Streptococcus suis type 2 virulent strain resistant to multiple antibiotics and application
By screening the multidrug-resistant Streptococcus suis type 2 virulent strain S068 to establish a stable infection model, and combining it with polysaccharide conjugate vaccine evaluation, the instability and antibiotic abuse problems of the Streptococcus suis type 2 infection model were solved, and efficient and accurate vaccine protection effects were achieved in an antibiotic environment.
Patent Information
- Application Number
- CN202510894337.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-06-30
- Publication Date
- 2025-09-19
Smart Images
Figure CN120665774A_ABST
Abstract
Description
Technical Field
[0001] The invention relates to a highly virulent type 2 strain of Streptococcus suis resistant to multiple antibiotics and application thereof, belonging to the technical field of vaccine preparation. Background Art
[0002] Streptococcus suis is a common bacterial infectious disease in pig farms and a significant zoonosis, posing a significant threat to public health and safety. Reports have been reported in all pig-raising regions. The primary pathogen is Streptococcus suis (SS), which can be divided into 35 serotypes, including types 1 to 34 and SS1 / 2, based on the specificity of its capsular antigens. Among them, Streptococcus suis type 2 (SS2) is considered the most virulent strain and the most commonly isolated from infected pigs.
[0003] This disease occurs in many countries and regions worldwide. The isolated strains of Streptococcus suis type 2 exhibit irregular patterns in artificial disease outbreaks, and its causative factors and interaction mechanisms remain unclear. In particular, obtaining reproducible results using isolates of S. suis type 2 inoculated in experimental animals such as piglets or mice is difficult. This may be due to the current overuse of antibiotics in piggery management. Pigs are typically treated with large amounts of antibiotics after bacterial infection, resulting in long-term antibiotic residues in the animals' bodies. Furthermore, animal excreta containing antibiotic residues is discharged into the environment, potentially contributing to environmental antibiotic contamination. Furthermore, during experimental breeding, pigs remain at risk of infection with various pathogens, leading to abnormal mortality and suboptimal experimental results. Therefore, when establishing artificial S. suis type 2 infection models, pigs from different sources often exhibit significant individual variability.
[0004] This study screened 24 clinically isolated Streptococcus suis type 2 strains and identified a highly virulent, multidrug-resistant strain. Through isolation and culture, drug sensitivity testing, and animal testing, a challenge model for S. suis type 2-infected piglets was successfully established. This model reduces experimental costs, simplifies the modeling process, and provides highly accurate and stable challenge results, further facilitating the evaluation and screening of subsequent vaccines. Summary of the Invention
[0005] The purpose of the present invention is to provide a virulent strain of Streptococcus suis type 2 that is resistant to multiple antibiotics. The strain has been deposited in the China Center for Type Culture Collection on December 6, 2024, with a preservation number of CCTCC NO: M20242747 and a classification name of Streptococcus suis type 2 S068.
[0006] Furthermore, the minimum challenge dose for 4 / 5 deaths of 8-9 week old healthy piglets was 2×10 6 CFU / head.
[0007] Another object of the present invention is to provide a method for evaluating the toxicity of the virulent strain of Streptococcus suis type 2 resistant to multiple antibiotics: (1) Weaned piglets aged 3-4 weeks were divided into an experimental vaccine group, a commercial vaccine control group, and a challenge control group; (2) The experimental vaccine group received an intramuscular injection of the experimental vaccine containing Streptococcus suis type 2, the commercial vaccine control group received an intramuscular injection of the commercial Streptococcus suis type 2 vaccine, and the challenge control group was not immunized; (3) A second immunization with the same dose was performed 21 days after the first immunization, and a lethal dose of Streptococcus suis type 2 S068 strain was injected into the ear vein 14 days after the second immunization; (4) After infection, the animals were observed for 14 consecutive days, with body temperature monitored daily and clinical symptoms such as joint swelling, lameness, and ataxia recorded; (5) Autopsy to observe pathological changes such as joint effusion, pericardial effusion, and cerebral congestion; (6) The judgment criteria are: no symptoms or body temperature rise ≤1.5℃ and lasting for less than 2 days, and no typical joint / brain lesions, which means that the protection against the virus is established.
[0008] Furthermore, amoxicillin antibiotic is added to each ton of feed for the weaned piglets.
[0009] The beneficial effects of the present invention are: 1. The virulent S. suis type 2 strain of the present invention possesses the advantages of high virulence, causing significant clinical symptoms and pathological changes, providing an ideal model for studying the pathogenic mechanisms of suis streptococcal disease and evaluating drugs. It also exhibits multidrug resistance, making it an ideal target for screening and evaluating new antimicrobial drugs, and facilitating the development of new treatment options to address drug resistance. This strain is also highly valuable in evaluating vaccine efficacy and validating immune challenge models.
[0010] 2. The Streptococcus suis type 2 polysaccharide conjugate vaccine demonstrated a higher protection rate when fed antibiotics, demonstrating its adaptability, efficiency, and safety in complex clinical settings. The protective efficacy of the polysaccharide conjugate vaccine was not weakened when fed antibiotics, but rather, it was more accurate due to reduced interference from other pathogens, making it suitable for use in actual farming environments. BRIEF DESCRIPTION OF THE DRAWINGS
[0011] Figure 1 Schematic diagram of the microscopic examination results of Streptococcus suis type 2 strain S068.
[0012] Figure 2 This is the growth curve of Streptococcus suis type 2 S068 strain.
[0013] Figure 3 This is a picture of suppurative arthritis lesions in piglets after autopsy after injection of Streptococcus suis type 2 strain S068. DETAILED DESCRIPTION
[0014] In order to make the technical means, creative features, objectives and effects of the present invention easier to understand, the present invention is further explained below with reference to specific illustrations.
[0015] Example 1, Isolation and Culture of Streptococcus suis Type 2 Strain
[0016] From 2020 to 2024, our laboratory obtained a total of 105 respiratory tract-related disease samples from 4 provinces in China. After homogenization, they were spread on TSA medium plates containing 5% newborn calf serum and cultured at 37°C for 48 hours. Suspected single colonies of Streptococcus suis (small gray-white colonies with neat edges and smooth and moist surfaces) were selected and inoculated into TSB liquid medium containing 5% newborn calf serum. gdh The gene was identified by PCR, and the amplification method was as follows: Required primers: gdh F: 5′–AAGTTCCTCGGTTTTGAGCA–3′ gdh R: 5′–GCAGCGTATTCTGTCAAACG–3′ The reaction program was as follows: pre-denaturation at 95°C for 5 min; 30 cycles of 95°C for 1 min, 55°C for 1 min, and 72°C for 1 min, followed by extension at 72°C for 10 min.
[0017] After amplification, add Loading Buffer to the PCR stock solution and perform agarose gel electrophoresis. After electrophoresis, photograph the sample using a gel imaging system. For samples that amplify a specific band (566 bp), add sterile glycerol to a final concentration of 25% to the bacterial solution, mix thoroughly, and store at -70°C. Serological identification is then performed using the following amplification method: Required primers: CPS 2F: 5′–GTTGAGCCTTATACACCTGTT–3′ CPS 2R: 5′–CAGAAAATTCATATTGTCCACC–3′ The reaction program was as follows: pre-denaturation at 95°C for 5 min; 30 cycles of 95°C for 1 min, 50°C for 1 min, and 72°C for 30 sec, followed by extension at 72°C for 10 min.
[0018] After amplification, add Loading Buffer to the PCR stock solution and perform agarose gel electrophoresis. After electrophoresis, visualize the sample using a gel imaging system. Samples that amplify a specific band (450 bp) are Streptococcus suis serotype 2.
[0019] According to the above method, the bacteria isolated from 105 test materials were identified, and a total of 24 clinical isolates of serotype 2 Streptococcus suis were obtained.
[0020] Example 2, Drug Sensitivity Test of Strain (A Multidrug-Resistant Strain, Named S068)
[0021] With reference to the CLSI animal-derived bacterial resistance standards, the broth microdilution method was used to test the minimum inhibitory concentrations of 8 antimicrobial drugs: amoxicillin / clavulanate potassium, ceftiofur sodium, tiamulin, florfenicol, enrofloxacin, trimethoprim / sulfamethoxazole, clindamycin, and tetracycline against 24 clinical isolates of Streptococcus suis type 2. The specific method is as follows: Preparation of antibiotic stock solution: Dissolve 8 kinds of antibiotic powders according to the solution and dissolution method in Table 1 to prepare antibiotic stock solution, and store at 2-8°C for use.
[0022] Table 1 Antibiotic dissolution and dilution methods
[0023] Preparation of antibiotic working solutions: The above eight antibiotic stock solutions were diluted 2-fold with the corresponding diluents to prepare eight different concentrations of antibiotic working solutions. The concentrations of the diluted antibiotics are shown in Table 2.
[0024] Table 2 Antibiotic working concentrations and breakpoints
[0025] Preparation of bacterial solution: The preserved bacteria were streaked on TSA solid medium containing 5% newborn calf serum, cultured at 37°C, and several single colonies were picked and transferred to sterile MH broth to detect the bacterial concentration OD 600nm It is about 0.1 to 0.2, and then it is diluted 100 times to make its concentration 1×10 6 cfu / mL.
[0026] Microdilution: In a 96-well plate, add 10 different concentrations of amoxicillin / clavulanate potassium solution to wells 10 in row 1, from left to right. Similarly, add ceftiofur sodium, tiamulin, florfenicol, enrofloxacin, trimethoprim / sulfamethoxazole, clindamycin, and tetracycline hydrochloride to rows 2 through 6, respectively. Do not add antibiotics to wells 11 and 12 in each row. After adding antibiotics, add 100 μL of the prepared diluted bacterial solution to wells 1 through 11 in all 6 rows. Add 100 μL of CAMHB liquid medium to well 12. Thus, wells 1 through 10 are test wells, well 11 is a positive control well, and well 12 is a positive control well. Perform two replicates for each bacterial species to be tested.
[0027] Incubation and assessment: Seal the reaction plate with sterile plastic wrap and place it in a 35°C incubator for static incubation. Observe the results after 20–24 hours. The 11th well in each row should show good bacterial growth (turbid culture medium), while the 12th well should show no bacterial growth (clear culture medium). Among the 10 dilutions of antibiotics in each row, the well that completely inhibits bacterial growth (clear culture medium) with the naked eye corresponds to the antibiotic concentration in that well. The lowest antibiotic concentration is the minimum inhibitory concentration (MIC) for that clinical isolate. Results are shown in Table 3.
[0028] Table 3 Minimum inhibitory concentrations of 24 strains of Streptococcus suis type 2 against 8 antibiotics
[0029] Example 3, Identification and Cultivation of Streptococcus suis Type 2 S068
[0030] Twenty-four clinically isolated Streptococcus suis type 2 strains were screened out through drug sensitivity testing to obtain a multidrug-resistant strain S068 for colony morphology observation, Gram staining microscopy, biochemical identification and growth curve determination.
[0031] 1. Colony Morphology: Spread Streptococcus suis type 2 strain S068 onto TSA solid medium supplemented with 5% newborn calf serum and incubate in a 37°C incubator for 16-24 hours. Bacteria should grow well on the plate, forming smooth, neatly marginated, translucent small colonies with blue fluorescence.
[0032] 2. Gram staining observation: Spread the Streptococcus suis type 2 S068 strain on TSA solid medium containing 5% newborn calf serum and incubate it in a 37℃ constant temperature incubator for 16-24 hours. Pick a single colony for Gram staining microscopy, and the result is Gram-positive small rods. Figure 1 .
[0033] 3. Biochemical Identification: Biochemical tests for glucose, sucrose, fructose, maltose, mannitol, sorbitol, and lactose were performed. Streptococcus suis type 2 strain S068 was plated on TSA solid medium supplemented with 5% newborn calf serum and incubated in a 37°C incubator for 16-24 hours. In a test tube containing 2 mL of sterile water, 1-3 colonies were picked from the plate using a sterile inoculating loop and added to the sterile water to create a uniform bacterial suspension. 50-100 μL of this suspension was added to an ampoule and sealed with parafilm. After inoculation, the ampoule was incubated at 37°C for 18-24 hours. After completion of the experiment, the reaction results were evaluated according to the instructions. The biochemical identification results, shown in Table 4, were consistent with the biochemical characteristics of Streptococcus suis.
[0034] 4. Growth Curve: Streptococcus suis type 2 strain S068 was plated onto TSA solid medium containing 5% newborn calf serum and incubated in a 37°C constant temperature incubator for 16-24 hours. One to three colonies with the largest growth were selected and transferred to 15 mL of TSB liquid medium containing 5% newborn calf serum. The culture was continued in a shaking incubator at 37°C ± 1°C at 150 rpm for 12 hours. The OD value of the strain in the liquid medium was measured at 1-hour intervals using photoelectric turbidimetry. 600nm The growth curve of Streptococcus suis type 2 clinical isolate S068 was drawn, as shown in Figure 2 As shown: 0 to 2 hours is the lag phase, 2 to 5 hours is the logarithmic growth phase, 5 to 9 hours is the stable phase, and after 9 hours is the decline phase.
[0035] Example 4, Virulence Detection of Streptococcus suis Type 2 S068 Strain
[0036] Twenty-five healthy piglets aged 8 to 9 weeks were randomly divided into 5 groups, with 5 pigs in each group. Groups 1 to 4 were challenged with 1 mL of Streptococcus suis type 2 S068 bacterial solution injected into the ear vein, with the live bacterial counts of 5×10 5 CFU / mL, 1×10 6 CFU / mL, 2×10 6 CFU / mL, 4×10 6 CFU / mL. Group 5 served as a blank control group and was not challenged. Piglets were observed for 14 consecutive days after challenge with Streptococcus suis type 2 strain S068 to assess clinical manifestations and mortality.
[0037] The results of the challenge showed that piglets aged 8 to 9 weeks, challenged with different doses of Streptococcus suis type 2 strain S068 by intravenous injection at the ear margin, all showed one or more clinical symptoms such as fever, depression, decreased appetite to loss of appetite, joint swelling, and lameness. The specific results are shown in Table 5. Autopsy was performed 14 days after the challenge, and obvious pathological changes such as joint effusion and pericardial effusion were observed in the piglets in the challenge group (see Figure 3 Group 4 (4×10 6 CFU / head) of 5 experimental piglets all showed severe clinical symptoms after challenge and all died during the observation period; Group 3 (2×10 6 CFU / head) of 5 experimental piglets showed typical clinical symptoms and autopsy changes of Streptococcus suis after challenge, such as lameness caused by joint swelling, septic arthritis at autopsy, and 4 pigs died; Group 2 (1×10 6 CFU / head) of 5 experimental piglets showed typical clinical symptoms and autopsy changes of Streptococcus suis after challenge; Group 1 (5×10 6 CFU / head) of 5 experimental piglets showed typical clinical symptoms and autopsy changes of Streptococcus suis after challenge; all 5 piglets in the blank control group were normal. The above results show that the Streptococcus suis type 2 clinical isolate S068 isolated by the present invention has strong virulence, and the minimum challenge dose of 2×10 6 CFU / head was considered a lethal dose.
[0038] Table 5 Virulence test results of S068 strain experimental group Challenge dose Increased body temperature Clinical symptoms Necropsy lesions die 1 <![CDATA[5×10 5 CFU / head]]> 0 / 5 1 / 5 1 / 5 0 / 5 2 <![CDATA[1×10 6 CFU / head]]> 1 / 5 2 / 5 2 / 5 0 / 5 3 <![CDATA[2×10 6 CFU / head]]> 3 / 5 4 / 5 4 / 5 4 / 5 4 <![CDATA[4×10 6 CFU / head]]> 4 / 5 5 / 5 5 / 5 5 / 5 5 Blank control group 0 / 5 0 / 5 0 / 5 0 / 5 Strain S068 has been sent to China Center for Type Culture Collection for preservation.
[0039] Classification name: Streptococcus suis Deposit number: CCTCC NO: M20242747; Deposit date: December 6, 2024; Address: Wuhan University, Wuhan, China.
[0040] Example 5, Comparative virulence test of Streptococcus suis type 2 S068 strain and reference strain SS2-12 strain Streptococcus suis type 2 reference strain SS2-12 was kindly provided by Hangzhou Hongqiao Zhongke Gene Technology Co., Ltd.
[0041] Fifteen healthy piglets aged 8 to 9 weeks were randomly divided into three groups, with 5 pigs in each group. Group 1 was challenged with 1 mL of Streptococcus suis type 2 S068 strain via the ear vein, with a live bacterial count of 2 × 10 6 CFU / mL, and the second group was challenged with 1 mL of Streptococcus suis type 2 reference strain SS2-12 injected through the ear vein, with a viable bacterial count of 2×10 6 CFU / mL. Group 3 served as the blank control group and was not challenged. Piglets were observed for 14 consecutive days after challenge, and the clinical manifestations and mortality rates of the piglets after challenge with the two Streptococcus suis type 2 strains were compared.
[0042] Challenge results showed that 8- to 9-week-old piglets challenged with the same dose of the two strains via the ear vein all developed one or more clinical symptoms, including elevated body temperature, depression, decreased to no appetite, joint swelling, and lameness. Detailed results are shown in Table 6. Autopsies performed 14 days after challenge revealed significant pathological changes in the challenged piglets, including joint effusions, pericardial effusions, and cerebral congestion. Five out of five piglets in the first group developed typical clinical symptoms and postmortem changes of S. suis after challenge with the S068 strain, including lameness due to joint swelling, septic arthritis, and cerebral congestion. All pigs died. Three out of five piglets in the second group developed typical clinical symptoms and postmortem changes of S. suis after challenge with the SS2-12 strain, including lameness due to joint swelling, septic arthritis, and cerebral congestion. Three out of five piglets died. The above results show that when the multi-antibiotic-resistant Streptococcus suis type 2 clinical isolate S068 isolated by the present invention and the reference strain SS2-12 were challenged with the same challenge dose on 8-9 week old piglets, the S068 strain was more virulent.
[0043] Table 6 Virulence test results of S068 and SS2-12 strains experimental group Challenge strain Increased body temperature Clinical symptoms Necropsy lesions die 1 S068 strain 4 / 5 5 / 5 5 / 5 5 / 5 2 SS2-12 strain 3 / 5 3 / 5 3 / 5 3 / 5 3 - 0 / 5 0 / 5 0 / 5 0 / 5 Example 6, immune challenge test of Streptococcus suis type 2 S068 strain under antibiotic feeding environment
[0044] Our laboratory developed a Streptococcus suis type 2 polysaccharide conjugate vaccine, which was then immunized in piglets and challenged with the S068 strain. Thirty weaned piglets, aged 3 to 4 weeks, were selected and divided into six groups of five pigs each. Groups 1 to 3 were fed a standard diet without antibiotics, while Groups 4 to 6 were fed a diet supplemented with amoxicillin (1000 g of amoxicillin per ton of feed at 10% amoxicillin). Piglets in Groups 1 and 4 were injected intramuscularly with the polysaccharide conjugate vaccine (containing 50 μg of polysaccharide per piglet). Piglets in Groups 2 and 5 were injected intramuscularly with a commercial inactivated vaccine. Piglets in Groups 3 and 6 served as the challenge control group. Twenty-one days after immunization, a second booster vaccination was administered using the same dose and route. Fourteen days after the second vaccination, all test pigs were challenged with a lethal dose of Streptococcus suis type 2 S068 strain via the ear vein. After challenge, they were observed for 14 consecutive days, with body temperature measured daily. The incidence and mortality of each group within 14 days were recorded, and autopsies were performed to observe whether typical pathological changes such as joint effusion, pericardial effusion, and cerebral congestion occurred. The criteria for judging the protection of piglets from challenge were (1) no symptoms; (2) no clinical symptoms such as joint swelling, lameness, and ataxia, and no autopsy lesions such as suppurative arthritis and meningitis (brain edema, congestion). If the body temperature rose, it should not exceed 1.5°C of the basal body temperature. If it exceeded 1.5°C, it should remain below 1.5°C for 2 days. If any of the above two items were met, the piglets were judged to be protected.
[0045] The results showed that when challenged with piglets fed a standard diet without antibiotics, the two immunized groups achieved 80% and 60% protection, respectively. When challenged with piglets fed a diet supplemented with amoxicillin, the two immunized groups achieved 100% and 80% protection, respectively. In both challenged control groups, more than four-fifths of the piglets died. Regardless of whether or not the pigs were fed antibiotics, the challenged control groups achieved the expected disease outcomes. Furthermore, the addition of antibiotics reduced the likelihood of the pigs contracting other bacterial pathogens during their feeding, providing a more accurate indicator of vaccine protection. The results are shown in Table 7.
[0046] Table 7 Results of the S068 strain immune challenge test
[0047] The basic principles, main features, and advantages of the present invention are shown and described above. Those skilled in the art will appreciate that the present invention is not limited to the foregoing embodiments and that various modifications and improvements may be made to the present invention without departing from the spirit and scope of the present invention. Such modifications and improvements are intended to fall within the scope of the present invention. The scope of the present invention is defined by the appended claims and their equivalents.
Claims
1. A virulent strain of Streptococcus suis type 2 resistant to multiple antibiotics, characterized in that: It was deposited in the China Center for Type Culture Collection on December 6, 2024, with the preservation number CCTCC NO: M20242747 and the classification name: Streptococcus suis type 2 S068.
2. The virulent strain of Streptococcus suis type 2 resistant to multiple antibiotics according to claim 1, characterized in that: The minimum challenge dose for 4 / 5 deaths of 8-9 week old healthy piglets was 2×10 6 CFU / head.
3. A method for evaluating the toxicity of a multi-antibiotic-resistant Streptococcus suis type 2 virulent strain according to claim 1, characterized in that: (1) Weaned piglets aged 3-4 weeks were divided into an experimental vaccine group, a commercial vaccine control group, and a challenge control group; (2) The experimental vaccine group received an intramuscular injection of the experimental vaccine containing Streptococcus suis type 2, the commercial vaccine control group received an intramuscular injection of the commercial Streptococcus suis type 2 vaccine, and the challenge control group was not immunized; (3) A second immunization with the same dose was performed 21 days after the first immunization, and a lethal dose of Streptococcus suis type 2 S068 strain was injected into the ear vein 14 days after the second immunization; (4) Observe continuously for 14 days after infection, monitor body temperature daily, and record clinical symptoms such as joint swelling, lameness, and ataxia; (5) Observe the pathological changes of joint effusion, pericardial effusion, and cerebral congestion during autopsy; (6) The judgment criteria are: no symptoms or body temperature rise ≤1.5℃ and lasting for less than 2 days, and no typical joint / brain lesions, which means that the protection against the virus is established.
4. The method for evaluating the challenge of a virulent strain of Streptococcus suis type 2 resistant to multiple antibiotics according to claim 3, characterized in that: Amoxicillin antibiotic is added to each ton of feed for the weaned piglets.