, persist for extended periods, continuously activating hepatic stellate cells and myofibroblasts, and consequently strongly promoting liver fibrosis.

[0016] To date, numerous studies have investigated liver fibrosis using macrophages as their target, but none have led to drug development. One reason for this is that none of these studies targeted activated Kupffer cells, which are specific to cirrhotic patients. The candidate substances used in these studies target not only Kupffer cells, the cause of liver fibrosis, but also various macrophages present throughout the body, outside the liver. This results in diminished efficacy and the development of various systemic side effects. Based on this background, the inventors of this case conceived of developing a novel treatment that, by focusing on the disease-specific properties of Kupffer cells present in cirrhosis, could target and inhibit only these target cells.

[0017] Moreover, this time, the inventors of this case focused on CCL1, a type of chemokine. CCL1 is secreted from activated M2b macrophages and activates macrophages, Th2 cells, and control T cells by binding to cells with Chemokine Receptor 8. The inventors of this case have clearly pointed out in previous studies that if the CCL1 production capacity of M2b macrophages is modified by gene therapy, the M2b macrophages can be drastically reduced, and the appearance of quiescent macrophages can be induced (see non-patent document 1). Specifically, the following content is shown, namely, the CCL1 production capacity of M2b macrophages is modified by a CCL1 inhibitor, so that the activated M2b macrophages revert to quiescent macrophages, and the activation is inhibited together with the locally distributed macrophages. In addition, liver fibrosis is improved by also directly inhibiting T cells. Utilizing these findings, the present invention uses a CCL1 inhibitor to control Kupffer cells and T cells, which have the characteristics of M2b macrophages that specifically exist in hosts exhibiting liver fibrosis, thereby inhibiting the effects of CCL1 and ultimately improving liver fibrosis.

[0018] The CCL1 antisense oligodeoxynucleotide (AS ODN), which is one of the CCL1 inhibitors used in this embodiment, is not particularly limited as long as it can inhibit the production of CCL1 in Kupffer cells. For example, a CCL1 AS ODN containing the sequence of SEQ ID NO: 1 below can be used in mice, and a CCL1 AS ODN containing the sequences of SEQ ID NOs: 2 to 23 below can be used in humans. Sequence number 1: GAAGCCCGAGAACATCAT Sequence number 2: CAGCTAGCAGCAAGCACA Sequence number 3: GATGATCTGCATGTCTTC Sequence number 4: TGTGGTGATGATCTGCA Sequence number 5: GGGCTGTGGTGATGATCT Sequence number 6: AAGCACACCAGGGCTGT Sequence number 7: CATCTGGAGAAGGGTACCTG Sequence number 8: CATTGGAGCAGATGGAGCTG Sequence number 9: AAGCCATGTGGTTTCCAGAG Sequence number 10: AAGGAATGGTGTAGGGCTGG Sequence number 11: CAGAGGGTTGGGGGTTGATG Sequence number 12: GCCATGTGGTTTCCAGAG Sequence number 13: GA GAAGGGTACCTGCATG Sequence number 14: CAACATCTGGAGAAGGGT Sequence number 15: GTCTTCTGGTCTGGCTTG Sequence number 16: ATGTCTTCTGGTCTGGCT Sequence number 17: CATGTCTTCTGGTCTGGC Sequence number 18: TGTGGTGATGATCTGCAT Sequence number 19: CTGTGGTGATGATCTGCA Sequence number 20: AGGGCTGTGGTGATGATC Sequence number 21: GGGCTGTGGTGATGATC Sequence number 22: AGGGCTGTGGTGATGAT Sequence number 23: CAGGGCTGTGGTGATGAT

[0019] In this embodiment, the CCL1 inhibitor may include, in addition to CCL1 AS ODN, anti-CCL1 antibodies, and RNA-based nucleic acid agents. The anti-CCL1 antibodies and RNA-based nucleic acid agents are not particularly limited as long as they can inhibit the production and effect of CCL1.

[0020] The pharmaceutical composition according to this embodiment contains the CCL1 inhibitor as a main ingredient and may also contain various additives. Examples of additives include sterile water, physiological saline, vegetable oil, emulsifiers, suspending agents, surfactants, stabilizers, flavoring agents, excipients, pH stabilizers, carriers, preservatives, and binders, and the types of additives are not particularly limited.

[0021] In this embodiment, the dosage form of the pharmaceutical composition is not particularly limited, and can be, for example, an oral dosage form or an injection, including, for example, tablets, capsules, granules, and sublingual preparations.

[0022] In the present embodiment, the method of administering the pharmaceutical composition is not particularly limited, and for example, oral administration, injection, etc. can be used.

[0023] In this embodiment, the subjects to which the pharmaceutical composition is applied are not particularly limited, and may be mammals, such as humans, mice, cows, goats, pigs, dogs, and cats.

[0024] The following examples provide detailed descriptions of the pharmaceutical compositions of the present invention. In this example, the effects of a CCL1 inhibitor on mice with chronic liver damage were investigated. The experimental methods and results are described below.

[0025] For C57 / BL6 mice, carbon tetrachloride (1.0 mg / kg / twice a week) was administered subcutaneously for 8 weeks, and chronic liver injury mice showing liver fibrosis were obtained, and carbon tetrachloride (1.0 mg / kg / twice a week) was administered subcutaneously for 12 weeks to complete cirrhosis mice. In the present embodiment, for the chronic liver injury mice obtained by administering carbon tetrachloride subcutaneously for 8 weeks as described above, mice to which carbon tetrachloride (1.0 mg / kg / twice a week) was administered subcutaneously for 4 weeks (a total of 12 weeks) (carbon tetrachloride administration group) were added, and mice to which CCL1 inhibitors (CCL1 AS ODN of the sequence of sequence number 1, 6.0 μg / kg / twice a week) were administered subcutaneously in other parts (CCL1 inhibitor administration group) were compared. Specifically, after 12 weeks of the above-mentioned administration, liver tissue was removed from each mouse using a conventional method, and liver tissue sections were prepared. HE staining and Sirius red staining ( Figures 1 to 4 ), the inflammatory activity and fibrosis stage of each group were assessed based on the well-known Modified HAI grading, and their liver fibrosis rates were assessed using BZ-X710 (microscope) and HALO (image analysis software). Figure 5 ).

[0026] like Figures 1 to 5 As shown, mice administered with the CCL1 inhibitor showed little inflammation and liver fibrosis compared to mice administered with carbon tetrachloride alone, indicating a preventive effect on inflammation and liver fibrosis.

[0027] Next, the effects of a CCL1 inhibitor on cirrhotic mice prepared by subcutaneously administering carbon tetrachloride (1.0 mg / kg twice weekly) for 12 weeks were evaluated in C57 / BL6 mice. Specifically, the cirrhotic mice were evaluated for fibrosis in the anti-CCL1 antibody-administered group (Mouse CCL1 / I-309 / TCA-3 Antibody, R&D SYSTEMS, #MAB8451, 10 μg / mouse, 3 times per week, subcutaneous injection, 4 weeks), the anti-CCL1 AS ODN-administered group (CCL1 AS ODN of SEQ ID NO: 1, 6.0 μg / kg, 2 times per week, subcutaneous injection, 4 weeks), and the PBS-administered group (the control group described above). Figure 6 The results are shown.

[0028] like Figure 6As shown, when comparing the groups in which CCL1 was inhibited by various methods with the group that received PBS, liver fibrosis was significantly improved in all groups. In particular, the improvement in liver fibrosis in the CCL1 AS ODN-treated group was even greater than that in the anti-CCL1 antibody-treated group.

[0029] The above results indicate that inhibiting CCL1 can improve both liver inflammation and liver fibrosis, and can also improve fibrosis in cirrhotic livers.

Claims

1. A pharmaceutical composition, characterized in that: The pharmaceutical composition comprises a CCL1 inhibitor and is used for preventing and treating liver fibrosis.

2. The pharmaceutical composition according to claim 1, wherein: The CCL1 inhibitor comprises a CCL1 AS ODN containing any one of SEQ ID NOs: 1 to 23 or an anti-CCL1 antibody.