Circulating miRNAs marker and application thereof
By screening and applying circulating miRNAs markers miR-19b-3p, miR-21-5p, miR-30e-5p or miR-15a-5p, the problem of insufficient sensitivity and specificity in the diagnosis of early cardiac function damage in hypertensive patients in existing technologies is solved, and efficient non-invasive diagnosis is achieved.
Patent Information
- Application Number
- CN202510814495.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-06-18
- Publication Date
- 2025-09-19
AI Technical Summary
In the existing technology, target organ damage often occurs in patients with hypertension when they are diagnosed. The existing diagnostic methods are not sensitive and specific enough, making it difficult to detect cardiac function damage at an early stage.
Circulating miRNAs markers miR-19b-3p, miR-21-5p, miR-30e-5p or miR-15a-5p were used to screen differentially expressed miRNAs by next-generation sequencing technology, and receiver operating characteristic (ROC) curves were constructed to evaluate their diagnostic ability for distinguishing elderly hypertensive patients with left ventricular diastolic dysfunction.
It provides a non-invasive, highly specific, and highly sensitive diagnostic method, with the area under the ROC curve reaching 89.8% to 91.5%, the sensitivity of 80.68% to 86.36%, and the specificity of 88.28% to 89.93%.
Smart Images

Figure CN120666016A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of biomedical technology, and specifically discloses a circulating miRNAs marker and application thereof. Background Art
[0002] Due to poor screening habits and lack of awareness, most newly diagnosed hypertensive patients already have hypertensive target organ damage at the time of diagnosis.
[0003] Chronic hypertension triggers a series of anatomical and functional changes in the left ventricle (LV), left atrium, and coronary arteries, leading to the development of hypertensive heart disease (HHD). These changes include left ventricular hypertrophy (LVH), left ventricular diastolic dysfunction (LVDD), heart failure (HF), coronary artery disease (CAD), and atrial fibrillation (AF), with LVH being the core pathological driver. LVDD, characterized by impaired myocardial relaxation and increased ventricular stiffness, has been identified as the initial manifestation of HHD. Untreated or poorly controlled arterial hypertension can exacerbate LVDD, progressing from mild to severe stages and ultimately leading to diastolic and systolic heart failure. Epidemiological studies have shown that the prevalence of LVH in community-dwelling hypertensive populations in China is 31.9%. Hypertension and its complications, such as LVDD, are often asymptomatic in the early stages. Current technologies typically utilize comprehensive assessment methods such as echocardiography, cardiac catheterization, ambulatory blood pressure monitoring with biomarkers such as BNP, and clinical symptom assessment. However, these methods generally suffer from poor sensitivity and specificity, or invasive procedures that result in poor compliance.
[0004] MicroRNAs (miRNAs) are a class of small, highly conserved noncoding RNAs that play a role in various developmental processes and can regulate gene expression as posttranscriptional regulators. Studies have shown that miRNAs are involved in the pathophysiology of myocardial remodeling and cardiomyopathy and are associated with heart failure and fibroblast apoptosis. In our previous study, we found that circulating serum miR-21 levels were elevated in elderly patients with essential hypertension (EH) and left atrial dilation (LA dilation), and that miR-21 levels were significantly correlated with LA dilation in elderly EH patients. However, the diagnostic performance of miR-21 levels for LA dilation is not ideal. Summary of the Invention
[0005] To address the shortcomings of the prior art, the present invention provides a circulating miRNA marker and its application. These circulating miRNA markers can be used to differentiate elderly hypertension without cardiac impairment from elderly hypertension with cardiac impairment, offering advantages such as non-invasiveness, high specificity, and high sensitivity.
[0006] In order to achieve the above-mentioned object of the invention, the present invention adopts the following technical solutions: In a first aspect, the present invention provides a circulating miRNAs marker comprising at least one of miR-19b-3p, miR-21-5p, miR-30e-5p, or miR-15a-5p.
[0007] Among them, the base sequence of miR-19b-3p is shown in SEQ ID No.1, the base sequence of miR-21-5p is shown in SEQ ID No.2, the base sequence of miR-30e-5p is shown in SEQ ID No.3, and the base sequence of miR-15a-5p is shown in SEQ ID No.4.
[0008] This study used next-generation sequencing to analyze the differential expression of circulating miRNAs in elderly hypertensive patients (non-LVDD) and those with left ventricular diastolic dysfunction (LVDD). Four circulating miRNAs were identified based on high expression levels and an absolute fold change of ≥1.5 between the two groups. The diagnostic efficacy of these four circulating miRNAs and their combination in elderly hypertension with cardiac impairment was further evaluated. Compared to traditional cardiac stress biomarkers such as brain natriuretic peptide (BNP) or N-terminal pro-brain natriuretic peptide (NT-proBNP), or comprehensive assessments based on echocardiography, cardiac catheterization, and clinical symptoms, the circulating miRNAs provided by this study are novel biomarkers with minimally invasive access, high sensitivity, and strong specificity.
[0009] As a first limitation of the above-mentioned circulating miRNAs markers, the circulating miRNAs markers include at least three of miR-19b-3p, miR-21-5p, miR-30e-5p or miR-15a-5p.
[0010] As a further limitation of the first limitation above, the circulating miRNAs marker is any one of the following (I) to (III): (I) miR-19b-3p, miR-21-5p, and miR-30e-5p; (II) miR-19b-3p, miR-21-5p, and miR-15a-5p; (III) miR-19b-3p, miR-21-5p, miR-30e-5p and miR-15a-5p.
[0011] Receiver operating characteristic (ROC) curves were constructed to compare the diagnostic ability of four circulating miRNAs in distinguishing elderly hypertensive patients (non-LVDD) from hypertensive patients with left ventricular diastolic dysfunction (LVDD). The area under the ROC curve (AUC) for the preferred circulating miRNA marker combination ranged from 89.8% to 91.5% (95% confidence interval, 0.854-0.947), with a sensitivity of 80.68% to 86.36% and a specificity of 88.28% to 89.93%.
[0012] As a second limitation of the above-mentioned circulating miRNAs markers, the circulating miRNAs markers are derived from peripheral blood serum.
[0013] In a second aspect, the present invention provides the use of the above-mentioned circulating miRNAs markers in the preparation of reagents, kits or biochips for diagnosing or assisting in the diagnosis of elderly hypertension accompanied by early cardiac function damage.
[0014] As a first limitation to the above application, the early cardiac function damage includes left ventricular diastolic dysfunction.
[0015] As a second limitation to the above application, the hypertension includes essential hypertension.
[0016] As a third limitation to the above application, the elderly age range is 60 to 85 years old.
[0017] Given the advantages of the circulating miRNA markers provided by the present invention in terms of sensitivity and specificity, they can be used to prepare reagents, kits, or biochips for diagnosing or assisting in the diagnosis of elderly hypertension accompanied by early cardiac impairment. For example, the kits can include amplification primers and corresponding probes designed for miR-19b-3p, miR-21-5p, miR-30e-5p, and / or miR-15a-5p, as well as reverse transcriptase, buffer, dNTPs, MgCl2, DEPC water, and Taq enzyme. BRIEF DESCRIPTION OF THE DRAWINGS
[0018] In order to more clearly illustrate the technical solutions in the embodiments of the present invention, the following briefly introduces the drawings required for use in the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.
[0019] Figure 1 The relative expression level statistics of the four circulating miRNAs in the Non-LVDD group and the LVDD group in the validation population in Example 2 of the present invention are shown in FIG. Figure 1A) is a comparative analysis of the relative expression levels of miR-15a-5p in the Non-LVDD group and the LVDD group. Figure 1 B) is a comparative analysis of the relative expression levels of miR-21-5p in the Non-LVDD group and the LVDD group. Figure 1 C) is a comparative analysis of the relative expression levels of miR-19b-3p in the Non-LVDD group and the LVDD group. Figure 1 D is a comparative analysis of the relative expression levels of miR-30e-5p in the Non-LVDD group and the LVDD group; Figure 2 The KEGG pathway enrichment and association analysis of miRNAs in Example 2 of the present invention is shown in FIG. Figure 2 As shown, Figure 2 A) Bubble diagram of KEGG pathway enrichment analysis of miRNAs-related genes. Figure 2 B) is the network diagram of the KEGG pathway of miRNAs; Figure 3-1 is the correlation between right ventricular diameter (RV) and miR-19b-3p expression in Example 2 of the present invention; Figure 3-2 The correlation between left ventricular ejection fraction (LVEF) and miR-19b-3p expression in Example 2 of the present invention; Figure 3-3 The correlation between the shortening fraction (FS) and miR-19b-3p expression in Example 2 of the present invention; Figure 3-4 The correlation between the A value and the expression of miR-19b-3p in Example 2 of the present invention; Figure 3-5 is the correlation between the e-value and miR-19b-3p expression in Example 2 of the present invention; Figure 3-6 is the correlation between the E / e ratio and miR-19b-3p expression in Example 2 of the present invention; Figure 4-1 The correlation between left ventricular ejection fraction (LVEF) and miR-30e-5p expression in Example 2 of the present invention; Figure 4-2 is the correlation between the A value and miR-30e-5p expression in Example 2 of the present invention; Figure 4-3 This is the correlation between the E value and miR-30e-5p expression in Example 2 of the present invention; Figure 4-4 This is the correlation between the E / e ratio and miR-30e-5p expression in Example 2 of the present invention; Figure 4-5This is the correlation between the shortening fraction (FS) and miR-30e-5p expression in Example 2 of the present invention; Figure 5-1 The correlation between the shortening fraction (FS) and the expression of miR-15a-5p in Example 2 of the present invention; Figure 5-2 The correlation between left ventricular ejection fraction (LVEF) and miR-15a-5p expression in Example 2 of the present invention; Figure 6 is the area under the receiver operating characteristic curve of single and combined miRNAs in Example 2 of the present invention; wherein, Figure 6 A) Area under the receiver operating characteristic curves of miR-30e-5p, miR-19b-3p, miR-19b-3p+miR-21-5p+miR-30e-5p, miR-19b-3p+miR-21-5p+miR-15a-5p, and miR-19b-3p+miR-21-5p+miR-15a-5p+miR-30e-5p; Figure 6 B is the area under the receiver operating characteristic curve of miR-21-5p and miR-15a-5p; Figure 7 Statistical graph comparing the areas under the receiver operating characteristic curves of single and combined miRNAs in Example 2 of the present invention. DETAILED DESCRIPTION
[0020] In order to make the purpose, technical solutions and advantages of the present invention more clearly understood, the present invention is further described in detail below in conjunction with the embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not intended to limit the present invention.
[0021] Unless otherwise stated, the experimental methods, detection methods, and preparation methods disclosed in the present invention all adopt conventional techniques in the art.
[0022] Data in this study were analyzed using SPSS version 26.0. Before analysis, all data were assessed for normality using the Kolmogorov-Smirnov test. Normally distributed continuous variables were expressed as mean ± standard deviation (mean ± SD), while non-normally distributed continuous variables were expressed as median (interquartile range, 25%-75%). Differences between the two groups in normally distributed clinical variables were analyzed using a two-sample t-test, while non-normally distributed variables were analyzed using the Mann-Whitney U test. Non-normally distributed categorical data were expressed as proportions or percentages and compared between groups using the chi-squared test. Associations between miRNA levels and echocardiographic parameters were analyzed using Spearman correlation analysis.
[0023] A multivariate logistic regression model was used to evaluate the association between miRNA levels and LVDD in elderly patients with EH. Multicollinearity between continuous variables in the logistic model was tested by variance inflation factor (VIF). If all VIF values were less than 10, there was no collinearity problem. The calibration of the logistic model was assessed by Hosmer-Lemeshow test, with P < 0.05 indicating poor model calibration. In the analysis, we adjusted for the following factors: (1) factors with P < 0.05 in Tables 3-6; (2) factors that may affect LVDD, including coronary heart disease (CHD), diabetes mellitus (DM), alcohol consumption, angiotensin receptor blockers (ARBs), calcium channel blockers (CCBs), loop diuretics, beta-blockers, statins, antiplatelet drugs, glomerular filtration rate, and aspartate aminotransferase. Finally, receiver operating curves (ROCs) for individual and combined biomarkers were constructed, and the predictive value of the biomarkers was assessed using the area under the ROC curve, sensitivity, specificity, and Youden index. The improvement between two receiver operating curves was calculated using the Delong test, and statistical significance was defined as a two-tailed P < 0.05.
[0024] In order to better illustrate the embodiments of the present invention, further examples are given below.
[0025] Example 1 The present invention provides a screening process for four circulating miRNAs markers, and the specific method is as follows: 1. Research subjects and clinical data collection This retrospective study enrolled 247 elderly patients with essential hypertension (EH) who presented to the cardiology departments of four tertiary hospitals (Hebei Provincial People's Hospital, the Fourth Hospital of Hebei Medical University, Shijiazhuang People's Hospital, and Handan Central Hospital) between September 2022 and September 2023. Among these patients, 154 patients with EH without LVDD and 93 patients with EH associated with LVDD were included. The diagnosis of LVDD was based on Doppler examination techniques recommended by the American Society of Echocardiography and the European Society of Cardiovascular Imaging. All patients provided a detailed medical history and underwent a comprehensive clinical examination and laboratory testing. Exclusion criteria included the following: acute coronary syndrome, previous myocardial infarction, systemic inflammatory disease, renal failure, autoimmune disease, liver disease, moderate or severe aortic or mitral regurgitation or stenosis, prosthetic valve, atrial septal defect or aneurysm, atrial fibrillation (AF) or conduction disturbances, and inadequate echocardiographic images. The study protocol was approved by the Ethics Committee of Hebei Provincial People's Hospital. The study adhered to the Declaration of Helsinki and Good Clinical Practice guidelines defined by the International Conference on Harmonization. All patients provided written informed consent before the study. A data and safety monitoring committee was established to oversee safety and efficacy considerations. The study was registered with ResMan and the corresponding approval number was obtained.
[0026] 2. Small RNA Library Preparation and Next-Generation Sequencing 3-4 mL of peripheral blood was collected from each patient and placed in a coagulant tube. The sample was centrifuged at 2000 rpm for 10 minutes. The supernatant was transferred to a clean EP tube and centrifuged again at 13,000 rpm for 10 minutes to remove intact chromatin from ruptured blood cells, resulting in the supernatant serum. The supernatant was transferred to another clean EP tube and stored at -80°C.
[0027] Serum samples from 5 randomly selected EH patients without LVDD and 5 EH patients with LVDD were analyzed by next-generation sequencing.
[0028] 1. Next-generation sequencing analysis of patient demographic characteristics The basic information of the five non-LVDD EH patients and five LVDD EH patients who underwent next-generation sequencing analysis is shown in Tables 1-2.
[0029] Table 1 Basic information of Non-LVDD EH patients analyzed by next-generation sequencing
[0030] Table 2 Basic information of LVDD EH patients analyzed by next-generation sequencing
[0031] As shown in Table 1-2, there was no significant difference between the two groups in terms of age or hypertension grade.
[0032] 2. Next-generation sequencing analysis specifically includes the following steps: (1) Total RNA was extracted from serum using the Qiagen miRNeasy Kit (Cat. 217004). The specific method is as follows: 1) After taking the serum out of the -80℃ freezer, place it on ice and thaw slowly. During the thawing process, turn it upside down every 5 minutes to mix it evenly. This will speed up the thawing process and ensure the uniformity of the composition and temperature of the thawed part of the sample to prevent the formation of white precipitate.
[0033] 2) Before the sample is completely thawed, prepare a 1.5 mL EP tube, label the sample name on the tube cap, and add 5 times the sample volume of QIAzol.
[0034] 3) Once the sample is completely thawed, mix the serum or plasma sample by pipetting up and down. Immediately add 200 μL of the sample to the prepared QIAzol® solution. Incubate at room temperature for 10 minutes.
[0035] 4) Add 200 μL of chloroform and shake vigorously on a vortex shaker. After standing at room temperature for 5 minutes, place the sample in a 4°C centrifuge and centrifuge at 12,000 g for 15 minutes. Prepare a 1.5 mL EP tube for extraction and label it with the sample name.
[0036] 5) After centrifugation, take the supernatant into the prepared new EP tube.
[0037] 6) Add 1.5 times (i.e. 900 μL) of anhydrous ethanol to the supernatant and mix thoroughly by pipetting.
[0038] 7) Load the mixed solution from the previous step onto the column, centrifuge at >10,000 rpm for 15 seconds at room temperature, and discard the lower layer of liquid.
[0039] 8) Repeat step 6) once.
[0040] 9) Add 700 μL of RWT and centrifuge at 15,000 g for 15 seconds at room temperature. Discard the lower layer.
[0041] 10) Add 500 μL of RPE and centrifuge at 15,000 g for 5 seconds at room temperature. Discard the lower layer.
[0042] 11) Repeat step 9) once.
[0043] 12) Place the purification column in a new cannula and centrifuge at full speed for two minutes. Prepare a 1.5 mL EP tube for the next step and label it with the sample name.
[0044] 13) Transfer the purification column to a new 1.5 mL EP tube and add 30-50 μL of NF water to the membrane of the purification column. Incubate at room temperature for 1 minute and centrifuge. Discard the purification column and retain the centrifuged sample. Take 2 μL of the sample and quantify it using a nanodrop to obtain total RNA.
[0045] (2) The RNA concentration and A260 / A280 ratio of each sample were measured using a NanoDrop ND-1000 ultra-micro UV-visible spectrophotometer to assess RNA purity. The RNA fragment integrity number (RIN) was assessed using an Agilent 2100 Bioanalyzer microfluidic automated electrophoresis analysis platform.
[0046] After denaturation (70°C, 2 min), the RNA was mixed with a DNA 3' adapter. T4 RNA Ligase 2 (NEB, Cat. No. M0351L, truncated K227Q) was added, mixed at room temperature, and then transferred to 16°C for at least 8 hours. After completion of the reaction, unbound 3' adapters were removed by treatment with RTP (RNase T1 and polynucleotide phosphorylase) at 37°C for 30 minutes. A 5' adapter and T4 RNA Ligase 1 (NEB, Cat. No. M0204L) were added, and the ligation was completed at 37°C for 60 minutes. Reverse transcription was performed using SuperScript II Reverse Transcriptase (Thermo, Cat. No. 18064014) at 50°C for 60 minutes, followed by termination by treatment at 80°C for 10 minutes. The cDNA product was amplified using Phusion® High-Fidelity DNA Polymerase (NEB, Cat. No. M0530L). Amplification conditions included: initial denaturation at 98°C for 30 seconds; 10–16 cycles: 98°C for 15 seconds (denaturation) → 60°C for 30 seconds (annealing) → 72°C for 15 seconds (extension); and a final extension at 72°C for 5 minutes. The PCR products obtained were purified by PAGE electrophoresis and sequenced at 50 bp using an Illumina HiSeq 2500 platform.
[0047] After filtering low-quality sequences using ACGT101-miR v4.2 software, the raw data were aligned with miRBase 22.1 using the miRDeep2 algorithm and combined with RNAfold secondary structure prediction (parameters: stem base pairs ≥ 16, free energy ≤ -15 kcal / mol) to identify novel miRNAs. The details are as follows: Raw reads were processed using the in-house program ACGT101-miR (v4.2) to remove adapter dimers, junk sequences, low-complexity sequences, common RNA families (rRNA, tRNA, snRNA, snoRNA), and repetitive sequences. Subsequently, unique sequences ranging from 18 to 26 nucleotides in length were aligned to species-specific precursors in miRBase 22.1 via BLAST searches to identify known miRNAs and novel 3p- and 5p-derived miRNAs. Length variation at both ends (3' and 5') of the sequence, as well as one mismatch within the sequence, was tolerated. Unique sequences that aligned to the hairpin arm of a species-specific mature miRNA were identified as known miRNAs. Unique sequences that aligned to the other arm of a known species-specific precursor hairpin (opposite to the arm where the annotated mature miRNA resides) were considered novel 5p- or 3p-derived miRNA candidates. Remaining sequences were aligned to precursors from other selected species (excluding specific species) in miRBase 22.1 via BLAST searches. These pre-miRNAs were further BLAST-aligned to the genomes of the specific species to determine their genomic locations. Both of these scenarios were defined as known miRNAs. Unaligned sequences were BLAST-aligned to the specific genomes, and RNAfold software was used to predict the hairpin RNA structure encompassing the sequence from the flanking 80 nt sequence. The criteria for secondary structure prediction are as follows: (1) the number of nucleotides in a bulge in the stem is ≤12; (2) the number of base pairs in the predicted hairpin stem region is ≥16; (3) the free energy cutoff kCal / mol is ≤-15; (4) the length of the hairpin: upper and lower stems + terminal loop is ≥50; (5) the length of the hairpin loop is ≤20; (6) the number of nucleotides in a bulge in the mature region is ≤8; (7) the number of bias errors in a bulge in the mature region is ≤4; (8) the number of bias bulges in the mature region is ≤2; (9) the number of errors in the mature region is ≤7; (10) the number of base pairs in the predicted hairpin mature region is ≥12; and (11) the percentage of mature stem is ≥80%.
[0048] 3. Sequencing analysis results Differential expression of miRNAs based on normalized deep sequencing counts was optionally analyzed using the Student's t-test, with a significance threshold of 0.05 based on the experimental design. Criteria for selecting miRNAs from the next-generation sequencing data included statistically significant differences between groups (P < 0.05), high expression levels, and an absolute fold change ≥ 1.5. Next-generation sequencing analysis identified 32 significantly differentially expressed miRNAs (P < 0.05) between patients with non-LVDD EH (designated the Non-LVDD group) and patients with LVDD EH (designated the LVDD group). Four circulating miRNAs, miR-19b-3p, miR-21-5p, miR-30e-5p, and miR-15a-5p, were selected based on high expression levels and an absolute fold change ≥ 1.5 between the two groups.
[0049] Among them, the base sequence of miR-19b-3p is shown in SEQ ID No.1, the base sequence of miR-21-5p is shown in SEQ ID No.2, the base sequence of miR-30e-5p is shown in SEQ ID No.3, and the base sequence of miR-15a-5p is shown in SEQ ID No.4.
[0050] SEQ ID No. 1 is specifically: TGTGCAAATCTATGCAAAACTGA; SEQ ID No. 2 is specifically: TAGCTTATCAGACTGATGTTGA; SEQ ID No. 3 is specifically: TGTAAACATCCTTGACTGGAAGCT; SEQ ID No. 4 is specifically: TAGCAGCACATAATGGTTTGT.
[0051] Example 2 The specific differences between the four circulating miRNAs markers miR-19b-3p, miR-21-5p, miR-30e-5p and miR-15a-5p obtained in Example 1 in Non-LVDD EH patients and LVDD EH patients, and whether they can be used as biomarkers, were verified and analyzed in the present embodiment.
[0052] 1. RT-qPCR validation of serum miRNAs To verify the results obtained from the above RNA-seq data, this application used the remaining 237 patients of the 247 elderly essential hypertension (EH) study subjects as the validation population, among which Non-LVDD EH patients were recorded as the Non-LVDD group and LVDD EH patients were recorded as the LVDD group.
[0053] 1. Basic information of the verification population The basic information and medication status of the validation population were collected, and their biochemical indicators, echocardiogram, and expression levels of four circulating miRNAs were examined. The specific information is shown in Tables 3-6.
[0054] Table 3 Basic information and biochemical index statistics of the validation population
[0055] Table 4 Statistics of drug use in the validation population
[0056] Table 5 Statistics of echocardiographic parameters of the validation population
[0057] As shown in Table 3, there were no significant differences between the Non-LVDD group and the LVDD group in age, sex, systolic blood pressure (SBP), diastolic blood pressure (DBP), body mass index (BMI), and the proportion of patients with chronic kidney disease (CKD), cancer, smoking, and use of ACEI, ARNI, MRA, thiazide drugs, α-receptor antagonists, and nitrates (all P>0.05).
[0058] Table 3 also shows that compared with the Non-LVDD group, the LVDD group had significantly lower levels of total cholesterol (4.45±1.08 vs. 4.13±1.06, P=0.026), low-density lipoprotein cholesterol (2.84[2.24,3.40] vs. 2.22[1.77,2.93], P<0.001), high-density lipoprotein cholesterol (1.12[0.97,1.32] vs. 1.03[0.87,1.17], P<0.001), serum creatinine (0.82[0.69,0.94] vs. 0.74[0.63,0.87], P=0.019), and cystatin C (2.06[1.59,2.72] vs. The levels of lipopolysaccharide (LPS) (22.75 [18.42, 27.80] vs. 19.80 [16.95, 23.00], P = 0.001) and estimated glomerular filtration rate (50.43 [38.07, 60.84] vs. 54.71 [42.96, 65.57], P = 0.020) were higher in the Non-LVDD group. In contrast, there were no significant differences in triglyceride, uric acid, blood urea nitrogen, albumin, alanine aminotransferase, and hemoglobin between the two groups (P > 0.05).
[0059] As shown in Table 4 , the LVDD group had a higher proportion of patients with coronary heart disease (37 / 88 vs. 35 / 149, P = 0.003), diabetes mellitus (18 / 88 vs. 11 / 149, P = 0.003), and a history of alcohol consumption (10 / 88 vs. 5 / 149, P = 0.014). In terms of drug treatment, the LVDD group had a higher proportion of patients using ARBs (33 / 88 vs. 32 / 149, P=0.008), loop diuretics (10 / 88 vs. 5 / 149, P=0.014), and beta-blockers (24 / 88 vs. 23 / 149, P=0.027) than the Non-LVDD group, while a lower proportion of patients using CCBs (49 / 88 vs. 63 / 149, P=0.046), statins (48 / 88 vs. 53 / 149, P=0.004), and antiplatelet drugs (43 / 88 vs. 51 / 149, P=0.026).
[0060] As shown in Table 5 , in echocardiographic examination, the LVDD group had higher diastolic interventricular septal thickness (IVS, 10 [10, 11] vs. 9.81 [9.00, 10.65], P < 0.001), main pulmonary artery (MPA, 23 [21, 25] vs. 22.00 [20, 24], P = 0.003), A value (1.00 ± 0.22 vs. 0.93 ± 0.20, P = 0.016), and E / e ratio (13.06 [10.81, 15.12] vs. 11.50 [9.49, 12.99], P < 0.001). However, left atrial diameter (LAD, 36.50 [34, 39] vs. 38.00 [35, 41], P = 0.017), right ventricular diameter (RV, 25.5 [21.0, 31.21] vs. 29.90 [27, 32], P < 0.001), left ventricular ejection fraction (LVEF%, 58 [55, 62] vs. 64.00 [60, 68], P < 0.001), fractional shortening (FS%, 29.9 [28.6, 35] vs. 35.00 [30.40, 37.00], P < 0.001), and e-value (5.44 [4.59, 6.89] vs. 6.16 [5.12, 7.37], P = 0.008) were lower in the LVDD group. There were no significant differences between the two groups in left ventricular posterior wall thickness (LVPWT), E value, E / A ratio, pulmonary artery systolic pressure (PASP) and maximum tricuspid regurgitation velocity (P>0.05).
[0061] Table 6 Statistics of relative expression levels of four circulating miRNAs in the validation population
[0062] The method for determining the expression levels of the four circulating miRNAs in the validation population is as follows: total miRNAs were extracted from the serum of the validation population using the miRNeasySerum / Plasma Advanced Kit.
[0063] Quantitative RT-PCR was performed according to the corresponding manual. The primers for the miRNAs selected in the present invention were purchased from Qiagen. Among them, the primer number for miR-19b-3p is YP00204450; the primer number for miR-21-5p is YP00204230; the primer number for miR-30e-5p is YP00204714; and the primer number for miR-15a-5p is YP00204066. To standardize miRNA expression, miR-191-5p (primer number YP00204306) was selected as the internal reference control because of its stable expression in human samples. Nematode miR-39-3p (cel-miR-39-3p) (primer number YP00203952) was used as the external reference control to control the operational error during RT-PCR. The sample with the lowest Ct value of the target miRNAs gene was used as the control. The results of each serum sample were analyzed using 2 −∆∆Ct Method calculation.
[0064] Based on the relative expression of the four circulating miRNAs in the validation population shown in Table 6, the statistical graphs of the relative expression levels of the four circulating miRNAs in the Non-LVDD group and the LVDD group in the validation population are shown in Figure 6. Figure 1 As shown. Figure 1 As shown in Table 6 , compared with the Non-LVDD group, the expression levels of miR-19b-3p (P < 0.001) and miR-30e-5p (P = 0.039) were higher, while the expression levels of miR-15a-5p (P = 0.151) and miR-21-5p (P = 0.017) were lower in the LVDD group.
[0065] 2. Identification of circulating miRNAs and analysis of related KEGG pathways The present invention attempts to identify the gene networks regulated by the four miRNAs described above. To predict the most abundant miRNA-targeted genes, the present invention used two computational target prediction algorithms (TargetScan v5.0 and Miranda v3.3a) to identify miRNA binding sites. The data predicted by the two algorithms were then merged and the overlap was calculated. The Kyoto Encyclopedia of Genes and Genomes (KEGG) pathways of these miRNA targets were annotated, and the enrichment and interactions of miRNA-related genes in KEGG pathways were further correlated. The KEGG pathway enrichment and association analysis of miRNAs is shown in the figure below. Figure 2 As shown, Figure 2 A) Bubble diagram of KEGG pathway enrichment analysis of miRNAs-related genes. Figure 2 B) is the network diagram of KEGG pathway of miRNAs. Figure 2The target predictions of the above four miRNAs can be further speculated or verified to identify key elements related to cardiac injury, such as LPAR1 (PI3K-Akt signaling pathway), GNB5 (Ras signaling pathway), ARHGEF7, GNA12 and LPAR1 (regulating the actin cytoskeleton), PDE3A and ATP2B1 (cGMP-PKG signaling pathway).
[0066] 3. Correlation between circulating miRNAs and echocardiographic parameters The correlation between the above circulating miRNAs and echocardiographic parameters of the two groups of patients was evaluated using a multivariate logistic regression model. Figure 3-1 to Figure 3-6 shown; among them, Figure 3-1 represents the correlation between right ventricular diameter (RV) and miR-19b-3p expression, Figure 3-2 represents the correlation between left ventricular ejection fraction (LVEF) and miR-19b-3p expression, Figure 3-3 represents the correlation between shortening fraction (FS) and miR-19b-3p expression, Figure 3-4 represents the correlation between A value and miR-19b-3p expression, Figure 3-5 represents the correlation between e-value and miR-19b-3p expression, Figure 3-6 represents the correlation between E / e ratio and miR-19b-3p expression; The correlation between miR-30e-5p and cardiac ultrasound indicators is as follows Figure 4-1 to Figure 4-5 shown; among them, Figure 4-1 represents the correlation between left ventricular ejection fraction (LVEF) and miR-30e-5p expression, Figure 4-2 represents the correlation between A value and miR-30e-5p expression, Figure 4-3 represents the correlation between E value and miR-30e-5p expression, Figure 4-4 represents the correlation between E / e ratio and miR-30e-5p expression, Figure 4-5 represents the correlation between fractional shortening (FS) and miR-30e-5p expression; The correlation between miR-15a-5p and cardiac ultrasound indicators is as follows Figure 5-1 to Figure 5-2 shown; among them, Figure 5-1 represents the correlation between shortening fraction (FS) and miR-15a-5p expression, Figure 5-2 represents the correlation between left ventricular ejection fraction (LVEF) and miR-15a-5p expression.
[0067] Figures 3-1 to 3-6The results showed that right ventricular diameter (RV, r=-0.200, P=0.002), left ventricular ejection fraction (LVEF, r=-0.240, P<0.001), shortening fraction (FS, r=-0.181, P=0.005), A value (r=0.138, P=0.034), e value (r=-0.135, P=0.038) and E / e ratio (r=0.198, P=0.002) were significantly correlated with miR-19b-3p expression. Figure 4-1 to Figure 4-5 It showed significant correlation with LVEF (r=-0.137, P=0.035), E value (r=0.176, P=0.007), E / e ratio (r=0.170, P=0.009), FS (r=-0.181, P=0.005) and A value (r=0.141, P=0.030). Figure 5-1 to Figure 5-2 The results showed that FS (r=-0.148, P=0.024) and LVEF (r=-0.182, P=0.005) were significantly correlated with miR-15a-5p.
[0068] 2. Multiple Regression Variable Analysis Univariate and multivariate correlation analyses were conducted between the four circulating miRNAs and the non-LVDD and LVDD groups (see Table 7 for detailed data). In the unadjusted model, miR-19b-3p levels (OR = 1.565, 95% CI: 1.098-2.231), miR-21-5p (OR = 0.713, 95% CI: 0.611-0.831), and miR-15a-5p (OR = 0.762, 95% CI: 0.656-0.885) were all significantly associated with LVDD. Furthermore, we adjusted for factors that showed significant differences between the two groups, including coronary heart disease (CHD), diabetes mellitus (DM), alcohol consumption, ARBs, CCBs, loop diuretics, beta-blockers, statins, antiplatelet drugs, eGFR, and AST.
[0069] Table 7 Correlation analysis of single and multiple factors
[0070] In multivariate analysis, even after incorporating the factors that showed significant differences between the two groups, miR-19b-3p (OR = 4.359, 95% CI: 2.154-8.822), miR-21-5p (OR = 0.664, 95% CI: 0.516-0.854), and miR-15a-5p (OR = 0.728, 95% CI: 0.579-0.915) levels still showed significant odds ratios. Furthermore, variance inflation factors (VIFs) were used to assess multicollinearity between coronary artery disease, diabetes, alcohol consumption, ARBs, CCBs, loop diuretics, beta-blockers, statins, antiplatelet drugs, eGFR, AST, and miRNAs. All VIF values were less than 10, indicating no collinearity. The Hosmer-Lemeshow test demonstrated significant goodness-of-fit of the adjusted model (P = 0.214).
[0071] 3. The value of four circulating miRNAs in the diagnosis or auxiliary diagnosis of elderly hypertension with cardiac function impairment The present invention constructs receiver operating curves (ROCs) for individual and combined circulating miRNAs and uses the area under the ROC curve (AUC), sensitivity, specificity, and Youden index to assess the predictive value of the biomarkers. The improvement between two ROC curves is calculated using the Delong test, with statistical significance defined as a two-tailed P < 0.05.
[0072] The area under the receiver operating characteristic curves of individual and combined miRNAs are shown in Figure 2. Figure 6 As shown, Figure 6 A) Area under the receiver operating characteristic curves of miR-30e-5p, miR-19b-3p, miR-19b-3p+miR-21-5p+miR-30e-5p, miR-19b-3p+miR-21-5p+miR-15a-5p, and miR-19b-3p+miR-21-5p+miR-15a-5p+miR-30e-5p; Figure 6 B is the area under the receiver operating characteristic curve of miR-21-5p and miR-15a-5p. Figure 7 Statistical graph comparing the areas under the receiver operating characteristic curves of individual and combined miRNAs.
[0073] The results of the area under the receiver operating characteristic (ROC) curve, sensitivity, specificity, and Youden index values are shown in Table 8 .
[0074] Table 8 Statistics of parameters related to receiver operating curve
[0075] Depend on Figure 6-7As shown in Table 8, among the individual miRNAs, miR-19b-3p had the best area under the receiver operating characteristic (ROC) curve (AUC) of 0.735 (95% confidence interval: 0.669-0.800), a Youden index of 0.356, a sensitivity of 88.64%, and a specificity of 46.98%. Furthermore, in the combined analysis, the combinations of miR-19b-3p + miR-21-5p + miR-30e-5p, miR-19b-3p + miR-21-5p + miR-15a-5p, and miR-19b-3p + miR-21-5p + miR-15a-5p + miR-30e-5p all showed good diagnostic value, with AUCs ranging from 89.8% to 91.5%, sensitivities of 80.68% to 86.36%, and specificities of 88.28% to 89.93%. Among them, miR-19b-3p+miR-21-5p+miR-30e-5p had the best comprehensive performance, with an area under the ROC curve of 0.915 (95% confidence interval: 0.872-0.947), a Youden index of 0.763, a sensitivity of 86.360%, and a specificity of 89.930%, which were superior to those of a single miRNA (P<0.001).
[0076] Example 3 Given the advantages of high sensitivity and specificity of the circulating miRNA markers provided herein, particularly the combinations of miR-19b-3p + miR-21-5p + miR-30e-5p, miR-19b-3p + miR-21-5p + miR-15a-5p, and miR-19b-3p + miR-21-5p + miR-15a-5p + miR-30e-5p, they can be used to prepare reagents, kits, or biochips for diagnosing or assisting in the diagnosis of elderly hypertension associated with early cardiac impairment (particularly elderly hypertension associated with left ventricular diastolic dysfunction). For example, the kits may include amplification primers and corresponding probes designed based on miR-19b-3p, miR-21-5p, miR-30e-5p, and / or miR-15a-5p, as well as reverse transcriptase, buffer, dNTPs, MgCl2, DEPC water, and Taq enzyme.
[0077] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions or improvements made within the spirit and principles of the present invention should be included in the scope of protection of the present invention.
Claims
1. A circulating miRNAs marker, characterized in that The circulating miRNAs markers include at least one of miR-19b-3p, miR-21-5p, miR-30e-5p or miR-15a-5p.
2. The circulating miRNAs marker according to claim 1, wherein The circulating miRNAs markers include at least three of miR-19b-3p, miR-21-5p, miR-30e-5p or miR-15a-5p.
3. The circulating miRNAs marker according to claim 2, wherein The circulating miRNAs marker is any one of the following (I) to (III): (I) miR-19b-3p, miR-21-5p, and miR-30e-5p; (II) miR-19b-3p, miR-21-5p, and miR-15a-5p; (III) miR-19b-3p, miR-21-5p, miR-30e-5p and miR-15a-5p.
4. The circulating miRNAs marker according to claim 1, wherein The circulating miRNAs markers are derived from peripheral blood serum.
5. Use of the circulating miRNAs marker according to any one of claims 1 to 4 in the preparation of a reagent, a kit or a biochip for diagnosing or assisting in the diagnosis of elderly hypertension accompanied by early cardiac function damage.
6. The use according to claim 5, characterized in that The early cardiac function damage includes left ventricular diastolic dysfunction.
7. The use according to claim 5, characterized in that The hypertension includes essential hypertension.
8. The use according to claim 5, characterized in that The elderly are aged between 60 and 85 years old.