LAMP (loop-mediated isothermal amplification) primer combination for detecting human parainfluenza virus type 1, kit and application

Abstract

The invention relates to the technical field of biology, in particular to an LAMP primer combination for detecting human parainfluenza virus type 1, a kit and application. The LAMP primer combination for detecting the human parainfluenza virus type 1 provided by the invention comprises an LAMP primer combination, a primer pair and a primer pair, wherein the LAMP primer combination is designed on the basis of an HN gene of the human parainfluenza virus type 1; according to the invention, through a large amount of comparison, screening and analysis, at least two highly conservative gene regions are selected as targets; according to the invention, the highly conservative gene region is found and screened, and the highly conservative gene region has the characteristics of higher conservative type, higher specificity and universal type in the human parainfluenza virus 1, so that the HN gene of the human parainfluenza virus 1 can be selected as a target gene to design an LAMP primer combination; the LAMP primer combination can be used for detecting the human parainfluenza virus type 1 in a high-sensitivity and high-specificity manner and can be used for quickly detecting the human parainfluenza virus type 1 in a short time.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to a LAMP primer combination, a kit and uses for detecting human parainfluenza virus type 1. Background Art

[0002] Loop-mediated isothermal amplification (LAMP) was first proposed by Notomi et al. in 2000 as an efficient, rapid and specific nucleic acid amplification technology. LAMP technology uses a DNA polymerase with chain displacement activity (such as Bst DNA polymerase) and a set of specifically designed primers to achieve exponential amplification of the target DNA sequence under constant temperature conditions (usually 60-65°C). Unlike traditional polymerase chain reaction (PCR), LAMP does not require thermal cycling equipment and can complete the reaction only with a constant temperature heating device. Therefore, this technology is particularly suitable for on-site testing or immediate diagnosis (Point-of-Care Testing, POCT) in resource-limited environments.

[0003] LAMP primers typically include two outer primers (F3 and B3), two inner primers (FIP and BIP), and optionally two loop primers (LF and LB). These primers can recognize multiple specific regions on the target DNA sequence, thereby ensuring high specificity and sensitivity of the reaction. The LAMP reaction products are a series of DNA fragments of different lengths and structures, and the results are usually interpreted by turbidity detection, fluorescent dyes, or colorimetry. Due to its simple and rapid operation (usually completed within 30-60 minutes) and low equipment requirements, LAMP technology has been widely used in pathogen detection, food safety monitoring, environmental microbiology analysis, and genetic disease diagnosis.

[0004] Human parainfluenza virus type 1 (HPIV-1), as an important member of the Paramyxoviridae genus, mainly causes respiratory tract infections clinically, and is of great clinical significance, especially for children, the elderly, and immunosuppressed people. HPIV-1 is one of the main pathogens that cause acute respiratory tract infections in children (such as laryngotracheobronchitis, also known as "croup"). Among cases of croup in children, its infection accounts for approximately 40%-50%. Typical symptoms of croup include a barking cough, hoarseness, inspiratory wheezing, and difficulty breathing. In severe cases, it can cause airway obstruction and even be life-threatening. In addition, HPIV-1 can also cause upper respiratory tract infections (such as the common cold) and lower respiratory tract infections (such as bronchitis and pneumonia), especially in infants and young children, which may lead to serious complications. At present, the treatment for HPIV-1 infection is mainly symptomatic and supportive treatment, and no specific antiviral drugs or vaccines have been approved for marketing. Therefore, early diagnosis and preventive measures (such as hand hygiene and avoiding contact with infected people) are crucial to controlling the spread of HPIV-1.

[0005] Existing primer design methods for the loop-mediated isothermal amplification (LAMP) technique for detecting human parainfluenza virus type 1 (HPIV-1) have several limitations. First, the HPIV-1 genome is highly variable. In particular, mutations in the fusion protein (F) and hemagglutinin-neuraminidase (HN) genes can alter primer binding sites, thereby affecting the sensitivity and specificity of LAMP assays. LAMP primer design requires recognition of six to eight specific regions within the target sequence, placing high demands on the selection of highly conserved regions within the HPIV-1 genome, making design challenging. Furthermore, HPIV-1 shares high genomic sequence homology with other parainfluenza viruses (such as HPIV-2 and HPIV-3), potentially leading to cross-reactions between primers and non-target viruses, resulting in false-positive results. Second, existing LAMP primer design tools (such as PrimerExplorer) may not fully account for sequence differences between viral strains when designing for the HPIV-1 genome, resulting in unstable primer performance in practical applications. Furthermore, the presence of inhibitors in HPIV-1 samples (such as mucus or cellular debris in respiratory secretions) may further affect the efficiency and accuracy of the LAMP reaction. Compared with traditional PCR technology, LAMP is simple to operate under constant temperature conditions, but its complexity in primer design and dependence on template purity limit its application in complex samples. Summary of the Invention

[0006] Therefore, the technical problem to be solved by the present invention is to provide a LAMP primer combination, a kit and a use for detecting human parainfluenza virus type 1, which can detect human parainfluenza virus type 1 with high sensitivity and high specificity, and can be quickly detected in a short time, providing an efficient tool for the clinical diagnosis and epidemiological monitoring of human parainfluenza virus type 1.

[0007] To this end, the present invention provides the following technical solutions:

[0008] In an embodiment of the present invention, a LAMP primer combination for detecting human parainfluenza virus type 1 is provided, comprising primers designed based on bp 85 to 1653 of the HN gene of human parainfluenza virus type 1. The present inventors have discovered that designing a LAMP primer combination within this conserved region enables high sensitivity and specificity in detecting human parainfluenza virus type 1, and enables rapid detection within a short period of time.

[0009] In some embodiments, the LAMP primer combination for detecting human parainfluenza virus type 1 comprises:

[0010] Outer primer set:

[0011] Outer primer F3: nucleotide sequence as shown in SEQ ID NO.1;

[0012] Outer primer B3: nucleotide sequence is shown in SEQ ID NO.2;

[0013] Inner primer set:

[0014] Internal primer FIP: nucleotide sequence is shown in SEQ ID NO.3;

[0015] Internal primer BIP: nucleotide sequence is shown in SEQ ID NO.4;

[0016] Loop primer set:

[0017] Loop primer LF: nucleotide sequence is shown in SEQ ID NO.5;

[0018] Loop primer LP: nucleotide sequence is shown in SEQ ID NO.6;

[0019] or

[0020] Outer primer set:

[0021] Outer primer F3: nucleotide sequence is shown in SEQ ID NO.7;

[0022] Outer primer B3: nucleotide sequence is shown in SEQ ID NO.8;

[0023] Inner primer set:

[0024] Internal primer FIP: nucleotide sequence is shown in SEQ ID NO.9;

[0025] Internal primer BIP: nucleotide sequence is shown in SEQ ID NO.10;

[0026] Loop primer set:

[0027] Loop primer LF: nucleotide sequence is shown in SEQ ID NO.11;

[0028] Loop primer LP: The nucleotide sequence is shown in SEQ ID NO.12.

[0029] In some embodiments, the molar ratio of the final concentration of the outer primer F3, outer primer B3, inner primer FIP, inner primer BIP, loop primer LF, and loop primer LP is 0.2-0.5 μM: 0.2-0.5 μM: 1-2 μM: 1-2 μM: 0.4-0.5 μM: 0.4-0.5 μM. The molar ratio of the final concentration of the system of the outer primer F3, outer primer B3, inner primer FIP, inner primer BIP, loop primer LF, and loop primer LP can be any one or a range value between any two values ​​of 0.2μM: 0.5μM: 1μM: 2μM: 0.4μM: 0.5μM, 0.5μM: 0.2μM: 2μM: 1μM: 0.5μM: 0.4μM, 0.3μM: 0.3μM: 1.5μM: 1.5μM: 0.45μM: 0.45μM or 0.2μM: 0.2μM: 1.6μM: 1.6μM: 0.4μM: 0.4μM.

[0030] An embodiment of the present invention provides use of the LAMP primer combination for detecting human parainfluenza virus type 1 in preparing a product for detecting human parainfluenza virus type 1.

[0031] In some embodiments, the product comprises a reagent, a kit, or a chip.

[0032] An embodiment of the present invention provides a kit for detecting human parainfluenza virus type 1, comprising the LAMP primer combination for detecting human parainfluenza virus type 1.

[0033] In some embodiments, a loop-mediated isothermal amplification reaction system is further included; the isothermal amplification reaction system includes Bst DNA polymerase, reverse transcriptase, fluorescent dye, buffer and / or dNTP.

[0034] The loop-mediated isothermal amplification reaction system:

[0035] Bst Buffer: 5-7 μL;

[0036] 10× primer mix: 2-3 μL;

[0037] Bst Enzyme Mix (UDG plus): 0.5~1.5μL;

[0038] Template: concentration 25-100 copies / reaction, 1-3 μL;

[0039] Enzyme-free water: make up to 25 μL;

[0040] In the loop-mediated isothermal amplification reaction system, the molar ratio of the final concentration of the outer primer F3, the outer primer B3, the inner primer FIP, the inner primer BIP, the loop primer LF, and the loop primer LP is 0.2-0.5 μM: 0.2-0.5 μM: 1-2 μM: 1-2 μM: 0.4-0.5 μM: 0.4-0.5 μM.

[0041] In some preferred embodiments, the loop-mediated isothermal amplification reaction system:

[0042] Bst Buffer: 6 μL;

[0043] 10× primer mix: 2.5 μL;

[0044] Bst Enzyme Mix (UDG plus): 1μL;

[0045] Template: concentration 25-100 copies / reaction, 2 μL;

[0046] Enzyme-free water: make up to 25 μL.

[0047] The Bst Buffer is a commercially available product, containing a buffer, dNTPs, and the fluorescent dye required for detection. The Bst Enzyme Mix (UDG plus) is a commercially available product, a mixed enzyme solution including Bst DNA polymerase and reverse transcriptase.

[0048] In an embodiment of the present invention, a method for detecting human parainfluenza virus type 1 is provided, comprising the following steps:

[0049] S1, extracting RNA from the sample to be tested;

[0050] S2. Using the LAMP primer combination for detecting human parainfluenza virus type 1 or the kit for detecting human parainfluenza virus type 1, a loop-mediated isothermal amplification reaction is performed using the cDNA in step S1 as a template;

[0051] S3. After the loop-mediated isothermal amplification reaction is completed, determine whether an amplification product is amplified in the loop-mediated isothermal amplification reaction system, and determine whether the sample to be tested contains human parainfluenza virus type 1.

[0052] In some embodiments, the conditions of the loop-mediated isothermal amplification reaction are: incubation at 37°C for 2-5 minutes; incubation at a constant temperature of 60-65°C for 30-60 minutes; inactivation at 85°C for 4-6 minutes. In the loop-mediated isothermal amplification reaction, the purpose of incubation at 37°C for 2-5 minutes is to activate the activity of the UDG enzyme and prevent the impact of aerosol pollution in the environment on expansion. In some embodiments, the incubation is at 37°C for 2 minutes, 3 minutes, 4 minutes or 5 minutes. In some embodiments, the incubation is at a constant temperature of 60-65°C for 30-60 minutes, such as any one of 60, 61, 62, 63, 64, and 65°C or a range between any two values, and the incubation time can be any one of 30, 35, 40, 45, 50, and 60 minutes or a range between any two values. A preferred embodiment is incubation for 30 minutes.

[0053] The technical solution of the present invention has the following advantages:

[0054] 1. The present invention provides a LAMP primer combination for detecting human parainfluenza virus type 1, comprising: a primer combination designed based on bp 85 to 1653 of the HN gene of human parainfluenza virus type 1; at least two highly conserved gene regions are selected as targets through extensive comparison, screening, and analysis; multiple sequence alignment is performed using Clustal Omega and MEGA X software, and specificity is verified in combination with BLAST to eliminate cross-reactions with closely related species. Ultimately, the highly conserved gene regions are screened out, showing high conservation and specificity, and being universal among human parainfluenza virus type 1. Therefore, the HN gene of human parainfluenza virus type 1 can be selected as the target gene for designing a LAMP primer combination, thereby obtaining a LAMP primer combination capable of detecting human parainfluenza virus type 1 with high sensitivity, high specificity, and rapid detection in a short time.

[0055] 2. The present invention provides a LAMP primer combination for detecting human parainfluenza virus type 1, comprising: an outer primer group: an outer primer F3: a nucleotide sequence as shown in SEQ ID NO.1; an outer primer B3: a nucleotide sequence as shown in SEQ ID NO.2; an inner primer group: an inner primer FIP: a nucleotide sequence as shown in SEQ ID NO.3; an inner primer BIP: a nucleotide sequence as shown in SEQ ID NO.4; a loop primer group: a loop primer LF: a nucleotide sequence as shown in SEQ ID NO.5; a loop primer LP: a nucleotide sequence as shown in SEQ ID NO.6; or an outer primer group: an outer primer F3: a nucleotide sequence as shown in SEQ ID NO.7; an outer primer B3: a nucleotide sequence as shown in SEQ ID NO.8; an inner primer group: an inner primer FIP: a nucleotide sequence as shown in SEQ ID NO.9; an inner primer BIP: a nucleotide sequence as shown in SEQ ID NO.10; a loop primer group: a loop primer LF: a nucleotide sequence as shown in SEQ ID NO.11; a loop primer LP: a nucleotide sequence as shown in SEQ ID NO. As shown in Figure 12, the present invention has verified that the above-mentioned LAMP primer combination can detect human parainfluenza virus type 1 with high sensitivity and high specificity, and can be rapidly detected in a short time. The maximum sensitivity is 6.25 copies / reaction specificity (95% coincidence rate), and rapid detection can be achieved within 30 minutes, providing an efficient tool for clinical diagnosis and epidemiological monitoring of human parainfluenza virus type 1. BRIEF DESCRIPTION OF THE DRAWINGS

[0056] In order to more clearly illustrate the specific embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the specific embodiments or the description of the prior art. Obviously, the drawings described below are some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0057] Figure 1 is a map showing the position of primer set 1 in Example 1 of the present invention in the HPIV1 HN gene;

[0058] Figure 2 is a map showing the position of primer set No. 2 in Example 1 of the present invention in the HPIV1 HN gene;

[0059] Figure 3 is a map showing the position of primer set 3 in Example 1 of the present invention in the HPIV1 HN gene;

[0060] Figure 4 This is the primer wet method verification result in Experimental Example 1 of the present invention;

[0061] Figure 5 is the sensitivity test result of primer set 2 in Experimental Example 2 of the present invention;

[0062] Figure 6 This is the sensitivity test result of primer set 3 in Experimental Example 2 of the present invention;

[0063] Figure 7 This is the test result of primer set 3 in Experimental Example 2 of the present invention detecting 20 groups of 6.25 copies / reaction samples;

[0064] Figure 8 This is the specific detection result of primer set 3 in Experimental Example 3 of the present invention;

[0065] Figure 9 These are the test results of primer set No. 3 in Experimental Example 4 of the present invention and the primer set in the existing literature.

[0066] Figure 10 This is the test result of the clinical sample tested by primer set No. 3 in Experimental Example 5 of the present invention. DETAILED DESCRIPTION

[0067] The following examples are provided for a better understanding of the present invention and are not intended to limit the best mode of implementation. They do not limit the content and scope of protection of the present invention. Any product identical or similar to the present invention obtained by anyone under the guidance of the present invention or by combining the features of the present invention with other prior arts shall fall within the scope of protection of the present invention.

[0068] If no specific experimental steps or conditions are specified in the examples, the conventional experimental steps or conditions described in the literature in this field can be used. If the manufacturer of the reagents or instruments is not specified, they are all commercially available conventional reagents.

[0069] Bst Buffer and Bst Enzyme Mix (UDG plus) were purchased from Yisheng Biotechnology (Shanghai) Co., Ltd.

[0070] The primers in the following examples were synthesized by Sangon Biotechnology Co., Ltd.

[0071] Example 1 LAMP primer combination for detecting human parainfluenza virus type 1

[0072] After extensive screening and comparison, this example ultimately discovered that bp 85-1653 of the HN gene of human parainfluenza virus type 1 is highly conserved and highly specific, and exhibits universal characteristics across human parainfluenza virus type 1. Therefore, the HN gene of human parainfluenza virus type 1 was selected as the target gene for designing LAMP primer combinations. The designed primer combinations are shown in the table below.

[0073] Table 1. HPIV1 primer design sequence list

[0074]

[0075]

[0076] The positions of the above primer sets in the HN gene are as follows: Figure 1-Figure 3 shown.

[0077] Example 2 Kit for detecting human parainfluenza virus type 1

[0078] This embodiment provides a kit for detecting human parainfluenza virus type 1, comprising the following loop-mediated isothermal amplification reaction system:

[0079] Bst Buffer: 6 μL;

[0080] 10× primer mix: 2.5 μL;

[0081] Bst Enzyme Mix (UDG plus): 1μL;

[0082] Template: concentration 25-100 copies / reaction, 2 μL;

[0083] Enzyme-free water: make up to 25 μL;

[0084] In the loop-mediated isothermal amplification reaction system, the final concentration of the outer primer F3 is 0.2 μM, the final concentration of the outer primer B3 is 0.2 μM, the final concentration of the inner primer FIP is 1.6 μM, the final concentration of the inner primer BIP is 1.6 μM, the final concentration of the loop primer LF is 0.4 μM, and the final concentration of the loop primer LP is 0.4 μM. The primer combination is any one of primer No. 1, primer No. 2, or primer No. 3 in Example 1.

[0085] Example 3 Method for Detecting Human Parainfluenza Virus Type 1

[0086] This embodiment provides a method for detecting human parainfluenza virus type 1, comprising the following steps:

[0087] S1, extracting RNA from the sample to be tested;

[0088] The RNA template of HPIV1 in this example was purchased from Twiss nucleic acid standard (original concentration: 10 6 copies / μL)

[0089] S2. Using the kit for detecting human parainfluenza virus type 1 described in Example 2, a loop-mediated isothermal amplification reaction was performed using the cDNA in step S1 as a template; the prepared loop-mediated isothermal amplification reaction system was as follows:

[0090] Bst Buffer: 6 μL;

[0091] 10× primer mix: 2.5 μL;

[0092] Bst Enzyme Mix (UDG plus): 1μL;

[0093] Template: concentration 25-100 copies / reaction, 2 μL;

[0094] Enzyme-free water: Make up to 25 μL

[0095] In the loop-mediated isothermal amplification reaction system, the final concentration of the outer primer F3 is 0.2 μM, the final concentration of the outer primer B3 is 0.2 μM, the final concentration of the inner primer FIP is 1.6 μM, the final concentration of the inner primer BIP is 1.6 μM, the final concentration of the loop primer LF is 0.4 μM, and the final concentration of the loop primer LP is 0.4 μM.

[0096] The conditions of the loop-mediated isothermal amplification reaction are: incubation at 37° C. for 5 min; incubation at a constant temperature of 63° C. for 30 min; and inactivation at 85° C. for 5 min.

[0097] From the start of the loop-mediated isothermal amplification reaction to the end of the reaction procedure, the QuantStudio1Plus real-time fluorescence quantitative PCR instrument was used to detect the fluorescence signal in the loop-mediated isothermal amplification reaction system. The reaction time (min) was used as the horizontal axis and the change in fluorescence intensity (△Rn) was used as the vertical axis to draw a fluorescence amplification curve. The results were judged as follows: when the amplification incubation time was 30 minutes, the negative group (the sample group containing no nucleic acid, or called the blank group) required no positive time (the positive time was the time point when the fluorescence signal of the positive group sample changed dramatically), or the positive time was greater than 27 minutes; the positive amplification group: the positive time was required to be less than 10 minutes when the template concentration was 100Copies / Reaction, otherwise it was judged to be negative, or the positive time was less than 15 minutes when it was lower than 100Copies / Reaction, otherwise it was judged to be positive, otherwise it was judged to be negative.

[0098] Experimental Example 1 Primer wet method verification

[0099] The templates were detected using primer set 1, primer set 2, and primer set 3, respectively. The detection method was implemented according to Example 3. In the loop-mediated isothermal amplification reaction system, the template was: HPIV1 RNA template purchased from Twis nucleic acid standard (original concentration: 106 The blank group is an amplification group that does not contain nucleic acid samples. The missing liquid volume is replaced with enzyme-free water (it only does not contain nucleic acid; the rest of the amplification components are exactly the same as those of the positive amplification group).

[0100] Test results such as Figure 4 As shown, the amplification performance of the primers was tested at a template concentration of 100 copies / reaction per reaction. Primer sets 2 and 3 had the best amplification performance (the orange line for primer set 2 amplified within 10 minutes, and the green line for primer set 3 amplified within 10 minutes), while primer set 1 had the worst amplification performance.

[0101] Experimental Example 2 Sensitivity Test

[0102] The templates were detected using primer set 1, primer set 2 and primer set 3 respectively. The detection method was implemented according to Example 3. In the loop-mediated isothermal amplification reaction system, the templates were: HPIV-1 RNA template (nucleic acid standard purchased from Twis, original concentration: 10 6 A serial dilution was performed using copies / μL (copies / reaction) (Copies / R or C / R for simplicity), with the units of measurement being 250, 125, 100, 50, 25, 12.5, 6.25, and 3.125 C / R, respectively. A blank control group was an amplification group without nucleic acid sample, and the missing liquid volume was filled with enzyme-free water (only nucleic acid was absent; the remaining amplification components were identical to those in the positive amplification group).

[0103] The detection limit fluorescence curve of primer set 2 is shown in the figure below. Figure 5 As shown, it can be seen that the minimum detection limit of primer set 2 is 12.5 Copies / Reaction.

[0104] The detection limit fluorescence curve of primer set 3 is shown in the figure below. Figure 6 As shown in Figure 2, the minimum detection limit of primer set 2 is 6.25 copies / reaction. 20 sets of samples with a template concentration of 6.25 copies / reaction were tested. The results are as follows: Figure 7 As shown, 19 groups of samples were detected, with a detection rate of 95%. In addition, there was no peak in the blank group, which means that the primer set had good amplification efficiency and no non-specific amplification.

[0105] Experimental Example 3 Specificity Verification

[0106] HPIV1 primer set 3 was tested using various influenza virus RNA samples, following the procedures described in Example 3. RNA templates for influenza A H3N2, human parainfluenza virus PIV4, and human parainfluenza virus type 1 (HPIV1) were purchased from Twiss Nucleic Acid Standards. Each template was diluted to 100 copies / reaction. Three replicates were performed for each virus.

[0107] The results are as follows Figure 8 As shown, it was found that the primer set No. 3 of the present invention could not amplify under human parainfluenza virus type 4 (HPIV4) and influenza virus, but could only amplify under the template of HPIV1, with good specificity.

[0108] Experimental Example 4

[0109] This experimental example examined Primer Set 3 of the present invention and a primer set disclosed in existing literature. The experiments were conducted according to Example 3, with each template diluted to 100 copies / reaction. The difference was that the primer set used was Primer Set 3 or a primer set disclosed in existing literature. Three parallel experiments were performed for each set. The sequences of the primers used in the literature (primer number: HPIV1-literature) are as follows:

[0110] F3: AGTCCGGAATTATATCTCACT (see SEQ ID NO. 19);

[0111] B3: AATGCCTCTGATCCGCA (see SEQ ID NO. 20);

[0112] FIP: TGAACCCATCTGTTTTTTGTTCTTTTCAAACGGTGTCAATGCTG (see SEQ ID NO. 21);

[0113] BIP:

[0114] TCAAAACGAGAGACATGGAGTATGGCCCTTGGAACAATGGATT (see SEQ ID NO. 22);

[0115] LF: CTCTCTCTATATTATATATCAC (see SEQ ID NO. 23);

[0116] LB: CCACAGAGTGGTTGTTTGGAC (see SEQ ID NO. 24).

[0117] The results are as follows Figure 9As shown, using the same template, the three positive groups of primer No. 3 of the present invention had positive times of 5.75, 6.12, and 5.95 minutes, and all three replicates were detected, with a detection rate of 100%. In contrast, the primers in the literature amplified only one of the three replicates, with a reaction time of 6.05 minutes and a detection rate of 33.3%. Comparing the detection rates and reaction times of the two primer groups shows that the amplification effect of primer No. 3 of the present invention is stronger than that of the primer group in the literature.

[0118] Experimental Example 5 Clinical Sample Testing

[0119] This experimental example investigated the No. 3 primer set of the present invention, and detected 24 nasopharyngeal swab specimens suspected of human parainfluenza virus type 1 (the method was implemented according to Example 3, and each template was diluted to 100 copies / reaction). Fluorescence quantitative PCR (ChamQ Universal SYBR qPCR Master Mix, a universal high-sensitivity dye-based quantitative PCR detection kit purchased from Nanjing Novozymes Biotechnology Co., Ltd.) was used for verification.

[0120] Twenty-four clinical samples were tested simultaneously using the LAMP method and fluorescent quantitative PCR. A heat map was created using the sample number and the sample's positive time / Ct value. Darker colors indicate shorter times, and lighter colors indicate longer times. Because the instruments for most blank control samples in the LAMP and fluorescent quantitative PCR groups do not provide positive time / Ct values, the maximum amplification time was used instead for better plotting. LAMP-positive groups colored green represent negative groups; qPCR-positive groups colored yellow represent negative groups (LAMP amplification incubation is 30 minutes, while fluorescent quantitative PCR amplification is 40 minutes, so the negative groups have different colors for the two methods).

[0121] The test results are as follows Figure 10 The results showed that among 24 groups of clinical samples, the LAMP method detected 21 groups of samples with a positive rate of 87.5% (the percentage of detected samples to the total number of samples); the fluorescence quantitative PCR detected 19 groups of samples with a positive rate of 79.2%, but the detection time used by the LAMP method was significantly shorter than that of the fluorescence quantitative PCR.

[0122] Note: The reaction time of the LAMP method is 30 minutes, and the determination method is the same as in Example 3. For the fluorescence quantitative PCR amplification, a Ct value of less than 35 minutes is considered a positive result, and a Ct value greater than 35 minutes is considered a negative result.

[0123] Obviously, the above embodiments are merely examples for clarity of explanation and are not intended to limit the implementation methods. Those skilled in the art will readily appreciate that other variations or modifications based on the above descriptions are possible. It is not necessary and impossible to enumerate all implementation methods here. Obvious variations or modifications arising therefrom remain within the scope of protection of the present invention.

Claims

1. A LAMP primer combination for detecting human parainfluenza virus type 1, characterized in that: include: The design was based on bp 85 to 1653 of the HN gene of human parainfluenza virus type 1.

2. The LAMP primer combination for detecting human parainfluenza virus type 1 according to claim 1, characterized in that include: Outer primer set: Outer primer F3: nucleotide sequence as shown in SEQ ID NO.1; Outer primer B3: nucleotide sequence is shown in SEQ ID NO.2; Inner primer set: Internal primer FIP: nucleotide sequence is shown in SEQ ID NO.3; Internal primer BIP: nucleotide sequence is shown in SEQ ID NO.4; Loop primer set: Loop primer LF: nucleotide sequence is shown in SEQ ID NO.5; Loop primer LP: nucleotide sequence is shown in SEQ ID NO.6; or Outer primer set: Outer primer F3: nucleotide sequence is shown in SEQ ID NO.7; Outer primer B3: nucleotide sequence is shown in SEQ ID NO.8; Inner primer set: Internal primer FIP: nucleotide sequence is shown in SEQ ID NO.9; Internal primer BIP: nucleotide sequence is shown in SEQ ID NO.10; Loop primer set: Loop primer LF: nucleotide sequence is shown in SEQ ID NO.11; Loop primer LP: The nucleotide sequence is shown in SEQ ID NO.

12.

3. The LAMP primer combination for detecting human parainfluenza virus type 1 according to claim 2, characterized in that The molar ratio of the final concentration of the system of outer primer F3, outer primer B3, inner primer FIP, inner primer BIP, loop primer LF, and loop primer LP is 0.2-0.5 μM: 0.2-0.5 μM: 1-2 μM: 1-2 μM: 0.4-0.5 μM: 0.4-0.5 μM.

4. Use of the LAMP primer combination for detecting human parainfluenza virus type 1 according to any one of claims 1 to 3 in preparing a product for detecting human parainfluenza virus type 1.

5. The use according to claim 4, characterized in that The product includes a reagent, a kit or a chip.

6. A kit for detecting human parainfluenza virus type 1, characterized in that A LAMP primer combination for detecting human parainfluenza virus type 1 comprising the method according to any one of claims 1 to 3.

7. The kit for detecting human parainfluenza virus type 1 according to claim 6, characterized in that It also includes a loop-mediated isothermal amplification reaction system; the isothermal amplification reaction system includes Bst DNA polymerase, reverse transcriptase, fluorescent dye, buffer and / or dNTP.

8. The kit for detecting human parainfluenza virus type 1 according to claim 7, characterized in that The loop-mediated isothermal amplification reaction system: Bst Buffer: 5-7 μL; 10× primer mix: 2-3 μL; Bst Enzyme Mix (UDG plus): 0.5~1.5μL; Template: concentration 25-100 copies / reaction, 1-3 μL; Enzyme-free water: make up to 25 μL; In the loop-mediated isothermal amplification reaction system, the molar ratio of the final concentration of the outer primer F3, the outer primer B3, the inner primer FIP, the inner primer BIP, the loop primer LF, and the loop primer LP is 0.2-0.5 μM: 0.2-0.5 μM: 1-2 μM: 1-2 μM: 0.4-0.5 μM: 0.4-0.5 μM.

9. A method for detecting human parainfluenza virus type 1, characterized in that The steps include: S1, extracting RNA from the sample to be tested; S2. Using the LAMP primer combination for detecting human parainfluenza virus type 1 according to any one of claims 1 to 3 or the kit for detecting human parainfluenza virus type 1 according to any one of claims 6 to 8, a loop-mediated isothermal amplification reaction is performed using the cDNA in step S1 as a template; S3. After the loop-mediated isothermal amplification reaction is completed, determine whether an amplification product is amplified in the loop-mediated isothermal amplification reaction system, and determine whether the sample to be tested contains human parainfluenza virus type 1.

10. The method for detecting human parainfluenza virus type 1 according to claim 9, characterized in that: The conditions of the loop-mediated isothermal amplification reaction are: incubation at 37° C. for 2-5 minutes; incubation at a constant temperature of 60-65° C. for 30-60 minutes; and inactivation at 85° C. for 4-6 minutes.

Images