Application of reagent for detecting DNA methylation of RPL10 promoter region in preparation of sow pregnancy diagnosis product

Abstract

The invention belongs to the technical field of biological diagnosis, and particularly relates to application of a reagent for detecting DNA methylation of an RPL10 promoter region in preparation of a sow pregnancy diagnosis product. Through methylation high-throughput sequencing of blood DNA of pregnant sows and non-pregnant sows, it is found that the methylation level of a gene promoter region of the ribosomal protein L10 in the early pregnancy stage of the sows is remarkably reduced. The methylation level of the pregnant sow RPL10 is analyzed by using MSP, BSP and qMSP methods, and meanwhile, the ROC curve analysis result also shows that the RPL10 has diagnostic value. The results show that the method for detecting the RPL10 gene in the pig blood sample can be an effective method for diagnosing the early pregnancy of pigs. According to the invention, a pregnancy diagnosis technology based on RPL10 promoter region DNA methylation is preliminarily established, pig pregnancy detection methods are enriched, and a reference is provided for further exploring the DNA methylation level and the regulation mechanism of the pig pregnancy early stage.

Description

Technical Field

[0001] The present invention belongs to the technical field of biological diagnosis, and particularly relates to an application of a reagent for detecting DNA methylation in an RPL10 promoter region in the preparation of a sow pregnancy diagnosis product. Background Art

[0002] With the intensive development of pig farming, early pregnancy diagnosis in sows has become increasingly important. Promptly diagnosing pregnancy in sows after mating can avoid "ineffective breeding," improve sow reproductive efficiency, and ultimately enhance the economic benefits of the farming industry. Currently, ultrasound is the most commonly used method in large-scale farms. Recent research suggests that using RTUs can diagnose pregnancy as early as 30 days after fertilization. However, diagnostic results can be affected by the operator's skill level and experience. Furthermore, the equipment is relatively expensive and requires specialized training and maintenance. Furthermore, ultrasound images can be affected by factors such as the sow's internal tissue structure and intestinal gas, affecting diagnostic accuracy. Another method is to diagnose pregnancy by rectal palpation of the sow's uterus and ovaries, feeling for changes in shape, size, and texture. This method requires high operator skill, extensive experience, and a good sense of touch, and can easily lead to misdiagnosis. Furthermore, in early pregnancy, changes in the uterus and ovaries may not be obvious, making accurate assessment difficult. Furthermore, the procedure may cause stress to the sow, affecting its normal physiological state. Therefore, a new strategy for determining pregnancy in sows is needed. Summary of the Invention

[0003] In order to accurately diagnose early pregnancy in sows, the present invention provides a use of a reagent for detecting DNA methylation in the RPL10 promoter region in the preparation of a sow pregnancy diagnosis product.

[0004] The technical solution adopted in the present invention is: The present invention provides an application of a reagent for detecting DNA methylation in an RPL10 promoter region in the preparation of a sow pregnancy diagnosis product, wherein the nucleotide sequence of the DNA in the RPL10 promoter region is shown in SEQ ID NO.1.

[0005] Preferably, the reagents include primers and probes.

[0006] Preferably, the sequences of the primers are shown as SEQ ID NO.2 to SEQ ID NO.9; The sequence of the probe is shown in SEQ ID NO.10.

[0007] Preferably, the 5' end of the probe is connected to 6-carboxyfluorescein, and the 3' end is connected to 5-carboxytetramethylrhodamine succinimidyl ester.

[0008] Preferably, the method for detecting DNA methylation in the RPL10 promoter region is as follows: Collect genomic DNA from sows; Using genomic DNA as a template and the primers and probes, the methylation level of the RPL10 promoter region DNA is detected by specific methylation PCR, bisulfite detection and / or real-time quantitative specific methylation PCR.

[0009] Preferably, the genomic DNA is derived from the blood of a sow.

[0010] Preferably, when using the specific methylation PCR method for detection, the calculation formula for the methylation level is: , where I : methylation index; M : methylation number, bp; U : Unmethylated number, bp.

[0011] Preferably, when using real-time quantitative specific methylation PCR for detection, the calculation formula for the methylation level is any one of the following: 1) , where P : methylation level; E : CT value of methylation status; F : CT value of the unmethylated state; 2) , where ΔCT : methylation level; CT 1 : CT value of RPL10 promoter region DNA; CT 2 : β-actin CT value.

[0012] Compared with the prior art, the present invention has the following beneficial effects: The present invention provides a reagent for detecting DNA methylation in the RPL10 promoter region for use in preparing a product for diagnosing sow pregnancy. The nucleotide sequence of the DNA in the RPL10 promoter region is shown in SEQ ID NO. 1. By performing high-throughput sequencing of methylation in the blood DNA of pregnant sows and empty-stomach sows, the present invention found that the methylation level of the gene promoter region of ribosomal protein L10 in sows in early pregnancy was significantly reduced. The present invention analyzed the methylation level of RPL10 in pregnant sows using MSP, BSP, and qMSP methods. At the same time, the ROC curve analysis results also showed that RPL10 has diagnostic value. These results indicate that detecting the RPL10 gene in pig blood samples may be an effective method for diagnosing early pregnancy in pigs. The present invention preliminarily establishes a pregnancy diagnosis technology based on DNA methylation in the RPL10 promoter region, providing a reference for further exploring the DNA methylation level and its regulatory mechanism in early pregnancy in pigs. BRIEF DESCRIPTION OF THE DRAWINGS

[0013] Figure 1 Figure 2 shows the RPL10 MSP results. A: MSP amplification diagram of RPL10 in pregnant and non-pregnant blood samples; B: relative fluorescence intensity of each band of the MSP amplification product in Figure A.

[0014] Figure 2 Figure 3 MSP results of three biological replicates of RPL10 in the pregnancy group and the non-pregnancy group. A: MSP amplification graph of RPL10 in three blood samples from the pregnancy group and the non-pregnancy group; B: relative fluorescence intensity of each band of the MSP amplification product in graph A.

[0015] Figure 3 RPL10 BSP results, A: non-pregnancy group; B: pregnancy group.

[0016] Figure 4 These are the RPL10 qMSP results.

[0017] Figure 5 is the methylation level of RPL10.

[0018] Figure 6 Figure 2 shows the ROC curve and AUC of RPL10 in pig blood samples. DETAILED DESCRIPTION

[0019] The present invention will be further described below by way of specific examples, but the scope of the present invention is not limited thereto. The details and forms of the technical solution of the present invention may be modified or replaced without departing from the spirit and scope of the present invention, but such modifications or replacements fall within the scope of protection of the present invention.

[0020] The inventive concept of the present invention is as follows: Epigenetics is the study of heritable changes in gene activity or function without altering the DNA sequence itself. DNA methylation is a natural modification of DNA, involving the covalent attachment of a methyl group to the fifth carbon position of cytosine in a CpG dinucleotide. DNA methylation is the most extensively studied and important epigenetic modification in humans, regulating gene expression and present in many cell proliferation and differentiation processes. DNA methylation is closely associated with mammalian growth and development, embryonic development, and inflammatory diseases.

[0021] DNA methylation has been widely used in the diagnosis of various diseases and is considered a good biomarker for cancer diagnosis. In addition, DNA methylation is also widely used in animal husbandry. Studies have shown that DNA methylation can be used to screen out differential genes related to excellent genetic traits, thereby selecting the best breeds and achieving good breeding. Existing technologies have found that DNA methylation can regulate the development of pig skeletal muscle and play an important role in the development of pig skeletal muscle. The advantages of DNA methylation-based detection technology in early cancer screening can be used to diagnose cancer at an early stage.

[0022] Currently, pig pregnancy diagnosis relies primarily on ultrasound. The main methods for diagnosing early pregnancy in pigs include traditional diagnostic methods, ultrasound, and laboratory tests, each with its own advantages and disadvantages. Therefore, a new method is needed for diagnosing pig pregnancy. This invention takes a novel approach: determining sow pregnancy based on RPL10 methylation levels. High RPL10 methylation levels indicate an empty uterus, while low levels indicate a pregnant sow.

[0023] Ribosomal protein L10 (RPL10), also known as QM and DXS648, is encoded by the q28 gene located on the X chromosome and has a molecular weight of approximately 24 kDa. RPL10 is a component of the large ribosomal subunit and a functionally conserved ribosomal protein. RPL10 participates in ribosome biogenesis and protein synthesis, playing a crucial role in ribosome function. Furthermore, RPL10 has numerous extra-ribosomal functions, and evidence suggests that RPL10 is involved in regulating cell biological processes such as metabolism, differentiation, cell proliferation, and apoptosis. Previous studies on embryonic development have shown that RPL10 influences embryonic and tissue development and differentiation.

[0024] In the present invention, MSP and BSP results showed that the DNA methylation level of the RPL10 gene in pig blood was significantly downregulated after pregnancy. The ROC curve analysis results showed an AUC value of 0.8968 for RPL10, which has diagnostic value. These results suggest that detecting the RPL10 gene in pig blood samples may be an effective method for diagnosing early pregnancy in pigs.

[0025] The present invention uses methods such as methylation-specific PCR, bisulfite detection, and quantitative methylation-specific PCR to confirm that the methylation level of the RPL10 promoter region in sows in early pregnancy is significantly reduced, and establishes a fluorescent probe detection technology based on the DNA methylation level of the RPL10 gene promoter region. This detection technology has potential application value in the diagnosis of sow pregnancy.

[0026] DNA methylation is an epigenetic modification that is not only used in the early screening of various cancer diseases such as colorectal cancer, prostate cancer, lung cancer and breast cancer, but also plays an important role in many developmental processes of animals, plants and fungi, among which DNA methylation plays an important role in the development of mammalian oocytes and embryos. However, the changes in pig blood methylation during pregnancy are still unclear. The present invention uses the methylated target gene RPL10 promoter region as a porcine pregnancy diagnostic marker, providing a new direction for porcine pregnancy diagnosis. The present invention uses methods such as MSP, BSP and q-MSP to verify the changes in the DNA methylation level of the target gene in pig blood during pregnancy, explaining the state of pig blood methylation during pregnancy from an epigenetic perspective.

[0027] In order to make those skilled in the art better understand the technical solution of the present invention and be able to implement it, the present invention is further described below in conjunction with specific examples. In the description of the present invention, if not otherwise specified, the reagents used are all commercially available and the methods used are all conventional techniques in the art.

[0028] The abbreviations of the present invention are shown in Table 1.

[0029] Table 1 Abbreviations Example 1 The application of the reagent for detecting DNA methylation in the promoter region of RPL10 in the preparation of sow pregnancy diagnostic products is as follows: 1. Materials and methods

[0030] 1.1. Experimental animals

[0031] The experimental subjects were non-producing gilts of the Duroc and Landrace binary hybrid breed. Blood was collected from the 28-day pregnant and non-pregnant pigs, and the blood samples were frozen during transportation.

[0032] The 28-day pregnancy group was designated as Pre, and the non-pregnancy group was designated as Ctrl.

[0033] 1.2. Main reagents.

[0034] Blood genomic DNA extraction kit, DH5α competent cells, DL2000 DNA Marker, agarose gel DNA recovery kit, pMD19-T, and Bisulfite Conversion Kit were all purchased from Yisheng Biotechnology Co., Ltd.

[0035] 1.3. Main instruments.

[0036] Micro21 low-temperature high-speed centrifuge, NanoDrop ND2000 ultramicro-volume spectrophotometer and ABI-2720 PCR amplifier were purchased from Thermo Fisher Scientific (China) Co., Ltd.; PowerPac basic nucleic acid electrophoresis instrument and gel imaging instrument were purchased from BioRad, USA; constant temperature incubator was purchased from Thermo Fisher Biotechnology Co., Ltd.; LightCycler 96 fluorescence quantitative instrument was purchased from Roche Diagnostics.

[0037] 1.4. Blood DNA extraction and methylation modification.

[0038] Pig blood was collected and frozen for storage. DNA was extracted using a blood DNA extraction kit, and DNA concentration was determined using a NanoDrop ND2000 microspectrophotometer. The DNA was methylated using a Bisulfite Conversion Kit and stored frozen at -20°C for subsequent experiments.

[0039] 1.5. Verification of differential gene methylation.

[0040] 1.5.1. MSP method analysis and verification, as follows: According to the sequencing results, the region with differential methylation levels in the RPL10 promoter was located at 124926771 to 124927005 on the positive strand of chromosome X, and the specific sequence is shown in SEQ ID NO.1.

[0041] SEQ ID NO.1: cccggtccacaaaggaacgatggccgaagctccattagggtgcgtccctgccgagccctggaaccgcacgggggaggcacagagggctcgtcccaagcctcacgatgccaggggacag gtgtgcggccgccgcgagccccattcgggagtactttcttccagtgctaggaacagatgtcttttatagttacggcgaagcctcgggcaagaattttacgcccaagatggccaaccg.

[0042] Significant changes in methylation were observed in this region. MSP primers for the RPL10 gene were designed using the MethPrime website. Primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd.; specific primer sequence information is shown in Table 2. Extracted porcine blood DNA was methylated using the Bisulfite Conversion Kit. PCR amplification of the methylated DNA samples was performed using the following system: 20 μL system, 10 μL BioGold 2×SuperPCR Master Mix, 1 μL each of the upstream and downstream primers, 1.5 μL DNA, and 6.5 μL ddH2O. The PCR reaction procedure was as follows: initial denaturation at 95°C for 3 min; 45 cycles of 95°C for 10 s, 56°C for 30 s, and 72°C for 20 s; extension at 72°C for 3 min; and storage at 4°C. The amplified samples were subjected to w / v 2% agarose gel electrophoresis, and the methylation level of the target gene RPL10 was analyzed using Image J software. The methylation ratio of RPL10 in the pregnant group and the non-pregnant group was calculated using the following formula:

[0043] .

[0044] Where, I : methylation index; M : methylation number, bp; U : Unmethylated number, bp.

[0045] Table 2 MSP primer information 1.5.2. Analysis and verification of the BSP method are as follows: BSP primers for the RPL10 gene were designed using the MethPrime website. Primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd. Specific primer sequences are shown in Table 3. DNA extracted from porcine blood was methylated using the Bisulfite Conversion Kit. The methylated DNA samples were then amplified by PCR. The PCR system consisted of a 50 μL system, 25 μL of BioGold 2× SuperPCR Master Mix, 2 μL each of the upstream and downstream primers, 4 μL of DNA, and 17 μL of ddH2O. The PCR reaction procedure was as follows: initial denaturation at 95°C for 3 min; 40 cycles of 95°C for 30 s, 55°C for 30 s, and 72°C for 20 s; extension at 72°C for 3 min; and storage at 4°C. After amplification, the samples were subjected to electrophoresis on a 1.5% w / v agarose gel. The PCR-amplified DNA products were then recovered using an agarose gel DNA recovery kit and cloned into the pMD19-T vector purchased from Takara. After ligation at room temperature for 5 minutes, transform E. coli DH5α competent cells.

[0046] The transformation process involved adding 10 μL of the ligation product to 100 μL of E. coli DH5α competent cells, incubating on ice for 30 minutes, heat shocking at 42°C for 90 seconds, and then incubating on ice for 5 minutes. Then, 800 μL of antibiotic-free LB medium was added and the cells were incubated at 37°C for 30 minutes. The cells were centrifuged at 12,000 rpm for 1 minute, and the supernatant was discarded. The pellet was resuspended and plated on an ampicillin-resistant LB plate and incubated overnight at 37°C for 8 hours. Single colonies were then selected and cultured in small batches for 8 hours. PCR was performed to identify the clones, and 20 positive clones were randomly selected and sequenced using universal sequencing primers for the pMD19-T vector. Sequencing data were analyzed for CpG-CT conversion using the original DNA sequence as a reference using online software. The methylation status of the target sequence was displayed as the percentage of methylated CpGs relative to the total number of CpGs, and the results were presented as black and white dot plots. Online software: http: / / quma.cdb.riken.jp / top / index.html.

[0047] Table 3 BSP primer information 1.5.3. qMSP method analysis and validation, as follows: qMSP-SYBR Green method: For qMSP, primer sequences are shown in Table 2. Methylation modification was performed on DNA extracted from porcine blood using the Bisulfite Conversion Kit. Methylation levels were determined using a LightCycler 96 system. The reaction system consisted of 20 μL of DNA, 10 μL of BioGold SYBR qPCR Master Mix, 0.4 μL each of the upstream and downstream primers, 1 μL of bisulfite-converted DNA template, and 8.2 μL of ddH2O. The reaction procedure was as follows: initial denaturation at 95°C for 3 min, followed by 40 cycles of 95°C for 5 s and 60°C for 20 s. DNA methylation levels in the RPL10 promoter region were determined in pregnant and non-pregnant groups using the formula.

[0048] The calculation formula is: ; Where, P : methylation level; E : CT value of methylation status; F : CT value of the unmethylated state.

[0049] qMSP probe method: Consult relevant literature, follow the principles of probe primer design, and use Beacon Designer software to design primers and probes for the RPL10 promoter region and primers and probes for the pig β-actin internal reference. The specific primer sequences are shown in Table 4. The extracted pig blood DNA was methylated using the Bisulfite Conversion Kit. The methylation level was determined using the LightCycler 96 system. The reaction system was 20μL, TaqProbe 2×qPCR-MultiplexMastermix 10μL, 0.4μL each of the upstream and downstream primers of the RPL10 gene, 0.2μL of the probe, 0.4μL each of the upstream and downstream primers of β-actin, 0.2μL of the probe, 2μL of bisulfite-converted DNA template, and 6μL of ddH2O. The reaction procedure was: pre-denaturation at 95℃ for 30s; 95℃ for 15s, 58℃ for 30s, and 50 cycles. Use ΔCT The values ​​reflect the DNA methylation levels of the RPL10 gene in the pregnant and non-pregnant groups.

[0050] .

[0051] Where, ΔCT Value: DNA methylation level; CT 1 : CT value of RPL10; CT 2 : CT value of β-actin.

[0052] Table 4 qMSP primer and probe information Note: In Table 4, FAM is 6-carboxyfluorescein; TAMRA-N is 5-carboxytetramethylrhodamine succinimidyl ester; BHQ3 is 6-carboxy-1,4-dimethylquinoline-3-sulfonamide.

[0053] (6) Data analysis.

[0054] GraphPad Prism 9.0 software was used to perform independent sample t-tests and draw graphs. *P<0.05 indicates a significant difference, and **P<0.01 indicates an extremely significant difference.

[0055] 2. Results.

[0056] 2.1 MSP Verification Results MSP results showed that the promoter region of the target gene RPL10 was methylated in both the pregnancy group and the non-pregnancy group. The methylation ratio of each group was calculated using ImageJ software. Figure 1 The results showed that the methylation level of RPL10 in sows during early pregnancy was lower than that in empty sows.

[0057] Next, the analysis was repeated for pregnant and non-pregnant samples, n = 3, and the methylation ratio of each group was calculated. Figure 2 As shown in Table 5 , the comprehensive methylation ratio of RPL10 in the pregnancy group was 40.1%, while that in the non-pregnancy group was 53.5%.

[0058] Figure 1 In A, lane 1: DL2000 DNA Marker; the remaining lanes from left to right are: unmethylated RPL10 MSP product U of the Ctrl group, methylated RPL10 MSP product M of the Ctrl group, unmethylated RPL10 MSP product U of the Pre group, and methylated RPL10 MSP product M of the Pre group; Figure 1 B is the methylation ratio between the pregnancy group and the non-pregnancy group calculated by ImageJ software. The methylation of the Ctrl group was 0.508, and the methylation of the Pre group was 0.438, excluding the data with large errors in the first group.

[0059] Figure 2In Figure A, lane 1: DL2000 DNA Marker; lane 2, lane 4, lane 6: three repeats of unmethylated RPL10 MSP product U in the Ctrl group; lane 3, lane 5, lane 7: three repeats of methylated RPL10 MSP product M in the Ctrl group; lane 8, lane 10, lane 12: three repeats of unmethylated RPL10 MSP product U in the Pre group; lane 9, lane 11, lane 13: three repeats of methylated RPL10 MSP product M in the Pre group. Figure 2 B is the gray area in the pregnancy group and the non-pregnancy group calculated by ImageJ software.

[0060] Table 5 Comprehensive methylation ratios of the pregnancy group and the non-pregnancy group 2.2. BSP verification results.

[0061] The results of BSP showed that the methylation ratios of the RPL10 gene in the blood samples of the pregnant and non-pregnant pigs were 8.2% and 55.3%, respectively. Compared with the non-pregnant group, the DNA methylation level of this gene in the pregnant group was significantly decreased (P<0.01). Figure 3 .

[0062] Figure 3 In the BSP validation, each row represents a positive clone and each column represents a CpG site; ●: methylated CpG site; ○: unmethylated CpG site.

[0063] 2.3. qMSP verification results

[0064] qMSP-SYBR Green method: qMSP results showed that the methylation level of RPL10 gene in the pregnant group was lower than that in the non-pregnant group. The methylation level of RPL10 promoter region DNA in the pregnant group was 28.19%, while that in the non-pregnant group was 37.60%, and there was a significant difference (P < 0.05). Figure 4 .

[0065] qMSP-probe method: The present invention uses the qMSP probe method to detect the methylation of RPL10 in the pregnant group and the non-pregnant group. A total of 48 samples were tested in the experiment, including 21 non-pregnant samples and 27 pregnant samples. The above samples were all pig blood samples confirmed by B-ultrasound examination. The methylation level is represented by the ΔCT value. The lower the ΔCT value, the higher the methylation level. Figure 5The results showed that the methylation level of the RPL10 promoter region was significantly lower in the pregnant group than in the non-pregnant group (P < 0.0001). Regarding the RPL10 methylation test values: a ΔCt ≤ 1.7 indicates non-pregnancy, and a ΔCt > 3.5 indicates pregnancy (see Table 6).

[0066] Table 6 RLP10 hypomethylation target critical value judgment The ROC curve was drawn based on the Ct value of each sample, and the area under the curve (AUC) value was calculated. The results showed that the AUC value was 0.8968. Figure 6 The methylation detection compliance rate was 87.5%.

[0067] The technical features of the above-mentioned embodiments can be combined arbitrarily. In order to make the description concise, not all possible combinations of the technical features in the above-mentioned embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0068] The above-described embodiments merely illustrate several implementations of the present invention. While the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the present invention. It should be noted that a person skilled in the art would be able to make numerous variations and improvements without departing from the spirit of the present invention, and all such variations and improvements fall within the scope of protection of the present invention.

Claims

1. Use of a reagent for detecting DNA methylation in the RPL10 promoter region in the preparation of a sow pregnancy diagnostic product, characterized in that: The nucleotide sequence of the RPL10 promoter region DNA is shown in SEQ ID NO.

1.

2. The use according to claim 1, characterized in that The reagents include primers and probes.

3. The use according to claim 2, characterized in that The sequences of the primers are shown in SEQ ID NO.2 to SEQ ID NO.9; The sequence of the probe is shown in SEQ ID NO.

10.

4. The use according to claim 3, characterized in that The 5' end of the probe is connected to 6-carboxyfluorescein, and the 3' end is connected to 5-carboxytetramethylrhodamine succinimidyl ester.

5. The use according to claim 2, characterized in that The method for detecting DNA methylation in the RPL10 promoter region is as follows: Collect genomic DNA from sows; Using genomic DNA as a template and the primers and probes, the methylation level of the RPL10 promoter region DNA is detected by specific methylation PCR, bisulfite detection and / or real-time quantitative specific methylation PCR.

6. The use according to claim 5, characterized in that The genomic DNA is derived from the blood of sows.

7. The use according to claim 5, characterized in that When using specific methylation PCR, the methylation level is calculated as follows: , where I : methylation index; M : methylation number, bp; U : Unmethylated number, bp.

8. The use according to claim 5, characterized in that When using real-time quantitative methylation-specific PCR, the methylation level is calculated using one of the following formulas: 1) , where P : methylation level; E : CT value of methylation status; F : CT value of the unmethylated state; 2) , where ΔCT : methylation level; CT 1 : CT value of RPL10 promoter region DNA; CT 2 : β-actin CT value.

Images