Application of 1-((4-cyclohexylphenyl) sulfonyl)-N-(4-fluorobenzyl)-4-methylpiperidine-4-formamide in preparation of medicine for treating nervous system diseases

Abstract

The invention belongs to the technical field of drug development, and particularly relates to application of 1-((4-cyclohexylphenyl) sulfonyl)-N-(4-fluorobenzyl)-4-methylpiperidine-4-formamide in preparation of drugs for treating nervous system diseases. The invention aims to provide a medicine which has small toxic and side effects and can target SLC11A2 to treat or improve nerve cell injury. According to the technical scheme, the invention relates to application of 1-((4-cyclohexylphenyl) sulfonyl)-N-(4-fluorobenzyl)-4-methylpiperidine-4-formamide in preparation of a medicine for treating nervous system diseases. It is proved that the compound 1-((4-cyclohexylphenyl) sulfonyl)-N-(4-fluorobenzyl)-4-methylpiperidine-4-formamide is small in toxic and side effect, and nerve cell damage can be protected or improved by targeting SLC11A2; and a new choice is provided for treating or improving nerve cell injury.

Description

Technical Field

[0001] The present invention belongs to the technical field of drug development, and specifically relates to the application of 1-((4-cyclohexylphenyl)sulfonyl)-N-(4-fluorobenzyl)-4-methylpiperidine-4-carboxamide in the preparation of drugs for treating nervous system diseases. Background Art

[0002] Neurological diseases, such as Alzheimer's disease, Parkinson's disease, stroke, and traumatic brain injury, are closely associated with neuronal cell death and dysfunction. As highly differentiated terminal cells with limited regenerative capacity, neuronal cell damage and death often lead to irreversible neurological deficits. Therefore, developing effective neuronal cell protection strategies is crucial for the prevention and treatment of neurological diseases. In recent years, with the deepening of research into the mechanisms of neuronal cell death, a variety of potential neuroprotective targets have been discovered, such as inhibiting excitatory amino acid toxicity, alleviating oxidative stress, inhibiting apoptosis, and promoting the secretion of neurotrophic factors. Based on these targets, researchers have developed a variety of neuroprotective strategies, including drug intervention, gene therapy, cell therapy, and physical therapy. Although several neuroprotective strategies have entered clinical trials, they still face numerous challenges, such as poor drug targeting, significant side effects, and limited therapeutic efficacy. Therefore, developing safer, more effective, and more targeted neuroprotective technologies remains a key research priority and challenge.

[0003] While currently available drugs for treating nerve cell damage have some efficacy, they still have numerous drawbacks. For example, sodium ganglioside injections can induce allergic reactions such as rashes, chills, and high fever; long-term, high-dose use of some sedatives and hypnotics can lead to drug dependence; patients taking donepezil long-term may experience a gradual decrease in drug efficacy, accompanied by side effects such as excessive excitement, mood swings, gastrointestinal discomfort, and liver damage; and rivastigmine can cause gastrointestinal reactions and liver damage. Some drugs for treating nerve cell damage, especially bioinhibitors or high-end drugs, are expensive and have limited availability, leading to limitations in their clinical application. Summary of the Invention

[0004] The purpose of the present invention is to provide a drug with small toxic and side effects and capable of targeting SLC11A2 to treat or improve nerve cell damage.

[0005] The technical solution of the present invention is the use of 1-((4-cyclohexylphenyl)sulfonyl)-N-(4-fluorobenzyl)-4-methylpiperidine-4-carboxamide in the preparation of drugs for treating nervous system diseases; the structural formula of the 1-((4-cyclohexylphenyl)sulfonyl)-N-(4-fluorobenzyl)-4-methylpiperidine-4-carboxamide is as follows: .

[0006] Wherein, the nervous system disease is caused by Aβ deposition.

[0007] Furthermore, the neurological disease is Alzheimer's disease.

[0008] Specifically, the concentration of 1-((4-cyclohexylphenyl)sulfonyl)-N-(4-fluorobenzyl)-4-methylpiperidine-4-carboxamide in the drug is 5 to 50 μM.

[0009] Preferably, the concentration of 1-((4-cyclohexylphenyl)sulfonyl)-N-(4-fluorobenzyl)-4-methylpiperidine-4-carboxamide in the drug is 10 to 20 μM.

[0010] The present invention also provides a drug for treating nervous system diseases, comprising 1-((4-cyclohexylphenyl)sulfonyl)-N-(4-fluorobenzyl)-4-methylpiperidine-4-carboxamide.

[0011] Wherein, the nervous system disease is caused by Aβ deposition.

[0012] Furthermore, the neurological disease is Alzheimer's disease.

[0013] Specifically, the concentration of 1-((4-cyclohexylphenyl)sulfonyl)-N-(4-fluorobenzyl)-4-methylpiperidine-4-carboxamide in the drug is 5 to 50 μM.

[0014] Preferably, the concentration of 1-((4-cyclohexylphenyl)sulfonyl)-N-(4-fluorobenzyl)-4-methylpiperidine-4-carboxamide in the drug is 10 to 20 μM.

[0015] The present invention also provides the use of gene SLC11A2 as a detection target in the preparation of a nerve cell injury diagnosis or prognosis evaluation kit.

[0016] Wherein, the nerve cell damage is caused by Aβ deposition.

[0017] Wherein, the nerve cell damage is caused by Alzheimer's disease.

[0018] Specifically, the kit contains primers for amplifying the gene or antibodies for detecting the protein encoded by the gene.

[0019] Beneficial effects of the present invention: The present invention screened a large number of Aβ 1-42The present invention also provides a detection target for the detection or prognosis of nerve cell damage. Through a series of network pharmacology studies, the compounds HY-Q42044, HY-Q42678, HY-Q42034, HY-Q31735, and HY-Q02007 were screened. Cell experiments showed that these compounds can improve the 1-42 The induced SY5Y cell activity changes, thereby improving nerve cell damage. This may be because HY-Q42044, HY-Q42678, HY-Q42034, HY-Q31735, and HY-Q02007 inhibit the expression of SLC11A2, thereby improving iron metabolism disorders and reducing Aβ 1-42 The present invention also demonstrates through experiments that HY-Q42044, HY-Q42678, HY-Q42034, HY-Q31735, and HY-Q02007 have minimal toxicity and side effects, and can protect or ameliorate nerve cell damage by targeting SLC11A2. This invention provides a new option for preparing drugs to treat or ameliorate nerve cell damage. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 The CCK8 analysis of SH-SY5Y cell survival rate was taken as 100%.

[0021] Figure 2 Figure 1 shows the validation of the KO library cell line. A shows the sgRNA plasmid transfection detected by q-PCR; B shows the sgRNA plasmid integration detected by DNA electrophoresis.

[0022] Figure 3 Aβ 1-42 Figure 3. Enrichment of treated SH-SY5Y cells.

[0023] Figure 4 This is a CRISPR library in vitro screening diagram, showing the key negative regulatory targets for neuronal cell survival discovered through screening. Figure A is a heat map showing significantly upregulated sgRNAs; Figure B is a heat map showing the top target genes with their corresponding sgRNAs; Figure C shows the log2 FC values ​​of each differentially expressed gene and the corrected log2 FC values ​​of all sgRNAs. P Volcano plot of values, after correction P <0.1.

[0024] Figure 5 Figure 1 is a graph showing the in vitro validation of candidate targets. Figure A shows the KO efficiency of candidate targets detected by q-PCR; Figure B shows the CCK8 assay showing the inhibition of candidate targets on Aβ. 1-42Figure 3. Effect of induced SH-SY5Y cell survival.

[0025] Figure 6 Figure 2 is a workflow diagram of virtual screening based on molecular docking.

[0026] Figure 7 The chemical structure of 1-((4-cyclohexylphenyl)sulfonyl)-N-(4-fluorobenzyl)-4-methylpiperidine-4-carboxamide is shown.

[0027] Figure 8 This is a Venn diagram of AD-related genes in the GeneCards database and the DisGeNET database. Orange: AD-related genes in the GeneCards database; Green: AD-related genes in the DisGeNET database.

[0028] Figure 9 A Venn diagram showing the relationship between small molecule compounds and disease-related genes. Green: number of genes associated with small molecule compounds; blue: number of genes associated with diseases.

[0029] Figure 10 Compounds HY-Q42044, HY-Q42678, HY-Q42034, HY-Q31735, and HY-Q02007 for Aβ 1-42 Effect of treatment on SLC11A2 mRNA expression in SY5Y cells ( ±s, n=3); compared with the blank group, *** P<0.001; compared with the model group, ## P < 0.01, ### P<0.001.

[0030] Figure 11 This is the KEGG pathway analysis diagram.

[0031] Figure 12This is a GO analysis chart. The vertical axis represents the number of genes enriched for each biological function. The horizontal axis divides the gene functions into three components: biological process (BP), cellular component (CC), and molecular function (MF). The three components cover the following functions: biological process (protein phosphorylation, signal transduction, protein autophosphorylation, chromatin remodeling, positive regulation of cell proliferation, intracellular signal transduction, negative regulation of apoptosis, positive regulation of epidermal growth factor receptor signaling pathway transcription by RNA polymerase II, insulin-like growth factor receptor signaling pathway), cellular component (plasma membrane, cytosol, cytoplasm, membrane, nucleoplasm, extracellular domain, extracellular region, mitochondria, glutamatergic synapse), and molecular function (protein binding, ATP binding, protein serine / threonine kinase activation, protein kinase activation, histone H3Y41 kinase activity, H2AXY142 kinase activity, protein tyrosine kinase activity, and metal ion binding).

[0032] Figure 13 This is a "component-target-disease" network diagram. Orange-red: target genes; blue: drugs.

[0033] Figure 14 This is a molecular docking visualization diagram. Light blue helical structure: SLC11A2 protein structure; green: small molecule; dark blue: amino acid binding site; yellow: small molecule.

[0034] Figure 15 Different drugs for Aβ 1-42 Effect of treatment on SY5Y cell activity (±s, n=3). Compared with the blank group, ** P <0.01, *** P <0.001 compared with the model group # P <0.05, ## P <0.01, ### P <0.001.

[0035] Figure 16 The figure shows the effect of different drug concentrations on SY5Y cell activity (±s, n=3). Compared with the blank group, * P <0.05, ** P <0.01, *** P <0.001. DETAILED DESCRIPTION

[0036] Most neurodegenerative diseases share common pathological hallmarks, with neuronal death being the most devastating. However, the regulatory processes governing neuronal death and axonal regeneration in these diseases remain poorly understood. An imbalance in the production and degradation of Aβ (β-amyloid protein) in the brain is now widely recognized as a key mechanism in the pathogenesis of Alzheimer's disease. Aggregated Aβ is toxic to neurons, causing both necrosis and apoptosis. Identifying Aβ-responsive targets and systematically analyzing the mechanisms by which Aβ deposition affects neuronal damage could provide new insights into the development of neuroprotective therapeutic strategies.

[0037] CRISPR library screening technology is a screening technology based on the CRISPR / Cas9 system. By designing and constructing a sgRNA library targeting all known gene libraries of a species or certain specific gene groups of interest, it can simultaneously knock out or activate different genes in the same tube of cells, and perform functional screening through drug treatment modeling and other methods to discover genes related to the screening phenotype.

[0038] The present invention uses CRISPR full gene KO library to construct stable cell lines and 1-42 (Aβ 1-42 A key variant of Aβ, due to its unique structure and pathological properties, plays a central role in the development and progression of Alzheimer's disease (AD). This variant will be used in subsequent experiments to model the neurotoxicity of SH-SY5Y cells. Surviving cells will be screened for library sequencing, and the negative regulatory targets of neuronal cell survival will be analyzed and identified, providing research targets for subsequent drug screening with neuroprotective effects.

[0039] After extensive screening experiments, SLC11A2 was ultimately identified as a target for treating or ameliorating neuronal cell damage. SLC11A2, also known as divalent cation transporter 1 (DMT1), NRAMP 2, or solute carrier family 11 member 2, is a proton-coupled metal ion symporter. It primarily transports divalent metal cations such as Cd(2+), Fe(2+), Co(2+), and Mn(2+), and to a lesser extent Zn(2+), Ni(2+), and VO(2+). It is crucial for maintaining iron homeostasis, regulating intestinal Fe(2+) absorption, transporting TF-associated endosomal Fe(2+), and promoting the import of Fe(2+) and Mn(2+) into mitochondria. SLC11A2 has been implicated in various diseases. For example, the iron metabolism disorders and neuronal ferroptosis in Alzheimer's disease (AD) may be related to abnormal SLC11A2 expression or function. The study also found that knocking out the SLC11A2 gene can reverse the neuronal structural and functional damage and cognitive behavioral abnormalities caused by Aβ, but current technology does not have drugs that target SLC11A2 to treat or improve nerve cell damage.

[0040] In order to further illustrate the technical means and effects adopted by the present invention to achieve the predetermined purpose of the invention, the specific implementation methods, structures, features and effects of the present invention are described in detail below in conjunction with the accompanying drawings and preferred embodiments.

[0041] Example 1 Aβ 1-42 Exploration of toxic concentrations for SH-SY5Y cells Take SH-SY5Y cells (Wuhan Punosai Biotechnology) in the logarithmic growth phase and adjust the cell concentration to 1×10 5 100 μL / well was inoculated into a 96-well plate and incubated in a 37°C 5% CO2 saturated humidity incubator for 12 h. 1-42 (Biyuntian Biotechnology) was used to establish the injury model. The culture medium was replaced with a final concentration of 5 μM, 10 μM, 15 μM, 20 μM, and 40 μM Aβ. 1-42 The solution was added at 100 μL / well. Serum-free medium was replaced in the normal control group and the zero-adjusted wells. Each group was plated with 5 replicate wells. The cells were incubated in an incubator for 24 h.

[0042] Detection of Aβ by CCK8 1-42 To measure the cell viability, 20 μL of CCK8 solution (Biyuntian, C0039) was added to each well. The culture plate was incubated in an incubator for 2 hours. The absorbance at 450 nm was measured using a microplate reader (Thermo, Multiskoun GO).

[0043] The results are as follows Figure 1 Shown: Aβ 1-42 The cytotoxicity to SH-SY5Y cells was concentration-dependent. 1-42 The cell survival rates were inhibited by increasing concentrations (5 μM, 10 μM, 15 μM, 20 μM, 40 μM), and the differences were statistically significant compared with the normal control group (NC) (P < 0.05). The survival rates were 68.14%, 59.86%, 42.12%, 31.04%, and 28.3%, respectively. 1-42 The degree of damage was obvious and stable, so 20 μM Aβ was used. 1-42 The modeling condition was to act on SH-SY5Y cells for 24 hours.

[0044] Example 2 Construction of CRISPR full-gene KO library cell line (1) Cell plating: 7×10 cells per plate one day in advance 7 293T cells were plated in a 15 cm dish and 10 mL of DMEM medium containing 10% FBS was added. Before transfection, the cells were ensured to be approximately 90% confluent.

[0045] (2) Plasmid Mixture: 22.5 μg of CRISPR KO library plasmids (including GECKOA and GECKOB plasmids, Zhongyuan Bio), 7.5 μg of pCMV-VSV-G, 7.5 μg of pMDLg pRRE, and 7.5 μg of pRSV-Rev lentiviral packaging plasmids (Jierui Bio) were added to 0.6 mL of DMEM without FBS. 90 μL of polyethyleneimine was then added to the plasmid mixture, vortexed briefly, and incubated for 15 min.

[0046] (3) Cell infection: Add the transfection reagent and mixed plasmids to 293T cells, change the medium after 6 hours, and return to the 37℃, 5% CO2 incubator.

[0047] (4) Virus collection and concentration: 48 h and 72 h after transfection, the virus solution was collected and centrifuged at 4000 rpm for 5 min at room temperature. The virus was concentrated to 0.2 mL using the PEG precipitation method. The lentivirus titer was detected by PCR and stored at -80°C.

[0048] (5) Determine the drug screening concentration: Set the gradient concentration of puromycin, and use the lowest drug concentration that causes all SH-SY5Y cells to die after 7 to 10 days as the subsequent drug screening concentration.

[0049] (6) Cell infection and drug screening: One day before infection, SH-SY5Y cells were plated onto a 15 cm dish, and viral supernatant and 10 μg of polybrene were added. Puromycin was used for drug screening to obtain a stable cell line.

[0050] Extract DNA from SH-SY5Y wt cells, SH-SY5Y control group library cells, and KO library cells, design KO library backbone vector primers, perform PCR amplification, and identify whether the KO library sgRNA cells are successfully transfected. The specific steps are as follows: DNA extraction: HiPure Tissue DNA Mini Kit (Meiji Bio) was used to extract Day 0 SH-SY5Y full gene knockout library cell line, as well as Aβ 1-42 DNA of surviving SH-SY5Y cells after treatment was collected and the DNA concentration was detected.

[0051] The amplification system was as follows: 50 µL ddH₂O, 100 ng DNA, 2.5 µL Primer (10 µM), and 25 µL 2× Phanta Max Master Mix. The amplification program was as follows: initial denaturation at 95°C for 60 s; denaturation at 95°C for 10 s, annealing at 56°C / 60°C for 10 s, extension at 72°C for 30 s, 20 cycles; 72°C for 1 min; and 12°C. Primer sequences were: KO seq-F (SEQ ID No. 1): TCTTGTGGAAAGGACGAAACACCG; KO seq-R (SEQ ID No. 2): ACCTTCTCTAGGCACCGGAT.

[0052] Electrophoresis and gel recovery: After electrophoresis, the PCR product was recovered using the HiPure Gel Pure DNA Mini Kit for sgRNA library sequencing. The sequence of the PCR product (209 bp) (SEQ ID No. 3) is: TCTTGTGGAAAGGACGAAACACCGNNNNNNNNNNNNNNNNNNNNGTTTTAGAGCTAGGCCAACATGAGGATCACCCATGTCTGCAGGGCCTAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGGCCAACATGAGGATCACCCATGTCTGCAGGGCCAAGTGGCACCGAGTCGGTGCTTTTTTTGGATCCTAGGTCTTGAAAGGAG.

[0053] sgRNA library sequencing: High-throughput sequencing was performed using the HiSeq 2500 platform to analyze the sgRNA reads of each group of samples.

[0054] like Figure 2 As shown in Figure A, compared with the control group (SH-SY5Y), the expression levels of sgRNA mRNA in the experimental groups (SH-SY5-NC, SH-SY5Y-KO) were significantly increased (P < 0.001), indicating that the KO library transfection was successful. Figure 2 Figure B shows that the SH-SY5-NC and SH-SY5Y-KO library cells have obvious and very strong target bands (209 bp), while the SH-SY5Y cells (negative control) have no obvious bands, indicating that the sgRNA plasmid has been integrated into the SH-SY5Y cell DNA.

[0055] Example 3 Aβ 1-42 Treatment of SH-SY5Y stable cell lines The above 20 μM concentration of Aβ was used 1-42 SH-SY5Ywt and knockout library cell lines were processed. Since CRISPR full-gene KO library A (GECKOA) and library B (GECKOB) contain 65,383 and 58,028 sgRNAs, respectively, targeting 19,050 genes for knockout, the number of cells processed in each batch should be approximately 3×10 7 , that is, the library coverage is greater than 200. Take pictures after 24 hours of treatment, such as Figure 3 Surviving cells were collected to extract genomic DNA, amplified by PCR, and the products were recovered and sequenced for sgRNA library.

[0056] Example 4 Screening and Verification of Negative Regulatory Targets for Neuronal Cell Survival Bioinformatics analysis of the control group library and Aβ 1-42 Sequencing data of sgRNA library of SH-SY5Y cells that survived after treatment were used to screen candidate negative regulatory targets for neuronal cell survival. 1-42 The results showed that 427 sgRNAs were significantly upregulated in surviving cells. Figure 4 , corrected P value < 0.1), among which SLC11A2 was significantly overexpressed in surviving cells (log2FC>10).

[0057] The candidate target KO plasmid was synthesized and packaged with lentivirus to infect SH-SY5Y cell line (see Example 2 for the method). The knockout efficiency of the candidate target was detected by q-PCR. CCK8 was used to detect whether inhibiting the expression of the candidate target could promote Aβ 1-42 The induced SH-SY5Y cell survival, thus exerting a neuroprotective effect. Figure 5A in Figure 1 shows that the expression levels of each candidate target gene were significantly reduced after KO plasmid transformation. The results of CCK8 experiment showed that ( Figure 5 B), knocking out SLC11A2 can significantly promote Aβ 1-42 The induced SH-SY5Y cell survival indicated that knockdown of the candidate target gene had a neuroprotective effect.

[0058] The primers used for q-PCR were as follows: upstream primer F: TGGCACCAGCACAATGAA (SEQ ID No. 4) and downstream primer R: CTAAGTCATAGTCCGCCTAGAAGCA (SEQ ID No. 5) for β-actin (product length, 185 bp); upstream primer F: AATGGACTAGGCTGGCGGAT (SEQ ID No. 6) and downstream primer R: GGACATGCCCAGTGCAATCA (SEQ ID No. 7) for SLC11A2 (product length, 195 bp). The qPCR reaction program was as follows: 95°C for 30 s, followed by 40 cycles of 95°C for 5 s and 60°C for 30 s.

[0059] Example 5: Initial Screening of Drugs Targeting SLC11A2 SLC11A2 can selectively transport divalent metal cations, including Fe(2+), and is crucial for maintaining iron homeostasis in the body. SLC11A2 is widely expressed in tissue cells throughout the body, and its functions are diverse and important. SLC11A2 knockout can improve iron metabolism disorders and neuronal ferroptosis caused by Aβ, which further supports the important role of SLC11A2 in nerve cell damage. Therefore, the present invention takes SLC11A2 as the core to screen drugs that target and inhibit this gene and treat nerve cell damage.

[0060] 1. Virtual Screening Virtual screening was performed for SLC11A2 using MCE's 50K Diversity Library database and Natural Product Library Plus database. Five components were then screened from each database based on the docking scores for related research. The virtual screening software used was Schrödinger Maestro 12.8, and the screening process was as follows: Figure 6 shown.

[0061] After screening, the five components obtained were: (E)-N-benzyl-2-(4-((2-fluorobenzyl)oxy)benzylidene)hydrazinecarbothioamide (HY-Q42044), N-(4-(N-phenethylsulfamoyl)phenyl)-2,2-diphenylacetamide (HY-Q42678), (E)-N-benzyl-2-((5-(phenylthio)furan-2-yl)methylene)hydrazine-1-thiocarboamide (HY-Q42679), and N-(4-(N-phenethylsulfamoyl)phenyl)-2,2-diphenylacetamide (HY-Q42677). 1-((4-cyclohexylphenyl)sulfonyl)-N-(4-fluorobenzyl)-4-methylpiperidine-4-carboxamide, HY-Q02007). Among them, the structure of 1-((4-cyclohexylphenyl)sulfonyl)-N-(4-fluorobenzyl)-4-methylpiperidine-4-carboxamide (HY-Q02007) is as follows Figure 7 shown.

[0062] 2. Network pharmacology analysis The Smiles-formatted components of the screened drugs were imported into the SwissTargetPrediction database (http: / / swisstargetprediction.ch) for target prediction, screening for all targets with a probability greater than 0. After integration, 376 targets with a probability greater than 0 were screened (Table 1), and after deduplication, a total of 254 potential targets were identified.

[0063] Table 1 Compound-related genes .

[0064] Alzheimer's disease is a common disease caused by neurological damage. Therefore, using "Alzheimer's disease" as a keyword, we used the GeneCards database (https: / / www.genecards.org) and the DisGeNET database (http: / / www.disgenet.org / ) to search for disease-related targets and integrated the obtained targets. 26,108 Alzheimer's disease-related genes were obtained in the GeneCards database, and 3,397 Alzheimer's disease-related genes were obtained in the DisGeNET database. After integrating the two databases, there were 26,266 Alzheimer's disease-related genes ( Figure 8 ).

[0065] The compound-related genes and disease-related genes were uploaded to the Micro-informatics platform (http: / / www.bioinformatics.com.cn) to make a Venn diagram ( Figure 9 ), the intersection of the two was taken, that is, there are 232 identical genes between drug targets and disease-related genes.

[0066] We further used the DAVID database (https: / / davidbioinformatics.nih.gov / ) to perform KEGG and GO enrichment analysis on 232 targets at the intersection of diseases and compounds. We selected the top 20 KEGG pathways based on count values ​​and mapped them using the Microbiology Information Platform. In the GO analysis, we analyzed the top 20 terms in terms of biological processes, cellular components, and molecular functions of related genes. Figure 11 ) found that the related genes were mainly clustered in cancer pathways, MAPK signaling pathways, neuroactive ligand-receptor interactions, PI3K-AKT signaling pathways, calcium signaling pathways, RAS signaling pathways, etc. In GO analysis ( Figure 12 ), the related genes mainly involve protein phosphorylation, signal transduction, chromatin remodeling, plasma membrane, solutes, protein binding, ATP binding and other aspects.

[0067] At the same time, in order to better illustrate the relationship between each target, cytoscape 3.7.1 was used to draw the PPI protein interaction network. Protein interaction analysis shows that the mechanism of drug treatment of diseases is complex, which is a synergistic effect between multiple targets and does not rely on a single target. The active ingredients and targets of the drugs were imported into Cytoscape 3.7.1 software to construct a "component-target" network diagram. The Merge tool in Cytoscape3.7.1 software was further used to merge the "component-target" network with the PPI protein interaction network to obtain a "component-target-disease" network diagram. Figure 13 As shown, orange-red represents targets, and blue represents drug screening. The darker the target color, the greater the degree value, indicating that the target is more important. The figure contains five screened active ingredients, 232 nodes, and 4174 edges.

[0068] The small molecule compound name was entered into the PubChem database (https: / / pubchem.ncbi.nlm.nih.gov), compound information was retrieved, and the SDF format was downloaded. The three-dimensional structure of human SLC11A2 (AF-P49281-F1) was downloaded from the alphafold website for future use. After obtaining the small molecule ligand and protein receptor, both were processed. First, the small molecule mechanical structure was optimized using Chem 3D and saved in mol2 format. The ligand root and rotatable bond structures in the mol2 file were then processed using AutDocktools and exported as a PDBQT file. Using Pymol software, the protein receptor, dehydrated molecule, small molecule ligand, and repeat structure were saved in PBD format. This file was then opened using AutDocktools to calculate charges, add atoms, and identify the docking region. A configuration file was created for molecular docking. The docking results were visualized using Pymol and the Protein-Ligand Interaction Profiler database (https: / / plip-tool.biotec.tu-dresden.de / plip-web / plip / index). After processing the SLC11A2 protein structure, the docking boxes were determined to be (-7.622, 7.685, -7.309). The docking scores were ranked from high to low as follows: HY-Q42044 (-10.394), HY-Q42678 (-10.004), HY-Q42034 (-9.667), HY-Q31735 (-9.665), and HY-Q02007 (-9.627). The pose with the highest docking score was selected for visualization ( Figure 14 ).

[0069] Example 6 Effects of Different Drugs on Aβ 1-42Effect of treatment on SY5Y cell viability Weigh 1 mg of each of the five aforementioned compounds (Dongru Biotechnology) into separate EP tubes and prepare a 1 mM stock solution at a 1:100 ratio of DMSO to DMEM / F12 medium. The original stock solution of the synthetic drug is 10 mM, which is diluted to a 1 mM stock solution at a 1:9 ratio using DMEM / F12 medium and set aside.

[0070] The experiment was set up as a blank group (CON), a model group (MOD), a 10μM drug group, and a 20μM drug group. SY5Y cells in the logarithmic growth phase were taken, digested and centrifuged, and then an appropriate amount of culture medium was added and mixed. The cells were counted and 105 cells were seeded into a 96-well plate per well for 24 hours. After the cells adhered to the wall, the old culture medium was removed. 100μL of complete culture medium without double antibody was added to each well of the blank group, and 100μL of 20μM Aβ was added to each well of the model group. 1-42 Solution, 100 μL of 20 μM Aβ was added to each well of the 10 μM treatment group. 1-42 Mix with 10 μM drug solution. For the 20 μM drug group, add 100 μL of 20 μM Aβ to each well. 1-42 After incubation with a 20 μM drug solution mixture for 24 hours, the old culture medium was removed and a new culture medium containing CCK-8 was added. After incubation for 2 hours, the absorbance was measured at 450 nm to calculate the cell survival rate. 1-42 Effect of treatment on the survival rate of SY5Y cells.

[0071] The results are as follows Figure 15 As shown in the figure, compared with the blank group, the cell survival rate of the model group was significantly decreased (P < 0.01, P < 0.001), indicating that 20 μM Aβ 1-42 The modeling effect of damaging SY5Y cells for 24 hours was significant; compared with the model group, the cell survival rates of the low-dose and high-dose groups of different drugs were significantly increased (P < 0.05, P < 0.01, P < 0.001), indicating that the drugs screened virtually have a strong effect on Aβ 1-42 The results showed that the drug had a significant protective effect on the cell damage caused by leukemia. HY-Q42044, HY-Q42678, HY-Q42034, HY-Q31735, and HY-Q02007 were subsequently selected for further research.

[0072] Example 7 Effects of different drug concentrations on SY5Y cell activity To determine the safe dosing range and optimal dosing concentration of each drug for SY5Y cells, the 1mM stock solutions of the four drugs were diluted into 5μM, 10μM, 25μM, 50μM, and 100μM solutions using complete culture medium without double antibody. SY5Y cells in the logarithmic growth phase were digested and centrifuged, and then an appropriate amount of culture medium was added and mixed. After counting the cells, 10 cells were added to each well. 5 Cells were seeded into 96-well plates and cultured for 24 hours. After cells adhered, the corresponding concentration of drug was added. The cells were placed in a cell culture incubator for 24 hours. The old culture medium was removed and fresh culture medium containing CCK-8 was added. After incubation for 2 hours, the absorbance was measured at 450 nm and the cell viability was calculated. The effects of different drug concentrations on SY5Y cell viability were determined to determine the appropriate drug concentration.

[0073] The results are as follows Figure 16 As shown, each drug was treated at 5μM, 10μM, 25μM, 50μM, and 100μM, respectively. The concentrations at which each drug produced toxicity to SY5Y cells varied. HY-Q42044 had no significant toxic effect on SY5Y cells at concentrations of 5-50μM, HY-Q42678 had no significant toxic effect on SY5Y cells at concentrations of 5-50μM, HY-Q42034 had no significant toxic effect on SY5Y cells at concentrations of 5-25μM, HY-Q31735 had no significant toxic effect on SY5Y cells at concentrations of 5-50μM, and HY-Q02007 had no significant toxic effect on SY5Y cells at concentrations of 5-10μM.

[0074] Example 8 Inhibitory effects of different drugs on SLC11A2 1. Cell processing After digestion and centrifugation of SY5Y cells in the logarithmic growth phase, complete culture medium was added and mixed. After counting the cells, 10 cells were added to each well. 6 Cells were seeded into 6-well plates and set as blank control group (CON), model group (MOD), and HY-Q42044, HY-Q42678, HY-Q42034, HY-Q31735, and HY-Q02007 drug treatment groups.

[0075] After culturing for 24 h, 2 mL of complete culture medium without dual antibodies (i.e., DMEM / F12 culture medium containing 15 v / v% FBS) was added to each well of the blank group; 2 mL of 20 μM Aβ prepared in Example 2 was added to each well of the model group. 1-42 The HY-Q42044, HY-Q42678, HY-Q42034, HY-Q31735, and HY-Q02007 drug treatment groups were treated with the corresponding drugs. Cells in each group were placed in a cell culture incubator and cultured for 24 hours.

[0076] 3. RNA extraction and reverse transcription After the culture is completed, the old culture medium is removed, 500 μL of Trizol is added to each well, the tube is pipetted repeatedly, and the tube is allowed to stand at room temperature for 5 minutes. 300 μL of chloroform substitute is added to each well, the tube is shaken for 15 seconds, the tube is allowed to stand at room temperature for 5 minutes, and then centrifuged at 4°C and 12000 rpm for 15 minutes. The upper aqueous phase is taken, 0.5 times the volume of isopropanol is added, the tube is vortexed for 15 seconds, the tube is allowed to stand at room temperature for 10 minutes, and then centrifuged at 4°C and 12000 rpm for 15 minutes. The supernatant is discarded, and the RNA precipitate is washed with 1 mL of 75% ethanol. After adding 75% ethanol, the tube is centrifuged at 4°C and 7500 rpm for 5 minutes. The washing is repeated three times, and the tube is evaporated to dryness at room temperature for 30 minutes. 20 μL of enzyme-free water is added to dissolve the RNA, and the RNA concentration is detected using a spectrophotometer.

[0077] The extracted RNA was reverse transcribed using a reverse transcription reagent (Acori Biotechnology) according to the RNA content of 300 ng, and the obtained cDNA was stored at -20°C.

[0078] 3. qPCR detection of SLC11A2 mRNA expression The cDNA obtained in the previous step was diluted at a ratio of 1:2 (cDNA: enzyme-free water), mixed, and used as a template for qPCR analysis. qPCR primers (SEQ ID Nos. 4-7) were synthesized by Sangon Biotech (Shanghai) Co., Ltd. The qPCR reaction system consisted of: 2× SYBR Green Rro Taq HS Premix, 5 μL; Primer F (10 μM), 0.2 μL; Primer R (10 μM), 0.2 μL; Template, 1 μL; Enzyme-free water, 3.6 μL). The qPCR reaction program was as follows: 95°C for 30 s; 95°C for 5 s; 60°C for 30 s, for 40 cycles.

[0079] like Figure 10 As shown in the data, compared with the CON group, the SLC11A2 mRNA expression in the MOD group was significantly increased (P < 0.001). Compared with the MOD group, the SLC11A2 mRNA expression in the HY-Q42044, HY-Q42678, HY-Q42034, HY-Q31735, and HY-Q02007 groups was significantly decreased (P < 0.001). This suggests that HY-Q42044, HY-Q42678, HY-Q42034, HY-Q31735, and HY-Q02007 can inhibit the expression of SLC11A2 mRNA and are inhibitors targeting SLC11A2.

[0080] The above description is merely a preferred embodiment of the present invention and does not constitute any form of limitation to the present invention. Although the present invention has been disclosed as above in terms of a preferred embodiment, it is not intended to limit the present invention. Any person skilled in the art can, without departing from the scope of the technical solution of the present invention, make some changes or modifications to equivalent embodiments using the technical contents disclosed above. However, any brief modifications, equivalent changes and modifications made to the above embodiments based on the technical essence of the present invention without departing from the content of the technical solution of the present invention are still within the scope of the technical solution of the present invention.

Claims

1. Use of 1-((4-cyclohexylphenyl)sulfonyl)-N-(4-fluorobenzyl)-4-methylpiperidine-4-carboxamide in the preparation of a drug for treating nervous system diseases, characterized in that: The nervous system disease is caused by Aβ deposition; the structure of the 1-((4-cyclohexylphenyl)sulfonyl)-N-(4-fluorobenzyl)-4-methylpiperidine-4-carboxamide is as follows: .

2. The application according to claim 1, characterized in that: The concentration of 1-((4-cyclohexylphenyl)sulfonyl)-N-(4-fluorobenzyl)-4-methylpiperidine-4-carboxamide in the drug is 5 to 50 μM.

3. The application according to claim 2, characterized in that: The concentration of 1-((4-cyclohexylphenyl)sulfonyl)-N-(4-fluorobenzyl)-4-methylpiperidine-4-carboxamide in the drug is 10-20 μM.

4. A drug for treating a nervous system disease, characterized in that: The invention relates to 1-((4-cyclohexylphenyl)sulfonyl)-N-(4-fluorobenzyl)-4-methylpiperidine-4-carboxamide; the neurological disease is caused by Aβ deposition.

5. The drug according to claim 4, characterized in that: The concentration of 1-((4-cyclohexylphenyl)sulfonyl)-N-(4-fluorobenzyl)-4-methylpiperidine-4-carboxamide in the drug is 5 to 50 μM.

6. The drug according to claim 5, characterized in that: The concentration of 1-((4-cyclohexylphenyl)sulfonyl)-N-(4-fluorobenzyl)-4-methylpiperidine-4-carboxamide in the drug is 10-20 μM.

Images