MRNA recombinant capping enzyme
By designing a fusion protein containing an mRNA capping enzyme polypeptide linked to an Fh8 polypeptide and optimizing its expression in host cells, the problem of low capping enzyme productivity was solved, achieving efficient mRNA capping and improved translation efficiency.
Patent Information
- Application Number
- CN202380093587.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Priority Date
- 2022-12-15
- Filing Date
- 2023-12-15
- Publication Date
- 2025-09-16
AI Technical Summary
The existing capping enzyme production procedures used in mRNA manufacturing processes have the problem of low soluble yield, which makes it difficult to meet the needs of large-scale production.
A fusion protein comprising a messenger RNA (mRNA) capping enzyme polypeptide linked to an Fh8 polypeptide or a fragment thereof was designed, and the fusion protein was expressed in host cells using a codon-optimized nucleotide sequence and an expression vector to improve the solubility and yield of the capping enzyme.
The solubility and yield of the capping enzyme are improved, meeting the needs of large-scale mRNA manufacturing and enhancing the stability and translation efficiency of mRNA.
Smart Images

Figure BDA0005537543810000441 
Figure BDA0005537543810000731 
Figure BDA0005537543810000741
Abstract
Description
Background Art
[0001] The 5'-terminal m7G cap present on most eukaryotic mRNAs promotes translation at the initiation level. For most mRNAs, elimination of the cap structure results in a loss of stability (especially against exonuclease degradation) and a reduction in the formation of the mRNA initiation complex for protein synthesis.
[0002] Vaccinia capping enzymes D1-D12 and VP39 are commercially available and widely used for enzymatic capping in mRNA manufacturing processes using post-transcriptional in vitro capping.
[0003] The vaccinia RNA capping system consists of a multifunctional mRNA cap synthetase (D1 and D12 subunits) containing three catalytic domains: a triphosphatase (TPase), a guanylyltransferase (GTase), and an N7 methyltransferase (N7MTase). The 5′-triphosphate of the nascent mRNA is first hydrolyzed by the TPase to produce the 5′-diphosphate RNA, which is then transferred sequentially to other internal domains for capping and methylation, with the methylation reaction being allosterically stimulated by direct association with D12. The sequential reactions lead to the formation of cap-0, characterized by the addition of a guanine triphosphate group to the 5′-end via a head-to-head triphosphate group. Cap assembly is completed by the viral VP39, a bifunctional protein that catalyzes the addition of a methyl group to the ribose 02′ of the penultimate nucleotide, forming cap-1.
[0004] Currently, protein production procedures for the production of capping enzymes (such as D1, D12, and VP39 enzymes) used for enzymatic capping in mRNA manufacturing suffer from low soluble yields. There remains a need for more efficient reagents and methods for large-scale production of mRNA capping enzymes. Summary of the Invention
[0005] The present disclosure provides a fusion protein comprising a messenger RNA (mRNA) capping enzyme polypeptide linked to a Fh8 polypeptide or a fragment thereof.
[0006] In some embodiments, the Fh8 polypeptide or fragment thereof comprises an amino acid sequence that is at least 90% identical to the amino acid sequence set forth in SEQ ID NO:10.
[0007] In some embodiments, the Fh8 polypeptide or fragment thereof is linked to the N-terminus or C-terminus of the capping enzyme polypeptide.
[0008] In some embodiments, the capping enzyme polypeptide comprises a vaccinia virus D1 subunit.
[0009] In some embodiments, the vaccinia virus D1 subunit comprises an amino acid sequence that is at least 90% identical to the amino acid sequence set forth in SEQ ID NO: 1; and / or the fusion protein comprises an amino acid sequence that is at least 90% identical to the amino acid sequence set forth in SEQ ID NO: 3.
[0010] In some embodiments, the capping enzyme polypeptide comprises a vaccinia virus D12 subunit.
[0011] In some embodiments, the vaccinia virus D12 subunit comprises an amino acid sequence that is at least 90% identical to the amino acid sequence set forth in SEQ ID NO:2.
[0012] In some embodiments, the capping enzyme polypeptide comprises a vaccinia virus VP39 polypeptide or a fragment thereof.
[0013] In some embodiments, the VP39 polypeptide comprises an amino acid sequence that is at least 90% identical to the amino acid sequence set forth in SEQ ID NO:6, and / or the fusion protein comprises an amino acid sequence that is at least 90% identical to the amino acid sequence set forth in SEQ ID NO:4.
[0014] In some embodiments, the VP39 polypeptide fragment comprises an amino acid sequence that is at least 90% identical to the amino acid sequence set forth in SEQ ID NO:7, and / or the fusion protein comprises an amino acid sequence that is at least 90% identical to the amino acid sequence set forth in SEQ ID NO:5.
[0015] In some embodiments, the capping enzyme polypeptide comprises a Bluetongue virus VP4 polypeptide or a fragment thereof.
[0016] In some embodiments, the VP4 polypeptide comprises an amino acid sequence that is at least 90% identical to the amino acid sequence shown in SEQ ID NO:16; and / or the fusion protein comprises an amino acid sequence that is at least 90% identical to the amino acid sequence shown in SEQ ID NO:17, SEQ ID NO:18 or SEQ ID NO:22.
[0017] In one aspect, the present disclosure provides a polynucleotide comprising a nucleotide sequence encoding the above-mentioned fusion protein.
[0018] In some embodiments, the nucleotide sequence is codon-optimized.
[0019] In some embodiments, the nucleotide sequence is at least 90% identical to the nucleotide sequence set forth in SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:32, SEQ ID NO:33, or SEQ ID NO:37.
[0020] In one aspect, the present disclosure provides an expression vector comprising a polynucleotide described herein.
[0021] In one aspect, the present disclosure provides a host cell comprising the above-mentioned expression vector.
[0022] In some embodiments, the host cell is an E. coli cell.
[0023] In some embodiments, the E. coli cell is a BL21 (DE3) or Origami E. coli cell strain.
[0024] In one aspect, the disclosure provides a method of expressing a fusion protein, the method comprising culturing the host cell under conditions sufficient to express the fusion protein.
[0025] In some embodiments, the fusion protein is further isolated from the host cell.
[0026] In one aspect, the disclosure provides a method of capping an mRNA, the method comprising incubating the mRNA with the fusion protein under conditions sufficient to cap the mRNA with a cap 0 structure.
[0027] In one aspect, the present disclosure provides a method for converting a Cap 0 structure on an mRNA to a Cap 1 structure, the method comprising incubating the mRNA with the fusion protein under conditions sufficient to cap the mRNA with the Cap 1 structure.
[0028] In one aspect, the disclosure provides a method of capping an mRNA, the method comprising incubating the mRNA with the fusion protein under conditions sufficient to cap the mRNA with a Cap 1 structure.
[0029] In one aspect, the present disclosure provides a process for preparing mRNA, comprising a capping step, the capping step comprising: a) incubating the mRNA with the above-described fusion protein under conditions sufficient to cap the mRNA, b) optionally purifying the capped mRNA, c) optionally tailing the mRNA with a polyadenylation step, and d) optionally purifying the capped polyadenylated mRNA.
[0030] In one aspect, the present disclosure provides a capped mRNA obtained by the above method or by the above process. BRIEF DESCRIPTION OF THE DRAWINGS
[0031] Figure 1 The vaccinia RNA capping system is characterized, which consists of a multifunctional mRNA cap synthetase (D1 and D12 subunits) containing three catalytic domains, namely triphosphatase (TPase), guanylyltransferase (GTase), and N7 Methyltransferase (N7MTase). The 5'-triphosphate of the nascent mRNA is first hydrolyzed by TPase to produce a 5'-diphosphate RNA, which is then sequentially transferred to other internal domains for capping and methylation, where the methylation reaction is allosterically stimulated by direct association with D12. The sequential reactions lead to the formation of cap-0, characterized by the addition of a guanine triphosphate group to the 5'-end via a head-to-head sequence. Cap assembly is completed by viral VP39, a bifunctional protein that catalyzes the addition of a methyl group to the ribose 02' of the penultimate nucleotide, forming cap-1.
[0032] Figure 2 A- Figure 2 D depicts the map of the pET-28 plasmid designed for expression of D1 and D12 in E. coli. Figure 2 A is a map of a control plasmid without a soluble tag. Figure 2 B is a plasmid map of an experiment in which D1 has an N-terminal SUMO soluble tag. Figure 2 C is a plasmid map of an experiment in which D1 has an N-terminal Fh8 soluble tag. Figure 2 D is a plasmid map of an experiment in which D1 contains the N-terminal periplasmic targeting tag phoA.
[0033] Figure 3 A- Figure 3 C depicts a map of the pET-28-based plasmid designed for expression of VP39 in E. coli. Figure 3 A is a plasmid map in which VP39 has an N-terminal GST tag. Figure 3 B is a plasmid map in which VP39-C26 has an N-terminal GST tag. Figure 3 C is a plasmid map in which VP39 has an N-terminal Fh8 tag.
[0034] Figure 4 A- Figure 4 B is shown in detail in the E. coli host strain Artic Express ( Figure 4 A) or BL21(DE3)( Figure 4 B) Bar graph of the soluble expression patterns of D1-D12 expression plasmids with different soluble tags tested.
[0035] Figure 5This table summarizes the soluble expression patterns of D1-D12 constructs with different soluble tags tested in E. coli host strains ArcticExpress, Shuffle, BL21(DE3), and Origami. White boxes indicate no soluble expression was detected (no bands were seen on the gel), gray boxes indicate low soluble expression (faint but visible bands on the gel), and black boxes indicate high soluble expression (strong and clear bands on the gel).
[0036] Figure 6 is an image of an immunoblot JESS gel comparing soluble protein expression levels in E. coli BL21 cells transformed with a pET-28 plasmid containing His-Fh8-D1-D12 (lane 2) or a pET-28 plasmid containing His-D1-D12 (lane 3). Lane 1 contains a protein ladder.
[0037] Figure 7 A- Figure 7 C shows the results of optimizing expression induction conditions to increase soluble enzyme yield for the D1-D12 plasmid containing the Fh8-tagged D1 subunit transformed into E. coli BL21(DE3) cells. Figure 7 A is an image of a JESS immunoblot gel showing the soluble and total expression of the Fh8-tagged D1 subunit under the following conditions: no IPTG induction, or at OD 600 IPTG induction was performed at 0.1-0.4. Figure 7 B is the quantification of JESS gel images normalized to the protein concentration in the samples, and Figure 7 C is its graphical representation.
[0038] Figure 8 A- Figure 8 B shows the activity results of the Fh8-tagged D1-D12 enzyme in the capping reaction with RNA substrate. Figure 8 A is an image of a dot blot containing RNA substrate incubated with increasing concentrations of commercially available (from New England Biolabs (NEB)) D1-D12 or Fh8-tagged D1-D12 enzyme for 0, 10, 20, or 30 minutes and detected with anti-7mG cap antibody. Figure 8 B is a graph comparing the average reaction velocity (ng / min) / concentration (ng / ml) of commercially available D1-D12 or Fh8-tagged D1-D12 enzymes.
[0039] Figure 9Bar graph showing soluble protein expression yields from E. coli strains Arctic Express, Shuffle, BL21, Origami, or C41 transformed with plasmids containing His6-GST-tagged VP39, His6-GST-tagged VP39-C26, His6-Fh8-tagged VP39, or His6-Fh8-tagged VP39-C26 constructs following IPTG-induced growth in the BioFlo fermentation system. All constructs were codon-optimized by either Method A or Method B (indicated by the terminal "A" or "B" on each X-axis construct label).
[0040] Figure 10 A- Figure 10 B shows the results of soluble expression in E. coli BL21 (DE3) cells transformed with a plasmid containing Fh8-tagged VP39 C26 and grown in fermentors. Figure 10 A is in OD 600 JESS gel images of immunoblots of samples from E. coli BL21(DE3) cells transformed with a plasmid containing Fh8-tagged VP39 C26 before and after IPTG induction (0.1 mM IPTG) at 0.4 and 22°C. Figure 10 Table B shows the calculation of soluble VP39 enzyme using GST-tagged VP39 as a standard. The standard concentrations ranged from 0.025 to 0.2 mg / mL (see lanes 6 to 9).
[0041] Figure 11 Results are shown for the O-methyltransferase (OMT) activity of Fh8-VP39-C26 on cap-O RNA substrates. Promega's MTase-Glo assay was used. The O-methyltransferases tested used SAM as a methyl donor to methylate the target substrate, resulting in SAH production. TM The reagent converts SAH into ADP. Then MTase-Glo is added TM The assay solution converts ADP to ATP, which is detected via a luciferase reaction that produces detectable luminescence. Various amounts of each enzyme were used, along with a fixed amount of substrate and a fixed reaction time. SAH was used as a surrogate for Cap-1 (1:1 stoichiometry). The results of the O-methyltransferase (OMT) activity assay are plotted in a graph comparing the enzyme rate (expressed as the amount of S-adenosylhomocysteine (SAH) produced per hour) at each concentration (pmol) of commercially available VP39 (OMT NEB) or Fh8-tagged Fh8-VP39-C26.
[0042] Figure 12 A- Figure 12B shows the soluble expression pattern of VP4 in E. coli BL21(DE3) cells transformed with a plasmid containing a construct with a VP4 soluble tag. Figure 12 A is a bar graph representation of VP4 expression, and Figure 12 B is the quantification of immunoblot Jess gel images normalized to protein concentration. DETAILED DESCRIPTION
[0043] The present disclosure relates to a fusion protein comprising a messenger RNA (mRNA) capping enzyme polypeptide linked to a Fh8 polypeptide or a fragment thereof. Also provided are methods for preparing mRNA, comprising the step of capping using the capping enzyme described herein. definition
[0044] Unless otherwise defined herein, the scientific and technical terms used in conjunction with this disclosure should have the implication that those of ordinary skill in the art are usually understood. Although methods and materials similar to or equivalent to those described herein can also be used in the practice or test of this disclosure, exemplary methods and materials are described below. In the event of a conflict, this specification sheet, including the definition, should be used as the criterion. Usually, the nomenclature and technology used in conjunction with cell and tissue culture, molecular biology, virology, immunology, microbiology, genetics, analytical chemistry, synthetic organic chemistry, medicine and pharmaceutical chemistry, and protein and nucleic acid chemistry and hybridization described herein are those nomenclatures and technologies well known in the art and commonly used. Carry out enzymatic reaction and purification techniques as usually achieved in this area or as described herein according to the manufacturer's instructions. Further, unless the context requires otherwise, singular terms should include plural numbers, and plural terms should include singular numbers. Throughout the present specification and examples, the words "have" and "comprise" or variations (e.g., "has / having," "comprises / comprising") should be understood to imply the inclusion of a stated integer or group of integers but not the exclusion of any other integer or group of integers. All publications and other references mentioned herein are incorporated by reference in their entirety. Although a number of documents are cited herein, this citation does not constitute an admission that any of these documents forms part of the common general knowledge in the art.
[0045] It should be noted that the term "a" or "an" entity refers to one or more entities; for example, "a nucleotide sequence" should be understood to represent one or more nucleotide sequences. Therefore, the terms "a / an", "one or more", and "at least one" can be used interchangeably herein.
[0046] Furthermore, “and / or” where used herein should be taken as a specific disclosure of each of the two specified features or components with or without the other. Thus, the term “and / or” as used herein in phrases such as “A and / or B” is intended to include “A and B,” “A or B,” “A” (alone), and “B” (alone). Likewise, the term “and / or” as used in phrases such as “A, B, and / or C” is intended to cover each of the following: A, B, and C; A, B, or C; A or C; A or B; B or C; A and C; A and B; B and C; A (alone); B (alone); and C (alone).
[0047] It should be understood that wherever aspects are described herein with the language "comprising," similar aspects described as "consisting of" and / or "consisting essentially of" are also provided.
[0048] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure relates. For example, Concise Dictionary of Biomedicine and Molecular Biology, Juo, Pei-Show, 2nd ed., 2002, CRC Press; The Dictionary of Cell And Molecular Biology, 3rd ed., 1999, Academic Press; and Oxford Dictionary of Biochemistry And Molecular Biology, Revised Edition, 2000, Oxford University Press can provide one of ordinary skill with a general dictionary of many of the terms used in this disclosure.
[0049] Units, prefixes and symbols are all expressed in a form acceptable to the International System of Units (SI). Numerical ranges include numbers that limit the range. Unless otherwise indicated, amino acid sequences are written from left to right in the amino to carboxyl direction. The headings provided herein are not limitations on the various aspects of this disclosure. Therefore, the terms of the definitions immediately below are more fully defined by reference to the specification (in their entirety).
[0050] The term "approximately" or "about" is used herein to mean approximately, roughly, approximately, or around. When the term "approximately" is used in conjunction with a numerical range, it defines the range by extending the boundaries above and below the stated values. Generally speaking, the term "approximately" can define a numerical value to be above and below a stated value by, for example, 10% or more (higher or lower). In some embodiments, the term represents a deviation from the indicated value of ±10%, ±5%, ±4%, ±3%, ±2%, ±1%, ±0.9%, ±0.8%, ±0.7%, ±0.6%, ±0.5%, ±0.4%, ±0.3%, ±0.2%, ±0.1%, ±0.05%, or ±0.01%. In some embodiments, "approximately" represents a deviation from the indicated value of ±10%. In some embodiments, "approximately" represents a deviation from the indicated value of ±5%. In some embodiments, "approximately" represents a deviation from the indicated value of ±4%. In some embodiments, "approximately" represents a deviation from the indicated value of ±3%. In some embodiments, "approximately" represents a deviation from the indicated value of ±2%. In some embodiments, “about” means a deviation of ±1% from the indicated value. In some embodiments, “about” means a deviation of ±0.9% from the indicated value. In some embodiments, “about” means a deviation of ±0.8% from the indicated value. In some embodiments, “about” means a deviation of ±0.7% from the indicated value. In some embodiments, “about” means a deviation of ±0.6% from the indicated value. In some embodiments, “about” means a deviation of ±0.5% from the indicated value. In some embodiments, “about” means a deviation of ±0.4% from the indicated value. In some embodiments, “about” means a deviation of ±0.3% from the indicated value. In some embodiments, “about” means a deviation of ±0.1% from the indicated value. In some embodiments, “about” means a deviation of ±0.05% from the indicated value. In some embodiments, “about” means a deviation of ±0.01% from the indicated value.
[0051] The polynucleotides according to the present disclosure can be codon optimized. "Codon optimization" or "codon optimized" means that the polynucleotide sequence is optimized for the codon usage of the host organism (e.g., E. coli). The genetic code has 64 possible codons. Each codon consists of a sequence of three nucleotides. Codons that encode the same amino acid are called synonymous codons. During protein synthesis, species or genes typically tend to use one or a few specific synonymous codons, called optimal codons, a phenomenon known as codon usage bias. Codon usage tables contain experimentally derived data regarding the frequency with which each codon is used to encode a certain amino acid for the specific host organism (e.g., E. coli) for which the table was generated. For each codon, this information is expressed as a percentage (0 to 100%) or a fraction (0 to 1), i.e., the frequency with which the codon is used to encode the amino acid relative to the total number of times all codons that encode the amino acid are used. Codon usage tables are stored in public databases, such as the Codon Usage Database (Nakamura et al. (2000) Nucleic Acids Research 28(1), 292; available online at https: / / www.kazusa.or.jp / codon / ). The expression level of a protein is highly correlated with the codon usage bias of the host organism. Codon optimization involves increasing the optimal codon content of the host organism in a polynucleotide sequence without changing the amino acid sequence to promote expression of the recombinant gene in the host organism. Any codon optimization method can be used to generate the codon-optimized polynucleotides disclosed herein, and such methods are known to those skilled in the art (see, for example, the methods described in Al-Hawash et al. (2017), Gene Reports, Vol. 9, 46-53).
[0052] As used herein, the term "messenger RNA" or "mRNA" refers to a polynucleotide encoding at least one polypeptide. As used herein, mRNA encompasses both modified and unmodified RNA. mRNA may contain one or more coding regions and non-coding regions. The coding region may alternatively be referred to as an open reading frame (ORF). The non-coding regions in mRNA include a 5' cap, a 5' untranslated region (UTR), a 3' UTR, and a polyA tail. mRNA can be purified from natural sources, produced using a recombinant expression system (e.g., in vitro transcription), and optionally purified or chemically synthesized.
[0053] The present disclosure also includes fragments or variants of polypeptides and any combination thereof. When referring to the polypeptides of the present disclosure, the term "fragment" or "variant" includes any polypeptide that retains at least some properties (e.g., enzymatic activity or lytic activity) of the reference polypeptide. Fragments of polypeptides include C-terminal fragments and N-terminal fragments and deletion fragments, but do not include naturally occurring full-length polypeptides (or mature polypeptides). Variants of the polypeptides of the present disclosure include fragments as described above, and polypeptides with altered amino acid sequences due to amino acid substitutions, deletions or insertions. Variants can be naturally occurring or non-naturally occurring. Non-naturally occurring variants can be produced using mutagenesis techniques known in the art. Variant polypeptides can include conservative or non-conservative amino acid substitutions, deletions or additions. In certain embodiments, the fragment has a length of at least 20 amino acids, at least 30 amino acids, at least 40 amino acids, at least 50 amino acids or at least 60 amino acids. The enzymatic activity of the fragments can be assessed by any method known to those skilled in the art, such as a dot blot assay, and depending on the enzymatic activity being assessed, a GTP-PPi exchange assay, an inorganic pyrophosphatase assay, an RNA triphosphatase assay, a methyltransferase assay (e.g., the MTase Glo methyltransferase assay), or a guanylyltransferase assay.
[0054] "Capping enzymes" are one or more polypeptides having enzymatic activity that, in the presence of suitable reaction conditions, catalyze the attachment of a 5' cap to a messenger RNA molecule, thereby synthesizing capped RNA, including RNA having a cap 0 structure or a cap 1 structure. Generally, capping enzymes comprise the enzymatic activity of an RNA triphosphatase and an RNA guanylyltransferase, and optionally, the capping enzyme may also comprise the enzymatic activity of an RNA guanine-7-methyltransferase. Without limiting the present disclosure, vaccinia virus capping enzymes and bluetongue virus VP4 capping enzymes (including both their full length and enzymatically active portions) having these enzymatic activities that have been identified, purified, characterized, cloned, and expressed from clones are examples of capping enzymes (Moss et al. (1991), 266(3):1355-1358; J Biol Chem. Sutton et al. (2007), Nat Struct Mol Biol. 14(5):449-451). As used herein, "capping enzyme" is interchangeable with the term "cap synthetase."
[0055] A "fusion protein" is a protein produced by linking two or more genes that originally encode separate proteins or polypeptides. This typically involves removing the stop codon from the DNA sequence encoding the first protein and then appending the DNA sequence of the second protein in frame by ligation or overlap extension PCR. If more than two genes are fused, additional genes are added in frame in the same manner. The resulting DNA sequence can then be expressed as a single protein by the cell. In the context of the present disclosure, the fusion protein can be engineered to include: the complete sequence of the first and / or second protein, or only a fragment of the first and / or second protein (e.g., a capping enzyme polypeptide or fragment thereof linked to a Fh8 polypeptide or fragment thereof). The connection of two or more genes can be performed in any order. The first amino acid or nucleotide sequence can be directly linked or juxtaposed to the second amino acid or nucleotide sequence, or alternatively, an insertion sequence can covalently link the first sequence to the second sequence. In one embodiment, the first amino acid sequence can be linked to the second amino acid sequence by a peptide bond or a linker. The first nucleotide sequence can be linked to the second nucleotide sequence by a phosphodiester bond or a linker. The linker can be a peptide or polypeptide (for polypeptide chains) or a nucleotide or nucleotide chain (for multiple nucleotide chains) or any chemical moiety (for both polypeptide and polynucleotide chains).
[0056] As used herein, the term "linked" or "attached" or "fused" refers to the covalent or non-covalent linking of a first amino acid sequence or nucleotide sequence to at least a second amino acid sequence or nucleotide sequence, respectively, thereby producing a fusion protein. The term "linked" not only means the fusion of a first amino acid sequence to a second amino acid sequence at the C-terminus or N-terminus, but also includes the insertion of the entire first amino acid sequence (or second amino acid sequence) into any two amino acids in the second amino acid sequence (or first amino acid sequence, respectively). The term "linked" is also represented by a hyphen (-).
[0057] The present disclosure describes nucleic acid sequences (eg, DNA sequences and RNA sequences) and amino acid sequences that have a certain degree of identity to a given nucleic acid sequence or amino acid sequence, respectively (reference sequence).
[0058] The "sequence identity" between two nucleic acid sequences indicates the percentage of identical nucleotides between the sequences. The "sequence identity" between two amino acid sequences indicates the percentage of identical amino acids between the sequences.
[0059] The terms "% identical", "% identity" or similar terms are intended to refer in particular to the percentage of identical nucleotides or amino acids in an optimal alignment between the sequences to be compared. The percentages are purely statistical, and the differences between the two sequences may, but are not necessarily, randomly distributed over the entire length of the sequences to be compared. The comparison of two sequences is typically performed by comparing the sequences, after optimal alignment, over segments or "comparison windows" to identify local regions of corresponding sequences. Optimal alignment for comparison can be performed manually or with the aid of the local homology algorithm of Smith and Waterman, 1981, Ads App. Math. 2, 482, with the aid of the local homology algorithm of Needleman and Wunsch, 1970, J. Mol. Biol. 48, 443, with the aid of the similarity search algorithm of Pearson and Lipman, 1988, Proc. Natl Acad. Sci. USA 88, 2444, or with the aid of computer programs that use such algorithms (GAP, BESTFIT, FASTA, BLAST P, BLAST N, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Drive, Madison, Wis.).
[0060] The percent identity is obtained by determining the number of corresponding identical positions in the sequences being compared, dividing this number by the number of compared positions (eg, the number of positions in the reference sequence), and multiplying this result by 100.
[0061] In some embodiments, the degree of identity is given for a region that is at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% of the entire length of the reference sequence. For example, if the reference nucleic acid sequence consists of 200 nucleotides, the degree of identity is given for at least about 100, at least about 120, at least about 140, at least about 160, at least about 180, or about 200 nucleotides (in some embodiments, contiguous nucleotides). In some embodiments, the degree of identity is given for the entire length of the reference sequence.
[0062] A nucleic acid sequence or amino acid sequence having a specific degree of identity to a given nucleic acid sequence or amino acid sequence, respectively, can have at least one functional property of the given sequence, for example, and in some cases, is functionally equivalent to the given sequence. In some embodiments, a nucleic acid sequence or amino acid sequence having a specific degree of identity to a given nucleic acid sequence or amino acid sequence is functionally equivalent to the given sequence.
[0063] As used herein, the term "kit" refers to a packaged set of related components, such as one or more compounds or compositions and one or more related materials, such as solvents, solutions, buffers, instructions, or desiccant. D1-D12 mRNA capping enzyme
[0064] The vaccinia virus capping enzyme (VCE) helps add the 7-methylguanylate cap structure (cap-0) to the 5' end of RNA (Shuman, S. (1990). J. Biol. Chem. [Journal of Biological Chemistry] 265, 11960-11966). Vaccinia capping enzyme is composed of two subunits (D1 and D12). At a minimum, in order to perform mRNA capping, the system needs to contain a heterodimer of the large subunit D1 (about 97 kDa) and the small subunit D12 (about 33 kDa). The three enzyme functions include phosphatase activity (cleavage of the nascent 5' triphosphate of the mRNA into a diphosphate), guanylyltransferase activity (incorporation of a GTP molecule into the 5' end of the mRNA portion), and methylation activity (incorporation of a methyl group into the N7 position of the guanosine base). This process is as follows Figure 1 As shown, this is called mRNA capping.
[0065] The 5'-triphosphate of the nascent mRNA is first hydrolyzed by TPase to produce a 5'-diphosphate RNA, which is then sequentially transferred to other internal domains for capping and methylation, with the methylation reaction being allosterically stimulated by direct association with D12. This sequential reaction leads to the formation of cap-0, characterized by the head-to-head addition of a guanine triphosphate group to the 5'-end. Cap assembly is completed by viral VP39, a bifunctional protein that catalyzes the addition of a methyl group to the ribose 02' of the penultimate nucleotide, forming cap-1.
[0066] Previously, expression plasmids containing His6-tagged D1-D12 were described for purification of vaccinia virus capping enzymes. Fuchs et al. (2016), RNA, Vol. 22(9):1454-1466. However, improvements in the amount of enzyme required to produce capped RNA and the efficiency of the protein purification process are needed to accommodate the large-scale production methods required for manufacturing mRNA-based therapeutics.
[0067] As used herein, "D1-D12 mRNA capping enzyme" is interchangeable with the terms "vaccinia capping enzyme," "vaccinia capping complex," or "D1-D12 complex."
[0068] The fusion proteins described herein may comprise one or both subunits of the vaccine capping complexes D1 and D12.
[0069] In some embodiments, the fusion protein of the present disclosure comprises an mRNA capping enzyme protein comprising the amino acid sequence of the wild-type large subunit D1 (SEQ ID NO: 1) as shown in Table 1. In some embodiments, the amino acid sequence of the large subunit D1 has at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 1.
[0070] In some embodiments, the D1 amino acid sequence is encoded by a polynucleotide sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:27.
[0071] In some embodiments, the fusion protein of the present disclosure comprises an mRNA capping enzyme protein comprising the amino acid sequence of the wild-type small subunit D12 (SEQ ID NO: 2) as shown in Table 1. In some embodiments, the amino acid sequence of the small subunit D12 has at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 2.
[0072] In some embodiments, the D12 amino acid sequence is encoded by a polynucleotide sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:28.
[0073] The ability of the D1-D12 complex to cap nascent mRNA with the Cap 0 structure can be assessed by any method known to those skilled in the art, such as a dot blot assay (as described, for example, in Example 4). VP4 capping enzyme
[0074] As used herein, the terms "VP4," "VP4 capping enzyme," or "bluetongue virus capping enzyme" are used interchangeably and refer to the single-unit VP4 capping enzyme of bluetongue virus (BTV; a dsRNA orbivirus of the family Reoviridae). VP4 is a 76 kDa protein encoded by the BTV segment M4. This capping enzyme may be able to homodimerize via a putative leucine zipper located near the carboxyl terminus of the protein (Ramadevi et al. (1998), J Virol 72(4):2983-2990).
[0075] VP4 catalyzes mRNAm 7 All enzymatic steps required for GpppN cap synthesis are catalyzed. The stepwise process proceeds as follows: (1) 5'-triphosphate is hydrolyzed to diphosphate by RNA 5'-triphosphatase (RTPase); (2) GMP is added via the 5'-5' triphosphate bond using guanylyltransferase (GTase); and (3) a methyl group is transferred to the N7 position by (guanine-N(7)-)-methyltransferase (N7MTase) to yield Cap 0. Methylation then occurs at the 2'-hydroxyl group of the ribose sugar of the first nucleotide, catalyzed by (nucleoside-2'-O-)-methyltransferase (2'OMTase), to form the Cap 1 structure. Methyltransferases use S-adenosyl-L-methionine (AdoMet) as a methyl donor to generate S-adenosyl-L-homocysteine (AdoHcy) (Sutton et al. (2007), Nat Struct Mol Biol. 14(5):449-451).
[0076] The fusion proteins described herein may comprise a full-length VP4 sequence or a fragment thereof, particularly an enzymatically active fragment thereof. In some embodiments, the fragment of the VP4 polypeptide has a length of at least 50 amino acids, at least 100 amino acids, at least 200 amino acids, at least 250 amino acids, at least 300 amino acids, at least 350 amino acids, at least 400 amino acids, at least 450 amino acids, at least 500 amino acids, at least 550 amino acids, or at least 600 amino acids. The fragment of the VP4 polypeptide retains at least the enzymatic activity of the VP4 polypeptide, particularly the activity to catalyze mRNA mRNA expression. 7 The ability of GpppN to perform all enzymatic steps required for cap synthesis, i.e., to cap nascent mRNA with Cap 1 structure. The ability of the enzyme or its fragments to cap nascent mRNA with Cap 1 structure can be assessed by any method well known to those skilled in the art, such as dot blot assay.
[0077] In some embodiments, the VP4 polypeptide comprises an amino acid sequence that has at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to the amino acid sequence set forth in SEQ ID NO:16.
[0078] In some embodiments, the VP4 amino acid sequence is encoded by a polynucleotide sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO:31. mRNA cap-specific 2'-O-methyltransferase
[0079] As used herein, mRNA cap-specific 2'-O-methyltransferase (OMT) can convert cap 0 structure to cap 1 structure, such as Figure 1 shown.
[0080] As described herein, VP39 is an mRNA cap-specific 2'-O-methyltransferase. VP39 is derived from vaccinia virus and is approximately 39 kDa. At the 5' mRNA end, VP39 acts as a cap-specific mRNA (nucleoside-2'-O-)-methyltransferase. In the initial step of mRNA cap synthesis, the cap-0 structure (m7G(5')ppp(G / A)) is formed (Schnierle et al. (1992), PNAS [Proceedings of the National Academy of Sciences of the United States of America], Vol. 89: 2897-2901). VP39 acts on the cap-0 structure and converts cap-0 to cap-1 (m7G(5')ppp(Gm / Am)) by methylating the 2'-O position of the ribose of the first transcribed nucleotide in a S-adenosylmethionine (AdoMet)-dependent manner, thereby forming the cap-1 structure. (Schnierle, supra).
[0081] In some embodiments, the fusion proteins of the present disclosure comprise a VP39 enzyme protein comprising the amino acid sequence of wild-type VP39 (SEQ ID NO: 6) as shown in Table 1. In some embodiments, the amino acid sequence of VP39 has at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 6.
[0082] In some embodiments, the VP39 amino acid sequence is encoded by a polynucleotide sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:30.
[0083] The fusion proteins described herein can comprise a full-length VP39 sequence or a fragment thereof, particularly an enzymatically active fragment thereof. In some embodiments, the fragment of the VP39 polypeptide has a length of at least 50 amino acids, at least 100 amino acids, at least 200 amino acids, at least 250 amino acids, or at least 300 amino acids. The fragment of the VP39 polypeptide retains at least the enzymatic activity of the VP39 polypeptide, particularly the cap-specific mRNA (nucleoside-2′-O-)-methyltransferase activity, which enables the conversion of the cap 0 structure to the cap 1 structure. The cap-specific mRNA (nucleoside-2′-O-)-methyltransferase activity of the compound can be assessed by any method familiar to those skilled in the art, such as a dot blot assay or an MTase Glo methyltransferase assay (as shown in Example 8).
[0084] In some embodiments, the fusion protein disclosed herein comprises a mutant VP39 enzyme protein. In some embodiments, the mutant VP39 enzyme protein comprises a C-terminal truncation of 26 amino acids (i.e., VP39-C26). Thus, the mutant VP39-C26 enzyme protein is a VP39 polypeptide fragment. In some embodiments, the mutant VP39 enzyme protein comprises the amino acid sequence of SEQ ID NO: 7 as shown in Table 1. In some embodiments, the amino acid sequence of the mutant VP39 has at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 7. Label Soluble tags
[0085] In some embodiments, the fusion proteins of the present disclosure comprising an mRNA capping enzyme (e.g., D1, D12, D1-D12, VP39, and / or VP4 enzyme) comprise a soluble tag.
[0086] As used herein, a "soluble tag" refers to an amino acid sequence that is linked or fused to a protein of interest (e.g., an mRNA capping enzyme) to improve the solubility and expression of the protein. Examples of soluble tags are found in Costa et al. (2014), Front. Microbiol., Vol. 5(63): 1-20, and include small ubiquitin-related modifier (SUMO) tags, glutathione-S-transferase (GST) tags, maltose binding protein (MBP), and Fh8 tags as described herein.
[0087] SUMO
[0088] The soluble tag small ubiquitin-related modifier (SUMO) is a fusion tag that acts as both a chaperone and an initiator of protein folding. If the target protein is transported to inclusion bodies, the SUMO tag is usually used (Lee et al. (2008), Protein Sci, Vol. 17(7):1241-1248). There are at least four SUMO paralogs in vertebrates: SUMO-1, SUMO-2, SUMO-3, and SUMO-4. SUMO-2 and SUMO-3 are very similar in structure and function and are distinct from SUMO-1. Previously, D1-D12, which carry the SUMO soluble tag, have been reported to improve the yield of Escherichia coli Rosetta strain (Novagen) (US10995354 B2).
[0089] The amino acid sequence of SUMO is SEQ ID NO: 9 as shown in Table 1.
[0090] GST
[0091] As used herein, a GST tag is a wild-type glutathione S-transferase (GST) or a variant thereof. The GST tag can also be used as an affinity tag (e.g., binding to glutathione-agarose beads). VP39 has been successfully expressed as an N-terminally tagged GST fusion protein (Schnierle et al. (1994), J Biol Chem., Vol. 269(30):20700-20706). It has been reported that a GST-tagged VP39 mutant (VP39-C26) with the last 26 amino acids truncated at the C-terminus does not affect 2'-O-methyltransferase catalytic activity (Shi et al. (1996), RNA Journal, Vol. 2:88-101).
[0092] The amino acid sequence of the GST tag is SEQ ID NO: 8 as shown in Table 1.
[0093] MBP
[0094] As used herein, the MBP tag is wild-type maltose binding protein (MBP) or a variant thereof. The MBP tag can also be used as an affinity tag (eg, for binding to maltose-agarose beads).
[0095] The amino acid sequence of the MBP tag is SEQ ID NO: 15 as shown in Table 1.
[0096] Fh8
[0097] As used herein, the Fh8 tag is any protein or portion of a protein that can replace at least part of the activity of the Fh8 tag. The Fh8 tag is an 8kDa calcium-binding recombinant protein (GenBank ID AF213970) derived from the parasite Fasciola hepatica and previously used as part of its parasitic infection diagnostic program. Because Fh8 is a calcium-sensing protein, its structure changes upon binding to calcium, thereby exposing its hydrophobic residues, and thus can interact with target molecules such as phenyl-agarose hydrophobic resin (Costa et al. (2013), Protein Expression and Purification, Vol. 92: 163-170). The Fh8 tag has been used to enhance the expression of soluble proteins (Costa et al. (2013), Appl Microbiol Biotechnol., Vol. 97(15): 6779-6791). As used herein, the expressions "Fh8 polypeptide" and "Fh8 tag" are synonymous.
[0098] In some embodiments, the fusion proteins disclosed herein comprise an Fh8 tag comprising the amino acid sequence of SEQ ID NO: 10 as shown in Table 1. In some embodiments, the amino acid sequence of the Fh8 tag has at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 10. In some embodiments, a fragment of the Fh8 polypeptide has a length of at least 20 amino acids, at least 30 amino acids, at least 40 amino acids, at least 50 amino acids, or at least 60 amino acids. A fragment of the Fh8 polypeptide is a biologically active fragment of the Fh8 polypeptide. "Biologically active fragment of the Fh8 polypeptide" herein means that the Fh8 polypeptide retains at least some of the properties of the Fh8 polypeptide, particularly at least the lytic activity of the Fh8 polypeptide. The solubility activity of a compound can be assessed by any method known to those skilled in the art, such as SDS-PAGE / immunoblotting of the total or insoluble fraction and the soluble fraction using a relevant primary antibody (e.g., an antibody raised against a solubilization tag or fusion protein), a split-GFP assay (at least a kit commercialized by Sigma), or a kinetic solubility assay (e.g., turbidimetric assay, direct UV assay, or HPLC).
[0099] In some embodiments, the Fh8 tag amino acid sequence is encoded by a polynucleotide sequence having at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 29.
[0100] In some embodiments, the Fh8 polypeptide or fragment thereof is linked to the N-terminus or C-terminus of a capping enzyme polypeptide (eg, D1, D12, D1-D12, VP39, and / or VP4 enzyme).
[0101] In some embodiments, the Fh8 polypeptide or fragment thereof is linked to the N-terminus of the capping enzyme polypeptide D1, D12, D1-D12, or VP39.
[0102] In some embodiments, the Fh8 polypeptide or fragment thereof is linked to the C-terminus of the capping enzyme polypeptide VP4.
[0103] In some embodiments, the Fh8 polypeptide or fragment thereof is linked to the N-terminus of the capping enzyme polypeptide D1, D12, D1-D12, or VP39 and the C-terminus of the capping enzyme polypeptide VP4 enzyme. Periplasmic labeling
[0104] PhoA, lamb, malE, xynA, and pelB are periplasmic tags that can also be used as soluble tags. They are signal peptides (also called signal sequences) that are used to localize recombinant fusion proteins in the periplasm of host bacteria (Karyolaimos et al. (2019), Front. Microbial [Microbiology Frontier] 10(1511): 1-11; Karyolaimos and de Gier (2021), Front. Bioeng. Biotechnol [Bioengineering and Biotechnology Frontier] 9: 797334; Singh et al. (2013), Plos One [Public Library of Science One] 8(5): e63442). Affinity tags
[0105] In some embodiments, the fusion proteins of the present disclosure comprising an mRNA capping enzyme (e.g., D1, D12, D1-D12, VP39 and / or VP4 enzyme) further comprise an affinity tag.
[0106] An affinity tag is an amino acid sequence that is linked or fused to a protein of interest (e.g., an mRNA capping enzyme) to facilitate purification of the protein of interest. Examples of soluble tags can be found in Costa et al. (2014), Front. Microbiol., Vol. 5(63): 1-20 and include a His tag, an MBP tag, or a GST tag.
[0107] A His tag is a series of six or more consecutive histidine residues (e.g., six to ten histidine residues). The most common his tag is a hexahistidine tag, a His6 tag, which has a molecular weight of 0.8 kDa. In some embodiments, the fusion protein of the present disclosure comprising an mRNA capping enzyme (e.g., D1, D12, D1-D12, VP39, and / or VP4 enzyme) further comprises a His tag, such as a His6 tag. The GST affinity tag is the same as the GST polypeptide of the soluble tag described above. The MBP affinity tag is the same as the MBP polypeptide of the soluble tag described above. Fusion protein
[0108] In one aspect, disclosed herein is a fusion protein comprising a messenger RNA (mRNA) capping enzyme polypeptide linked to a Fh8 polypeptide or a fragment thereof.
[0109] Fh8 polypeptides are particularly defined herein. Fh8 polypeptide fragments are particularly defined herein. Fh8 polypeptide fragments are biologically active fragments as defined herein. In one embodiment, the fragment has a length of at least 20 amino acids, at least 30 amino acids, at least 40 amino acids, at least 50 amino acids, or at least 60 amino acids. For example, a Fh8 polypeptide or fragment thereof comprises an amino acid sequence that is at least 90% identical to the amino acid sequence set forth in SEQ ID NO: 10.
[0110] The capping enzyme polypeptide may comprise (i) a vaccinia virus D1 subunit and / or a vaccinia virus D12 subunit, (ii) a vaccinia virus VP39 polypeptide or a fragment thereof, or (iii) a bluetongue virus VP4 polypeptide or a fragment thereof. The vaccinia virus D1 subunit, the vaccinia virus D12 subunit, the vaccinia virus VP39 polypeptide, a fragment of the vaccinia virus VP39 polypeptide, the bluetongue virus VP4 polypeptide, and a fragment of the bluetongue virus VP4 polypeptide are particularly as defined herein.
[0111] In the fusion protein as defined herein, the Fh8 polypeptide or fragment thereof can be linked to the N-terminus or C-terminus of the capping enzyme polypeptide. In some embodiments, when the capping enzyme polypeptide comprises a VP4 polypeptide or fragment thereof, the Fh8 polypeptide or fragment thereof is linked to the C-terminus of the capping enzyme polypeptide. In some embodiments, when the capping enzyme polypeptide comprises a vaccinia virus D1 subunit and / or a vaccinia virus D12 subunit, or comprises a VP39 polypeptide, the Fh8 polypeptide or fragment thereof is linked to the N-terminus of the capping enzyme polypeptide. In some embodiments, when the Fh8 polypeptide or fragment thereof is linked to the C-terminus of the capping enzyme polypeptide, the fusion protein comprises a linker between the capping enzyme polypeptide and the Fh8 polypeptide or fragment thereof.
[0112] In some embodiments, the fusion protein as defined herein comprises a capping enzyme polypeptide comprising a vaccinia virus D1 subunit, optionally wherein the vaccinia virus D1 subunit comprises an amino acid sequence that is at least 90% identical to the amino acid sequence set forth in SEQ ID NO: 1; and / or the fusion protein comprises an amino acid sequence that is at least 90% identical to the amino acid sequence set forth in SEQ ID NO: 3.
[0113] In some embodiments, the fusion protein as defined herein comprises a capping enzyme polypeptide comprising a vaccinia virus D12 subunit, optionally wherein the vaccinia virus D12 subunit comprises an amino acid sequence that is at least 90% identical to the amino acid sequence shown in SEQ ID NO:2.
[0114] In some embodiments, the fusion protein as defined herein comprises a capping enzyme polypeptide comprising a vaccinia virus D1 subunit as defined herein and a vaccinia virus D12 subunit as defined herein, optionally wherein the vaccinia virus D1 subunit comprises an amino acid sequence that is at least 90% identical to the amino acid sequence set forth in SEQ ID NO: 1 and / or wherein the vaccinia virus D12 subunit comprises an amino acid sequence that is at least 90% identical to the amino acid sequence set forth in SEQ ID NO: 2.
[0115] In some embodiments, the fusion protein as defined herein comprises a capping enzyme polypeptide comprising a vaccinia virus VP39 polypeptide or a fragment thereof, optionally wherein the VP39 polypeptide comprises an amino acid sequence that is at least 90% identical to the amino acid sequence of SEQ ID NO:6, and / or wherein the fusion protein comprises an amino acid sequence that is at least 90% identical to the amino acid sequence of SEQ ID NO:4; or the VP39 polypeptide fragment comprises an amino acid sequence that is at least 90% identical to the amino acid sequence of SEQ ID NO:7, and / or wherein the fusion protein comprises an amino acid sequence that is at least 90% identical to the amino acid sequence of SEQ ID NO:5.
[0116] In some embodiments, the fusion protein as defined herein comprises a capping enzyme polypeptide comprising a bluetongue virus VP4 polypeptide or a fragment thereof, optionally wherein the VP4 polypeptide comprises an amino acid sequence that is at least 90% identical to the amino acid sequence shown in SEQ ID NO: 16; and / or the fusion protein comprises an amino acid sequence that is at least 90% identical to the amino acid sequence shown in SEQ ID NO: 17, SEQ ID NO: 18 or SEQ ID NO: 22.
[0117] In some embodiments, the fusion protein comprises at least one additional tag, optionally selected from the group consisting of a soluble tag, a periplasmic tag, and an affinity tag. The soluble tag, periplasmic tag, and affinity tag can be as defined herein. The soluble tag is, for example, a SUMO tag, a GST tag, or an MBP tag. The affinity tag is, for example, a His tag, a GST tag, or an MBP tag. In one embodiment, the Fh8 polypeptide is the only soluble tag in the fusion protein. In one embodiment, the fusion protein does not comprise a SUMO tag, a GST tag, or an MBP tag.
[0118] In some embodiments, the fusion protein comprises at least one protease cleavage site, particularly to enable removal of the tag after protein purification. In one embodiment, the fusion protein comprises a protease cleavage site between the capping enzyme polypeptide and the Fh8 polypeptide or fragment thereof. Any protease cleavage site known to those skilled in the art can be used. The protease cleavage site is, for example, a TEV protease cleavage site.
[0119] In some embodiments, the fusion protein comprises an amino acid sequence that has at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to the amino acid sequence shown in SEQ ID NO:3.
[0120] In some embodiments, the fusion protein comprises an amino acid sequence that has at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to the amino acid sequence shown in SEQ ID NO:4.
[0121] In some embodiments, the fusion protein comprises an amino acid sequence that has at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to the amino acid sequence shown in SEQ ID NO:5.
[0122] In some embodiments, the fusion protein comprises an amino acid sequence that has at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to the amino acid sequence shown in SEQ ID NO:17.
[0123] In some embodiments, the fusion protein comprises an amino acid sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the amino acid sequence shown in SEQ ID NO:18.
[0124] In some embodiments, the fusion protein comprises an amino acid sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the amino acid sequence shown in SEQ ID NO:22.
[0125] In some embodiments, the fusion protein is encoded by a polynucleotide sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO:23.
[0126] In some embodiments, the fusion protein is encoded by a polynucleotide sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:24.
[0127] In some embodiments, the fusion protein is encoded by a polynucleotide sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO:32.
[0128] In some embodiments, the fusion protein is encoded by a polynucleotide sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO:33.
[0129] In some embodiments, the fusion protein is encoded by a polynucleotide sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO:37. polynucleotides
[0130] In one aspect, disclosed herein is a polynucleotide comprising a nucleotide sequence encoding a fusion protein as defined herein. Optionally, the nucleotide sequence is codon-optimized.
[0131] In some embodiments, the polynucleotide comprises: a) a nucleotide sequence encoding a fusion protein and optionally having at least 90% identity to the nucleotide sequence shown in SEQ ID NO: 23, wherein the fusion protein comprises a His tag, a Fh8 polypeptide and a VP39 polypeptide, b) a nucleotide sequence encoding (i) a fusion protein and (ii) a D12 subunit, and optionally having at least 90% identity to the nucleotide sequence shown in SEQ ID NO: 24, wherein the fusion protein comprises a His tag, an Fh8 polypeptide and a D1 subunit, c) a nucleotide sequence encoding a fusion protein and optionally having at least 90% identity to the nucleotide sequence shown in SEQ ID NO: 32, wherein the fusion protein comprises a VP4 polypeptide, a Fh8 polypeptide and a His tag, d) a nucleotide sequence encoding the fusion protein of (i) and optionally having at least 90% identity to the nucleotide sequence shown in SEQ ID NO: 33, wherein the fusion protein comprises a VP4 polypeptide, a TEV protease cleavage site, a Fh8 polypeptide and a His tag, e) a nucleotide sequence encoding the fusion protein of (i) and optionally having at least 90% identity to the nucleotide sequence shown in SEQ ID NO: 36, wherein the fusion protein comprises a VP4 polypeptide, a Fh8 polypeptide and a His tag, f) a nucleotide sequence encoding the fusion protein of (i) and optionally having at least 90% identity to the nucleotide sequence shown in SEQ ID NO: 37, wherein the fusion protein comprises a His tag, a Fh8 polypeptide and a VP4 polypeptide, g) a nucleotide sequence encoding a fusion protein, wherein the fusion protein comprises a D1 subunit linked to an Fh8 polypeptide, and optionally, wherein the sequence encoding the D1 subunit is at least 90% identical to the sequence of SEQ ID NO: 27, and / or the sequence encoding the Fh8 polypeptide is at least 90% identical to the sequence of SEQ ID NO: 29, h) a nucleotide sequence encoding a fusion protein, wherein the fusion protein comprises a D12 subunit linked to a Fh8 polypeptide, and optionally, wherein the sequence encoding the D12 subunit is at least 90% identical to the sequence of SEQ ID NO: 28, and / or the sequence encoding the Fh8 polypeptide is at least 90% identical to the sequence of SEQ ID NO: 29, i) a nucleotide sequence encoding a fusion protein, wherein the fusion protein comprises a VP4 polypeptide linked to an Fh8 polypeptide, and optionally wherein the sequence encoding the VP4 polypeptide is at least 90% identical to the sequence corresponding to nucleotides 1 to 1938 of SEQ ID NO: 31, and / or the sequence encoding the Fh8 polypeptide is at least 90% identical to the sequence of SEQ ID NO: 29, j) a nucleotide sequence encoding a fusion protein, wherein the fusion protein comprises a VP39 polypeptide linked to an Fh8 polypeptide, and optionally, wherein the sequence encoding the VP39 polypeptide is at least 90% identical to the sequence of SEQ ID NO: 30, and / or the sequence encoding the Fh8 polypeptide is at least 90% identical to the sequence of SEQ ID NO: 29. In the polynucleotides disclosed herein, the His tag is optional. In the polynucleotides disclosed herein, the His tag can be replaced by a different affinity tag. In the polynucleotides disclosed herein, the TEV protease cleavage site is optional. In the polynucleotides disclosed herein, the TEV protease cleavage site can be replaced by a different cleavage site. carrier
[0132] In one aspect, disclosed herein are vectors comprising a polynucleotide sequence encoding an mRNA capping enzyme disclosed herein. The polynucleotide is, for example, as defined herein. Vectors include, but are not limited to, plasmids, phagemids, phage derivatives, animal viruses, and cosmids. Special purpose vectors may include expression vectors, replication vectors, probe generation vectors, sequencing vectors, and vectors optimized for in vitro transcription.
[0133] The expression of the polynucleotide sequence disclosed herein is driven by an RNA polymerase promoter. A variety of RNA polymerase promoters are known. In certain embodiments, the promoter can be a T7 RNA polymerase promoter. Other useful promoters can include, but are not limited to, T3 and SP6 RNA polymerase promoters. The consensus nucleotide sequences for T7, T3, and SP6 promoters are known. In certain embodiments, the promoter is constitutive. In other embodiments, the promoter is inducible (e.g., an IPTG inducible promoter).
[0134] Also disclosed herein are host cells (eg, bacterial cells) comprising a vector or RNA composition disclosed herein.
[0135] Vectors can be introduced into target cells using any of a variety of different methods, e.g., commercially available methods including, but not limited to, electroporation (Amaxa Nucleofector-II (Amaxa Biosystems, Cologne, Germany)), (ECM 830 (BTX) (Harvard Instruments, Boston, MA) or Gene Pulser II (BioRad, Denver, CO), Multiporator (Eppendorf, Hamburg, Germany), cationic liposome-mediated transfection using lipofection, polymer encapsulation, peptide-mediated transfection, bioballistic particle delivery systems such as a "gene gun" (see, e.g., Nishikawa, et al. (2001). Hum Gene Ther. 12(8):861-70 or TransIT-RNA transfection kit (Mirus, Madison, WI)).
[0136] Chemical means for introducing polynucleotides into host cells include colloidal dispersion systems such as macromolecular complexes, nanocapsules, microspheres, beads, and lipid-based systems (including oil-in-water emulsions, micelles, mixed micelles, and liposomes). An exemplary colloidal system for use as a delivery vehicle in vitro and in vivo is a liposome (e.g., an artificial membrane vesicle).
[0137] In addition, the expression vector preferably contains one or more selectable marker genes to provide a phenotypic characteristic for selection of transformed host cells, such as dihydrofolate reductase in E. coli, neomycin resistance, or kanamycin resistance.
[0138] In some embodiments, the vector comprises: a) a nucleotide sequence encoding a fusion protein as defined herein, wherein the fusion protein comprises (i) a vaccinia virus D1 subunit and / or a vaccinia virus D12 subunit, and (ii) an Fh8 polypeptide or a fragment thereof, b) optionally, a nucleotide sequence encoding (i) a fusion protein as defined herein, comprising the vaccinia virus D1 subunit linked to the Fh8 polypeptide or a fragment thereof, or (ii) a vaccinia virus D1 subunit or a fragment thereof (in particular in case the fusion protein encoded by the nucleotide sequence a) does not comprise a vaccinia virus D1 subunit, c) optionally, a nucleotide sequence encoding (i) a fusion protein as defined herein, comprising a vaccinia virus D12 subunit linked to an Fh8 polypeptide or a fragment thereof, or (ii) a vaccinia virus D12 subunit or a fragment thereof (particularly in case the fusion protein encoded by nucleotide sequence a) does not comprise a vaccinia virus D12 subunit, and d) Optionally, a nucleotide sequence encoding (i) a fusion protein as defined herein or (ii) a VP39 polypeptide or a fragment thereof, wherein the fusion protein comprises a VP39 polypeptide or a fragment thereof linked to a Fh8 polypeptide or a fragment thereof.
[0139] In some embodiments, the vector comprises a nucleotide sequence encoding a fusion protein as defined herein, wherein said fusion protein comprises a VP39 polypeptide or a fragment thereof linked to a Fh8 polypeptide or a fragment thereof.
[0140] In some embodiments, the vector comprises a nucleotide sequence encoding a fusion protein as defined herein, wherein said fusion protein comprises a VP4 polypeptide or a fragment thereof linked to a Fh8 polypeptide or a fragment thereof.
[0141] The vector containing the above-mentioned appropriate DNA sequence and appropriate promoter or regulatory sequence can be used to transform appropriate host cells to express the protein.
[0142] IPTG induction
[0143] As described herein, the T7 promoter is widely used in a large number of expression systems for E. coli protein expression using isopropyl-β-D-1-thiogalactoside (IPTG) induction. Expression can be induced by adding IPTG or an IPTG analog (e.g., isobutyl-C-galactoside (IBCG)). Depending on the selected plasmid, lactose or melibiose may also be suitable. The selection of inducer will depend on the expression system used and will be apparent to those of ordinary skill in the art. Other inducers may be used, and these inducers are described in more detail elsewhere (e.g., Miller and Reznikoff (1978), The Operon [operon], version 448S). Inducers can be used alone or in combination. Escherichia coli host strain
[0144] Protein expression in E. coli is one of the simplest methods for producing non-glycosylated proteins for analytical and production purposes. E. coli genome-scale engineering has been used to enhance recombinant protein expression, thereby generating strains suitable for protein expression. This engineering primarily involves introducing DNA mutations that affect protein synthesis, degradation, secretion, or folding, and can generate optimized E. coli expression strains for the synthesis of low-molecular-weight compounds in a manner similar to metabolic engineering (Makino et al. (2011), Microb Cell Fact, Vol. 10:32). For example, the ArticExpress strain (Agilent Technologies) improves protein processing at low temperatures. The BL21(DE3) strain lacks two proteases (Ion protease and OmpT), which reduces the degradation of heterologous proteins expressed in cells. BL21(DE3) is a strain widely used for producing recombinant proteins under the control of T7 RNA polymerase (Studier et al. (1986), J. Mol. Biol., Vol. 189:113-130).
[0145] Another example of an E. coli engineered host strain is an E. coli engineered strain that provides extra copies of rare tRNAs, such as the Rosetta strain (Invitrogen) and the BL21 Codon Plus strain (Novagen). A third example of an E. coli engineered host strain is a mutant strain that promotes disulfide bond formation and protein folding in the E. coli cytoplasm (through mutations in the glutathione reductase (gor) and thioredoxin reductase (trxB) genes to oxidize them and / or by co-producing the Dsb protein), such as the Origami strain (Novagen) or the Shuffle strain (New England Biolabs) (Lobstein et al. (2012), Microb Cell Fact., Vol. 11:56). A fourth example host strain of E. coli is one that has improved membrane protein synthesis, such as the C41 and C43 (Avidis) BL21 (DE3) mutant strains (Dumon-Seignovert et al. (2004), Protein Expr Purif., Vol. 37(1):203-206). Previously, it was reported that the soluble expression of D1-D12 with a His6 tag in E. coli BL21(DE3) was low (Fuchs et al. (2016), RNA, Vol. 22(9):1454-1466). Another group reported that D1-D12 with a SUMO soluble tag could improve the production of E. coli Rosetta strain (Novagen) (US10995354 B2). Methods for capping mRNA
[0146] In one aspect, disclosed herein is a method for capping mRNA, comprising incubating the mRNA with a fusion protein as defined herein, wherein the capping enzyme polypeptide comprises a vaccinia virus D1 subunit and / or a vaccinia virus D12 subunit, particularly for obtaining an mRNA having a cap 0 structure. The starting mRNA may be a nascent mRNA. If the fusion protein comprises a vaccinia virus D1 subunit but does not comprise a vaccinia virus D12 subunit, the mRNA is further incubated with (i) an additional fusion protein as defined herein or (ii) a vaccinia virus D12 subunit, wherein the capping enzyme polypeptide comprises a vaccinia virus D12 subunit. The fusion protein comprising the vaccinia virus D1 subunit is typically in the form of a complex with the additional fusion protein comprising the vaccinia virus D12 subunit or with the D12 subunit. Similarly, if the fusion protein comprises the vaccinia virus D12 subunit but does not comprise the vaccinia virus D1 subunit, the mRNA is also incubated with (i) an additional fusion protein as defined herein or (ii) a vaccinia virus D1 subunit, wherein the capping enzyme polypeptide comprises the vaccinia virus D1 subunit. The fusion protein comprising the vaccinia virus D12 subunit is typically in the form of a complex with the additional fusion protein comprising the vaccinia virus D1 subunit or with the D1 subunit. The step of incubating the mRNA with the fusion protein is performed under conditions sufficient to cap the mRNA with a cap 0 structure, wherein the capping enzyme polypeptide comprises a vaccinia virus D1 subunit and / or a vaccinia virus D12 subunit. The conditions sufficient to cap the mRNA with a cap 0 structure are well known to those skilled in the art and are the conditions typically used when using a D1-D12 complex. For example, the mRNA is first denatured by heating it at 65° C. for 5 minutes and then cooling it on ice for 5 minutes. The denatured mRNA is then incubated with the D1-D12 complex, for example, at 37° C. in the presence of a buffer, GTP, S-adenosylmethionine (SAM), and optionally a ribonuclease inhibitor for at least 30 minutes. For example, 0.1 pmol of complexed D1-D12 can be used per 1 pmol of RNA substrate.
[0147] In one aspect, disclosed herein is a method for capping mRNA, comprising incubating the mRNA with a first fusion protein as defined herein, wherein the capping enzyme polypeptide comprises a vaccinia virus D1 subunit and / or a vaccinia virus D12 subunit, and subsequently or simultaneously with incubating the mRNA with a second fusion protein as defined herein, wherein the capping enzyme polypeptide comprises a VP39 polypeptide or a fragment thereof, particularly for obtaining an mRNA having a cap 1 structure. The starting mRNA may be nascent mRNA. If the first fusion protein comprises a vaccinia virus D1 subunit but does not comprise a vaccinia virus D12, the mRNA is further incubated with (i) an additional fusion protein as defined herein, wherein the capping enzyme polypeptide comprises a vaccinia virus D12 subunit, or (ii) a vaccinia virus D12 subunit. The fusion protein comprising the vaccinia virus D1 subunit is typically in the form of a complex with the additional fusion protein comprising the vaccinia virus D12 subunit or with the D12 subunit. Similarly, if the first fusion protein comprises the vaccinia virus D12 subunit but does not comprise the vaccinia virus D1 subunit, the mRNA is further incubated with (i) an additional fusion protein as defined herein or (ii) a vaccinia virus D1 subunit, wherein the capping enzyme polypeptide comprises the vaccinia virus D1 subunit. The fusion protein comprising the vaccinia virus D12 subunit is typically in the form of a complex with the additional fusion protein comprising the vaccinia virus D1 subunit or with the D1 subunit. The step of incubating the mRNA with the first fusion protein and the second fusion protein is performed under conditions sufficient to cap the mRNA with the cap 1 structure. The conditions sufficient to cap the mRNA with the cap 1 structure are well known to those skilled in the art and are the conditions typically used when using the D1-D12 complex and the VP39 polypeptide. For example, the mRNA is first denatured by heating it at 65° C. for 5 minutes and then cooling it on ice for 5 minutes. The denatured mRNA is then incubated with the D1-D12 complex, for example, at 37° C. in the presence of a buffer, GTP, S-adenosylmethionine (SAM), and an optional ribonuclease inhibitor, for example, at least 30 minutes. For example, 0.1 pmol of the complexed D1-D12 can be used for every 1 pmol of RNA substrate. The second fusion protein (wherein the capping enzyme polypeptide comprises a VP39 polypeptide or a fragment thereof) is added simultaneously with the D1-D12 complex, or thereafter, for example, once the mRNA with a cap 0 structure is obtained. When the second fusion protein is added after the D1-D12 complex, the second fusion protein can be incubated with the mRNA with a cap 0 structure in the presence of a buffer and S-adenosylmethionine (SAM) at 37° C. for example, at least one hour. For example, 0.1 pmol of the second fusion protein can be used for every 1 pmol of mRNA substrate. The mRNA with a cap 0 structure can be denatured first, as disclosed above.
[0148] In one aspect, disclosed herein is a method for capping mRNA, comprising incubating the mRNA with a fusion protein as defined herein, wherein the capping enzyme polypeptide comprises a bluetongue virus VP4 polypeptide or a fragment thereof, particularly for obtaining an mRNA having a cap 1 structure. The starting mRNA may be nascent mRNA. The step of incubating the mRNA with the fusion protein is performed under conditions sufficient to cap the mRNA with the cap 1 structure. Conditions sufficient to cap the mRNA with the cap 1 structure are well known to those skilled in the art and are typically used when using a bluetongue virus VP4 polypeptide. For example, the mRNA is first denatured by heating it at 65°C for 5 minutes and then cooled on ice for 5 minutes. The denatured mRNA is then incubated with the fusion protein, for example, at 37°C in the presence of a buffer, GTP, S-adenosylmethionine (SAM), and optionally a ribonuclease inhibitor, for at least 1 hour. For example, 0.1 pmol of fusion protein can be used per 1 pmol of mRNA.
[0149] In one aspect, disclosed herein is a method for converting a Cap 0 structure on an mRNA to a Cap 1 structure, the method comprising incubating the mRNA with a fusion protein as defined herein, wherein the capping enzyme polypeptide comprises a VP39 polypeptide or a fragment thereof. The starting mRNA is an mRNA capped with a Cap 0 structure. The incubation step is performed under conditions sufficient to cap the mRNA with a Cap 1 structure. The conditions sufficient for capping the mRNA are well known to those skilled in the art and are typically used when using a VP39 polypeptide. For example, the mRNA having the Cap 0 structure is first denatured by heating at 65°C for 5 minutes and then cooled on ice for 5 minutes. The denatured mRNA is then incubated with the fusion protein, for example, at 37°C in the presence of a buffer and S-adenosylmethionine (SAM) for at least one hour. For example, 0.1 pmol of fusion protein can be used for every 1 pmol of mRNA.
[0150] The steps of the above methods may be combined and / or performed in combination with additional steps, as shown in the processes disclosed below.
[0151] In one aspect, disclosed herein is a process for preparing mRNA, the process comprising a capping step, the capping step comprising: a) incubating the mRNA with a fusion protein as defined herein, wherein the capping enzyme polypeptide comprises a vaccinia virus D1 subunit and / or a vaccinia virus D12 subunit, under conditions sufficient to cap the mRNA with a cap 0 structure, b) incubating the mRNA capped with the Cap 0 structure with a fusion protein as defined herein, under conditions sufficient to cap the mRNA with the Cap 1 structure, wherein the capping enzyme polypeptide comprises a VP39 polypeptide or a fragment thereof, d) optionally purifying the capped mRNA, e) optionally tailing the mRNA with a polyadenylation step, and f) optionally purifying the capped polyadenylated mRNA. Steps a) and b) may be performed as defined in the corresponding methods provided herein. Steps a) and b) may be performed simultaneously, or step b) may be performed after step a), in particular as defined herein.
[0152] In one aspect, disclosed herein is a process for preparing mRNA, the process comprising a capping step, the capping step comprising: a) incubating the mRNA with a fusion protein as defined herein, wherein the capping enzyme polypeptide comprises a Bluetongue virus VP4 polypeptide or a fragment thereof, under conditions sufficient to cap the mRNA with a Cap 1 structure, b) optionally purifying the capped mRNA, c) optionally tailing the mRNA with a polyadenylation step, and d) optionally purifying the capped polyadenylated mRNA. Step a) can be performed as defined in the corresponding methods provided herein. RNA
[0153] The capping enzyme composition disclosed herein is capable of capping an RNA molecule (e.g., mRNA) encoding a polypeptide of interest (e.g., an antigenic polypeptide). The RNA molecule may comprise at least one ribonucleic acid (RNA) comprising an ORF encoding the polypeptide of interest. In certain embodiments, the RNA is a messenger RNA (mRNA) comprising an ORF encoding the polypeptide of interest. In certain embodiments, the RNA (e.g., mRNA) further comprises at least one 5'UTR, 3'UTR, and / or a poly (A) tail. A.5' cap
[0154] The mRNA 5' cap can provide resistance to nucleases found in most eukaryotic cells and promote translation efficiency. Several types of 5' caps are known. The 7-methylguanosine cap (also known as the "m 7 G" or "cap-0") contains a guanosine linked to the first transcribed nucleotide via a 5'–5'-triphosphate bond.
[0155] The 5' cap is typically added as follows: first, an RNA terminal phosphatase removes one terminal phosphate group from the 5' nucleotide, leaving two terminal phosphates; then, guanosine triphosphate (GTP) is added to the terminal phosphate via a guanylyltransferase to produce a 5'5'5 triphosphate bond; then, the 7-nitrogen of guanine is methylated by a methyltransferase. Examples of cap structures include, but are not limited to, m7G(5')ppp, (5'(A, G(5')ppp(5')A, and G(5')ppp(5')G. Additional cap structures are described in U.S. Publication Nos. US2016 / 0032356 and US2018 / 0125989, which are incorporated herein by reference.
[0156] 5' capping of polynucleotides can be concomitantly accomplished during the in vitro transcription reaction using the following chemical RNA cap analogs according to the manufacturer's protocol to generate a 5'-guanosine cap structure: 3'-O-Me-m7G(5')ppp(5')G (ARCA cap); G(5')ppp(5')A; G(5')ppp(5')G; m7G(5')ppp(5')A; m7G(5')ppp(5')G; m7G(5')ppp(5')(2'OMeA)pG; m7G(5')ppp(5')(2'OMeA)pU; m7G(5')ppp(5')(2'OMeG)pG (New England BioLabs, Ipswich, MA; TriLink Biotechnologies).
[0157] 5'-Capping of the modified RNA can be accomplished post-transcriptionally using vaccinia capping enzyme to generate the Cap 0 structure: m7G(5')ppp(5')G. The Cap 1 structure can be generated using both the vaccinia capping enzyme and a 2'-O methyltransferase to generate: m7G(5')ppp(5')G-2'-O-methyl. The Cap 2 structure can be generated from the Cap 1 structure, followed by 2'-O-methylation of the 5' third-to-last nucleotide using a 2'-O methyl-transferase. The Cap 3 structure can be generated from the Cap 2 structure, followed by 2'-O-methylation of the 5' fourth-to-last nucleotide using a 2'-O methyl-transferase.
[0158] In certain embodiments, the mRNA of the present disclosure comprises a 5' cap selected from the group consisting of: 3'-O-Me-m7G(5')ppp(5')G (ARCA cap), G(5')ppp(5')A, G(5')ppp(5')G, m7G(5')ppp(5')A, m7G(5')ppp(5')G, m7G(5')ppp(5')(2'OMeA)pG, m7G(5')ppp(5')(2'OMeA)pU, and m7G(5')ppp(5')(2'OMeG)pG.
[0159] In certain embodiments, the mRNA of the present disclosure comprises a 5' cap: B. Untranslated region (UTR)
[0160] In some embodiments, the mRNA of the present disclosure includes a 5' and / or 3' untranslated region (UTR). In an mRNA, the 5' UTR begins at the transcription start site and continues to the start codon, but does not include the start codon. The 3' UTR begins immediately after the stop codon and continues until the transcription termination signal.
[0161] In some embodiments, the mRNA disclosed herein may comprise a 5'UTR comprising one or more elements that affect the stability or translation of the mRNA. In some embodiments, the 5'UTR may have a length of about 10 to 5,000 nucleotides. In some embodiments, the 5'UTR may have a length of about 50 to 500 nucleotides. In some embodiments, the 5'UTR has a length of at least about 10 nucleotides, a length of about 20 nucleotides, a length of about 30 nucleotides, a length of about 40 nucleotides, a length of about 50 nucleotides, a length of about 100 nucleotides, a length of about 150 nucleotides, a length of about 200 nucleotides, a length of about 250 nucleotides, a length of about 300 nucleotides, a length of about 350 nucleotides, a length of about 400 nucleotides, a length of about 450 nucleotides, a length of about 500 nucleotides, a length of about 550 nucleotides, a length of about 600 nucleotides, a length of about 650 nucleotides, a length of about 800 nucleotides, a length of about 800 nucleotides, a length of about 900 nucleotides, a length of about 900 nucleotides, a length of about 1000 nucleotides, a length of about 1500 nucleotides, a length of about 2000 nucleotides, a length of about 2500 nucleotides, a length of about 3000 nucleotides, a length of about 3500 nucleotides, a length of about 4000 nucleotides, a length of about 4500 nucleotides, a length of about 5000 nucleotides, a length of about 5500 nucleotides, a length of about 6000 nucleotides, a length of about 6500 nucleotides, a length of about In some embodiments, the present invention relates to a nucleic acid sequence of the present invention. The nucleic acid sequence of the present invention may be a length of about 0 nucleotides, a length of about 700 nucleotides, a length of about 750 nucleotides, a length of about 800 nucleotides, a length of about 850 nucleotides, a length of about 900 nucleotides, a length of about 950 nucleotides, a length of about 1,000 nucleotides, a length of about 1,500 nucleotides, a length of about 2,000 nucleotides, a length of about 2,500 nucleotides, a length of about 3,000 nucleotides, a length of about 3,500 nucleotides, a length of about 4,000 nucleotides, a length of about 4,500 nucleotides, or a length of about 5,000 nucleotides.
[0162] In some embodiments, the mRNA disclosed herein may comprise a 3'UTR comprising one or more of: a polyadenylation signal, a binding site for a protein that affects the stability of the location of the mRNA in the cell, or one or more binding sites for a miRNA. In some embodiments, the 3'UTR may have a length of 50 to 5,000 nucleotides or longer. In some embodiments, the 3'UTR may have a length of 50 to 1,000 nucleotides or longer. In some embodiments, the 3'UTR has a length of at least about 50 nucleotides, a length of about 100 nucleotides, a length of about 150 nucleotides, a length of about 200 nucleotides, a length of about 250 nucleotides, a length of about 300 nucleotides, a length of about 350 nucleotides, a length of about 400 nucleotides, a length of about 450 nucleotides, a length of about 500 nucleotides, a length of about 550 nucleotides, a length of about 600 nucleotides, a length of about 650 nucleotides, a length of about 700 nucleotides, a length of about a length of about 750 nucleotides, a length of about 800 nucleotides, a length of about 850 nucleotides, a length of about 900 nucleotides, a length of about 950 nucleotides, a length of about 1,000 nucleotides, a length of about 1,500 nucleotides, a length of about 2,000 nucleotides, a length of about 2,500 nucleotides, a length of about 3,000 nucleotides, a length of about 3,500 nucleotides, a length of about 4,000 nucleotides, a length of about 4,500 nucleotides, or a length of about 5,000 nucleotides.
[0163] In some embodiments, an mRNA disclosed herein may comprise a 5' or 3' UTR that is derived from a different gene than the gene encoded by the mRNA transcript (ie, the UTR is a heterologous UTR).
[0164] In certain embodiments, 5' and / or 3' UTR sequences can be derived from stable mRNA (e.g., globin, actin, GAPDH, tubulin, histone or citric acid cycle enzyme) to increase the stability of mRNA. For example, the 5' UTR sequence can include a CMV immediate early 1 (IE1) gene or a fragment thereof of a partial sequence to improve the nuclease resistance of mRNA and / or improve the half-life of mRNA. It is also contemplated that the sequence encoding human growth hormone (hGH) or a fragment thereof will be included in the 3' end or non-translated region of mRNA. Generally speaking, these modifications improve the stability and / or pharmacokinetic properties (e.g., half-life) of mRNA relative to its unmodified counterpart, and include, for example, modifications performed to improve the resistance of such mRNA to nuclease digestion in vivo.
[0165] Exemplary 5'UTRs include a sequence derived from the CMV immediate early 1 (IE1) gene (U.S. Publication Nos. 2014 / 0206753 and 2015 / 0157565, each of which is incorporated herein by reference) or the sequence GGGAUCCUACC (SEQ ID NO: 38) (U.S. Publication No. 2016 / 0151409, incorporated herein by reference).
[0166] In various embodiments, 5'UTR can be derived from the 5'UTR of TOP gene.The feature of TOP gene is typically the presence of 5'-terminal oligopyrimidine (TOP) bundle.In addition, the feature of most TOP genes is growth-related translation regulation.However, TOP genes with tissue-specific translation regulation are also known.In certain embodiments, the 5'UTR derived from the 5'UTR of TOP gene lacks 5'TOP motif (oligopyrimidine bundle) (for example, U.S. Publication Nos. 2017 / 0029847, 2016 / 0304883, 2016 / 0235864 and 2016 / 0166710, each of which is incorporated herein by reference).
[0167] In certain embodiments, the 5'UTR is derived from the ribosomal protein large 32 (L32) gene (U.S. Publication No. 2017 / 0029847, supra).
[0168] In certain embodiments, the 5'UTR is derived from the 5'UTR of the hydroxysteroid (17-b) dehydrogenase 4 gene (HSD17B4) (U.S. Publication No. 2016 / 0166710, supra).
[0169] In certain embodiments, the 5'UTR is derived from the 5'UTR of the ATP5A1 gene (U.S. Publication No. 2016 / 0166710, supra). In some embodiments, an internal ribosome entry site (IRES) is used in place of the 5'UTR.
[0170] In some embodiments, the 5'UTR comprises the nucleic acid sequence set forth in SEQ ID NO: 39, and is reproduced as follows: GGACAGAUCGCCUGGAGACGCCAUCCACGCUGUUUUGACCUCCAUAGAAGACACCGGGACCGAUCCAGCCUCCGCGGCCGGGAACGGUGCAUUGGAACGCGGAUUCCCCGUGCCAAGAGUGACUCACCGUCCUUGACACG (SEQ ID NO: 39).
[0171] In some embodiments, the 3'UTR comprises the nucleic acid sequence set forth in SEQ ID NO:40, and is reproduced as follows: CGGGUGGCAUCCCUGUGACCCCUCCCCAGUGCCUCCU GGCCCUGGAAGUUGCCACACUCCAGUGCCCACCAGCCUUGUCCU AAUAAAAUUAAGUUGCAUC (SEQ ID NO: 40).
[0172] The 5'UTR and 3'UTR are described in further detail in WO 2012 / 075040 (incorporated herein by reference). C. Polyadenylation tail
[0173] As used herein, the terms "poly (A) sequence", "poly (A) tail" and "poly (A) region" refer to the adenosine nucleotide sequence at the 3' end of an mRNA molecule. The poly (A) tail can impart stability to the mRNA and protect it from exonuclease degradation. The poly (A) tail can enhance translation. In some embodiments, the poly (A) tail is substantially a homopolymer. For example, a poly (A) tail of 100 adenosine nucleotides can substantially have a length of 100 nucleotides. In certain embodiments, the poly (A) tail can be interrupted by at least one nucleotide different from an adenosine nucleotide (e.g., a nucleotide that is not an adenosine nucleotide). For example, a poly (A) tail of 100 adenosine nucleotides can have a length of more than 100 nucleotides (including 100 adenosine nucleotides and at least one nucleotide or a section of nucleotides different from an adenosine nucleotide). In certain embodiments, the poly (A) tail comprises the sequence AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAGCAUAUGACUA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA (SEQ ID NO: 41).
[0174] As used herein, a "poly (A) tail" typically refers to RNA. However, in the context of the present disclosure, the term also refers to the corresponding sequence in a DNA molecule (e.g., a "poly (T) sequence").
[0175] The poly (A) tail may comprise from about 10 to about 500 adenosine nucleotides, from about 10 to about 200 adenosine nucleotides, from about 40 to about 200 adenosine nucleotides, or from about 40 to about 150 adenosine nucleotides. The poly (A) tail may be at least about 10, 50, 75, 100, 150, 200, 250, 300, 350, 400, 450, or 500 adenosine nucleotides in length.
[0176] In some embodiments where the nucleic acid is RNA, the poly(A) tail of the nucleic acid is obtained from a DNA template during in vitro transcription of the RNA. In certain embodiments, the poly(A) tail is obtained in vitro by conventional chemical synthesis methods without transcription from a DNA template. In various embodiments, the poly(A) tail is generated by enzymatic polyadenylation of the RNA (after in vitro transcription of the RNA) using a commercially available polyadenylation kit and corresponding protocols, or alternatively, by using an immobilized poly(A) polymerase, for example, using the methods and means described in WO 2016 / 174271.
[0177] The nucleic acid may comprise a poly(A) tail obtained by enzymatic polyadenylation, wherein the majority of the nucleic acid molecules comprise from about 100 (+ / - 20) to about 500 (+ / - 50) or about 250 (+ / - 20) adenosine nucleotides.
[0178] In some embodiments, the nucleic acid may include a poly(A) tail derived from the template DNA, and may further include at least one additional poly(A) tail produced by enzymatic polyadenylation, e.g., as described in WO 2016 / 091391.
[0179] In certain embodiments, the nucleic acid comprises at least one polyadenylation signal. D. Chemical modification
[0180] The mRNA disclosed herein can be modified or unmodified. In certain embodiments, the mRNA may include at least one chemical modification. In certain embodiments, the mRNA disclosed herein may contain one or more modifications that typically enhance RNA stability. Exemplary modifications may include backbone modifications, sugar modifications, or base modifications. In certain embodiments, the disclosed mRNA may be synthesized by naturally occurring nucleotides and / or nucleotide analogs (modified nucleotides) (including but not limited to purines (adenine (A) and guanine (G)) or pyrimidines (thymine (T), cytosine (C), and uracil (U)). In certain embodiments, the disclosed mRNA can be synthesized from modified nucleotide analogs or derivatives of purines and pyrimidines, such as, for example, 1-methyl-adenine, 2-methyl-adenine, 2-methylthio-N-6-isopentenyl-adenine, N6-methyl-adenine, N6-isopentenyl-adenine, 2-thio-cytosine, 3-methyl-cytosine, 4-acetyl-cytosine, 5-methyl-cytosine, 2,6-diaminopurine, 1-methyl-guanine, 2-methyl-guanine, 2,2-dimethyl-guanine, 7-methyl-guanine, inosine, 1-methyl-inosine, pseudouracil (5-uracil), dihydrouracil, 2-thio-uracil, 4-thio-uracil, 5-carboxy uracil, 5-(carboxyhydroxymethyl)-uracil, 5-fluoro-uracil, 5-bromo-uracil, 5-carboxymethylaminomethyl-uracil, 5-methyl-2-thio-uracil, 5-methyl-uracil, methyl N-uracil-5-oxyacetate, 5-methylaminomethyl-uracil, 5-methoxyaminomethyl-2-thio-uracil, 5'-methoxycarbonylmethyl-uracil, 5-methoxy-uracil, methyl uracil-5-oxyacetate, uracil-5-oxyacetic acid (v), 1-methyl-pseudouracil, quercetin, β-D-mannosyl-quercetin, phosphoramidate, phosphorothioate, peptide nucleotides, methylphosphonate, 7-deazaguanosine, 5-methylcytosine, and inosine.
[0181] In some embodiments, the disclosed mRNA may comprise at least one chemical modification including, but not limited to, pseudouridine, N1-methylpseudouridine, 2-thiouridine, 4'-thiouridine, 5-methylcytosine, 2-thiol-1-methyl-1-deaza-pseudouridine, 2-thiol-1-methyl-pseudouridine, 2-thiol-5-aza-uridine, 2-thiol-dihydropseudouridine, 2-thiol-dihydrouridine, 2-thiol-pseudouridine, 4-methoxy-2-thiol-pseudouridine, 4-methoxy-pseudouridine, 4-thiol-1-methyl-pseudouridine, 4-thiol-pseudouridine, 5-aza-uridine, dihydropseudouridine, 5-methyluridine, 5-methyluridine, 5-methoxyuridine, and 2'-O-methyluridine.
[0182] In some embodiments, the chemical modification is selected from the group consisting of pseudouridine, N1-methylpseudouridine, 5-methylcytosine, 5-methoxyuridine, and combinations thereof.
[0183] In some embodiments, the chemical modification comprises N1-methylpseudouridine.
[0184] In some embodiments, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% of the uridine nucleotides in the mRNA are chemically modified.
[0185] In some embodiments, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% of the uracil nucleotides in an ORF are chemically modified.
[0186] The preparation of such analogs is described, for example, in U.S. Pat. No. 4,373,071, U.S. Pat. No. 4,401,796, U.S. Pat. No. 4,415,732, U.S. Pat. No. 4,458,066, U.S. Pat. No. 4,500,707, U.S. Pat. No. 4,668,777, U.S. Pat. No. 4,973,679, U.S. Pat. No. 5,047,524, U.S. Pat. No. 5,132,418, U.S. Pat. No. 5,153,319, U.S. Pat. No. 5,262,530, and U.S. Pat. No. 5,700,642. E.mRNA synthesis
[0187] The mRNA disclosed herein can be synthesized according to any of a variety of methods. For example, the mRNA according to the present disclosure can be synthesized via in vitro transcription (IVT). Some methods for in vitro transcription are described, for example, in Geall et al. (2013) Semin. Immunol. 25(2):152-159; or Brunelle et al. (2013) Methods Enzymol. 530:101-14. Briefly, IVT is typically performed using a linear or circular DNA template containing a promoter, a ribonucleoside triphosphate pool, a buffer system that can include DTT and magnesium ions, an appropriate RNA polymerase (e.g., T3, T7, or SP6 RNA polymerase), DNase I, pyrophosphatase, and / or an RNase inhibitor. The exact conditions can vary depending on the particular application. The presence of these reagents is generally undesirable in the final mRNA product, and these reagents can be considered impurities or contaminants that can be purified or removed to provide a contaminant-free and / or homogeneous mRNA suitable for therapeutic use. While in some embodiments it may be desirable to provide mRNA from an in vitro transcription reaction, other sources of mRNA may be used in accordance with the present disclosure, including wild-type mRNA produced by bacteria, fungi, plants, and / or animals. Self-replicating RNA and trans-replicating RNA
[0188] Self-replicating RNA:
[0189] Self-replicating RNA can be produced by using the replication element that is derived from, for example, alphavirus and replacing structural viral protein with the nucleotide sequence of coding target protein (for example, antigenic polypeptide).Self-replicating RNA is typically a positive strand molecule, which can be directly translated after being delivered to the cell, and this translation provides RNA-dependent RNA polymerase, which then produces antisense and sense transcripts from the RNA delivered.Therefore, the RNA delivered makes a plurality of sub-RNAs produce.These sub-RNAs and colinear subgenomic transcripts can translate themselves to provide the in situ expression of encoded antigens, or can be transcribed to provide the further transcript with the same meaning as the RNA delivered, and these transcripts are translated to provide the in situ expression of antigens.The overall result of this transcription sequence is that the quantity of the replicon RNA introduced is a large number of amplifications, and therefore the coded antigen becomes the main polypeptide product of cell.
[0190] A kind of suitable system realizing self-replication in this way is to use the replicon based on alphavirus.These replicons are positive strand (sense strand) RNA, which causes the translation of replicase (or replicase-transcriptase) after being delivered to cell.Replicase is translated into polyprotein, and this polyprotein automatically cuts to provide replication complex, and this replication complex produces the genome chain copy of the RNA that positive strand is delivered.These negative (-) chain transcripts themselves can be transcribed to produce the further copy of positive strand parent RNA, and also produce the subgenomic transcript of encoding antigen.Therefore, the translation of subgenomic transcript makes infected cell in situ expression antigen.Suitable alphavirus replicon can use the replicase from Sindbis virus (Sindbis virus), Semliki forest virus (Semliki forest virus), eastern equine encephalitis virus (eastern equine encephalitisvirus), Venezuelan equine encephalitis virus (Venezuelan equine encephalitis virus) etc. Mutant or wild-type viral sequences may be used, for example, the attenuated TC83 mutant of VEEV has been used in replicons, see the following reference: WO 2005 / 113782, which is incorporated herein by reference.
[0191] In one embodiment, each self-replicating RNA described herein encodes (i) an RNA-dependent RNA polymerase that can transcribe RNA from a self-replicating RNA molecule, and (ii) a protein of interest. The polymerase can be an alphavirus replicase, for example, comprising one or more of the alphavirus proteins nsP1, nsP2, nsP3, and nsP4. Although the natural alphavirus genome also encodes structural virion proteins in addition to the non-structural replicase polyprotein, in certain embodiments, the self-replicating RNA molecule does not encode alphavirus structural proteins. Therefore, self-replicating RNA may lead to the production of copies of its own genomic RNA in the cell, but does not lead to the production of RNA-containing virions. The inability to produce these virions means that, unlike wild-type alphaviruses, self-replicating RNA molecules cannot make themselves permanent in an infectious form. The alphavirus structural proteins necessary for permanent existence in wild-type viruses do not exist in the self-replicating RNA of the present disclosure, and their positions are replaced by genes encoding the protein of interest, so that the subgenomic transcripts encode the protein of interest, rather than the alphavirus structural virion proteins. Self-replicating RNA is further described in detail in WO2011005799, which is incorporated herein by reference.
[0192] Trans-replicating RNA:
[0193] Trans-replicating RNA has elements similar to those of the above-mentioned self-replicating RNA. However, for trans-replicating RNA, two separate RNA molecules are used. The first RNA molecule encodes the above-mentioned RNA replicase (e.g., alphavirus replicase), and the second RNA molecule encodes a protein of interest (e.g., an antigenic prokaryotic polypeptide). RNA replicase can copy one or both of the first and second RNA molecules, thereby greatly increasing the copy number of the RNA molecule encoding the protein of interest. Trans-replicating RNA is further described in detail in WO 2017162265, which is incorporated herein by reference. Embodiments of the present disclosure
[0194] Example 1. A fusion protein comprising a messenger RNA (mRNA) capping enzyme polypeptide linked to a Fh8 polypeptide or a fragment thereof.
[0195] Example 2. The fusion protein of Example 1, wherein the fragment of the Fh8 polypeptide retains the lytic activity of the Fh8 polypeptide.
[0196] Embodiment 3. The fusion protein of embodiment 1 or 2, wherein the fragment of the Fh8 polypeptide has a length of at least 20 amino acids, at least 30 amino acids, at least 40 amino acids, at least 50 amino acids, or at least 60 amino acids.
[0197] Embodiment 4. The fusion protein of any one of embodiments 1 to 3, wherein the Fh8 polypeptide or fragment thereof comprises an amino acid sequence that is at least 90% identical to the amino acid sequence shown in SEQ ID NO: 10.
[0198] Embodiment 5. The fusion protein of any one of embodiments to 4, wherein the Fh8 polypeptide or fragment thereof is linked to the N-terminus or C-terminus of the capping enzyme polypeptide.
[0199] Embodiment 6. The fusion protein of any one of embodiments 1 to 5, wherein the capping enzyme polypeptide comprises a vaccinia virus D1 subunit.
[0200] Example 7. The fusion protein of Example 6, wherein the vaccinia virus D1 subunit comprises an amino acid sequence that is at least 90% identical to the amino acid sequence shown in SEQ ID NO: 1.
[0201] Embodiment 8. The fusion protein of embodiment 6 or 7, wherein the fusion protein comprises an amino acid sequence that is at least 90% identical to the amino acid sequence shown in SEQ ID NO: 3.
[0202] Embodiment 9. The fusion protein of any one of embodiments 1 to 8, wherein the capping enzyme polypeptide comprises a vaccinia virus D12 subunit.
[0203] Example 10. The fusion protein of Example 9, wherein the vaccinia virus D12 subunit comprises an amino acid sequence that is at least 90% identical to the amino acid sequence shown in SEQ ID NO: 2.
[0204] Embodiment 11. The fusion protein of any one of embodiments 1 to 5, wherein the capping enzyme polypeptide comprises a vaccinia virus VP39 polypeptide or a fragment thereof.
[0205] Example 12. The fusion protein of Example 11, wherein the fragment of the capping enzyme polypeptide has enzymatic activity.
[0206] Embodiment 13. The fusion protein of embodiment 11 or 12, wherein the fragment of the capping enzyme polypeptide has a length of at least 50 amino acids, at least 100 amino acids, at least 200 amino acids, at least 250 amino acids, or at least 300 amino acids.
[0207] Embodiment 14. The fusion protein of any one of embodiments 11 to 13, wherein the VP39 polypeptide comprises an amino acid sequence that is at least 90% identical to the amino acid sequence shown in SEQ ID NO: 6, or wherein the fusion protein comprises an amino acid sequence that is at least 90% identical to the amino acid sequence shown in SEQ ID NO: 4.
[0208] Example 15. A fusion protein as described in Example 14, wherein the VP39 polypeptide fragment comprises an amino acid sequence that is at least 90% identical to the amino acid sequence shown in SEQ ID NO:7, or wherein the fusion protein comprises an amino acid sequence that is at least 90% identical to the amino acid sequence shown in SEQ ID NO:5.
[0209] Embodiment 16. The fusion protein of any one of embodiments 1 to 5, wherein the capping enzyme polypeptide comprises a bluetongue virus VP4 polypeptide or a fragment thereof.
[0210] Embodiment 17. The fusion protein of embodiment 16, wherein the fragment of the capping enzyme polypeptide has enzymatic activity.
[0211] Embodiment 18. The fusion protein of embodiment 17, wherein the fragment of the capping enzyme polypeptide has RNA triphosphatase enzymatic activity, guanylyltransferase enzymatic activity, or methyltransferase enzymatic activity, or any combination thereof.
[0212] Embodiment 19. The fusion protein of any one of embodiments 16 to 18, wherein the fragment of the capping enzyme polypeptide has a length of at least 50 amino acids, at least 100 amino acids, at least 200 amino acids, at least 250 amino acids, at least 300 amino acids, at least 350 amino acids, at least 400 amino acids, at least 450 amino acids, at least 500 amino acids, at least 550 amino acids, or at least 600 amino acids.
[0213] Embodiment 20. The fusion protein of any one of embodiments 16 to 19, wherein the VP4 polypeptide comprises an amino acid sequence that is at least 90% identical to the amino acid sequence shown in SEQ ID NO: 16.
[0214] Embodiment 21. The fusion protein of embodiment 16 or 20, wherein the fusion protein comprises an amino acid sequence that is at least 90% identical to the amino acid sequence shown in SEQ ID NO: 17, SEQ ID NO: 18 or SEQ ID NO: 22.
[0215] Embodiment 22. A polynucleotide comprising a nucleotide sequence encoding the fusion protein of any one of embodiments 1 to 21.
[0216] Embodiment 23. The polynucleotide of embodiment 22, wherein the nucleotide sequence is codon-optimized.
[0217] Embodiment 24. The polynucleotide of embodiment 22 or 23, wherein the nucleotide sequence is at least 90% identical to the nucleotide sequence shown in SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 32, SEQ ID NO: 33 or SEQ ID NO: 37.
[0218] Embodiment 25. An expression vector comprising the polynucleotide of any one of embodiments 22 to 24.
[0219] Embodiment 26. A host cell comprising the expression vector of embodiment 25.
[0220] Embodiment 27. The host cell of embodiment 26, wherein the host cell is an Escherichia coli cell.
[0221] Embodiment 28. The host cell of embodiment 27, wherein the E. coli cell is a BL21 (DE3) or Origami E. coli cell strain.
[0222] Example 29. A method for expressing a fusion protein, comprising culturing the host cell of any one of Examples 26-28 under conditions sufficient to express the fusion protein.
[0223] Embodiment 30. The method of embodiment 29, wherein the fusion protein is further isolated from the host cell.
[0224] Example 31. A method of capping mRNA, comprising incubating the mRNA with the fusion protein of any one of Examples 1-10 under conditions sufficient to cap the mRNA with a cap 0 structure.
[0225] Example 32. A method for converting a cap 0 structure on an mRNA to a cap 1 structure, the method comprising incubating the mRNA with the fusion protein of any one of Examples 1-5 or 11-15 under conditions sufficient to cap the mRNA.
[0226] Example 33. A method of capping mRNA, comprising incubating the mRNA with the fusion protein of any one of Examples 1-5 or 16-21 under conditions sufficient to cap the mRNA with a Cap 1 structure.
[0227] Example 34. A method of capping mRNA, the method comprising incubating the mRNA with the fusion protein of any one of Examples 6-10 and the fusion protein of any one of Examples 11-15 under conditions sufficient to cap the mRNA with a Cap 1 structure.
[0228] Embodiment 35. The method of embodiment 34, wherein the fusion protein of any one of embodiments 6-10 is incubated before or simultaneously with the fusion protein of any one of embodiments 11-15.
[0229] Example 36. A process for preparing mRNA, the process comprising a capping step comprising: a) incubating the mRNA with a fusion protein as described in any of Examples 1-10 under conditions sufficient to cap the mRNA with a Cap 0 structure, b) incubating the mRNA capped with the Cap 0 structure with a fusion protein as described in any of Examples 11-15 under conditions sufficient to cap the mRNA with a Cap 1 structure, d) optionally purifying the capped mRNA, e) optionally tailing the mRNA with a polyadenylation step, and f) optionally purifying the capped polyadenylated mRNA.
[0230] Example 37. A process for preparing mRNA, comprising a capping step, the capping step comprising: a) incubating the mRNA with the fusion protein of any one of Examples 1-5 or 16-21 under conditions sufficient to cap the mRNA with a Cap 1 structure, b) optionally purifying the capped mRNA, c) optionally tailing the mRNA with a polyadenylation step, and d) optionally purifying the capped polyadenylated mRNA.
[0231] Embodiment 38. A capped mRNA obtained by the method of any one of embodiments 31-35, or by the process of embodiment 36 or 37.
[0232] In order to better understand the present disclosure, the following examples are described. These examples are for illustrative purposes only and are not to be construed as limiting the scope of the present disclosure in any way. Examples Example 1: Design of expression plasmids for improving the solubility of vaccinia capping enzyme D1 / D12
[0233] background
[0234] E. coli fusion tags can improve protein production titer, solubility, and folding, ultimately facilitating protein purification. Fusion tags designed to improve protein solubility are also known as soluble tags. However, fusion tags / soluble tags need to be customized based on the protein of interest, not only because each tag may target a different step in the protein purification procedure, but also because the protein of interest has unique properties that may present purification challenges.
[0235] Plasmid design for D1 / D12
[0236] To analyze whether the type of soluble tag affects the solubility of vaccinia capping complexes D1-D12, the following four plasmids were designed. Figure 2 A- Figure 2 As shown in D.
[0237] To ensure the stability of the D1-D12 complex, a dual T7 promoter system was used to drive the expression of the two subunits of the vaccinia capping enzyme, D1 and D12, in a pET28 vector suitable for E. coli transformation. Untagged D12 was co-purified in the D1-D12 complex formed upon its expression (Fuchs et al. (2016), RNA, Vol. 22(9):1454-1466). An N'-terminal His6 tag was added to D1 ( Figure 2 A, control, called pET-28a His6-D1-D12), with an N'-terminal SUMO fusion tag added to D1 ( Figure 2B, named pET-28a His6-SUMO-D1-D12), with an N'-terminal Fh8 fusion tag added to D1 ( Figure 2 C, termed pET-28a His6-Fh8-D1-D12), or with the addition of an N'-terminal phoA tag followed by a His6 tag to D1 ( Figure 2 D, termed pET-28a phoA-His6-D1-D12). The PhoA periplasmic tag is expressed at the N-terminus and is cleaved in the bacterial periplasm, exposing the His tag.
[0238] Other fusion periplasmic tags, including lamb, malE, xynA, and pelB, that share the same cleavage mechanism as PhoA in the bacterial periplasm were designed in a similar manner. All D1-D12 nucleotide sequences were codon-optimized (by codon optimization method A), except for the SUMO tag, for which a codon-optimized D1-D12 sequence construct (His6-SUMO-D1-D12.1) and a non-codon-optimized D1-D12 sequence construct (His6-SUMO-D1-D12) were constructed.
[0239] method
[0240] Transformation and generation of glycerol stock. Competent cells were then transformed using the plasmid according to the manufacturer's instructions. In brief, competent E. coli cell stock solutions (ArcticExpress (DE3), BL21 (DE3), Origami, Shuffle) stored in a -80°C refrigerator were thawed on ice and transferred to BD Falcon round-bottom tubes on ice. In order to improve transformation efficiency, β-mercaptoethanol was diluted 1:10 with dH2O, and 2 μl was added to the competent E. coli cells, and then the transformation procedure was performed. Subsequently, the cells were incubated on ice for 10 min. Next, 5 ng of plasmid (1 μl of 5 ng / μl stock solution) was added to the cells and incubated on ice for 30 min. The cells were then placed in a 42°C water bath for a heat pulse of 20 seconds and transferred to ice for 2 min. Preheated 0.9 ml (37°C) LB culture medium was added to the cell plus plasmid mixture, and the tube was incubated at 37°C for 1 hour, shaking at 220 rpm. 200 μl of each transformation reaction was plated onto LB plates and incubated overnight at 37°C. The next day, three colonies were picked from each transformation, inoculated into 1 ml of LB medium, and grown in a deep-well 96-well plate. The samples were incubated overnight at 37°C with shaking at 250 rpm. All media were supplemented with appropriate antibiotics.
[0241] To generate glycerol stock plates, dilute overnight cultures from deep-well 96-well plates 1:50. Add 100 μl of sterile 80% glycerol and 100 μl of culture to the wells of a clear 96-well cell culture plate. Prepare the plates, seal them with Thermo Fisher adhesive film, and store at -80°C. Example 2: Soluble expression of D1 / D12 with an N-terminal soluble tag
[0242] background
[0243] The D1-D12 expression plasmids designed in Example 1 were used to transform several E. coli host strains to test whether host cell selection could improve soluble protein expression. The engineered E. coli host strains included Artic Express, BL21 (DE3), Shuffle, and Origami.
[0244] method
[0245] Bacterial culture and induction conditions. To prepare growth cultures for enzyme expression, each clone was expanded so that each transformation had three clones and three technical replicates. The bacterial culture was backdiluted 1:50 and grown at 37°C for 3 hours with shaking at 220 rpm. After induction with 50 μM-1 mM IPTG, the temperature was lowered to 12°C-22°C. After overnight induction, the plates were centrifuged at 3500 rpm for 10 minutes to harvest the cells. The supernatant was decanted and the cell pellet was stored at -80°C.
[0246] Assessment of enzyme expression. Spin down 0.5–1 ml of cell samples at 4000 g for 10 min. Lyse the cell pellet using BugBuster Master Mix supplemented with protease inhibitors for 20 min at room temperature. Whole-cell lysate samples are then spun down and pelleted at 16,000 g for 10 min. Determine protein concentration using BCA assay and dilute samples to approximately 100 μg / ml with 0.1x JESS sample buffer. JESS standard package reagents are prepared according to the manufacturer's instructions. Mix the samples with 5x fluorescent master mix and denature at 95°C for 5 min. Load the samples onto the assay plate using a 1 / 10 dilution of the primary anti-his tag antibody and a 1 / 20 dilution of the secondary fluorescent-labeled antibody, following the manufacturer's recommendations. Spin the assay plate at 2500 g for 5 min and then load it into the JESS instrument.
[0247] result
[0248] All constructs were first screened for whole-cell expression. All constructs and strains showed high whole-cell expression (data not shown) and were further evaluated for soluble expression. The results of the soluble expression screen are summarized in Figure 5 middle.
[0249] Soluble expression of His6-D1-D12 was low in Arctic Express and Shuffle strains and undetectable in BL21(DE3). SUMO-tagged D1 and the codon-optimized variant His6-SUMO-D1-D12.1 had similar soluble expression patterns in E. coli Arctic Express or BL21(DE3) strains.
[0250] Advantageously, the soluble expression pattern of D1-D12 with the Fh8 tag was significantly higher than that of the His6-D1-D12 construct without the soluble tag or the SUMO-tagged construct in E. coli BL21 (DE3) and E. coli Origami. Other soluble tags tested (i.e., periplasmic phoA, pelB, malE, lamb, or XynA tags) did not improve the soluble expression of the fusion protein D1-D12. Figure 5 , column 4.
[0251] like Figure 4 A and Figure 4 As shown in Figure B, the choice of E. coli strain also affected the soluble expression pattern of the Fh8-tagged construct. Figure 4 As shown in B, the Fh8-tagged construct performed better than the other constructs when expressed in E. coli BL21(DE3). Figure 6 The JESS gel image also shows the degree of improvement of the D1-D12 construct with the Fh8 tag relative to the His6-D1-D12 construct without the soluble tag. Example 3: Optimization of induction conditions for soluble expression of His6-Fh8-D1-D12
[0252] background
[0253] In addition to the expression host strain, culture conditions (i.e., temperature, pH, induction time, and inducer concentration) may also have a significant impact on the production of soluble protein. Low temperature induction and induction with reduced amounts of inducer IPTG can improve the yield of soluble protein. The inventors tested another key parameter, the growth phase of the culture during induction, which is related to cell density and can be measured at OD 600nm for most E. coli strains.
[0254] method
[0255] To prepare a growing culture for enzyme expression, an overnight bacterial culture was diluted 1 / 250 in fresh LB medium and grown at 37°C with shaking at 220 rpm until the culture reached an OD of 600 The OD value measured at 4 °C reached 0.1-0.4. The temperature was then lowered to 16 °C and induced with 0.05-0.1 mM IPTG. After overnight induction, the cells were harvested by centrifugation at 6000 g for 20 min, the supernatant was decanted, and the cell pellet was stored at -80 °C.
[0256] result
[0257] To optimize the induction conditions, E. coli BL21(DE3) / pET28aHis6-Fh8-D1-D12 cells were cooled to 16°C and then cultured at different cell densities (OD 600 The results are summarized in Figure 7 The uninduced samples showed some low expression due to nonspecific promoter activity. Figure 7 B and Figure 7 As shown in C, the proportion of soluble protein is still as high as 50%. 600 Optimal expression levels and soluble fractions were observed when induced with IPTG at 4 0.5 % RI, with the soluble yield being twice that of the uninduced control. 600 The induction mainly produced insoluble products. Example 4: The enzyme activity of recombinant His6-Fh8-D1-D12 is improved compared to commercially available D1-D12
[0258] background
[0259] Any modification of a protein can adversely affect its biological activity. This is especially true for enzymes, where the catalytic site may become less efficient. The enzymatic activity of the recombinant His6-Fh8-D1-D12 enzyme produced in Example 2 was compared with that of commercially available D1-D12 (NEB) to assess whether the recombinant His6-Fh8-D1-D12 enzyme could be an attractive alternative to commercially available mRNA capping enzymes.
[0260] method
[0261] Capping reaction. 12.6 μl of RNA substrate was mixed with 17.4 μl of DEPC-water, incubated at 65°C for 5 minutes, and then cooled on ice for 5 minutes. The capping enzyme was diluted (1:10, 1:20, or 1:100) in capping buffer supplemented with 0.1 mg / ml BSA. The capping buffer was 50 mM Tris-HCl pH 8.0, 5 mM KCl, 1 mM MgCl2, and 1 mM DTT. To start the reaction, 5 μl of RNA substrate was added to samples containing different concentrations of NEB vaccinia capping enzyme or His6-Fh8-D1-D12 enzyme. The reaction was incubated in a 37°C water bath for 0, 10, 20, and 30 minutes. The reaction was supplemented with 0.5 mM GTP, 0.2 mM S-adenosylmethionine (SAM), and 0.1 pmol of D1 / D12 complex was used per 1 pmol of RNA substrate. To stop the reaction, 140 μl of extraction buffer was added to 10 μl of the reaction sample. Subsequently, 150 μl of phenol-chloroform mixture was added, mixed, and vortexed. The sample was then spun down at 12,000 g for 10 minutes to separate the phases. The aqueous phase (upper phase) was added to 1 μl of glycogen and 600 μl of cold ethanol. The sample was then incubated at -20°C overnight.
[0262] Dot blot analysis. The RNA capping sample prepared by the capping reaction detailed above was spun down to remove ethanol and then dissolved in 2 μl of DEPC-water. The nitrocellulose membrane was soaked in PBS for 5 minutes and then air-dried. RNA capping concentration standards were also prepared in DEPC-water. 1 μl of sample and standard were added to the membrane. Subsequently, the spotted RNA was cross-linked to the membrane using a UVP cross-linker for 2 minutes. The cross-linked RNA membrane was then washed with PBS-T buffer on an orbital shaker for 15 minutes to release unbound RNA and blocked with blocking solution on an orbital shaker for 1 hour at room temperature. The primary antibody (anti-7mG cap mouse monoclonal antibody (MBL)) was diluted 1:1000 in blocking solution and incubated overnight at 4°C. The next day, the membrane was washed three times with PBS-T for 5 minutes each. 1.5 ml of secondary antibody (anti-mouse HRP-conjugated antibody (Thermo Fisher Scientific)) diluted 1:5000 in blocking solution was incubated at room temperature for 1 hour. The membrane was washed three times for 15 minutes each with PBS-T on an orbital shaker. Capped RNA was visualized using the ECL prime kit according to the manufacturer's instructions, and the membrane was imaged using an iBright gel imager.
[0263] result
[0264] Unexpectedly, if Figure 8The enzyme activity of the recombinant His6-Fh8-D1-D12 enzyme was improved compared to that of a commercial RNA capping enzyme, as quantified by dot blot analysis shown in A. Furthermore, the recombinant His6-Fh8-D1-D12 enzyme achieved a similar reaction rate at one-fifth the concentration required for the commercial mRNA capping enzyme ( Figure 8 B) Thus, the recombinant His6-Fh8-D1-D12 enzyme has improved enzymatic activity compared to its commercially available counterpart. Example 5: Design of an expression plasmid for improving the solubility of vaccinia capping enzyme VP39
[0265] background
[0266] VP39 has been successfully expressed as an N-terminally tagged GST fusion protein (Schnierle et al. (1994), J Biol Chem., Vol. 269(30):20700-20706). It has been reported that a GST-tagged VP39 mutant (VP39-C26) with the last 26 amino acids truncated at the C-terminus does not affect its 2'-O-methyltransferase catalytic activity (Shi et al. (1996), RNA Journal, Vol. 2:88-101).
[0267] To understand whether the addition of the Fh8 soluble tag could also improve the purification of VP39, the Fh8 fusion tag was compared with the GST tag using full-length VP39 as well as the VP39-C26 mutant.
[0268] Plasmid design targeting VP39
[0269] As in Example 1, the pET-28a expression plasmid was selected. Genetic elements included a T7 promoter and an adjacent lac operator sequence to suppress uninduced expression. The following three plasmid maps containing VP39 or VP39-C26 were designed, as shown in FIG. Figure 3 A- Figure 3 C. An N-terminal His6 tag was added to VP39 ( Figure 3 A, control, called pET-38a His6-V39). An N-terminal His6 tag and a GST soluble tag were added to VP39-C26 ( Figure 3 B, termed pET-28a His6-GST-V39 C26). An N-terminal His6 tag and an Fh8 soluble tag were added to VP39 ( Figure 3 C, named pET-28a His6-Fh8-V39). Other plasmid designs were His6-GST-VP39 and His6-Fh8-VP39-C26 constructs. All constructs were prepared by method A or method B (in Figure 9Each construct marker on the X-axis is indicated by a terminal symbol "A" or "B" (denoted by a terminal symbol "A" or "B").
[0270] The transformation conditions and glycerol stock preparation were the same as those described in Example 1. Example 6: Soluble expression of VP39
[0271] Several E. coli host strains were transformed using the VP39 expression plasmids as described in Example 5. The methods and conditions were the same as described in Example 2 for soluble expression of the D1-D12 constructs.
[0272] result
[0273] Figure 9 Shown are the soluble expression patterns of His6-GST-VP39, His6-GST-VP39-C26, His6-Fh8-VP39, and His6-Fh8-VP39-C26 constructs in several E. coli host strains, in which the capping enzyme sequences were codon-optimized according to Method A or Method B. Surprisingly, in E. coli BL21(DE3), Fh8-tagged VP39 and the Fh8-tagged VP39-C26 mutant produced over 10-fold more soluble enzyme than constructs without or with a GST fusion tag, highlighting the advantage of using the Fh8 soluble tag for VP39 protein purification. Example 7: VP39-Fh8 production in fermenters
[0274] background
[0275] The His6-Fh8-VP39-C26-A construct was grown in a BioFlo fermentation system with an induction parameter of 0.1 mM IPTG at 22°C.
[0276] result
[0277] Samples were collected before and after IPTG induction and analyzed for soluble protein yield using quantitative JESS gel analysis. Figure 10 As shown in A. Using purified GST-tagged VP39 as a standard, the amount of soluble VP39 enzyme was estimated, as shown in Figure 10 The yield of soluble protein was 0.35 mg / ml culture, or approximately 1.4 g total for this fermentation run. This example demonstrates that Fh8-tagged VP39 can be expanded for future industrial fermentation programs. Example 8: Recombinant Fh8-VP39-C26 has improved activity compared to commercially available VP39
[0278] background
[0279] The enzymatic activity of the recombinant Fh8-VP39-C26 enzyme expressed in Examples 6 and 7 was compared with the commercially available VP39 enzyme (NEB) to evaluate whether the recombinant Fh8-VP39-C26 enzyme could be an attractive alternative to commercially available mRNA cap 2'-O-methyltransferases.
[0280] method
[0281] Methyltransferase activity assay. CapO substrate RNA was prepared as described in Example 4. Subsequently, CapO substrate RNA was incubated with Fh8-VP39-C26 enzyme or commercially available VP39 enzyme according to the experimental setup described in the manufacturer's instructions for the MTase-Glo methyltransferase assay (Promega). In short, after the methyltransferase reaction is complete, MTase-Glo reagent is added to convert the reaction product S-adenosylhomocysteine (SAH) into ADP. MTase Glo detection solution is then added to convert ADP into ATP, which is detected via a luciferase reaction. Luminescence is read using a Cytation plate reader in luminescence mode. Incubation with VP39 can be performed after or simultaneously with the generation of CapO on D1-D12.
[0282] mRNA was purified using NEB (Cat. No. T2040S) according to the manufacturer's instructions. RNA Cleanup Kit (50 μg) was used to purify the capped (cap-1) RNA.
[0283] result
[0284] The MTase-Glo methyltransferase assay (Promega) was used to test the methyltransferase activity of the recombinant Fh8-VP39-C26 enzyme or the commercially available VP39 enzyme (NEB). The results were expressed as reaction rates. The initial reaction rate of the recombinant Fh8-VP39-C26 enzyme was 30.15 pmol / h per 1 pmol of enzyme. The commercially available VP39 enzyme at a similar concentration produced 1.66-fold less SAH, indicating lower enzyme activity. Therefore, the recombinant Fh8-VP39-C26 enzyme had improved methyltransferase activity compared to its commercially available counterpart ( Figure 11 ). Example 9: Design and soluble expression of bluetongue virus capping enzyme VP4 with a soluble tag
[0285] introduce
[0286] To analyze whether the type of soluble tag affects the solubility of VP4, the following constructs were designed: VP4-His6, His6-SUMO-VP4, PhoA-His6-VP4, PhoAE-His6-VP4, His6-MBP-VP4, His6-Fh8-VP4, His6-Fh8-noTEV-VP4, VP4-noTEV-Fh8-His6, and VP4-TEV-Fh8-His6.
[0287] The N'- to C'-terminal topology of the VP4 constructs is retained in the nomenclature assigned to each VP4 construct. For example, a soluble tag preceding the word "VP4" indicates that the tag is located at the N'-terminus of the construct relative to the portion of the polynucleotide encoding VP4.
[0288] Some of the N'-terminal soluble tags tested for VP39 in the previous examples were also tested for VP4. In addition, some VP4 construct designs included a maltose binding protein (MBP) soluble / affinity tag, or a TEV protease cleavage site to facilitate tag removal after protein purification.
[0289] All nucleotide sequences encoding VP4 constructs were codon-optimized by either Method A or Method B.
[0290] method
[0291] Transformation and generation of glycerol stock solution. According to the manufacturer's instructions, plasmids were used to transform competent cells. In brief, competent E. coli cell stock solutions (Arctic Express (DE3), BL21 (DE3), Shuffle) stored in -80°C refrigerators were thawed on ice and transferred to BD Falcon round-bottom tubes on ice. In order to improve transformation efficiency, β-mercaptoethanol was diluted with dH2O at 1:10, and 2 μl was added to competent E. coli cells, and then the transformation procedure was performed. Subsequently, the cells were incubated on ice for 10 min. Next, 5 ng of plasmid (1 μl of 5 ng / μl stock solution) was added to the cells and incubated on ice for 30 min. The cells were then placed in a 42°C water bath for a heat pulse of 20 seconds and transferred to ice for 2 min. Preheated 0.9 ml (37°C) LB culture medium was added to the cell plus plasmid mixture, and the tube was incubated at 37°C for 1 hour, shaking at 220 rpm. 200 μl of each transformation reaction was plated onto LB plates and incubated overnight at 37°C. The next day, three colonies were picked from each transformation, inoculated into 1 ml of LB medium, and grown in a deep-well 96-well plate. The samples were incubated overnight at 37°C with shaking at 250 rpm. All media were supplemented with appropriate antibiotics.
[0292] To generate glycerol stock plates, dilute overnight cultures from deep-well 96-well plates 1:50. Add 100 μl of sterile 80% glycerol and 100 μl of culture to the wells of a clear 96-well cell culture plate. Prepare the plates, seal them with Thermo Fisher adhesive film, and store at -80°C.
[0293] Bacterial culture and induction conditions. To prepare growth cultures for enzyme expression, each clone was expanded to yield three clones and three technical replicates for each transformation. Bacterial cultures were back-diluted 1:500 and grown at 37°C with shaking at 220 rpm until the OD600 reached approximately 0.2. After induction with 50 μM-100 μM IPTG, the temperature was lowered to 14°C-22°C. After overnight induction, the cells were harvested by centrifugation at 3500 rpm for 10 minutes. The supernatant was decanted and the cell pellet was stored at -80°C.
[0294] Assessment of enzyme expression. A 1 ml cell sample was spun down at 4000 g for 10 min. The cell pellet was lysed at room temperature for 20 min using BugBuster Master Mix supplemented with protease inhibitors. The whole cell lysate sample was then spun down at 16000 g and pelleted for 10 min. Protein concentration was determined using BCA and the sample was diluted to approximately 100 ug / ml with 0.1x JESS sample buffer. JESS standard package reagents were prepared according to the manufacturer's instructions. The sample was mixed with 5x fluorescent master mix and denatured at 95°C for 5 min. The sample was loaded onto the assay plate using a 1 / 10 dilution of the primary his-tag antibody and a 1 / 20 dilution of the secondary fluorescent-labeled antibody as recommended by the manufacturer. The assay plate was spun down at 2500 g for 5 min and then loaded into the JESS instrument.
[0295] result
[0296] All VP4 constructs were first screened for whole-cell expression. All constructs and strains showed high whole-cell expression (data not shown) and were further evaluated for soluble expression. The results of the soluble expression screen are summarized in Figure 12 A- Figure 12 In B.
[0297] Soluble expression of the VP4 construct was low in the Shuffle strain, but better in BL21(DE3) or ArcticExpress(DE3) (data not shown). Most experiments were performed in the BL21(DE3) strain.
[0298] like Figure 12As shown, VP4 constructs with SUMO tags or periplasmic expression tags PhoA and PhoAE did not show improved soluble expression of VP4. VP4 constructs with N-terminal Fh8 or MBP tags showed improved soluble expression patterns compared to untagged VP4 (VP4-His6). VP4 constructs with C-terminal Fh8 tags showed high soluble expression of VP4.
[0299] Other embodiments of the disclosure will be apparent to those skilled in the art from consideration of the specification and practice of the disclosure disclosed herein. It is intended that the specification and examples be considered as exemplary only, with the true scope and spirit of the disclosure being indicated by the following claims.
[0300] All patents and publications cited herein are incorporated by reference in their entirety. sequence Table 1. Amino acid sequence Table 2. Nucleotide sequences
Claims
1. A fusion protein comprising a messenger RNA (mRNA) capping enzyme polypeptide linked to a Fh8 polypeptide or a fragment thereof. 2 . The fusion protein of claim 1 , wherein the Fh8 polypeptide or fragment thereof comprises an amino acid sequence that is at least 90% identical to the amino acid sequence shown in SEQ ID NO:
10. 3 . 3 . The fusion protein of claim 1 , wherein the Fh8 polypeptide or fragment thereof is linked to the N-terminus or C-terminus of the capping enzyme polypeptide.
4. The fusion protein of any one of claims 1 to 3, wherein the capping enzyme polypeptide comprises a vaccinia virus D1 subunit, optionally wherein: The vaccinia virus D1 subunit comprises an amino acid sequence that is at least 90% identical to the amino acid sequence shown in SEQ ID NO: 1; and / or The fusion protein comprises an amino acid sequence that is at least 90% identical to the amino acid sequence shown in SEQ ID NO:
3.
5. The fusion protein of any one of claims 1 to 4, wherein the capping enzyme polypeptide comprises a vaccinia virus D12 subunit, optionally wherein the vaccinia virus D12 subunit comprises an amino acid sequence that is at least 90% identical to the amino acid sequence shown in SEQ ID NO:
2.
6. The fusion protein of any one of claims 1 to 3, wherein the capping enzyme polypeptide comprises a vaccinia virus VP39 polypeptide or a fragment thereof, optionally wherein: The VP39 polypeptide comprises an amino acid sequence that is at least 90% identical to the amino acid sequence of SEQ ID NO: 6, and / or the fusion protein comprises an amino acid sequence that is at least 90% identical to the amino acid sequence of SEQ ID NO: 4; or The VP39 polypeptide fragment comprises an amino acid sequence that is at least 90% identical to the amino acid sequence shown in SEQ ID NO:7, and / or the fusion protein comprises an amino acid sequence that is at least 90% identical to the amino acid sequence shown in SEQ ID NO:
5.
7. The fusion protein of any one of claims 1 to 3, wherein the capping enzyme polypeptide comprises a bluetongue virus VP4 polypeptide or a fragment thereof, optionally wherein: The VP4 polypeptide comprises an amino acid sequence that is at least 90% identical to the amino acid sequence shown in SEQ ID NO: 16; and / or The fusion protein comprises an amino acid sequence that is at least 90% identical to the amino acid sequence shown in SEQ ID NO: 17, SEQ ID NO: 18 or SEQ ID NO:
22.
8. A polynucleotide comprising a nucleotide sequence encoding the fusion protein according to any one of claims 1 to 7, optionally wherein the nucleotide sequence is codon-optimized.
9. The polynucleotide of claim 8, wherein the nucleotide sequence is at least 90% identical to the nucleotide sequence shown in SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 32, SEQ ID NO: 33 or SEQ ID NO:
37.
10. An expression vector comprising the polynucleotide according to claim 8 or 9.
11. A host cell comprising the expression vector of claim 10, optionally wherein the host cell is an E. coli cell, optionally wherein the E. coli cell is a BL21 (DE3) or Origami E. coli cell strain.
12. A method for expressing a fusion protein, the method comprising culturing the host cell of claim 11 under conditions sufficient to express the fusion protein, optionally wherein the fusion protein is further isolated from the host cell.
13. A method for capping mRNA, the method comprising: a) incubating the mRNA with the fusion protein according to any one of claims 1 to 5 under conditions sufficient to cap the mRNA with the cap 0 structure, b) incubating the mRNA with a fusion protein according to claim 4 or 5 under conditions sufficient to cap the mRNA with the cap 1 structure and thereafter or simultaneously with incubating with a fusion protein according to claim 6, or c) incubating the mRNA with the fusion protein of any one of claims 1 to 3 or 7 under conditions sufficient to cap the mRNA with the Cap 1 structure.
14. A method for converting a cap 0 structure on an mRNA to a cap 1 structure, the method comprising incubating the mRNA with the fusion protein of any one of claims 1 to 3 or 6 under conditions sufficient to cap the mRNA.
15. A process for preparing mRNA, the process comprising a capping step, the capping step comprising: a) incubating the mRNA with the fusion protein according to any one of claims 1 to 5 under conditions sufficient to cap the mRNA with the cap 0 structure, b) incubating the mRNA capped with the Cap 0 structure with the fusion protein of claim 6 under conditions sufficient to cap the mRNA with the Cap 1 structure, d) optionally purifying the capped mRNA, e) optionally tailing the mRNA with a polyadenylation step, and f) optionally purifying the capped polyadenylated mRNA.
16. A process for preparing mRNA, the process comprising a capping step, the capping step comprising: a) incubating the mRNA with the fusion protein of any one of claims 1 to 3 or 7 under conditions sufficient to cap the mRNA with the cap 1 structure, b) optionally purifying the capped mRNA, c) optionally tailing the mRNA with a polyadenylation step, and d) optionally purifying the capped polyadenylated mRNA.
17. A capped mRNA obtained by the method of claim 13 or 14, or by the process of claim 15 or 16.
Citation Information
Patent Citations
Modification of RNA-related enzymes for enhanced production
US10995354B2
Lipid nanoparticle compositions and methods for mRNA delivery
US20140206753A1
Pulmonary delivery of mRNA to non-lung target cells
US20150157565A1
Quantitative assessment for cap efficiency of messenger RNA
US20160032356A1
Synergistic enhancement of the delivery of nucleic acids via blended formulations
US20160151409A1