Parapause control gene AjFoxO of apis cerana and application of apis cerana diapause control gene AjFoxO

Abstract

The invention belongs to the field of plant protection, and particularly relates to a diapause control gene AjFoxO of apis cerana and application of the diapause control gene AjFoxO. According to the application disclosed by the invention, the key gene AjFoxO for diapause control of the small apis belly bees is found through screening, and the influence of the AjFoxO gene on the diapause behavior of the small apis belly bees is verified through an addition test of RNAi (Ribonucleic Acid Interfere) and exogenous juvenile hormone. The method can be used for diapause control of the small apis belly bees, so that the shelf life of parasitic wasp products is controlled, and the optimal economic benefit is achieved. And the method can also be used for breeding and screening the variety of the small apis belly so as to obtain the variety with long diapause period and serve for biological prevention and control of agriculture and forestry.

Description

Technical Field

[0001] The present invention belongs to the field of plant protection. Specifically, the present invention relates to a diapause-control gene AjFoxO of a planaria wasp and an application thereof. Background Art

[0002] Parasitic wasps are excellent parasitic natural enemies of insects and play a vital role in biological control in agriculture and forestry. The Japanese flat-bellied wasp (Anastatus japonicus Ashmead), belonging to the family Cynomoridae in the order Hymenoptera, is a key egg parasitoid used in biological control of agricultural and forestry pests. As a natural enemy, it primarily parasitizes the eggs of Hemiptera and Lepidoptera pests. In natural enemy production, the Japanese flat-bellied wasp can be mass-produced using tussah silkworm eggs as an alternative host, and large-scale field releases serve as an effective pest control measure. However, in recent industrial applications, the role of parasitic wasps in pest control has been underutilized due to the short shelf life of their products, which makes long-distance transportation unsuitable. Exploiting the biological learning properties of insect diapause to extend the shelf life of parasitic wasp products is the most economical and reliable approach. Diapause is a survival strategy evolved by insects in response to long-term adverse environmental conditions. The insect diapause process undergoes significant physiological and biochemical changes, regulated by multiple hormones. The molecular mechanisms of hormone regulation are closely linked to multiple genes in their metabolic pathways. Therefore, studying the diapause-related control genes of parasitic wasps has important application value and significance for controlling the diapause of parasitic wasps and thus extending the shelf life of products. Summary of the Invention

[0003] While the diapause-related genes and mechanisms of parasitic wasps represented by the Japanese flat-bellied wasp still need to be further studied, the present invention has discovered the diapause-key gene AjFoxO of the flat-bellied wasp based on long-term research and analysis, thus completing the present invention.

[0004] In one aspect of the present invention, the present invention discloses a diapause-control gene AjFoxO of a planaria wasp. The nucleotide sequence of the diapause-control gene AjFoxO is shown in SEQ ID NO.1.

[0005] In a second aspect of the present invention, the present invention discloses the application of the diapause control gene AjFoxO of the flat-abdomen wasp in the diapause of the flat-abdomen wasp, and the effect of promoting the diapause of the flat-abdomen wasp is achieved by increasing the expression level of the AjFoxO gene. The nucleotide sequence of the diapause control gene AjFoxO is shown in SEQ ID NO.1.

[0006] In a third aspect, the present invention discloses a method for controlling the diapause of a flat-bellied wasp, which promotes the flat-bellied wasp to enter a diapause state by increasing the expression level of AjFoxO in the flat-bellied wasp.

[0007] In a fourth aspect of the present invention, a diapause reagent for Ornithorhynchus sylvaticus is disclosed, wherein the reagent can increase the expression level of AjFoxO in Ornithorhynchus sylvaticus.

[0008] In a fifth aspect, the present invention discloses a method for relieving diapause by reducing the expression level of AjFoxO in a wasp. In one embodiment, the expression level of AjFoxO in the wasp is reduced by RNAi. In a preferred embodiment, the expression level of AjFoxO in the wasp is reduced by increasing the level of juvenile hormone.

[0009] In a sixth aspect of the present invention, a method for screening flat-bellied wasps with a long diapause period is disclosed. The screening is performed by detecting the expression level of AjFoxO in the flat-bellied wasps. If the expression level of the AjFoxO gene in the flat-bellied wasps is higher than that of the wild type, then the flat-bellied wasps of this variety have a long diapause period; otherwise, they have a short diapause period.

[0010] Beneficial effects

[0011] The present invention discovered AjFoxO, a key gene for controlling diapause in the wasp A. sylvatica, through screening. Furthermore, the effects of AjFoxO on the diapause behavior of the wasp were verified through RNAi and exogenous juvenile hormone addition tests. The present invention can be used to control diapause in A. sylvatica, thereby controlling the shelf life of parasitic wasp products to achieve optimal economic benefits. It can also be used to select and breed A. sylvatica varieties to obtain varieties with extended diapause periods, thus contributing to biological control in agriculture and forestry. BRIEF DESCRIPTION OF THE DRAWINGS

[0012] Figure 1 : Changes in juvenile hormone titers of mature larvae of the Japanese flat-bellied wasp during diapause, where ND represents the non-diapause group and DT represents the diapause-released mature larvae.

[0013] Figure 2 :Relative expression levels of AjFoxO gene in diapause of A. japonicus , where different letters indicate significant differences (p<0.05).

[0014] Figure 3 : In a: M: DL2000DNA marker, 1: GFP-DNA; 2: AjFoxO-DNA; In b: M: DL2000DNAmarker, 1: GFP-dsRNA; 2: AjFoxO-dsRNA.

[0015] Figure 4 : Relative expression level of AjFoxO after injection of dsAjFoxO.

[0016] Figure 5 : Mortality and weight changes of mature larvae of AjFoxO after interfering with diapause of the Japanese flat-bellied wasp.

[0017] Figure 6 : Changes in lipid droplets after AjFoxO interference in diapausing mature larvae of the Japanese flat-bellied wasp, including: a: lipid droplet staining after dsGFP injection; b: lipid droplet staining after dsAjFoxO injection; c: relative lipid droplet staining area after AjFoxO interference in diapausing mature larvae.

[0018] Figure 7 : Changes in juvenile hormone titer after AjFoxO interference, where different letters indicate significant differences (p<0.05).

[0019] Figure 8 : Changes in biochemical substances after AjFoxO interference in diapausing mature larvae of the Japanese flat-bellied wasp. a: Changes in sorbitol content after injection of dsAjFoxO; b: Changes in glycogen content after injection of dsAjFoxO.

[0020] Figure 9 : Changes in biochemical substances after AjFoxO interference in diapausing mature larvae of the Japanese flat-bellied wasp. a: Changes in catalase activity after injection of dsAjFoxO; b: Changes in glycerol content after injection of dsAjFoxO.

[0021] Figure 10 : Changes in AjFoxO expression in diapausing mature larvae of the wasp A. japonica after injection of exogenous juvenile hormone. The dotted line in the figure represents CK.

[0022] Figure 11 : Changes in biochemical substances in diapausing mature larvae of the wasp Oreochromis japonicus after injection of exogenous juvenile hormone, including: a: changes in sorbitol content; b: changes in glycogen content.

[0023] Figure 12 : Changes in biochemical substances in diapausing mature larvae of the wasp Oreochromis japonicus after injection of exogenous juvenile hormone, including: a: changes in catalase activity; b: changes in glycerol content. DETAILED DESCRIPTION

[0024] In order to make the objectives, technical solutions and advantages of the present invention more clearly understood, the present invention is further described in detail below with reference to the following examples. Unless otherwise specified, the equipment and reagents used in each example and test example can be obtained from commercial sources. Unless otherwise specified, the reagents used in the present invention are all analytical grade reagents. The specific examples described herein are only used to illustrate the present invention and are not intended to limit the present invention.

[0025] Test insect sources and indoor rearing methods

[0026] The laboratory-reared population of the Japanese flat-bellied wasp used in the test was provided by the Ministry of Agriculture and Rural Affairs-CABI Joint Biosafety Laboratory, Institute of Plant Protection, Chinese Academy of Agricultural Sciences. The population was collected from parasitized egg masses of the brown stink bug in Beijing. Multiple generations of this population were propagated indoors using tussah silkworm eggs as a surrogate host to establish a stable indoor population for the test insect source.

[0027] Rearing conditions: The Japanese flat-abdomen wasp was parasitized on Antheraea pernyi eggs in a 320×252×92 mm insectary box in an artificial climate chamber with a temperature of 24±0.5°C, a photoperiod of L / / D=16h / / 8h, a relative humidity of 70±5%, and a light intensity of 3000lx.

[0028] Some reagent materials: PrimeScript TM RT reagent Kit with gDNA Eraser from Takara; TBGreen Premix Ex Taq from Takara; T7 RiboMAX TM Express RNAi System was from Promega; pEASY-Blunt Zero Cloning Kit was from Beijing Quanshijin.

[0029] In the statistical analysis of the present invention, asterisks represent significant differences between the treatment group and the control group (*p<0.05, **p<0.01, ***p<0.001, T-test)

[0030] Example 1:

[0031] 1.1 Test insect handling and sample collection

[0032] After being parasitized by Japanese flat-bellied wasp for 2 days, the egg cards made from fresh tussah eggs were placed in diapause (temperature 17±0.5℃, photoperiod L / / D=10h / / 14h, relative humidity 70±5%, light intensity 3000lx) and non-diapause (temperature 24±0.5℃, photoperiod L / / D=16h / / 8h, relative humidity 70±5%, light intensity 3000lx) environmental conditions for development.

[0033] Acquisition of non-diapause mature larvae samples: After the Japanese flat-bellied wasp parasitized the tussah eggs and placed them under non-diapause conditions for about 12 days of development, the non-diapause mature larvae of the Japanese flat-bellied wasp were dissected from the parasitized tussah eggs, which were the non-diapause group ND.

[0034] Acquisition of diapause mature larvae samples: After parasitizing the eggs of the silkworm, the Japanese flat-bellied wasp was placed under diapause conditions for development. The silkworm eggs were dissected and the diapause mature larvae were obtained at four points on the 25th, 35th, 45th and 55th days of diapause induction, which were the diapause groups of 25, 35th, 45th and 55th days.

[0035] Acquisition of samples of mature larvae for diapause release: After parasitizing the eggs of Antheraea silkworm, the Japanese flat-bellied wasp was placed under diapause conditions for 55 days of development. Then, the eggs were transferred to non-diapause conditions for further development for 12 days. The mature larvae were obtained from the eggs and designated as the diapause release group (DT).

[0036] 1.2 Juvenile hormone titer determination

[0037] After parasitizing, tussah eggs were dissected, and mature larvae of the Japanese flat-bellied wasp were carefully selected and transferred to 1.5 ml centrifuge tubes. Four to six biological replicates were set up for each treatment. 100 mg of mature larvae were collected from each replicate, quickly frozen in liquid nitrogen, and stored at -80°C until further use. Juvenile hormone titers of the Japanese flat-bellied wasp were determined using ultrahigh performance liquid chromatography-tandem mass spectrometry (UHPLC-MS / MS).

[0038] The results are as follows Figure 1 As shown in the results, the juvenile hormone titer of mature larvae of diapause-induced individuals at 35 and 45 days was significantly lower than that of non-diapause individuals (F3,8=14.802, p=0.001), which was reduced by 78.72% and 82.93% respectively compared with non-diapause individuals. The juvenile hormone titer of mature larvae of diapause-released individuals was significantly higher than that of diapause individuals, but there was no significant difference between them and non-diapause mature larvae.

[0039] Example 2 Expression changes of AjFoxO gene in the juvenile hormone signaling pathway

[0040] Based on the existing transcriptome sequences of the Japanese flat-bellied wasp, the AjFoxO gene was found to be one of the important genes through comparison with the NCBI website (https: / / www.ncbi.nlm.nih.gov) and bioinformatics analysis. Its sequence is shown in SEQ ID NO.1. The temporal and spatial expression patterns of the AjFoxO gene in the mature larvae of the Japanese flat-bellied wasp in non-diapause, different days of diapause induction and diapause release were analyzed using real-time fluorescence quantitative PCR technology. Specifically: (1) The mature larvae of the Japanese flat-bellied wasp in non-diapause, different days of diapause and diapause release were placed in a 1.5ml centrifuge tube, quickly frozen in liquid nitrogen and stored in a -80℃ refrigerator for later use. Ten larvae were taken for each treatment, with 3 biological replicates. (2) The total RNA of the mature larvae of the Japanese flat-bellied wasp was extracted according to the instructions of the RNA extraction kit (TransZol Up Plus RNA Kit). (3) The total RNA of the mature larvae of the Japanese flat-bellied wasp was extracted according to the instructions of the PrimeScript TMThe RT reagent kit with gDNA Eraser kit was used to remove genomic DNA and synthesize the first strand of reverse transcribed cDNA. The reverse transcription product was used for quantitative PCR detection and stored at -20°C until use. (4) Specific real-time fluorescence quantitative PCR primers were designed using Primer Premier 5 software (see Table 1) and PCR detection was performed.

[0041] Table 1: Primers for fluorescence quantitative detection of AjFoxO gene

[0042] name (5'-3') serial number AjFoxO-F CTTCAACCTTCTTCTTCACCC SEQ ID NO.2 AjFoxO-R CCGATCTTATTACACAAGCCAT SEQ ID NO.3

[0043] The results are as follows Figure 2 As shown in the results, the expression level of AjFoxO in mature larvae at different days of diapause induction was significantly higher than that in non-diapause mature larvae, and showed a trend of first increasing and then decreasing with the extension of diapause time. The expression level was the highest at 45 days after diapause induction, which was 17.24 times that of non-diapause individuals (F5,12=55.122, p<0.001). After diapause was released, the expression level of AjFoxO gene decreased significantly, but was still higher than that of non-diapause individuals, confirming the significant association between AjFoxO gene and diapause.

[0044] Example 3 Functional Analysis of the AjFoxO Gene in the Japanese Wasp

[0045] 3.1 AjFoxO gene dsRNA synthesis

[0046] Based on the AjFoxO gene sequence, specific synthetic dsRNA primers were designed using Primer Premier 5 software. PCR amplification was performed using the cDNA obtained in Example 2 as a template. After gel recovery, the PCR product was TA cloned using the pEASY-Blunt Zero Cloning Kit to extract the plasmid containing the target gene fragment. Using the plasmid containing the target gene fragment as a template, two pairs of primers containing a single T7 promoter for the target gene were used to synthesize two independent templates (A / B) with a single T7 promoter sequence by cross PCR. The PCR product was then used as a template and cloned according to the Promega T7 RiboMAX TM Synthesize dsRNA according to the Express RNAi System instructions. Finally, use liposome electrophoresis to verify that the dsRNA bands are single. Determine the dsRNA concentration spectrophotometrically to ensure it meets injection requirements. Dilute to the working concentration and store at -80°C. Simultaneously, perform the same steps using the GFP gene as a control. The relevant primer sequences for this example are shown in Table 2.

[0047] Table 2: Primers used in dsRNA synthesis

[0048] name (5'-3') serial number AjFoxO-2F TGGATGTAAAGGACTGTCAGG SEQ ID NO.4 AjFoxO-2R AGATAGTAATAGCAGCGCCG SEQ ID NO.5 AjFoxO-FT7 GGATCCTAATACGACTCACTATAGGTGGATGTAAAGGACTGTCAGG SEQ ID NO.6 AjFoxO-RT7 GGATCCTAATACGACTCACTATAGGAGATAGTAATAGCAGCGCCG SEQ ID NO.7 GFP-F CCCTGAAGTGCATCTGCCC SEQ ID NO.8 GFP-R TTTTTTAACCACCCCCCCA SEQ ID NO.9 GFP-FT7 GGATCCTAATACGACTCACTATAGGCCCTGAAGTGCATCTGCCC SEQ ID NO.10 GFP-RT7 GGATCCTAATACGACTCACTATAGGTTTTTTTAACCACCCCCCCA SEQ ID NO.11

[0049] Among them, GGATCCTAATACGACTCACTATAGG is the T7 promoter sequence

[0050] The results are as follows Figure 3 As shown: The PCR products were detected by 1% agarose gel electrophoresis. The sequence fragment amplified by AjFoxO was 316 bp long, and the sequence fragment amplified by GFP was 389 bp long. The electrophoresis bands were consistent with the expected size ( Figure 3 The dsRNA synthesized by in vitro transcription kit was sequenced and the target band was <500bp, which was consistent with the expected size ( Figure 3 (b) The concentration was >5000 ng / μL as determined by NanoDrop ND-2000C ultra-micro spectrophotometer, meeting the requirements.

[0051] 3.2 dsRNA microinjection

[0052] (1) Use a semi-automatic needle puller to pull a standard borosilicate glass capillary (outer diameter 1.0 mm, inner diameter 0.58 mm)

[0053] Pull out the longer tip and carefully place it in a storage box with double-sided tape on the bottom for later use.

[0054] (2) Gently remove the drawn capillary tube, break the needle tip to a suitable position with pointed tweezers, remove the dsRNA from the -80°C freezer, freeze and thaw on ice, add red food coloring at a ratio of 200:1 and mix well, then use a pipette to inject 10 μL of dsRNA into the capillary tube;

[0055] (3) The capillary was mounted on the injection arm of a FemtoJet-4x microinjector (Eppendrof). Injection parameters were set (injection pressure 800 Pa, compensation pressure 80 Pa, injection time 2.5 s). dsRNA was injected into the back of mature larvae of the Japanese flat-bellied wasp under a stereomicroscope. A dsGFP, which has no homology to the Japanese flat-bellied wasp, was also injected as a negative control. The injected mature larvae were placed in an artificial climate chamber to continue their development.

[0056] (4) After dsRNA injection, mature larvae were placed in an artificial climate chamber to continue their development. After 72 h, 20 mature larvae were randomly selected from each treatment to calculate the mortality rate. This was repeated three times.

[0057] 3.3 Detection of RNAi silencing efficiency

[0058] (1) Mature larvae were randomly selected 24, 48, and 72 hours after injection of dsGFP, dsAjFoxO, dsAjFOLD, and dsAjFHA, respectively. Five mature larvae were randomly selected for each treatment, and the experiment was repeated three times.

[0059] (2) Extraction of total RNA;

[0060] (3) removal of genomic DNA and reverse transcription to synthesize first-strand cDNA;

[0061] (4) Real-time fluorescence quantitative PCR was performed to detect changes in target gene expression.

[0062] The results are as follows Figure 4 As shown: After RNAi interference of the target gene, the expression level of AjFoxO decreased significantly, and the expression levels decreased by 30.07%, 35.64% and 55.74% at 24h, 48h and 72h, respectively.

[0063] 3.4 Biological phenotype changes after interference with target genes

[0064] Samples injected with dsRNA were collected for measurement of biological phenotypic changes. Weight: Parasitized tussah silkworm eggs were dissected, and mature larvae of the Japanese flat-abdomen wasp were carefully selected and placed on an electronic balance with an accuracy of 1 / 10,000. Each individual larva was weighed, with a minimum of 15 larvae per treatment.

[0065] The results are as follows Figure 5 As shown: The average mortality rate of mature larvae of Japanese flat-bellied wasp after injection was <10%, and there was no significant difference in mortality rate compared with the control group dsGFP ( Figure 5 Middle a), indicating that the microinjection operation causes little damage to the individual. The body weight of the mature larvae of the diapausing Japanese flat-bellied wasp injected with dsAjFoxO did not change significantly compared with dsGFP ( Figure 5 b)

[0066] 3.5 Changes in lipid droplets after target gene interference

[0067] After 35 days of diapause-induced mature larvae of the Japanese flat-bellied wasp, dsAjFoxO was injected. Lipid droplets were stained for Nile red fluorescence on the 10th day, using dsGFP as a control. Samples injected with dsRNA were collected, fixed in 4% paraformaldehyde at room temperature, and set aside. Three mature larvae of the flat-bellied wasp were dissected for each treatment. Specifically:

[0068] (1) Turn on the freezing microtome in advance and set the temperature to -20°C for precooling;

[0069] (2) After adding a layer of OCT embedding agent on the embedding table, the sample is moved to the embedding table, and after adding OCT embedding agent to completely embed the sample, the embedding table is placed on a quick freezing table and quickly frozen until the OCT completely turns white and hardens;

[0070] (3) Fix the embedding table, perform rough trimming to the appropriate sectioning position, set the section thickness to 10 μm, transfer the section to a glass slide, and store at -20°C for future use;

[0071] (4) Remove the frozen sections from the -20°C freezer and return them to room temperature. Draw circles on the sections, fix them with tissue fixative for 15 minutes, wash them three times with PBS, and let them air dry. Add diluted Nile red dye to the circled sections and incubate them in the dark at room temperature for 10 minutes.

[0072] (5) The slides were placed in PBS and washed on a shaker for 3 times, each time for 5 minutes. DAPI staining solution was added to the slides and incubated at room temperature in the dark for 10 minutes.

[0073] (6) The slides were placed in PBS and washed on a shaker for 3 times, 5 min each time, and then sealed with anti-fluorescence quenching mounting medium;

[0074] (7) Images were collected using an upright fluorescence microscope.

[0075] See also Figure 6 The results showed that after injection of dsAjFoxO, the diapause mature larvae showed a non-diapause phenotype, with a small amount of lipid droplets appearing in the body cavity, and the relative staining area of ​​the lipid droplets increased by 20.72% compared with dsGFP.

[0076] 3.6 Changes in juvenile hormone (JH) titer after target gene interference

[0077] Mature larvae of the Japanese wasp, which were induced to diapause for 35 days, were injected with dsAjFoxO. The titer of juvenile hormone (JH) was measured by ultra-high performance liquid chromatography-tandem mass spectrometry (UHPLC-MS / MS) 72 hours later.

[0078] The results are as follows Figure 7 As shown: After the diapause mature larvae were injected with dsAjFoxO, the juvenile hormone titer was significantly increased by 2.05 times compared with dsGFP.

[0079] 3.7 Changes in biochemical substances after interference with target genes

[0080] Mature larvae of the Japanese flat-bellied wasp, 35 days after diapause induction, were injected with dsAjFoxO and 72 hours later, and changes in glycerol, sorbitol, glycogen content, and catalase activity were measured. dsGFP was used as a control. Glycogen content assay kits (Beijing Solebold Technology Co., Ltd.), sorbitol content assay kits (Beijing Solebold Technology Co., Ltd.), catalase (CAT) activity assay kits (Beijing Solebold Technology Co., Ltd.), and glycerol content assay kits (Nanjing Jiancheng Bioengineering Institute) were used. Specific experimental procedures were performed according to the kit instructions. Each treatment included 10 biological replicates and three technical replicates. A 100 mg sample was collected from each biological replicate, frozen in liquid nitrogen, and stored at -80°C until further use.

[0081] The results are as follows Figure 8 、 Figure 9 As shown in Figure 2, after interfering with AjFoxO, the content of sorbitol, an antifreeze substance, in the mature larvae of the diapausing Japanese flat-bellied wasp was significantly reduced by 25.05%, and the content of glycogen, an energy substance, was significantly increased by 8.63% (see Figure 8 ), catalase activity increased significantly by 84.52%, and glycerol content did not change significantly (see Figure 9 ).

[0082] Example 4 Effect of exogenous juvenile hormone III (JHIII) injection on diapause of the flat-bellied wasp

[0083] 4.1 Effect of exogenous juvenile hormone III (JHIII) injection on AjFoxO gene expression

[0084] (1) Preparation of JHIII injection solution: weigh 1 mg of JHIII (TRC) in a reagent bottle, add acetone to dissolve, mix well, and dilute to 1 ml to prepare a 1 mg / ml stock solution; dilute with PBS to prepare a working solution, and the PBS and acetone mixture is the control group CK. Add red food coloring at a ratio of 200:1 as an injection indicator color, mix well, and store in a -20℃ refrigerator for later use.

[0085] (2) JHIII injection: Exogenous juvenile hormone was injected into the mature larvae of the Japanese flat-bellied wasp after 35 days of diapause induction. The injection method was the same as that in Section 3.2 of Example 3. A mixture of PBS and acetone was used as the control group CK.

[0086] (3) Detection of changes in AjFoxO gene expression 72 hours after injection of exogenous JH.

[0087] The results are as follows Figure 10 As shown, the expression level of AjFoxO was significantly reduced by 39.27% ​​after injection, indicating that the injection of exogenous juvenile hormone can significantly inhibit the expression of AjFoxO gene.

[0088] 4.2 Biochemical changes after injection of juvenile hormone III (JHIII)

[0089] Exogenous juvenile hormone was injected into mature larvae of the Japanese flat-bellied wasp after 35 days of diapause induction. Changes in glycerol, sorbitol, glycogen content, and catalase activity were measured 72 hours later. A mixture of PBS and acetone was used as the control group (CK). Figure 11-12 The results showed that after injection of exogenous juvenile hormone, the antifreeze substance sorbitol content of the diapausing mature larvae of the Japanese flat-bellied wasp was significantly reduced by 8.80%, and the energy substance glycogen content was significantly increased by 12.16% ( Figure 11 ), catalase activity decreased by 26.39%, and glycerol content increased significantly by 10.56% ( Figure 12 ).

[0090] In summary, UHPLC-MS / MS analysis revealed that juvenile hormone titers in diapause-bound mature larvae of the Japanese flat-bellied wasp were significantly lower than those in non-diapause individuals, and returned to non-diapause levels after diapause was terminated, indicating a link between low juvenile hormone levels and diapause in mature larvae of the Japanese flat-bellied wasp. The AjFoxO gene, a gene involved in the juvenile hormone signaling pathway, plays a crucial role in regulating insect diapause and is involved in diapause regulation in the Japanese flat-bellied wasp. Studies have shown that when insects enter diapause, glycogen is converted into sorbitol and glycerol, which serve as cryoprotectants to maintain their survival during the winter. After diapause is terminated, sorbitol is converted into glycogen by sorbitol dehydrogenase (SDH), providing energy for individual development. In the present invention, RNA interference with AjFoxO in diapause-prone larvae of the Japanese flat-bellied wasp significantly increased the titer of juvenile hormone in their bodies, causing the diapause-prone larvae to exhibit diapause-release phenotypes, such as increased lipid droplets in the body cavity, decreased levels of the antifreeze substance sorbitol, and increased levels of the energy substance glycogen. Exogenous juvenile hormone can reduce AjFoxO gene expression and promote changes in the levels of diapause-related substances. These evidences confirm the role of juvenile hormone and the AjFoxO gene in diapause in the Japanese flat-bellied wasp from both positive and negative directions.

[0091] The above content is a further detailed description of the present invention in conjunction with specific implementation methods. It cannot be determined that the specific implementation of the present invention is limited to these descriptions. For ordinary technicians in the technical field to which the present invention belongs, they can make several simple deductions or substitutions without departing from the concept of the present invention, which should be regarded as falling within the scope of protection determined by the claims submitted for the present invention.

Claims

1. A diapause control gene AjFoxO of a flat-bellied wasp, characterized in that: The nucleotide sequence of the diapause control gene AjFoxO is shown in SEQ ID NO.

1.

2. The use of the diapause-control gene AjFoxO of the flat-bellied wasp in the diapause of the flat-bellied wasp according to claim 1, characterized in that The diapause effect is achieved by increasing the expression level of the AjFoxO gene.

3. A method for controlling diapause of flat-bellied wasps, characterized in that: The expression level of AjFoxO in the flat-abdomen wasp is increased to induce the flat-abdomen wasp to enter a diapause state.

4. A diapause reagent for flat-bellied wasps, characterized in that The reagent can increase the expression level of AjFoxO in the body of the flat-abdomen wasp.

5. A method for relieving diapause, characterized in that: The method achieves the purpose of releasing diapause by reducing the expression level of AjFoxO in the body of the flat-abdomen wasp.

6. A method for screening flat-bellied wasps with a long diapause period, characterized in that: Screening is performed by detecting the expression level of AjFoxO in the flat-bellied wasp. If the expression level of the AjFoxO gene in the flat-bellied wasp is higher than that of the wild type, then the flat-bellied wasp of this variety has a long diapause period, otherwise it has a short diapause period.

Images