Kit and method for stomach cancer diagnosis and screening and application of kit and method
Patent Information
- Application Number
- CN202380084520.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Priority Date
- 2022-12-08
- Filing Date
- 2023-12-08
- Publication Date
- 2025-09-16
AI Technical Summary
Existing gastric cancer screening methods have insufficient sensitivity and specificity, making it difficult to detect gastric cancer early. They are also highly invasive and costly, making them difficult to apply to large-scale population screening.
Single-plex or multiplex real-time fluorescence quantitative PCR detection method is used to detect the CpG methylation status of the promoter region of the Reprimo gene and/or CABIN1 gene, and Alu-C4 or ACTB is used as an internal reference for nucleic acid quality control and quantitative reference. It is developed for gastric cancer. Diagnostic and screening kits.
The specific and sensitive detection of gastric cancer patients in plasma samples has been achieved. The detection sensitivity is high and the specificity is strong. It is suitable for large-scale population screening and reduces the detection cost and invasiveness.
Smart Images

Figure CN120659893A_ABST
Abstract
Description
Kit, method and use thereof for gastric cancer diagnosis and screening Technical Field The present invention relates to the field of molecular biology detection technology, and in particular to a kit, method and use thereof for gastric cancer diagnosis and screening. Background Art Gastric cancer (GC) is one of the most common and highly prevalent digestive tract tumors in my country, and it poses a serious threat to people's lives and health. In recent decades, with the improvement of people's living conditions, the formation of good eating habits, and the eradication of Helicobacter pylori (H. pylori), the overall incidence of gastric cancer has declined, but the situation is still not optimistic. According to the 2016 my country Cancer Data Report [1], there were approximately 396,500 new cases of gastric cancer and approximately 288,500 deaths in my country. Its incidence and mortality rate ranked third among malignant tumors. The 5-year survival rate of gastric cancer patients is closely related to the intervention period. The 5-year survival rate of patients with advanced gastric cancer is less than 15%, while the 5-year survival rate of patients with early gastric cancer is more than 90%. However, the diagnosis and treatment rate of early gastric cancer in my country is less than 10%, which is much lower than that of Japan (70%) and South Korea (50%) where early screening for gastric cancer is popular [2]. Therefore, improving the level of early diagnosis and screening of gastric cancer is of great significance for controlling the increase in the incidence of gastric cancer, prolonging the survival of patients, and improving the quality of life. The incidence of gastric cancer in the natural population in my country is about 31.28 / 100,000, with a male incidence of 42.93 / 100,000 and a female incidence of 19.03 / 100,000 [3]. About half of gastric cancer patients have no alarm symptoms and early gastric cancer generally has no specific symptoms. Therefore, screening subjects should not be excluded due to the lack of specific symptoms. The mortality rate of gastric cancer increases with age. It is at a low level when the age is under 40 years old and rises rapidly after 40 years old. Therefore, it is recommended that 40 years old be the starting age for gastric cancer screening [2]. However, there is currently no simple, effective and highly compliant detection method for screening high-risk populations in my country. At present, the main means of gastric cancer screening in my country are endoscopic examination and serological examination. Among them, imaging examinations based on endoscopy (gastroscopy) are widely used in clinical and physical examinations. Combined with histopathological examination, gastroscopy can detect early gastric cancer mucosal changes and is the "gold standard" for gastric cancer diagnosis. However, gastroscopy still has problems such as difficulty in detecting type IIb early gastric cancer, unstable success rate of accurate biopsy specimen collection, and risk of misdiagnosis. Gastroscopy is an invasive examination with poor compliance, huge human and medical resource consumption, and is difficult to apply to large-scale population screening. There are also reports of upper gastrointestinal damage and cross infection caused by inexperienced operators or improper equipment cleaning. Painless endoscopic screening has good accuracy, but the cost is relatively high, and there is also a certain probability of missed diagnosis. Common serum tumor markers such as CEA and CA19-9 have a detection rate of less than 10% for early gastric cancer, and have low specificity for gastric cancer. They are usually used as prognostic monitoring indicators and are not recommended as screening indicators. PG is an inactive precursor of pepsinogen, which is divided into two subtypes, PGI and PGII. It is a good indicator of the exocrine function of the gastric body and antrum mucosa. When gastric mucosal atrophy occurs, the level of the above indicators decreases. In addition, Helicobacter pylori (Hp) is considered to be a Class I carcinogen for human gastric cancer. Serum Hp antibody detection and urea breath test (13C-UBT or 14C-UBT) can detect whether Hp is infected, thereby indicating whether the subject is at risk of gastric cancer. The combined detection of PGI, PGII and Hp can indicate an increased risk of gastric cancer, but it does not have significant specificity compared to certain gastric diseases such as atrophic gastritis. The development and progression of gastric cancer is a multifactorial process. In order to achieve more convenient, accurate, and high-compliance screening, it is of great significance to develop a highly sensitive and specific detection technology that can be used for early diagnosis of gastric cancer. In recent years, studies have found that there are abnormal gene methylation levels in DNA isolated from the plasma of tumor patients; abnormal methylation of plasma free DNA is an important molecular feature in the early occurrence and development of tumors. Studies have found that methylation detection of Reprimo and CABIN1 genes in plasma free DNA has potential application value in in vitro molecular diagnosis of gastric cancer. Reprimo is a glycosylated cytoplasmic protein located on human chromosome 2q23.3. As a downstream effector of p53, it causes G2 / M phase arrest of the cell cycle and has the effect of inhibiting cell proliferation[4]. It is reported that in gastric cancer, Reprimo acts as a tumor suppressor gene. Due to the abnormal methylation status of the promoter region, its expression is lost in some samples. In 2008, the Catholic University of Chile found that the Reprimo gene had abnormal methylation status in 97.7% (42 / 43) tissue samples and 95.3% (41 / 43) plasma samples of 43 gastric cancer patient samples, while only 9.7% (3 / 31) of the control group had DNA methylation, suggesting that it can be used as a non-invasive biomarker for gastric cancer diagnosis[5]. In 2011, Zhongnan Hospital of Wuhan University reported that Reprimo was silenced in 65 of 100 gastric cancer patient samples, and its expression inhibition was also correlated with tumor invasion and lymph node metastasis[6]. In 2015, the Catholic University of Chile reported again that the Reprimo gene was suppressed in 71 of 114 gastric cancer patients and was positively correlated with the invasiveness of gastric cancer [7]. In the same year, Shandong Linyi Cancer Hospital reported that 62% (31 / 60) of the Reprimo gene was abnormally methylated in the plasma samples of 50 gastric cancer patients, while this abnormal methylation was not detected in the plasma samples of 30 normal people [8]. In 2016, Fujian Normal University reported that 94.3% (33 / 35) of the Reprimo gene was abnormally methylated in the plasma samples of 35 gastric cancer patients, while in normal people, this abnormal methylation was not detected in the plasma samples of 30 normal people [9]. In plasma samples, only 2.4% (1 / 41) [9] were found. In 2017, Zhejiang Ningbo University integrated previous data and reported that Reprimo had a sensitivity of 82% and a specificity of 89% as a target for gastric cancer diagnosis.
[0010] The above reports and data suggest that the detection of Reprimo gene methylation in plasma has potential application value in in vitro molecular diagnosis of gastric cancer. CABIN1 is a calcineurin-binding protein located at human chromosome 22q11.23. According to studies, CABIN1 is a negative regulator of the tumor suppressor gene p53, and its downregulation leads to the activation of certain specific p53 target genes.
[0011] According to research from the University of Texas Andrews Cancer Research Center
[0012] , the MINT25 gene (CABIN1 gene promoter region-related sequence) was overmethylated in biopsy tissue samples of advanced gastric cancer, early gastric cancer, and gastric atypical hyperplasia, and was hypomethylated in adjacent cancer tissues and normal gastric mucosal tissues; the same difference in methylation levels of MINT25 methylation was also detected in the gastric lavage fluid of gastric cancer patients and non-cancer normal subjects, with a sensitivity of 90% (18 / 20) and a specificity of 96% (46 / 48), especially for early gastric cancer, with a detection rate of 83.3% (5 / 6). Overmethylation of MINT25 in gastric cancer and its precancerous lesions was also found in another study.
[0013] The methylation levels of MINT25 in normal or chronic gastritis gastric mucosal tissue, intestinal metaplasia gastric mucosal tissue, non-cancerous dysplasia or adenoma tissue, cancerous dysplasia or adenoma tissue, and T1 gastric adenocarcinoma tissue were 10-37%, 41%, 67-78%, 81%, and 90%, respectively, suggesting that its methylation may be an early event in the development of gastric cancer. Peking University Tang Fuchou's research team found
[0014] In plasma samples, the genomic methylation sequencing method of CABIN1 combined with DOCK10 and KCNQ5 had a detection sensitivity of 44%, 59%, 78% and 100% for stage I, II, III and IV gastric cancer, respectively, while ensuring 92% specificity, and could significantly distinguish between colorectal cancer and liver cancer subjects; among them, the detection performance of CABIN1 alone was particularly excellent. Summary of the invention In view of this, the purpose of the present invention is to provide a kit, method and use thereof for the diagnosis and screening of gastric cancer, using a single or multiplex real-time fluorescence quantitative PCR (qPCR) detection method to detect the methylation of the CpG-rich promoter region genes of the Reprimo gene and / or CABIN1 gene, wherein the human repetitive Alu gene consensus sequence (Alu-C4) or the human β-actin gene (ACTB) is used as an internal reference for nucleic acid quality control and quantitative reference. Based on the above objectives, the first aspect of the present invention provides a kit for gastric cancer diagnosis and screening, which comprises a promoter region for detecting the Reprimo gene and / or the CABIN1 gene. Reagents for domain CpG methylation. In a preferred embodiment of the present invention, the nucleotide sequence of the Reprimo gene detected is selected from the nucleotide sequences shown in SEQ ID NO.1, 2, 3, 4 and 5; preferably, the nucleotide sequence of the Reprimo gene detected is shown in SEQ ID NO.1. In a preferred embodiment of the present invention, the nucleotide sequence of the detected CABIN1 gene is selected from the nucleotide sequences shown in SEQ ID NO.6, 7, 8, 9, 10 and 11; preferably, the nucleotide sequence of the detected CABIN1 gene is shown in SEQ ID NO.6. In a preferred embodiment of the present invention, the above-mentioned kit further comprises a reagent for detecting methylation of the internal reference gene Alu-C4 or ACTB; Preferably, the nucleotide sequence of the detected internal reference gene Alu-C4 is shown in SEQ ID NO.12; Preferably, the nucleotide sequence of the detected internal reference gene ACTB is shown as SEQ ID NO.13. In a preferred embodiment of the present invention, the reagent for detecting CpG methylation in the promoter region of the Reprimo gene and / or CABIN1 gene and the reagent for detecting methylation of the internal reference gene Alu-C4 or ACTB include upstream primers, downstream primers and / or probes, respectively. In a preferred embodiment of the present invention, the reagent for detecting the methylation of the nucleotide sequence SEQ ID NO.1 in the promoter region of the Reprimo gene may include or be selected from the upstream primer of the nucleotide sequence shown in SEQ ID NO.14, the downstream primer of the nucleotide sequence shown in SEQ ID NO.15 and the probe of the nucleotide sequence shown in SEQ ID NO.16; and / or the reagent for detecting the methylation of the nucleotide sequence SEQ ID NO.2 in the promoter region of the Reprimo gene may include or be selected from the upstream primer of the nucleotide sequence shown in SEQ ID NO.17, the downstream primer of the nucleotide sequence shown in SEQ ID NO.18 and the probe of the nucleotide sequence shown in SEQ ID NO.19; and / or the reagent for detecting the methylation of the nucleotide sequence SEQ ID NO.3 in the promoter region of the Reprimo gene may include or be selected from the upstream primer of the nucleotide sequence shown in SEQ ID NO.20, the downstream primer of the nucleotide sequence shown in SEQ ID NO.21 and the probe of the nucleotide sequence shown in SEQ ID NO.22; and / or the reagent for detecting the methylation of the nucleotide sequence SEQ ID NO.4 in the promoter region of the Reprimo gene may include or be selected from the nucleotide sequence shown in SEQ ID NO. An upstream primer of the nucleotide sequence shown in SEQ ID NO.23, a downstream primer of the nucleotide sequence shown in SEQ ID NO.24, and a probe of the nucleotide sequence shown in SEQ ID NO.25; and / or the nucleotide sequence of the promoter region for detecting the Reprimo gene The reagent for methylating SEQ ID NO.5 may include or be selected from an upstream primer of the nucleotide sequence shown in SEQ ID NO.26, a downstream primer of the nucleotide sequence shown in SEQ ID NO.27, and a probe of the nucleotide sequence shown in SEQ ID NO.28. In a preferred embodiment of the present invention, the reagent for detecting the methylation of the nucleotide sequence SEQ ID NO.6 in the promoter region of the CABIN1 gene may include or be selected from the upstream primer of the nucleotide sequence shown in SEQ ID NO.29, the downstream primer of the nucleotide sequence shown in SEQ ID NO.30 and the probe of the nucleotide sequence shown in SEQ ID NO.31; and / or the reagent for detecting the methylation of the nucleotide sequence SEQ ID NO.7 in the promoter region of the CABIN1 gene may include or be selected from the upstream primer of the nucleotide sequence shown in SEQ ID NO.32, the downstream primer of the nucleotide sequence shown in SEQ ID NO.33 and the probe of the nucleotide sequence shown in SEQ ID NO.34; and / or the reagent for detecting the methylation of the nucleotide sequence SEQ ID NO.8 in the promoter region of the CABIN1 gene may include or be selected from the upstream primer of the nucleotide sequence shown in SEQ ID NO.35, the downstream primer of the nucleotide sequence shown in SEQ ID NO.36 and the probe of the nucleotide sequence shown in SEQ ID NO.37; and / or the reagent for detecting the methylation of the nucleotide sequence SEQ ID NO.9 in the promoter region of the CABIN1 gene may include or be selected from the nucleotide sequence SEQ ID NO. NO.38, a downstream primer of the nucleotide sequence shown in SEQ ID NO.39, and a probe of the nucleotide sequence shown in SEQ ID NO.40; and / or the reagent for detecting methylation of the nucleotide sequence SEQ ID NO.10 in the promoter region of the CABIN1 gene may include or be selected from the upstream primer of the nucleotide sequence shown in SEQ ID NO.41, a downstream primer of the nucleotide sequence shown in SEQ ID NO.42, and a probe of the nucleotide sequence shown in SEQ ID NO.43; and / or the reagent for detecting methylation of the nucleotide sequence SEQ ID NO.11 in the promoter region of the CABIN1 gene may include or be selected from the upstream primer of the nucleotide sequence shown in SEQ ID NO.44, a downstream primer of the nucleotide sequence shown in SEQ ID NO.45, and a probe of the nucleotide sequence shown in SEQ ID NO.46. In a preferred embodiment of the present invention, the reagent for detecting methylation of the internal reference gene Alu-C4 may include or be selected from an upstream primer of the nucleotide sequence shown in SEQ ID NO.47, a downstream primer of the nucleotide sequence shown in SEQ ID NO.48, and a probe of the nucleotide sequence shown in SEQ ID NO.49. In a preferred embodiment of the present invention, the reagent for detecting methylation of the reference gene ACTB may include or be selected from an upstream primer of the nucleotide sequence shown in SEQ ID NO.50, a downstream primer of the nucleotide sequence shown in SEQ ID NO.51, and a downstream primer of the nucleotide sequence shown in SEQ ID NO.52. Probes with the indicated nucleotide sequences. The second aspect of the present invention provides use of the reagent described in the first aspect in preparing a kit for diagnosing and screening gastric cancer and its early precancerous lesions. The third aspect of the present invention provides a method for diagnosing and screening gastric cancer, comprising the following steps: 1) extracting sample DNA; and 2) Determine the CpG methylation status of the nucleotide sequence selected from SEQ ID NOs. 1-5 in the promoter region of the Reprimo gene and / or the nucleotide sequence selected from SEQ ID NOs. 6-11 in the promoter region of the CABIN1 gene. In a further preferred embodiment of this aspect, the following steps are also included: 1) converting the extracted sample DNA with bisulfite; and 2) Using the above kit, perform real-time fluorescence quantitative PCR amplification on the sample DNA obtained in step 1), detect the fluorescence signal and determine the result. In a preferred embodiment of the third aspect, the reagents described in the first aspect, such as the primers and / or probes, are used to detect the nucleotide sequence in the promoter region of the Reprimo gene and / or CABIN1 gene. In the first and second aspects of the present invention, the methylation of the Reprimo gene, CABIN1 gene and / or the internal reference gene is detected by fluorescent PCR (single or multiplex), such as real-time fluorescent quantitative PCR. In the preferred embodiment of the fluorescent PCR method in the first, second and third aspects of the present invention, the probe is fluorescently labeled. In a further preferred embodiment, the fluorescent label includes but is not limited to FAM, TAMRA, VIC, BHQ1, CY3, CY5 and MGB. The beneficial effects of the present invention are: The present invention is based on gastric cancer-specific Reprimo and CABIN1 genes, such as methylation detection of specific nucleotide sequences, such as single or multiplex fluorescence PCR detection, which can achieve specific and sensitive detection of gastric cancer patients in plasma samples. In group 1, plasma free DNA samples of 36 subjects (7 gastric cancer patients, 19 healthy people and 10 colorectal cancer patients) were detected. The receiver operating curve analysis showed that the area under the curve (AUC) of the methylation detection of the nucleotide sequence of the Reprimo gene was 1.00. At the appropriate positive threshold, the sensitivity of the detection was 100.00% (95% CI: 59.04% to 100%), and the specificity was 96.43% (95% CI: 81.65%~99.91%). In group 2, plasma free DNA samples of 24 subjects (8 gastric cancer positive patients, 14 clinical negative samples and 2 gastric cancer postoperative patients) were detected. According to the receiver operating curve analysis, the area under the curve (AUC) of the combined detection of nucleotide sequence methylation of Reprimo and CABIN1 gene was 0.9732. Under the appropriate positive threshold, the sensitivity of the detection was 87.50% (95% CI: 52.91%~97.76%), and the specificity was 100.00% (95% CI: 78.47%~100.00%). BRIEF DESCRIPTION OF THE DRAWINGS Figure 1 is a diagram showing the methylation degree of the Reprimo gene in the genome of healthy human whole blood (H1-H12), healthy human peripheral blood mononuclear cells (PBMC), healthy human natural killer cells (NK), colon cancer cell line HCT116, cervical cancer cell line Hela, gastric cancer cell line AGS, SNU1, N87 and other cell genome DNA. The smaller the ΔCt value, the higher the methylation degree of the Reprimo gene in the genome. Figure 2 is a diagram showing the methylation degree of CABIN1 gene in the genome of healthy human whole blood (H1-H12), healthy human peripheral blood mononuclear cells (PBMC), healthy human natural killer cells (NK), colon cancer cell line HCT116, cervical cancer cell line Hela, gastric cancer cell line AGS, SNU1, N87 and other cell genome DNA. The smaller the ΔCt value, the higher the methylation degree of CABIN1 gene in the genome. Figure 3 is a triple PCR amplification curve of healthy human whole blood genome (H3), healthy human peripheral blood mononuclear cells (PBMC), healthy human natural killer cells (NK), colorectal cancer cell line HCT116, cervical cancer cell line Hela, gastric cancer cell line AGS, SNU1, N87 and other cell genomic DNA. FIG. 4 shows the results of CpG island methylation sequencing in the promoter region of the Reprimo gene in the genome of AGS cells treated with M.Sss I. FIG. 5 shows the results of CpG island methylation sequencing in the promoter region of the Reprimo gene in the genome of wild-type AGS cells. FIG. 6 shows the results of CpG island methylation sequencing in the promoter region of the Reprimo gene in the genome of DNMT DKO HCT116 cells. FIG. 7 shows the results of CpG island methylation sequencing in the promoter region of the Reprimo gene in the peripheral blood genome of healthy volunteers. Figure 8 shows the results of 36 subjects (7 gastric cancer positive samples, 19 healthy subjects and 10 Ct value results of Reprimo gene in plasma samples of (14 patients with colorectal cancer). FIG9 is a receiver operating characteristic curve diagram of the Ct value of the Reprimo gene in plasma samples of 36 subjects (7 gastric cancer positive samples, 19 healthy physical examination subjects and 10 colorectal cancer patients). FIG. 10 shows the ΔCt values of the Reprimo gene and the internal reference Alu-C4 gene in plasma samples of 24 subjects (8 gastric cancer-positive patients, 14 clinically negative samples, and 2 gastric cancer postoperative patients). FIG. 11 shows the ΔCt values of the CABIN1 gene and the internal reference Alu-C4 gene in plasma samples of 24 subjects (8 gastric cancer-positive patients, 14 clinically negative samples, and 2 gastric cancer postoperative patients). FIG12 shows the double ΔCt values of Reprimo and CABIN1 genes and the internal reference Alu-C4 gene in plasma samples of 24 subjects (8 gastric cancer positive patients, 14 clinical negative samples and 2 gastric cancer postoperative patients). FIG13 is a receiver operating characteristic curve graph of the Reprimo single gene ΔCt value, CABIN1 single gene ΔCt value and dual gene dual ΔCt value in plasma samples of 24 subjects (8 gastric cancer positive patients, 14 clinically negative samples and 2 gastric cancer postoperative patients). Figure 14 is an amplification curve obtained by detecting SEQ ID NO.2 (after transformation) in the sample using a combination of SEQ ID NO.17 (upstream primer), SEQ ID NO.18 (downstream primer) and SEQ ID NO.19 (probe), wherein "M" is about 400 ng AGS cell DNA (after transformation) stock solution, "M / 4" is AGS cell DNA (Reprimo gene after transformation) after 4 times dilution, "M / 16" is AGS cell DNA (after transformation) after 16 times dilution, and "U" is about 400 ng NK cell DNA (after transformation) stock solution. Figure 15 is an amplification curve obtained by detecting SEQ ID NO.4 (Reprimo gene after transformation) in the sample using a combination of SEQ ID NO.23 (upstream primer), SEQ ID NO.24 (downstream primer) and SEQ ID NO.25 (probe), wherein "M" is about 400 ng AGS cell DNA (after transformation) stock solution, "M / 4" is AGS cell DNA (after transformation) after 4-fold dilution, "M / 16" is AGS cell DNA (after transformation) after 16-fold dilution, and "U" is about 400 ng NK cell DNA (after transformation) stock solution. Figure 16 is an amplification curve obtained by detecting SEQ ID NO.5 (Reprimo gene after transformation) in a sample using a combination of SEQ ID NO.26 (upstream primer), SEQ ID NO.27 (downstream primer) and SEQ ID NO.28 (probe), wherein "M" is about 400 ng AGS cell DNA (after transformation) stock solution, "M / 4" is AGS cell DNA (after transformation) diluted 4 times, "M / 16" is AGS cell DNA (after transformation) diluted 16 times, and "U" is about 400ng NK cell DNA (after transformation) stock solution. Figure 17 is an amplification curve obtained by detecting SEQ ID NO.7 (CABIN1 gene after transformation) in the sample using a combination of SEQ ID NO.32 (upstream primer), SEQ ID NO.33 (downstream primer) and SEQ ID NO.34 (probe), wherein "M" is about 400 ng AGS cell DNA (after transformation) stock solution, "M / 4" is AGS cell DNA (after transformation) after 4-fold dilution, "M / 16" is AGS cell DNA (after transformation) after 16-fold dilution, and "U" is about 400 ng NK cell DNA (after transformation) stock solution. Figure 18 is an amplification curve obtained by detecting SEQ ID NO.8 (CABIN1 gene after transformation) in the sample using a combination of SEQ ID NO.35 (upstream primer), SEQ ID NO.36 (downstream primer) and SEQ ID NO.37 (probe), wherein "M" is about 400 ng AGS cell DNA (after transformation) stock solution, "M / 4" is AGS cell DNA (after transformation) after 4-fold dilution, "M / 16" is AGS cell DNA (after transformation) after 16-fold dilution, and "U" is about 400 ng NK cell DNA (after transformation) stock solution. Figure 19 is an amplification curve obtained by detecting SEQ ID NO.9 (CABIN1 gene after transformation) in the sample using a combination of SEQ ID NO.38 (upstream primer), SEQ ID NO.39 (downstream primer) and SEQ ID NO.40 (probe), wherein "M" is about 400 ng AGS cell DNA (after transformation) stock solution, "M / 4" is AGS cell DNA (after transformation) after 4-fold dilution, "M / 16" is AGS cell DNA (after transformation) after 16-fold dilution, and "U" is about 400 ng NK cell DNA (after transformation) stock solution. FIG. 20 shows the ΔCt values of SEQ ID NO. 2 (after conversion) in different cell DNA and whole blood DNA samples detected using a combination of SEQ ID NO. 17 (upstream primer), SEQ ID NO. 18 (downstream primer) and SEQ ID NO. 19 (probe). FIG. 21 shows the ΔCt values of SEQ ID NO. 4 (after conversion) in different cell DNA and whole blood DNA samples detected using a combination of SEQ ID NO. 23 (upstream primer), SEQ ID NO. 24 (downstream primer) and SEQ ID NO. 25 (probe). FIG. 22 shows the ΔCt values of SEQ ID NO. 5 (after conversion) detected in different cell DNA and whole blood DNA samples using a combination of SEQ ID NO. 26 (upstream primer), SEQ ID NO. 27 (downstream primer) and SEQ ID NO. 28 (probe). FIG. 23 shows the ΔCt values of SEQ ID NO. 7 (after conversion) in different cell DNA and whole blood DNA samples detected using a combination of SEQ ID NO. 32 (upstream primer), SEQ ID NO. 33 (downstream primer) and SEQ ID NO. 34 (probe). FIG. 24 shows the ΔCt values of SEQ ID NO. 8 (after conversion) in different cell DNA and whole blood DNA samples detected using a combination of SEQ ID NO. 35 (upstream primer), SEQ ID NO. 36 (downstream primer) and SEQ ID NO. 37 (probe). FIG. 25 shows the ΔCt values of SEQ ID NO. 9 (after conversion) in different cell DNA and whole blood DNA samples detected using a combination of SEQ ID NO. 38 (upstream primer), SEQ ID NO. 39 (downstream primer) and SEQ ID NO. 40 (probe). DETAILED DESCRIPTION It should be noted that, unless otherwise defined, the technical terms or scientific terms used in this application should have the common meanings understood by technicians in the relevant field. A first aspect of the present invention provides a kit for gastric cancer diagnosis and screening, comprising a reagent for detecting CpG methylation in the promoter region of the Reprimo gene and / or the CABIN1 gene. The nucleotide sequence of the Reprimo gene can be found in NCBI Accession No. (Gene ID): 56475. The nucleotide sequence of the CABIN1 gene can be found in NCBI Accession No. (Gene ID): 23523. In a preferred embodiment of the present invention, the nucleotide sequence of the Reprimo gene promoter region detected is selected from the nucleotide sequences shown in SEQ ID NO.1, 2, 3, 4 and 5; preferably, the nucleotide sequence of the Reprimo gene detected is shown in SEQ ID NO.1. In a preferred embodiment of the present invention, the nucleotide sequence of the detected CABIN1 gene promoter region is selected from the nucleotide sequences shown in SEQ ID NO.6, 7, 8, 9, 10 and 11; preferably, the nucleotide sequence of the detected CABIN1 gene is shown in SEQ ID NO.6. In a preferred embodiment of the present invention, the above-mentioned kit further comprises a reagent for detecting methylation of the internal reference gene Alu-C4 or ACTB; Preferably, the nucleotide sequence of the detected internal reference gene Alu-C4 is shown in SEQ ID NO.12; Preferably, the nucleotide sequence of the detected internal reference gene ACTB is shown as SEQ ID NO.13. When measuring gene expression (e.g. using qPCR), the expression of the target gene and the reference gene can be measured separately, and the reference gene expression can be used as a standard to measure the relative expression of the target gene, and finally the relative expression between samples can be compared. The reference gene is a known gene whose expression level is not affected by the research conditions and can be expressed constantly between multiple samples. A reference gene, the expression level of which can be used to accurately quantify the loading of the initial material. In a preferred embodiment of the present invention, the reagent for detecting CpG methylation in the promoter region of the Reprimo gene and / or CABIN1 gene and the reagent for detecting methylation of the internal reference gene Alu-C4 or ACTB may include upstream primers, downstream primers and / or probes, respectively. In a preferred embodiment of the present invention, the nucleotide sequences of the upstream primer, downstream primer and probe for methylation of the nucleotide sequence SEQ ID NO.1 are shown as SEQ ID NOs.14 to 16, respectively; and / or the nucleotide sequences of the upstream primer, downstream primer and probe for detecting methylation of the nucleotide sequence SEQ ID NO.2 are shown as SEQ ID NOs.17 to 19, respectively; and / or the nucleotide sequences of the upstream primer, downstream primer and probe for detecting methylation of the nucleotide sequence SEQ ID NO.3 are shown as SEQ ID NOs.20 to 22, respectively; and / or the nucleotide sequences of the upstream primer, downstream primer and probe for detecting methylation of the nucleotide sequence SEQ ID NO.4 are shown as SEQ ID NOs.23 to 25, respectively; and / or the nucleotide sequences of the upstream primer, downstream primer and probe for detecting methylation of the nucleotide sequence SEQ ID NO.5 are shown as SEQ ID NOs.26 to 28, respectively. In a preferred embodiment of the present invention, the nucleotide sequences of the upstream primer, downstream primer and probe for detecting the methylation of the nucleotide sequence SEQ ID NO.6 are shown as SEQ ID NOs.29 to 31, respectively; and / or the nucleotide sequences of the upstream primer, downstream primer and probe for detecting the methylation of the nucleotide sequence SEQ ID NO.7 are shown as SEQ ID NOs.32 to 34, respectively; and / or the nucleotide sequences of the upstream primer, downstream primer and probe for detecting the methylation of the nucleotide sequence SEQ ID NO.8 are shown as SEQ ID NOs.35 to 37, respectively; and / or the nucleotide sequences of the upstream primer, downstream primer and probe for detecting the methylation of the nucleotide sequence SEQ ID NO.9 are shown as SEQ ID NOs.38 to 40, respectively; and / or the nucleotide sequences of the upstream primer, downstream primer and probe for detecting the methylation of the nucleotide sequence SEQ ID NO.10 are shown as SEQ ID NOs.41 to 43, respectively; and / or the nucleotide sequences of the upstream primer, downstream primer and probe for detecting the methylation of the nucleotide sequence SEQ ID NO.11 are shown as SEQ ID NOs.44 to 46, respectively. In a preferred embodiment of the present invention, the nucleotide sequences of the upstream primer, downstream primer and probe for detecting the methylation of the internal reference gene Alu-C4 are shown in SEQ ID NOs. 47 to 49, respectively. In a preferred embodiment of the present invention, the nucleotide sequences of the upstream primer, downstream primer and probe for detecting the methylation of the internal reference gene ACTB are as shown in SEQ ID NOs. 50 to 52, respectively. shown. The second aspect of the present invention provides the use of the above reagent in preparing a kit for the diagnosis and screening of gastric cancer and its early precancerous lesions. The sequences SEQ ID NO. 1 to 52 of the present invention are shown in Table 1 below. Table 1 In a preferred embodiment of the present invention, SEQ ID NOs. 14 to 52 are applied to, but not limited to, nucleic acid detection platforms such as conventional PCR, multiplex fluorescence PCR, digital PCR, capillary electrophoresis, isothermal amplification, and sequencing. The third aspect of the present invention provides a method for diagnosing and screening gastric cancer, comprising the following steps: 1) extracting sample DNA; and 2) Determine the CpG methylation status of the nucleotide sequence selected from SEQ ID NOs. 1-5 in the promoter region of the Reprimo gene and / or the nucleotide sequence selected from SEQ ID NOs. 6-11 in the promoter region of the CABIN1 gene. In a further preferred embodiment of this aspect, the following steps are also included: 1) The extracted sample DNA is converted with bisulfite; 2) Using the above kit, perform real-time fluorescence quantitative PCR amplification on the sample DNA obtained in step 1), detect the fluorescence signal and determine the result. In a preferred embodiment of the present invention, the sources of the sample DNA include cells, tissue sections, feces, whole blood, plasma, serum and gastric lavage fluid, preferably plasma. In a preferred embodiment of the above aspect of the present invention, the probe is fluorescently labeled. In a further preferred embodiment, the 5' end fluorescent group used to label the probe includes but is not limited to FAM, VIC or CY5, and the 3' end quenching group includes but is not limited to TAMRA, BHQ1, BHQ2, BHQ, MGB. Those skilled in the art know that the detected nucleotide sequences SEQ ID NO.1-11 and the primer sequences and probe sequences of the present invention can be appropriately adjusted and modified according to the sequences of the Reprimo gene, CABIN1 gene, the reference gene and the disclosure of the present application, such as the methylation of the promoter region CpG of the Reprimo gene and CABIN1 gene in the AGS gastric cancer cell line disclosed in the examples. These modified sequences to be detected, primer sequences and probe sequences can still be used to detect the methylation of the genes. The present invention also includes these equivalent technical solutions. Example In order to further illustrate the relevant technical content of the present invention and the specific experimental operations, some embodiments are listed below. It should be understood that the following examples are only for illustration, not for the purpose of limiting the scope of the present invention, and the primer probe combination, nucleic acid extraction method, DNA methylation treatment method, template DNA sample amount, reagent concentration and other experimental parameters that can be considered to change, and the actual operation can be changed according to the actual situation. The conventional experimental operations involved in the following embodiments are all operated according to conventional methods unless otherwise specified. The medicinal raw materials, reagent materials, etc. used in the following embodiments are all commercially available products unless otherwise specified. Example 1 CpG in the promoter region of Reprimo and CABIN1 genes is highly methylated in different gastric cancer cell lines 1. Main reagents and materials 1) Blood / cell / tissue genomic DNA extraction kit, Tiangen Biochemical Technology (Beijing) Co., Ltd., used to extract whole blood genomic DNA and cell genomic DNA from healthy subjects; 2) EZ DNA Methylation TM Kit (Zymo ReSearch) was used for bisulfite conversion of DNA; 3) TaKaRa Ex Hot Start Version is used for fluorescent PCR amplification. 2. Specific implementation steps 1) Use the blood / cell / tissue genomic DNA extraction kit according to the instructions to extract 200 μL of healthy human whole blood genome or about 5 million cell genomes; 2) Take 500ng of healthy human whole blood genome or cell genome and use EZ DNA Methylation TM Kit was used to perform C / T conversion of unmethylated CpG according to the instructions and eluted into 20 μL of eluent; 3) Using specific upstream and downstream primers and probes of Reprimo, CABIN1 gene and Alu-C4 internal reference gene (SEQ ID NO.14-16, SEQ ID NO.29-31, SEQ ID NO.47-49), wherein probe SEQ ID NO.16 is labeled with 5'-VIC fluorescent group and 3'-BHQ1, probe SEQ ID NO.31 is labeled with 5'-CY5 fluorescent group and 3'-BHQ1, and probe SEQ ID NO.49 is labeled with 5'-FAM fluorescent group and 3'-MGB), and TaKaRa Ex Hot Start Version prepared triple PCR reaction according to the instructions, with primer concentrations of 200-400 nM, probe concentration of 200 nM, enzyme concentration of 0.05 U / μL, and PCR buffer concentration of 1×. Take 2 μL of the above 20-fold diluted eluate as the amplification template for fluorescent PCR reaction. The amplification program was pre-denaturation at 95°C for 2 min, denaturation at 95°C for 8 s, annealing and extension at 60°C for 30 s, for a total of 45 cycles. 3. Results Analysis The results of triple PCR (fluorescence PCR) detection of the internal reference genes Reprimo, CABIN1 and Alu-C4 showed that the CpG in the promoter region of Reprimo and CABIN1 were unmethylated in the genome of healthy human whole blood (H1-H12), healthy human natural killer cells (NK), and the genome of the colorectal cancer cell line HCT116; they were highly methylated in the genomes of the gastric cancer cell lines AGS, SNU1, and N87; the CpG in the promoter region of the Reprimo gene was partially methylated in the genome of the peripheral blood mononuclear cells (PBMC) of a healthy volunteer and the genome of the cervical cancer cell line Hela, and the CABIN1 gene was partially methylated in the genome of the cervical cancer cell line Hela, and unmethylated in the genome of the peripheral blood mononuclear cells (PBMC) of a healthy volunteer. The results are shown in Figures 1 to 3. The above results showed that the Reprimo and CABIN1 genes were highly methylated in gastric cancer-related cell lines, and were unmethylated or partially methylated in healthy human blood or peripheral blood cell samples or intestinal cancer and cervical cancer cell lines, suggesting that they have the potential to be highly specific in the diagnosis and screening of gastric cancer, which is of great value for detection methods based on plasma free nucleic acid samples. Example 2 Next-generation sequencing study of CpG methylation in the promoter region of the Reprimo gene in AGS gastric cancer cell lines 1. Main reagents and materials 1) Blood / cell / tissue genomic DNA extraction kit, Tiangen Biochemical Technology (Beijing) Co., Ltd., used to extract whole blood genomic DNA and cell genomic DNA from healthy subjects; 2)CpG Methyltransferase(M.Sss I), NEW ENGLAND inc., used for DNA CpG site methylation modification; 3) TaKaRa Ex Hot Start Version is used for PCR amplification; 4) pMD 18-T vector (TaKaRa) was used for plasmid ligation and sequencing of PCR products. 2. Specific implementation steps 1) Use the blood / cell / tissue genomic DNA extraction kit according to the instructions to extract 200 μL of healthy human whole blood genome or about 5 million cell genomes; 2) Use CpG Methyltransferase (M.Sss I) to treat 1000 ng of wild-type AGS cell DNA according to the instructions to obtain a positive control sample for CpG site methylation; 3) Using TaKaRa Ex Hot Start Version and the following Reprimo gene methylation / unmethylation universal sequencing upstream and downstream primers were used to amplify CpG methylated AGS cell DNA, wild-type AGS cell DNA, DNMT DKO HCT116 cell DNA, and healthy human peripheral blood DNA to obtain the Reprimo gene methylated or unmethylated target fragments. Reprimo gene upstream sequencing primer: AGTGAGGTTTTTGGGAAATTTTTA (SEQ ID NO.53), Reprimo gene downstream sequencing primer: GTGAAAGCTTAATAAACAAATTACAAC (SEQ ID NO. 54); 4) PCR products were recovered using 80% ice ethanol and a gel recovery kit, and each PCR product was connected to pMD 18-T vector and transformed into competent E. coli cells. Positive colonies were obtained after coating plates (containing ampicillin) for first-generation sequencing analysis. 3. Results Analysis In the AGS genome treated with M.Sss I (positive control group), the results of CpG island methylation sequencing of about 400bp in the promoter region of the Reprimo gene showed that the methylation rate of 42 CpG sites was 100%, the methylation rate of 5 CpG sites was 90%, and the methylation rate of 2 CpG sites was 80%. The overall methylation rate was 98.16%. In the wild-type AGS cell genome, the results of CpG island methylation sequencing of about 400bp in the promoter region of the Reprimo gene showed that the methylation rates of 28 CpG sites were 100%, 14 CpG sites were 90%, 4 CpG sites were 80%, 2 CpG sites were 77.7%, and 1 CpG site was 70%. The overall methylation rate was 93.99%. In the genomic DNA of the DNMT DKO HCT116 cell line with double knockout of methylase (negative control group), the results of CpG island methylation sequencing of about 400bp in the promoter region of the Reprimo gene showed that the methylation rate of 35 CpG sites was 0%, the methylation rate of 9 CpG sites was 9.09%, the methylation rate of 2 CpG sites was 10%, the methylation rate of 2 CpG sites was 18.18%, and the methylation rate of 1 CpG site was 27.27%. The overall methylation rate was 3.38%. In the peripheral blood DNA of healthy volunteers, the results of CpG island methylation sequencing of about 400bp in the promoter region of the Reprimo gene showed that the methylation rate of 29 CpG sites was 0%, the methylation rate of 16 CpG sites was 16.67%, and the methylation rate of 4 CpG sites was 33.3%. The overall methylation rate was 8.16%. Reprimo is a glycosylated cytoplasmic protein that causes G2 / M phase arrest in the cell cycle and has the effect of inhibiting cell proliferation. In healthy cells, the Reprimo promoter region is in a low methylation state, and the Reprimo gene can be expressed normally and regulate normal physiological activities as a tumor suppressor gene; when its promoter region is highly methylated, the expression of the Reprimo gene is blocked and it cannot inhibit abnormal cell proliferation, which promotes the development of normal cells into cancer cells and further develops into gastric cancer. The above sequencing results showed that a sequence of about 400bp in the promoter region of the Reprimo gene was highly methylated in the DNA of the gastric cancer AGS cell line, with a methylation rate of up to 93.99%. However, in the peripheral blood DNA of healthy volunteers, the methylation rate of this region of the Reprimo gene was only 8.16%, which was in a low methylation state, suggesting the correlation between Reprimo gene promoter methylation and the pathogenicity of gastric cancer, as well as its potential as a marker for the diagnosis and screening of gastric cancer. Example 3 Reprimo gene achieves specificity and sensitivity for gastric cancer in plasma samples Detection 1. Main reagents and materials 1) Magnetic bead-based large-volume free nucleic acid extraction kit, Tiangen Biochemical Technology (Beijing) Co., Ltd., used to extract free plasma DNA samples; 2) EZ DNA Methylation TM Kit (Zymo Research) was used for bisulfite conversion of plasma cell-free DNA samples; 3) TaKaRa Ex Hot Start Version is used for fluorescent PCR amplification. 2. Specific implementation steps Plasma free DNA extraction 1) Add 2 mL of plasma to a 15 mL centrifuge tube, followed by 3 mL of lysis buffer (GHH), 200 μL of proteinase K, and 25 μL of magnetic beads. 2) Vortex and mix well, incubate at room temperature for 20 minutes, invert and mix for 10 seconds every 3-5 minutes. Centrifuge briefly after incubation. 3) Place the centrifuge tube on the magnetic rack and let it stand for 2 minutes. When the magnetic beads are completely adsorbed, carefully pour out the liquid. After pouring out, use a pipette to carefully remove the remaining liquid. 4) Add 750 μL of buffer GDF (make sure ethanol has been added) and mix by pipetting, transfer to a new 1.5 ml centrifuge tube, and vortex to mix. Place on the magnetic stand for 1 minute, and carefully pour out the liquid after the magnetic beads are completely adsorbed. After pouring out, carefully remove the remaining liquid with a pipette. 5) Add 750 μL of rinse solution PWG (make sure ethanol has been added), pipette to mix, and vortex to mix. 6) After placing on the magnetic stand for 1 minute, carefully remove the liquid when the magnetic beads are completely adsorbed. 7) Repeat steps 5 and 6, wash again, and try to remove all the liquid carefully. 8) Open the lid and let dry at room temperature for 5 minutes on the magnetic rack. 9) Add 50 μL of elution buffer TBC, use a pipette to resuspend the beads, place in a metal block at 56°C, heat for 5 minutes to fully elute the DNA on the beads, and shake every 2 minutes. Centrifuge the sample in a portable centrifuge and place on a magnetic rack for 2 minutes. 10) After the magnetic beads are completely adsorbed, transfer the liquid to a new 2 mL centrifuge tube for subsequent experiments or storage at -20°C. Methylation conversion of free DNA 11) Prepare CT reagent: 700 μL Water, 300 μL M-Dilution Buffer, 50 μL M-Dissolving, vortex to mix, and place on an oscillator for 10 min. 12) Add 40 μL DNA and 110 μL CT reagent to a 0.2 mL centrifuge tube, pipette to mix, centrifuge for a split second, and place in a PCR instrument to start transformation (preferably divided into 2 PCR tubes for reaction). 98°C, 10 min. 64°C, 150 min. Store at 4°C. 13) Place the filter column in a collection tube, add 600 μL M-Binding Buffer, then add all the mixture after transformation to the filter column, pipette to mix, centrifuge at 14,000 rpm for 30 seconds, and discard the waste liquid. 14) Add 100 μL M-Wash Buffer to the filter column and centrifuge at 14,000 rpm for 30 seconds. 15) Add 200 μL M-Desulphonation Buffer and incubate at room temperature for 20 min. After incubation, centrifuge at 14000 rpm for 30 seconds. 16) Add 200 μL M-Wash Buffer to the filter column, centrifuge at 14000 rpm for 30 seconds, and discard the waste liquid. 17) Repeat step 16 and wash again. 18) Place the filter column in a clean 1.5 ml centrifuge tube. Add 20 μL M-Elution Buffer, let stand for 5 min, centrifuge at 14000 rpm for 30 seconds, and use the eluted DNA for subsequent experiments. Fluorescence PCR amplification 19) Using specific upstream and downstream primers and probes of the Reprimo gene and the Alu-C4 internal reference gene (SEQ ID NO. 20-22, SEQ ID NO. 47-49), wherein the probe SEQ ID NO. 22 is labeled with a 5'-VIC fluorescent group and 3'-BHQ1, and the probe SEQ ID NO. 49 is labeled with a 5'-FAM fluorescent group and 3'-MGB), and TaKaRa Ex Hot Start Version prepared double PCR reaction according to the instructions, with primer concentrations of 200-400 nM, probe concentration of 200 nM, enzyme concentration of 0.025 U / μL, and final PCR buffer concentration of 1×. Take 2 μL of the eluate from step 18) as the amplification template and perform fluorescent PCR reaction. The amplification program is 95°C pre-denaturation for 2 min, 95°C denaturation for 8 s, 60°C annealing and extension for 30 s, for a total of 50 cycles. 3. Results Analysis The test results of the plasma samples of the above 36 subjects showed that the kit had a 100% detection rate for 7 gastric cancer patients, and was able to specifically distinguish 10 colorectal cancer patients from 19 healthy people, achieving specific and sensitive detection of gastric cancer. The receiver operating curve analysis (software: GraphPad Prism7.0) showed that the area under the curve (AUC) was 1.00. Under the appropriate positive threshold, the sensitivity of the test was 100.00% (95% CI: 59.04% to 100%), and the specificity was 96.43% (95% CI: 81.65% to 99.91%). See Figures 8 and 9 for details. Example 4 Reprimo and CABIN1 dual gene combined analysis or CABIN1 single gene analysis can achieve more sensitive detection of gastric cancer compared with Reprimo single gene analysis 1. Main reagents and materials 1) Magnetic bead-based large-volume free nucleic acid extraction kit, Tiangen Biochemical Technology (Beijing) Co., Ltd., used to extract 0.9-2 mL of plasma free DNA samples; 2) Methylation detection sample pretreatment kit (spin column method) (Zhongshan Baihui Biological Co., Ltd.) was used for bisulfite conversion of plasma free DNA samples; 3) Anhydrous ethanol; 4) TaKaRa Ex Hot Start Version is used for fluorescent PCR amplification. 2. Specific implementation steps Plasma free DNA extraction 1) Add 0.9-2 mL of plasma to a 15 mL centrifuge tube, and then add 1.5 times the volume of plasma lysis buffer (GHH), 0.1 times the volume of plasma proteinase K, and 25-30 μL of magnetic beads. 2) Vortex and mix well, incubate at room temperature for 20 minutes, invert and mix for 10 seconds every 3-5 minutes. Centrifuge briefly after incubation. 3) Place the centrifuge tube on the magnetic rack and let it stand for 2 minutes. When the magnetic beads are completely adsorbed, carefully pour out the liquid. After pouring out, use a pipette to carefully remove the remaining liquid. 4) Add 750 μl of buffer GDF (make sure ethanol has been added) and mix by pipetting, transfer to a new 1.5 ml centrifuge tube, and vortex to mix. Place on the magnetic stand for 1 min, and carefully pour out the liquid after the magnetic beads are completely adsorbed. After pouring out, carefully remove the remaining liquid with a pipette. 5) Add 750 μl of rinse solution PWG (make sure ethanol has been added), pipette to mix, and vortex to mix. 6) After placing on the magnetic stand for 1 minute, carefully remove the liquid when the magnetic beads are completely adsorbed. 7) Repeat steps 5 and 6, wash again, and try to remove all the liquid carefully. 8) Open the lid and let dry at room temperature for 5 minutes on the magnetic rack. 9) Add 50 μl of elution buffer TBC, use a pipette to resuspend the beads, place in a metal block at 56°C, heat for 5 minutes to fully elute the DNA on the beads, and shake once every 2 minutes. Centrifuge the sample in a portable centrifuge and place on a magnetic rack, let stand for 2 minutes. 10) After the magnetic beads are completely adsorbed, transfer the liquid to a new 2 ml centrifuge tube for subsequent experiments or storage at -20°C. Methylation conversion of free DNA 11) Prepare bisulfite conversion solution: add 750 μL of water and 190 μL of bisulfite conversion solution B to the brown tube of bisulfite conversion solution A, vortex and mix thoroughly to dissolve for later use. 12) In a 0.2 ml centrifuge tube, add 40 μL of free DNA extracted in step 10) and 110 μL of bisulfite conversion solution in step 11) in sequence, pipette to mix, centrifuge for a split second, and place in a PCR instrument to start conversion. Incubate at 98°C for 5 min to denature the DNA; incubate at 98°C for 5 min and 64°C for 30 min for a total of 3 cycles; keep at 4°C after completion. 13) Add 600 μL of binding solution into the adsorption column, and further transfer 150 μL of the sample transformed in step 12) into the adsorption column, invert and mix, centrifuge at 13000 rcf for 30 seconds, and discard the waste liquid. 14) Add 200 μL of washing solution (make sure ethanol has been added) to the adsorption column and centrifuge at 13000 rcf for 30 seconds. 15) Add 200 μL of treatment solution (make sure ethanol has been added) and incubate at room temperature for 20 minutes. After incubation, centrifuge at 13000 rcf for 30 seconds. 16) Add 200 μL of washing solution to the adsorption column and centrifuge at 13000 rcf for 30 seconds. 17) Repeat step 16 and wash once more. Discard the waste liquid. 18) Place the nucleic acid binding column in a clean 1.5 ml centrifuge tube, open the cover and let it stand for 2 minutes to remove possible ethanol residues. Add 20 μL T elution buffer, let it stand for 5 minutes, centrifuge at 13000 rcf for 30 seconds, and use the eluted DNA for subsequent experiments. Fluorescence PCR amplification 19) Using specific upstream and downstream primers and probes for the Reprimo gene, CABIN1 gene, and Alu-C4 internal reference gene (SEQ ID NOs. 14-16, SEQ ID NOs. 29-31, SEQ ID NOs. 47-49, wherein the probe SEQ ID NO. 16 is labeled with a 5'-VIC fluorescent group and 3'-BHQ1, the probe SEQ ID NO. 31 is labeled with a 5'-CY5 fluorescent group and 3'-BHQ1, and the probe SEQ ID NO. 49 is labeled with a 5'-FAM fluorescent group and 3'-MGB), as well as TaKaRa Ex Hot Start Version prepared triple PCR reaction according to the instructions, the final concentration of each primer was 200-500nM, the final concentration of each probe was 150-200nM, the final concentration of enzyme was 0.05U / μL, the final concentration of PCR buffer was 1×, and 2μL of the eluted DNA in step 18) was used as the amplification template for fluorescent PCR reaction. The amplification program was denaturation at 95℃ for 8s, annealing at 60℃ for 30s, and extension at 72℃ for 10s, for a total of 45 cycles. 3. Results Analysis In this example, plasma samples from 8 gastric cancer patients, 2 gastric cancer postoperative patients and 14 clinically negative subjects were tested. In the triple fluorescence PCR reaction system, based on the ΔCt value of a single gene (ΔCt value = Reprimo or CABIN1 Ct value - Alu-C4 Ct value) or the double ΔCt value of a double gene (double ΔCt value = Reprimo Ct value + CABIN1 Ct value - 2*Alu-C4 Ct value), receiver operating curve analysis (analysis software: GraphPad Prism7.0) showed that the areas under the curve (AUC) of the Reprimo single gene analysis, CABIN1 single gene analysis, and double gene combined analysis methods were 0.7679, 1.000, and 0.9732, respectively. Under the appropriate positive threshold, the sensitivity of Reprimo single gene analysis, CABIN1 single gene analysis and dual gene combined analysis were 62.50% (95% CI: 30.57% to 86.32%), 100.00% (95% CI: 67.56% to 100.00%), 87.50% (95% CI: 52.91% to 97.76%), and the specificity was 100.00% (95% CI: 78.47% to 100.00%), 92.86% (95% CI: 68.53% to 98.73%), 100.00% (95% CI: 78.47% to 100.00%). It can be seen that the performance of CABIN1 single gene or the combination of Reprimo and CABIN1 genes is better than that of Reprimo single gene analysis. See Figures 10 to 13 for details. (The above 95% confidence interval upper and lower limits are calculated by Wilson confidence interval method) It should be noted that the positive threshold of the above test results may change due to the sample population and number. However, it is foreseeable that adding the CABIN1 target on the basis of the Reprimo single gene can significantly improve the positive detection rate of gastric cancer population while ensuring sufficient specificity, which further suggests the advantages of the dual targets selected by the present invention. In addition, in the detection of 2 patients after gastric cancer surgery, the Reprimo gene and the CABIN1 gene each had a detection rate of 50%, suggesting the possible application of the present invention in monitoring the efficacy of gastric cancer patients after surgery. Example 5 The nucleotide sequences shown in SEQ ID NOs. 2, 4, 5, 7, 8, and 9 in the promoter region of Reprimo and CABIN1 genes (after transformation) can specifically distinguish gastric cancer-related cell DNA and their application value in gastric cancer diagnosis I. Overview of the Experimental Plan Experiment 1 verified that the nucleotide sequences (after transformation) shown in SEQ ID NO. 2, 4, 5, 7, 8, and 9 could specifically distinguish gastric cancer-related cell DNA by using corresponding primer-probe combinations in different concentrations of gastric cancer cell line (AGS) DNA and negative control DNA (natural killer cell DNA). Experiment 2 detects the Ct values of the nucleotide sequences shown in SEQ ID NO. 2, 4, 5, 7, 8, and 9 (after transformation) and the internal reference gene Alu in cell or whole blood DNA samples, and further evaluates the application value of the sequences and the corresponding primer probe combinations in the diagnosis of gastric cancer through the Ct value difference (ΔCt value). The primer and probe sequences used in the experiment are shown in Table 2. Table 2. Primer and probe sequence information for the experiment II. Experimental design 1. Bisulfite Conversion of DNA According to the instructions of the methylation detection sample pretreatment kit (centrifugal column method) of Zhongshan Baihui Biotechnology Co., Ltd., DNA was converted to obtain converted DNA. The specific steps are as follows: 1) Add 750 μL of water and 190 μL of bisulfite conversion solution B to the brown tube of bisulfite conversion solution A, vortex and mix for 3-5 minutes, prepare bisulfite conversion solution after it is fully dissolved, and centrifuge briefly for use. 2) Add 110 μL of bisulfite conversion solution prepared in step 1) and 40 μL of DNA into a PCR tube, mix well and centrifuge briefly for later use. 3) Place the PCR tube in step 2) on a PCR machine and run the following program: Table 3. Bisulfite conversion procedure Note: The temperature of the heated lid is 105°C; the reaction system is set to 100 μL. 4) Add 600 μL of binding solution to the purification column. 5) Add all the mixed solution obtained in step 3) to the purification column, and mix it by gently pipetting it repeatedly or by inverting it after covering it with a cap for dozens of times. 6) Centrifuge at 13000 rcf for 30 seconds at room temperature and discard the waste liquid. 7) Add 200 μL of washing solution to the purification column and centrifuge at 13000 rcf at room temperature for 30 seconds. 8) Add 200 μL of treatment solution to the purification column, place at room temperature for 15-20 minutes, centrifuge at 13000 rcf for 30 seconds at room temperature, and discard the waste liquid. 9) Add 200 μL of washing solution to the purification column and centrifuge at 13000 rcf at room temperature for 30 seconds. 10) Repeat step 9). 11) Transfer the nucleic acid adsorption column of the purification column to a clean 1.5mL centrifuge tube, open the lid, and let it stand at room temperature for 3-5 minutes to evaporate any residual ethanol. Then add 25-60μL of elution buffer to the column matrix, let it stand at room temperature for 2 minutes, and centrifuge at 13000rcf for 1 minute at room temperature to elute and recover the bis-DNA. 2. Fluorescence quantitative PCR detection TaKaRa Ex Hot Start Version reagent, perform the test according to the instructions. The specific steps are as follows: 1) Reagent preparation: Thaw the 10×Ex Taq Buffer (Mg2+plus) (20mM) component and dNTP Mixture (2.5mM each) component at 2-8°C, mix thoroughly by inversion, centrifuge briefly, and place at 2-8°C for later use. Place TaKaRa Ex Taq HS (5 U / μL) at -20°C and centrifuge briefly before use. 2) Preparation of PCR mixed solution: Prepare the PCR mixed solution according to the requirements in Table 4 below. Table 4. PCR mixture preparation Aliquoting of PCR mixture: After the PCR mixture is fully mixed and briefly centrifuged, it is dispensed into a new eight-tube reaction well at 18 μL / reaction. b) Sample addition: Take 2 μL of each converted bis-DNA product and add it to the reaction well of the eight-tube strip / 96-well plate containing the PCR mixture, cover the tube, centrifuge briefly, and place it on the sample well of the fluorescent PCR instrument, while recording the well position. PCR amplification: Set the PCR amplification parameters according to Table 5. Table 5. PCR amplification program Note: * Fluorescence is collected in this step 3. Test equipment and conditions 3.1 Reagents 1) Methylation detection sample pretreatment kit (centrifugal column method), 50 copies / box, provided by Zhongshan Baihui Biotechnology Co., Ltd.; 2) TaKaRa Ex Hot Start Version reagent was purchased from Dalian Takara Biotechnology (Takara Biotechnology (Dalian) Engineering Co., Ltd.; 3) Primers, probes, etc. were purchased from Invitrogen (Shanghai) Trading Co., Ltd. 4. Main equipment 1) Real-time fluorescence quantitative PCR instrument, model 7500, manufactured by Life Technologies Holdings Pte Ltd. 2) Real-time fluorescence quantitative PCR instrument, model: LightCycler 480 II, manufacturer: Roche Diagnostics GmbH 5. Experimental results and analysis and discussion 5.1 Experiment 1: Primer sequence-specific amplification verification According to the experimental protocol, about 400 ng of AGS cell DNA from the gastric cancer cell line was taken as a positive DNA sample (hereinafter referred to as "M"), and about 400 ng of natural killer (NK) cell DNA was taken as a negative control sample (hereinafter referred to as "U"), and the methylation detection sample pretreatment kit (centrifugal column method) was used for sulfite reagent conversion treatment, and finally eluted in 60 μL T elution solution. Sample M was further diluted 4 times and 16 times with TE buffer for standby use. DNA such as U, M stock solution, 4-fold dilution of M, and 16-fold dilution of M were taken and tested using the reaction system shown in Table 4 and the amplification reaction program shown in Table 5. The results showed that each primer combination shown in Table 2 can effectively amplify the AGS DNA of the gastric cancer cell line, and there is no amplification of the natural killer (NK) cell DNA, with good amplification performance and specificity, as shown in Figures 14 to 19 for details. 5.2 Experiment 2: Validation results based on cell DNA and whole blood DNA samples According to the experimental protocol, DNA samples of each cell and whole blood as shown in Table 6 were taken, and the methylation detection sample pretreatment kit (centrifugal column method) was used for sulfite reagent conversion treatment, and finally eluted in 25-40 μL T elution solution. The eluted bis-DNA was taken and tested using the internal reference Alu gene and the primer combination to be tested using the reaction system shown in Table 4 and the amplification reaction program shown in Table 5. The difference in Ct value (ΔCt value = Ct value of the gene to be tested - Ct value of the internal reference Alu) was used as an indicator. The smaller the ΔCt value, the higher the degree of methylation of the site. The test results showed that the primer probe combinations corresponding to the Reprimo test sequence (SEQ ID NO. 2, 4, 5) and the CABIN1 test sequence (SEQ ID NO. 7, 8, 9) can effectively distinguish the three gastric cancer cell lines (AGS, N87, SNU1), and all showed a high methylation state. At the same time, in healthy The non-methylated state in human whole blood DNA samples or colorectal cancer cell line DNA samples has a good expected value for gastric cancer diagnosis. The test results are shown in Table 7 and Figures 20 to 25. Table 6. Sample information Table 7. ΔCt value results of sample detection with different primer-probe combinations (Note: Samples without peaks and no Ct values were calculated as Ct = 45.00) Test conclusion: The nucleotide sequences (after transformation) shown in SEQ ID NO. 2, 4, 5, 7, 8 and 9 and their corresponding primer-probe combinations can effectively detect methylation and have good amplification performance in DNA of different gastric cancer cell lines (AGS, N87, SNU1), human intestinal cancer cell line (HCT116), natural No methylation was detected in DNA samples such as NK cells and whole blood of healthy people, and it is expected to be used for diagnostic screening of gastric cancer. *** According to the present disclosure, all reagents, kits and methods disclosed and claimed herein can be prepared and used without excessive experimentation. Although reagents such as primers, probes, kits and methods have been described for preferred embodiments, it should be apparent to those skilled in the art that changes can be made to the reagents, kits and methods described herein and the steps or sequence of steps in the methods without departing from the concept, spirit and scope of the present invention. For example, the detected nucleotide sequences SEQ ID NO.1-11 and the primer sequences and probe sequences of the present invention can be appropriately adjusted and modified according to the sequences of the Reprimo gene, CABIN1 gene, the reference gene and the disclosure of the present application, such as the methylation of the promoter region CpG of the Reprimo gene and CABIN1 gene in the AGS gastric cancer cell line disclosed in the examples. These modified sequences to be detected and primer sequences and probe sequences can still be used to detect the methylation of the genes. All such similar substitutions and modifications that are apparent to those skilled in the art are considered to be within the spirit, scope and concept of the present invention as defined by the appended claims. References: [1] Zheng, Rongshou, et al. "Cancer incidence and mortality in China, 2016." Journal of the National Cancer Center (2022). [2] Du Yiqi, Cai Quancai, Liao Zhuan, et al. Expert consensus on the screening process for early gastric cancer in China (draft) (2017, Shanghai) [J]. Gastroenterology, 2018(2): 8-14. [3] Zuo Tingting, Zheng Rongshou, Zeng Hongmei, et al. Current epidemiological status of gastric cancer in China[J]. Chinese Journal of Clinical Oncology, 2017(1). [4]Xu M,Knox AJ,Michaelis KA,Kiseljak-Vassiliades K,Kleinschmidt-DeMasters BK,Lillehei KO,Wierman ME.Reprimo(RPRM)is a novel tumor suppressor in pituitary tumors and regulates survival,proliferation,and tumorigenicity.Endocrinology.2012 Jul;153(7):2963-73. [5]Bernal C,Aguayo F,Villarroel C,Vargas M,Díaz I,Ossandon FJ, E,Palma M,Aravena E,Barrientos C,Corvalan AH.Reprimo as a potential biomarker for early detection in gastric cancer.Clin Cancer Res.2008 Oct 1;14(19):6264-9. [6]Luo J,Zhu Y,Yang G,Gong L,Wang B,Liu H.Loss of Reprimo and S100A2 expression in human gastric adenocarcinoma.DiagnCytopathol.2011 Oct;39(10):752-7. [7]Saavedra K,Valbuena J,Olivares W,Marchant MJ,Rodríguez A,Torres-Estay V,Carrasco-Avino G,Guzmán L,Aguayo F,Roa JC,Corvalán AH.Loss of Expression of Reprimo,a p53-induced Cell Cycle Arrest Gene,Correlates with Invasive Stage of Tumor Progression and p73 Expression in Gastric Cancer.PLoS One.2015 May 8;10(5):e0125834. [8]Liu L,Yang X.Implication of Reprimo and hMLH1 gene methylation in early diagnosis of gastric carcinoma.Int J ClinExpPathol.2015 Nov 1;8(11):14977-82. [9]Wang H,Zheng Y,Lai J,Luo Q,Ke H,Chen Q.Methylation-Sensitive Melt Curve Analysis of the Reprimo Gene Methylation in Gastric Cancer.PLoS One.2016 Dec 16;11(12):e0168635.
[0010] Wen J,Zheng T,Hu K,Zhu C,Guo L,Ye G.Promoter methylation of tumor-related genes as a potential biomarker using blood samples for gastric cancer detection.Oncotarget.2017 Sep 8;8(44):77783-77793.
[0011] Jang,H.,et al.″Cabin1 restrains p53 activity on chromatin.″Nature Structural&Molecular Biology 16.9(2009):910-915.
[0012] Watanabe,Yoshiyuki,et al.″Sensitive and specific detection of early gastric cancer with DNA methylation analysis of gastric washes.″Gastroenterology 136.7(2009):2149-2158.
[0013] Lee,Jae-Hyuk,et al.″Frequent CpG island methylation in precursor lesions and early gastric adenocarcinomas.″Oncogene 23.26(2004):4646-4654.
[0014] Ren,Jie,et al.″Genome-Scale Methylation Analysis of Circulating Cell-Free DNA in Gastric Cancer Patients.″Clinical chemistry 68.2(2022):354-364.
Claims
1. A kit for gastric cancer diagnosis and screening, comprising a reagent for detecting CpG methylation in the promoter region of the Reprimo gene and / or the CABIN1 gene; Preferably, the nucleotide sequence of the Reprimo gene detected is selected from the nucleotide sequences shown in SEQ ID NO.1, 2, 3, 4 and 5; more preferably, the nucleotide sequence of the Reprimo gene detected is shown in SEQ ID NO.1; Preferably, the nucleotide sequence of the detected CABIN1 gene is selected from the nucleotide sequences shown in SEQ ID NO.6, 7, 8, 9, 10 and 11; more preferably, the nucleotide sequence of the detected CABIN1 gene is shown in SEQ ID NO.
6.
2. The kit according to claim 1, wherein the kit further comprises a reagent for detecting methylation of the internal reference gene Alu-C4 or ACTB; Preferably, the nucleotide sequence of the detected internal reference gene Alu-C4 is shown in SEQ ID NO.12; Preferably, the nucleotide sequence of the detected internal reference gene ACTB is shown as SEQ ID NO.
13.
3. The kit according to claim 1 or 2, wherein the reagents comprise an upstream primer, a downstream primer and / or a probe.
4. The kit according to claim 3, wherein: The reagent for detecting methylation of the promoter region nucleotide sequence SEQ ID NO.1 of the Reprimo gene includes or is selected from an upstream primer of the nucleotide sequence shown in SEQ ID NO.14, a downstream primer of the nucleotide sequence shown in SEQ ID NO.15, and a probe of the nucleotide sequence shown in SEQ ID NO.16; and / or The reagent for detecting methylation of the promoter region nucleotide sequence SEQ ID NO.2 of the Reprimo gene includes or is selected from an upstream primer of the nucleotide sequence shown in SEQ ID NO.17, a downstream primer of the nucleotide sequence shown in SEQ ID NO.18, and a probe of the nucleotide sequence shown in SEQ ID NO.19; and / or The reagent for detecting methylation of the promoter region nucleotide sequence SEQ ID NO.3 of the Reprimo gene includes or is selected from an upstream primer of the nucleotide sequence shown in SEQ ID NO.20, a downstream primer of the nucleotide sequence shown in SEQ ID NO.21, and a probe of the nucleotide sequence shown in SEQ ID NO.22; and / or The promoter region nucleotide sequence for detecting the Reprimo gene is SEQ ID NO.4 The methylation reagent includes or is selected from an upstream primer of the nucleotide sequence shown in SEQ ID NO.23, a downstream primer of the nucleotide sequence shown in SEQ ID NO.24, and a probe of the nucleotide sequence shown in SEQ ID NO.25; and / or The reagent for detecting methylation of the promoter region nucleotide sequence SEQ ID NO.5 of the Reprimo gene includes or is selected from an upstream primer of the nucleotide sequence shown in SEQ ID NO.26, a downstream primer of the nucleotide sequence shown in SEQ ID NO.27, and a probe of the nucleotide sequence shown in SEQ ID NO.28; and / or The reagent for detecting methylation of the nucleotide sequence SEQ ID NO.6 in the promoter region of the CABIN1 gene includes or is selected from an upstream primer of the nucleotide sequence shown in SEQ ID NO.29, a downstream primer of the nucleotide sequence shown in SEQ ID NO.30, and a probe of the nucleotide sequence shown in SEQ ID NO.31; and / or The reagent for detecting the methylation of the nucleotide sequence SEQ ID NO.7 in the promoter region of the CABIN1 gene includes or is selected from an upstream primer of the nucleotide sequence shown in SEQ ID NO.32, a downstream primer of the nucleotide sequence shown in SEQ ID NO.33, and a probe of the nucleotide sequence shown in SEQ ID NO.34; and / or The reagent for detecting methylation of the nucleotide sequence SEQ ID NO.8 in the promoter region of the CABIN1 gene comprises or is selected from an upstream primer of the nucleotide sequence shown in SEQ ID NO.35, a downstream primer of the nucleotide sequence shown in SEQ ID NO.36, and a probe of the nucleotide sequence shown in SEQ ID NO.37; and / or The reagent for detecting methylation of the nucleotide sequence SEQ ID NO.9 in the promoter region of the CABIN1 gene includes or is selected from an upstream primer of the nucleotide sequence shown in SEQ ID NO.38, a downstream primer of the nucleotide sequence shown in SEQ ID NO.39, and a probe of the nucleotide sequence shown in SEQ ID NO.40; and / or The reagent for detecting methylation of the nucleotide sequence SEQ ID NO.10 in the promoter region of the CABIN1 gene comprises or is selected from an upstream primer of the nucleotide sequence shown in SEQ ID NO.41, a downstream primer of the nucleotide sequence shown in SEQ ID NO.42, and a probe of the nucleotide sequence shown in SEQ ID NO.43; and / or The reagent for detecting methylation of the nucleotide sequence SEQ ID NO.11 in the promoter region of the CABIN1 gene comprises or is selected from an upstream primer of the nucleotide sequence shown in SEQ ID NO.44, a downstream primer of the nucleotide sequence shown in SEQ ID NO.45, and a probe of the nucleotide sequence shown in SEQ ID NO.46; and / or The reagent for detecting the methylation of the internal reference gene Alu-C4 includes or is selected from an upstream primer of the nucleotide sequence shown in SEQ ID NO.47, a downstream primer of the nucleotide sequence shown in SEQ ID NO.48, and a probe of the nucleotide sequence shown in SEQ ID NO.49; and / or The reagent for detecting methylation of the internal reference gene ACTB includes or is selected from an upstream primer of the nucleotide sequence shown in SEQ ID NO.50, a downstream primer of the nucleotide sequence shown in SEQ ID NO.51, and a probe of the nucleotide sequence shown in SEQ ID NO.
52.
5. Use of the reagent according to any one of claims 1 to 4 in the preparation of a kit for the diagnosis and screening of gastric cancer and its early precancerous lesions.
6. A method for gastric cancer diagnosis and screening, comprising the following steps: 1) Extract sample DNA; and 2) Determine the CpG methylation status of the nucleotide sequence selected from SEQ ID NOs. 1-5 in the promoter region of the Reprimo gene and / or the nucleotide sequence selected from SEQ ID NOs. 6-11 in the promoter region of the CABIN1 gene.
7. The method according to claim 6, further comprising the steps of: 1) converting the extracted sample DNA with bisulfite; and 2) Using the kit according to any one of claims 1 to 4, performing real-time fluorescence quantitative PCR amplification on the sample DNA obtained in step 1), detecting the fluorescence signal and determining the result.
8. The method according to claim 6 or 7, wherein the nucleotide sequence in the promoter region of the Reprimo gene and / or the CABIN1 gene is detected using the reagent according to any one of claims 1 to 4.
9. The kit, use or method according to any one of claims 1 to 8, wherein the methylation of the Reprimo gene, CABIN1 gene and / or the internal reference gene is detected by fluorescent PCR.
10. The kit, use or method according to claim 9, wherein the probe is fluorescently labeled; preferably the fluorescent label is selected from FAM, TAMRA, VIC, BHQ1, CY3, CY5 and MGB.