AAV vectors, vector compositions, chimeric vectors and methods of treating or preventing SMA

Abstract

More specifically, the present invention relates to an smn1-delivering AAV vector comprising a tissue-specific promoter (Syn promoter), an smn1-delivering AAV vector composition, an smn1-delivering AAV chimeric vector, and a method for treating or preventing SMN deficiency related diseases using the same. The provided methods of treating or preventing SMN deficiency related diseases comprise administering to a subject through two or more administration routes using an smn1-delivering AAV vector, an AAV vector composition, an AAV chimeric vector.

Description

AAV vectors, vector compositions, chimeric vectors, and methods for treating or preventing SMA

[0001] Cross-references

[0002] This application claims priority to application number CN202410107317.9 filed on January 25, 2024. The entire contents of the prior application are deemed to be the disclosure contents of this application and are incorporated herein in their entirety.

[0003] Sequence Listing Reference

[0004] The sequence listing named D-CF231814-Sequence Listing.xml was created on January 24, 2024, is 20,979 bytes in size, and is hereby incorporated by reference in its entirety. Technical Field

[0005] The present invention relates to the field of gene therapy, and in particular to AAV vectors, vector compositions, AAV chimeric vectors, and methods of using the same to treat or prevent SMN deficiency-related diseases. Background Art

[0006] Spinal muscular atrophy (SMA) is a neuromuscular disease caused by mutations in the smn1 gene on chromosome 5q13. The smn1 gene encodes a constitutively expressed protein, SMN, that participates in the spliceosomal complex. SMN is an intracellular protein, and its deficiency leads to selective toxicity in lower limb motor neurons, resulting in progressive neuronal loss and muscle weakness. Disease severity is influenced by the number of duplicate copies of the homologous gene (smn2). The smn2 gene harbors a splice site mutation that impairs mRNA maturation, resulting in only a small number of full-length SMN transcripts. Patients with one or two copies of smn2 display a severe form of SMA (SMA type I), which begins within a few months of life and rapidly progresses to respiratory failure and death. Patients with three copies of smn2 typically have a more gradual disease progression, typically not developing symptoms until six months of age (SMA type II). Although patients with type II are unable to walk, they rarely progress to respiratory failure and typically survive into adulthood. People with four copies of SMN2 may not develop gradual-onset muscle weakness until adulthood (SMA types III / IV).

[0007] In addition to the antisense oligonucleotide (ASO) drug nusinersen (Spinraza) , currently approved drugs for SMA include an adeno-associated virus (AAV) vector-based drug that replaces the SMN1 gene for a long-term stable period, called onasemnogeneabeparvovec (Zolgensma).

[0008] Previous studies have demonstrated that adeno-associated viral vector type 9 (AAV9) can efficiently deliver genes to the central nervous system (CNS) following systemic administration. Intravenous (iv) administration of AAV9 vectors has also been shown to rescue severe spinal muscular atrophy (SMA) in animal models. Treatment with an AAV9 vector carrying a constitutively codon-optimized smn1 cDNA prolonged the median survival of SMN delta7 mice (which have knockout of the endogenous murine smn gene and co-express the human smn2 gene and a truncated smn cDNA) from 14 days to 160 days following IV administration of an AAV9 vector carrying a constitutively codon-optimized smn1 cDNA. Similar results have been independently reported by other studies, and the AAV9-based therapy originally developed by Foust et al. has received FDA approval for patients with SMA type 1. Among the pediatric patients treated, the cohort that received a high-dose AAV9 injection achieved the best motor recovery. However, the long-term effects of systemic administration (e.g., intravenous administration) of such high doses of AAV vectors remain unknown. In clinical studies, elevated aminotransferase levels, indicating possible liver damage, have been observed in some patients treated with intravenous AAV9-SMN. This severe toxicity has also been reported in non-human primates (NHPs) and juvenile pig models following intravenous (iv) administration of AAV9-SMN vectors with modified capsids. Therefore, reducing viral load while maintaining efficient targeting to the CNS and motor neurons (MNs) is crucial for improving effective and safe SMN gene replacement therapies. Therefore, more drugs and treatments need to be developed around the technology of AAV-SMN.

[0009] The approaches described in this section are not necessarily approaches that have been previously conceived or employed. Unless otherwise indicated, it should not be assumed that any approach described in this section is prior art simply by virtue of its inclusion in this section. Similarly, unless otherwise indicated, the issues raised in this section should not be considered as having been recognized in any prior art. Summary of the Invention

[0010] To solve the above problems, the present disclosure provides AAV vectors, vector compositions, and chimeric AAV vectors for delivering the smn1 gene; methods for treating or preventing SMN deficiency-related diseases; methods for producing the AAV vectors, vector compositions, and chimeric AAV vectors; and AAV vectors, including medical uses of the AAV vectors, vector compositions, and chimeric AAV vectors.

[0011] In a first aspect, the present disclosure provides an AAV vector composition comprising two or more AAV vectors for delivering the smn1 gene. In some embodiments, the AAV vector in the above-mentioned AAV vector composition comprises an expression cassette containing the smn1 gene, wherein the expression cassette comprises a promoter, human smn1 (hsmn1) cDNA and a tail signal, preferably, the AAV vector further comprises an ITR sequence, preferably, the AAV vectors are each independently complementary AAV, such as scAAV or cceAAV, or single-stranded AAV, such as ssAAV.

[0012] In a second aspect, the present disclosure provides a chimeric AAV vector for delivering the smn1 gene, wherein the capsid is composed of two or more capsid proteins. In some embodiments, the chimeric AAV vector comprises an expression cassette containing the smn1 gene, wherein the expression cassette comprises a promoter, hsmn1 cDNA, and a tail signal. Preferably, the chimeric AAV vector further comprises an ITR sequence. Preferably, the chimeric AAV vector is a complementary AAV, such as scAAV or cceAAV, or a single-stranded AAV, such as ssAAV.

[0013] In a third aspect, the present disclosure provides an AAV vector for delivering the smn1 gene, comprising an expression cassette containing a promoter, hsmn1 cDNA, and a tail signal. Preferably, the AAV vector further comprises an ITR sequence. Preferably, the AAV vector is a complementary AAV, such as scAAV or cceAAV, or a single-stranded AAV, such as ssAAV; wherein the promoter contained in the AAV vector is a Syn (synthetic) promoter. In some preferred embodiments, the Syn promoter comprises a CMV enhancer, a regulatory sequence upstream of the transcription start site of the human smn1 gene, and an SV40 late 16s intron. In a more preferred embodiment, the Syn promoter is as shown in SEQ ID NO: 8.

[0014] In a fourth aspect, the present disclosure provides a tissue-specific expression promoter, the Syn (synthetic) promoter, for use in expressing the human smn1 gene. In some preferred embodiments, the Syn promoter comprises a CMV enhancer, a regulatory sequence upstream of the human smn1 gene transcription start site, and the SV40 late 16s intron. In a more preferred embodiment, the Syn promoter is as shown in SEQ ID NO: 8.

[0015] In a fifth aspect, the present disclosure provides an smn1 expression cassette comprising a Syn promoter, h smn1 cDNA and a tail signal. Preferably, the Syn promoter comprises a CMV enhancer, an upstream regulatory sequence of the human smn1 gene transcription start site, and an SV40 late 16s intron. More preferably, the Syn promoter is as shown in SEQ ID NO: 8.

[0016] In a sixth aspect, the present disclosure provides a vector comprising an smn1 expression cassette, wherein the smn1 expression cassette comprises a Syn promoter, h smn1 cDNA and a tail signal. Preferably, the Syn promoter comprises a CMV enhancer, an upstream regulatory sequence of the human smn1 gene transcription start site, and an SV40 late 16s intron. More preferably, the Syn promoter is as shown in SEQ ID NO: 8.

[0017] In a seventh aspect, the present disclosure provides a host cell contacted with an AAV vector composition, a chimeric AAV vector, or a vector of the sixth aspect disclosed herein.

[0018] In an eighth aspect, the present disclosure provides a pharmaceutical composition comprising the AAV vector, vector composition, chimeric AAV vector, or vector of the sixth aspect disclosed in the present disclosure, and a pharmaceutically acceptable carrier.

[0019] In a ninth aspect, the present disclosure provides use of the AAV vector, vector composition, chimeric AAV vector, vector of the sixth aspect, or pharmaceutical composition disclosed herein in the preparation of a medicament for treating or preventing a disease associated with SMN deficiency. In some embodiments, the medicament is used in the following method: administering one or more AAV vectors delivering the SMN1 gene, or chimeric AAV vectors delivering the SMN1 gene, to a subject in need thereof simultaneously or sequentially via two or more administration routes, each administration route being independent of one another.

[0020] In a tenth aspect, the present disclosure provides an AAV vector, vector composition, chimeric AAV vector, or pharmaceutical composition disclosed herein for use in treating or preventing a disease associated with SMN deficiency. In an eleventh aspect, the present disclosure provides a method for increasing SMN1 protein expression or expressing SMN1 protein in a target sample, comprising administering to the target sample the smn1 expression cassette of the fifth aspect, the AAV vector composition disclosed herein, the chimeric AAV vector disclosed herein, the AAV vector disclosed herein, the vector of the sixth aspect, or the pharmaceutical composition disclosed herein. In some embodiments, the above-mentioned method for increasing SMN1 protein expression or expressing SMN1 protein in a target sample is an in vivo method. In some embodiments, the above-mentioned method for increasing SMN1 protein expression or expressing SMN1 protein in a target sample is an in vitro method.

[0021] In a twelfth aspect, the present disclosure provides use of the smn1 expression cassette of the fifth aspect, the AAV vector composition disclosed herein, the chimeric AAV vector disclosed herein, the AAV vector disclosed herein, the vector of the sixth aspect, or the pharmaceutical composition disclosed herein in the preparation of a medicament for expressing SMN1 protein in a target sample or in a subject or increasing the expression of SMN1 protein.

[0022] In a thirteenth aspect, the present disclosure provides the smn1 expression cassette of the fifth aspect, the AAV vector composition disclosed herein, the chimeric AAV vector disclosed herein, the AAV vector disclosed herein, the vector of the sixth aspect, or the pharmaceutical composition disclosed herein, for use in expressing SMN1 protein or increasing SMN1 protein expression in a target sample or in a subject.

[0023] In a fourteenth aspect, the present disclosure provides a method for treating or preventing an SMN deficiency-related disease, the method comprising administering a therapeutically or prophylactically effective amount of the AAV vector, vector composition, chimeric AAV vector, vector of the sixth aspect, or pharmaceutical composition disclosed in the present disclosure to a subject in need thereof.

[0024] In a fifteenth aspect, the present disclosure provides a method for treating or preventing a disease related to SMN deficiency, the method comprising administering to a subject in need thereof simultaneously or sequentially through two or more administration routes, each administration route being independent of each other, one or more AAV vectors delivering the smn1 gene, or a chimeric AAV vector delivering the smn1 gene.

[0025] In a sixteenth aspect, the present disclosure provides a method for producing the AAV vector composition disclosed in the present disclosure, the method comprising the following steps: (a) mixing and reacting a plasmid containing the smn1 gene and the AAV ITR element, a helper plasmid expressing an adenovirus element, and a plasmid containing a desired capsid protein sequence and an AAV Rep gene sequence; (b) transfecting host cells with the reactant obtained in step (a); (c) lysing the transfected host cells to release an AAV vector; (d) using a plasmid containing other desired capsid protein sequences in step (a) and repeating the above steps (a)-(c) one or more times to produce another one or more AAV vectors; (e) mixing the one AAV vector obtained in step (c) with the another one or more AAV vectors obtained in step (d) to produce the AAV vector composition.

[0026] In a seventeenth aspect, the present disclosure provides a method for producing the chimeric AAV vector disclosed in the present disclosure, the method comprising the following steps: (a) mixing and reacting a plasmid containing the smn1 gene and the AAV ITR element, a helper plasmid expressing an adenovirus element, and a plasmid containing two or more desired capsid protein sequences and an AAV Rep gene sequence; (b) transfecting a host cell with the reactant obtained from step (a); and (c) lysing the transfected host cell to release the AAV chimeric vector.

[0027] In an eighteenth aspect, the present disclosure provides a method for producing the AAV vector disclosed herein, comprising the following steps: (a) mixing and reacting a plasmid comprising the smn1 gene and the AAV ITR element, a helper plasmid expressing an adenovirus element, and a plasmid containing a desired capsid protein sequence and an AAV Rep gene sequence; (b) transfecting host cells with the reactant obtained from step (a); and (c) lysing the transfected host cells to release the AAV chimeric vector. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1. Schematic diagram of the design of the cceAAV vector (AAV-N0099) expressing the human smn1 gene.

[0029] Figure 2. Plasmid map of pRep-Cap9.

[0030] Figure 3. Plasmid map of pRep-Cap8.

[0031] Figure 4. Plasmid map of pRep-Cap1.

[0032] Figure 5. Plasmid map of pAd DeltaF6.

[0033] Figure 6. Survival rate of SMA mice after administration of AAV9-N0099 in the untreated control group, IV group, ICV group, and IV+ICV group in Example 3.1.

[0034] Figure 7. Body weight changes of SMA mice in the untreated control, Het, IV, ICV, and IV+ICV groups after administration of AAV9-N0099 in Example 3.1. Het mice are heterozygous (smn2+ / +; SMN△7+ / +; Smn+ / -) and do not show disease.

[0035] Figure 8. Schematic diagram of the mouse righting reflex experiment.

[0036] Figure 9. Survival rate of SMA mice after administration of the untreated control group, the IV or ICV single-route injection of AAV9-N0099 group, the IV and ICV multiple-route injection of AAV9-N0099 or the mixed vector group of AAV9-N0099 and AAV1-N0099, and the IV and ICV multiple-route injection of AAV8-N0099 or the mixed vector group of AAV9-N0099 and AAV1-N0099 in Example 3.2.

[0037] Figure 10. Changes in body weight of SMA mice after administration of the untreated control group, IV or ICV single-route injection of AAV9-N0099 group, IV and ICV multiple-route injection of AAV9-N0099 or AAV9-N0099, AAV1-N0099 mixed vector group, and IV and ICV multiple-route injection of AAV8-N0099 or AAV9-N0099, AAV1-N0099 mixed vector group in Example 3.2.

[0038] Figure 11. Changes in behavioral ability (righting time) of SMA mice after administration of the untreated control group, the IV or ICV single-route injection of AAV9-N0099 group, the IV and ICV multiple-route injection of AAV9-N0099 or the mixed vector group of AAV9-N0099 and AAV1-N0099, and the IV and ICV multiple-route injection of AAV8-N0099 or the mixed vector group of AAV9-N0099 and AAV1-N0099 in Example 3.2.

[0039] Figure 12. Survival rate of SMA mice after administration of the untreated control group, the AAV9-N0099 group injected with IV or ICV single route, the AAV9-N0099 or AAV9+1-N0099 chimeric vector injected with IV and ICV multiple routes, and the AAV8-N0099 or AAV9+1-N0099 chimeric vector group injected with IV and ICV multiple routes in Example 3.3.

[0040] Figure 13. Body weight changes of SMA mice after administration of the untreated control group, the AAV9-N0099 group injected with IV or ICV single route, the AAV9-N0099 or AAV9+1-N0099 chimeric vector injected with IV and ICV multiple routes, and the AAV8-N0099 or AAV9+1-N0099 chimeric vector group injected with IV and ICV multiple routes in Example 3.3.

[0041] Figure 14. Changes in behavioral ability of SMA mice after administration of the untreated control group, the AAV9-N0099 group injected with IV or ICV single route, the AAV9-N0099 or AAV9+1-N0099 chimeric vector injected with IV and ICV multiple routes, and the AAV8-N0099 or AAV9+1-N0099 chimeric vector group injected with IV and ICV multiple routes in Example 3.3.

[0042] Figure 15. Schematic diagram of the design of the cceAAV vector (AAV-N00241) for tissue-specific expression of the human smn1 gene.

[0043] Figure 16. Human SMN1 protein expression levels in N2a cells mediated by different SMN1 expression cassettes from Example 4.2. 1 represents plasmid N00238, 2 represents plasmid N00239, 3 represents plasmid N00240, 4 represents plasmid N00241, 5 represents plasmid N00242, 6 represents plasmid N00243, and 7 represents plasmid N0099. M represents a protein molecular weight marker. The 35 kD band indicates human SMN1 protein, and the 50 kD band indicates mouse β-tubulin protein.

[0044] Figure 17. Survival rate of SMA mice in the untreated control group, IV group, ICV group, and IV+ICV group after administration of AAV9-N00241 in Example 5.1.

[0045] Figure 18 shows the changes in body weight of SMA mice in the untreated control group, IV group, ICV group, and IV+ICV group after administration of AAV9-N00241 in Example 5.1.

[0046] Figure 19. Changes in behavioral ability (righting time) of SMA mice in the untreated control group, IV group, ICV group, and IV+ICV group after administration of AAV9-N00241 in Example 5.1.

[0047] FIG20 . Survival rates of SMA mice in the untreated control group, IV (AAV9-N0099) group, and IV (AAV9-N00241) group after administration in Example 5.2.

[0048] Figure 21. Body weight changes of SMA mice in the untreated control group, IV (AAV9-N0099) group, and IV (AAV9-N00241) group after administration in Example 5.2. DETAILED DESCRIPTION

[0049] Unless otherwise indicated, all numbers used in this specification and claims to represent content, concentration, ratio, mass, volume, time, temperature, thickness, technical effect, etc. should be understood as being modified by the term "about" or "approximately" in any case. Therefore, unless otherwise indicated, the numerical parameters listed in the following specification and the appended claims are approximate values. For those skilled in the art, it can vary according to the desired properties and effects sought to be obtained through this disclosure, and each numerical parameter should be interpreted according to the number of significant digits and conventional rounding methods or in a manner understood by those skilled in the art.

[0050] Although the numerical ranges and parameters setting forth the broad scope of the present disclosure are approximations, the numerical values ​​set forth in the specific examples are provided as precisely as possible. However, any numerical value inherently contains certain errors necessarily resulting from the standard deviation found in its respective testing measurements. Every numerical range given herein will include every narrower numerical range that falls within that broader numerical range, as if each narrower numerical range were expressly written herein.

[0051] As used herein, the expression "A and / or B" includes three cases: (1) A; (2) B; and (3) A and B. The expression "A, B, and / or C" includes seven cases: (1) A; (2) B; (3) C; (4) A and B; (5) A and C; (6) B and C; and (7) A, B, and C. The meanings of similar expressions can be deduced analogously.

[0052] When used in this document, "include", "comprising", "containing" and "having" can be used interchangeably, which all mean that in addition to the elements explicitly listed, there may be other elements, which are open expressions.

[0053] As used in this specification and the appended claims, the terms "a," "an," and "the" are not used in conjunction with quantifiers and the singular forms "a," "an," and "the" include both singular and plural referents unless the context clearly dictates otherwise.

[0054] As used herein, the terms "independently," "independently of each other," and "mutually independent" mean that multiple events do not affect each other. For example, "X and Y are independently selected from any of a, b, c, d, e, f, and g" means that X can be any of a, b, c, d, e, f, and g, and Y can be any of a, b, c, d, e, f, and g. The choice of X and the choice of Y can be the same or different, and the two do not interfere with each other.

[0055] definition

[0056] "Gene transfer" or "gene delivery" refers to a method or system for inserting foreign DNA into a host cell. Gene transfer or delivery can result in transient expression of the non-integrated transferred DNA, extrachromosomal replication and expression of the transferred or delivered replicons (e.g., episomes), or integration of the transferred or delivered genetic material into the genomic DNA of the host cell.

[0057] As used herein, "vector" refers to any genetic element, such as a plasmid, phage, transposon, cosmid, chromosome, artificial chromosome, virus, virion, etc., which is capable of replication when associated with appropriate control elements and which is capable of transferring gene sequences between cells. Thus, the term includes cloning and expression vectors, as well as viral vectors.

[0058] As used herein, "plasmid" refers to a small, circular DNA molecule. Plasmids are physically separate from chromosomal DNA and replicate independently. They typically carry a small number of genes, such as those associated with antibiotic resistance, and can be passed from cell to cell. Recombinant DNA methods can be used to splice a plasmid with a gene of interest (e.g., the smn1 gene) into the plasmid. When the plasmid replicates itself, it also replicates the inserted gene.

[0059] As used herein, an "expression cassette" or "expression cassette" is a component of vector DNA that consists of a gene and regulatory sequences to be expressed in a transfected or transduced cell. Generally, an expression cassette can consist of one or more genes and regulatory sequences that control their expression. With the use of appropriate regulatory sequences, different expression cassettes can express the gene sequences contained therein in different biological species, including but not limited to bacteria, yeast, plants, and mammalian cells.

[0060] As used herein, the term "AAV serotype" refers to any capsid that packages an AAV genome. It includes, but is not limited to, any AAV serotype capsid found in nature or any engineered or modified (e.g., biologically or chemically modified) capsid that can package an AAV genome. AAV serotype capsid proteins can be selected from natural serotype capsid proteins, mutants thereof, modified capsid proteins, and full-length or fragment combinations of two or more capsid protein amino acid sequences. Specific examples of AAV serotypes include, but are not limited to, AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV9.47, AAV9 (hu14), AAV10, AAV11, AAV12, AAVrh8, AAVrh10, AAVDJ, and AAVretro. Capsid proteins with tropism for peripheral tissues include, but are not limited to, AAV1, AAV2, AAV4, AAV5, AAV6, AAV7, AAV8, and AAV9. Capsid proteins with neural tissue tropism include, but are not limited to, AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV8, AAV9, AAVrh10, AAVDJ, and AAVretro.

[0061] As used herein, the term "covalently blocked end AAV (cceAAV)" refers to a linear AAV genome packaged into an AAV capsid, the AAV genome comprising self-complementary DNA sequences forming a pair of hairpin structures at the 5' and 3' ends, a double-stranded domain between the 5' and 3' ends (referred to herein as the "DS domain"), and SS-CCE ends. The DS domain is composed of self-complementary sequences that anneal to each other in the genomic DNA. The SS-CCE end contains a non-complementary sequence comprising a closed single-stranded region connecting the annealed portion in the DS domain. "Covalently blocked end domain," "cce domain," "single-stranded covalently blocked end domain," and "SS-CCE domain" are used interchangeably.

[0062] As used herein, the term "self-complementary AAV (cceAAV)" refers to a single-stranded AAV vector containing a double-stranded region that is generated by the lack of a terminal splitting site (TR) in one of the ITRs of AAV, wherein the lack of a TR prevents replication from initiating at the end of the vector where the TR is not present. ScAAV vectors typically contain a wild-type (wt) AAV TR at each end and a mutant TR (mTR) in the middle, which is connected to the AAV TR by a double-stranded region. The difference between cceAAV and self-complementary AAV (scAAV) is that cceAAV can be defined more broadly in a manner that does not require a mutant TR (mTR). ScAAV represents a species within the larger cceAAV genus described herein that has unique cce ends in the form of mutant ITRs (mITRs) or shDNA sequences.

[0063] The terms "short hairpin DNA" and "shDNA" are used interchangeably herein to refer to shDNA as described in US2018 / 0298380.

[0064] As used herein, the term "AAV inverted terminal repeats (ITRs)" refers to the inverted terminal repeats flanking the AAV genome, which are regions recognized in the art found at each end of the AAV genome. These regions act together in cis as the origin of DNA replication and the packaging signal for the viral genome. Its function is to support the replication, encapsidation, rescue, integration, etc. of AAV. AAV ITRs can include ITRs from any parvovirus or any parvovirus serotype, and can also include ITRs with mutations that support AAV replication, encapsidation, rescue and / or integration similar to wild-type ITRs. Together with the AAV rep coding region, the AAV ITRs provide for efficient excision and rescue of the nucleotide sequence inserted between the two flanking ITRs, as well as their integration into the mammalian cell genome.

[0065] "AAV rep coding region" refers to the art-recognized region of the AAV genome that encodes viral replication proteins, which are necessary for replicating the viral genome and inserting the viral genome into the host genome during latent infection. The term also includes its functional homologs, such as the human herpesvirus 6 (HHV-6) rep gene, which is also known to mediate AAV-2 DNA replication (Thomson et al. (1994) Virology, 204, 304-311). For further description of the AAV rep coding region, see, for example, Muzyczka, N. (1992) Current Topics in Microbioland Immunol., 158, 97-129; Kotin, RM (1994) Human Gene Therapy, 5, 793-801. As used herein, the rep coding region can be derived from any viral serotype, such as the AAV serotypes mentioned above. The region does not necessarily include all wild-type genes, but may be altered, for example, by insertion, deletion or substitution of nucleotides, as long as the rep genes present provide sufficient integration function when expressed in appropriate recipient cells.

[0066] "Functional homologs" or "functional equivalents" of a given adenoviral nucleotide region include similar regions derived from a heterologous adenoviral serotype, nucleotide regions derived from another viral or cellular source, and recombinantly produced or chemically synthesized polynucleotides that function in a manner similar to the reference nucleotide region to achieve a desired result.

[0067] "AAV cap coding region" refers to a region of the AAV genome recognized in the art that encodes the viral coat protein required for packaging the viral genome. For further description of the cap coding region, see, for example, Muzyczka, N. (1992) Current Topics in Microbiol, and Immunol., 158, 97-129; Kotin, RM (1994) Human Gene Therapy, 5, 793-801. As used herein, the AAV cap coding region can be derived from any AAV serotype as described above. The region (domain) does not have to include all wild-type cap genes, but can be altered, for example, by insertion, deletion or substitution of nucleotides, as long as the gene can provide sufficient packaging function when present in the host cell together with the AAV vector.

[0068] "AAV vector" refers to a vector derived from an adeno-associated virus serotype, including but not limited to AAV-1, AAV-2, AAV-3, AAV-4, AAV-5, AAV-6, AAV-7, AAV-9, AAV-10, AAV-11, AAV-12 and AAV-13. The AAV vector may have one or more AAV wild-type genes that are completely or partially deleted, preferably the rep and / or cap genes, but retain functional flanking ITR sequences. Functional ITR sequences are necessary for the rescue, replication and packaging of AAV virions. Therefore, AAV vectors are defined herein as comprising at least those cis sequences (e.g., functional ITRs) required for viral replication and packaging. ITRs do not have to be wild-type nucleotide sequences and can be altered, for example, by insertion, deletion or substitution of nucleotides, as long as the sequence provides functional rescue, replication and packaging.

[0069] The term "AAV helper construct" or "AAV helper plasmid" generally refers to a nucleic acid molecule that includes a nucleotide sequence that provides the AAV functions deleted from the AAV vector, and the AAV vector is used to generate a transduction vector to deliver the nucleotide sequence of interest. AAV helper constructs, such as AAV helper plasmids, are typically used to provide transient expression of the AAV rep and / or cap genes to supplement the missing AAV functions necessary for lytic AAV replication; however, the helper construct lacks the AAV ITRs and can neither replicate nor package itself. The AAV helper construct can be in the form of a plasmid, phage, transposon, cosmid, virus or virion. Many AAV helper constructs have been described, such as the commonly used plasmids pAAV / Ad and pIM29+45, which encode both Rep and Cap expression products. See, for example, Samulski et al. (1989) J. Virology, 63, 3822-3828; McCarty et al. (1991) J. Virology, 65, 2936-2945. Many other vectors encoding Rep and / or Cap expression products have been described. See, for example, U.S. Patent No. 5,139,941.

[0070] The term "transfection" is used to refer to the uptake of foreign DNA into a cell. When exogenous DNA is introduced into the interior of the cell membrane, the cell has been "transfected". Many transfection techniques are well known in the art. See, for example, Graham et al. (1973) Virology, 52, 456; Sambrook et al. (1989) Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratories, New York; Davis et al. (1986) Basic Methods in Molecular Biology, Elsevier; Chu et al. (1981) Gene, 13, 197. Such techniques can be used to introduce one or more exogenous DNA moieties, such as nucleotide integration vectors and other nucleic acid molecules, into a suitable host cell. The term encompasses chemical, electrical, and viral-mediated transfection procedures.

[0071] The term "host cell" refers to, for example, microorganisms, yeast cells, insect cells, and mammalian cells that can or have been used as recipients of AAV helper constructs, AAV vector plasmids, accessory function vectors, or other transfer DNAs. The term includes the progeny of the original cell that has been transfected. Thus, "host cell" as used herein generally refers to a cell that has been transfected with an exogenous DNA sequence. It will be understood that the progeny of a single parent cell may not necessarily be identical to the original parent in morphology or in terms of genome or total DNA complement sequence due to natural, accidental, or deliberate mutations.

[0072] The term "promoter region" is used herein in its general sense to refer to a DNA regulatory sequence to which RNA polymerase binds to initiate transcription of a downstream (3' direction) coding sequence.

[0073] A "coding sequence" or a sequence that "encodes" a particular protein is a nucleic acid sequence that is transcribed (in the case of DNA) and translated (in the case of mRNA) into a polypeptide in vitro or in vivo when placed under the control of appropriate regulatory sequences. The boundaries of the coding sequence are determined by a start codon at the 5' (amino) terminus and a translation stop codon at the 3' (carboxyl) terminus. Coding sequences can include, but are not limited to, cDNA from prokaryotic or eukaryotic mRNA, genomic DNA sequences from prokaryotic or eukaryotic DNA, and even synthetic DNA sequences.

[0074] AAV vector composition

[0075] The present disclosure provides an AAV vector composition comprising two or more AAV vectors for delivering the smn1 gene. In some embodiments, the AAV vector in the above-mentioned AAV vector composition comprises an expression cassette containing the smn1 gene, wherein the expression cassette comprises a promoter, hsmn1 cDNA and a tail signal. In some preferred embodiments, the AAV vector further comprises an ITR sequence 。 In some preferred embodiments, the AAV vectors are each independently a complemented AAV, such as scAAV or cceAAV, or a single-stranded AAV, such as ssAAV.

[0076] In some embodiments, the AAV vector composition provided by the present disclosure comprises a first AAV vector and a second AAV vector, wherein the capsid proteins of the first and second AAV vectors are different; the promoters contained in the first and second AAV vectors may be the same or different, for example, the promoters contained in the first and second AAV vectors may both be tissue-specific expression promoters (such as Syn promoter), both be constitutive expression promoters (such as CAG promoter), or one may be a tissue-specific expression promoter and the other a constitutive expression promoter; the tail signals of the first AAV vector and the second AAV vector may be the same or different.

[0077] In some embodiments, the promoter is selected from the following: promoters shown in SEQ ID NO: 1, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, and SEQ ID NO: 11.

[0078] In some embodiments, the present disclosure provides an AAV vector composition comprising a first AAV vector and a second AAV vector, wherein the first and second AAV vectors comprise an expression cassette comprising the smn1 gene, and the first and second AAV vectors respectively have capsid proteins of different serotypes.

[0079] The first and second AAV vectors each independently have a capsid protein selected from the following: a natural serotype capsid protein, a mutant thereof, a modified capsid protein, or a full-length or fragment combination of two or more capsid protein amino acid sequences. In some embodiments, the first AAV vector has a capsid protein selected from a peripheral tissue tropism, such as AAV1 or AAV9; the second AAV vector has a capsid protein selected from a neural tissue tropism, such as AAV1 or AAV9. In some embodiments, the capsid protein sequences of AAV9 and AAV1 used are shown in SEQ ID NO: 5 and SEQ ID NO: 7, respectively.

[0080] In some embodiments, the AAV vector composition provided by the present disclosure comprises a first AAV vector and a second AAV vector, wherein the first and second AAV vectors comprise an expression cassette containing the smn1 gene, and the first and second AAV vectors respectively have capsid proteins of different serotypes, for example, the first AAV vector has a capsid protein of AAV1 or AAV9, and the second AAV vector has a capsid protein of AAV1 or AAV9.

[0081] In some embodiments, the present disclosure provides an AAV vector composition comprising AAV1-N0099 and AAV9-N0099.

[0082] In some embodiments, the present disclosure provides natural serotype capsid proteins, mutants thereof, modified capsid proteins, or full-length or fragment combinations of two or more capsid protein amino acid sequences, including but not limited to AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV9.47, AAV9 (hu14), AAV10, AAV11, AAV12, AAVrh8, AAVrh10, AAVDJ, and AAVretro. Capsid proteins with tropism for peripheral tissues include but are not limited to AAV1, AAV2, AAV4, AAV5, AAV6, AAV7, AAV8, and AAV9; capsid proteins with tropism for neural tissues include but are not limited to AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV8, AAV9, AAVrh10, AAVDJ, and AAVretro.

[0083] In some embodiments, the AAV vector composition provided by the present disclosure comprises a first AAV vector and a second AAV vector, wherein the first AAV vector and the second AAV vector comprise different promoters controlling the smn1 gene, for example, the first AAV vector comprises an expression cassette comprising the smn1 gene controlled by a constitutive expression promoter, and the second AAV vector comprises an expression cassette comprising the smn1 gene controlled by a tissue-specific expression promoter.

[0084] In some embodiments, the AAV vector composition provided by the present disclosure comprises a first AAV vector and a second AAV vector, wherein the first and second AAV vectors comprise an expression cassette containing the smn1 gene, the first and second AAV vectors respectively have capsid proteins of different serotypes, and the first and second AAV vectors comprise different promoters for controlling the smn1 gene, for example, the first AAV vector comprises an expression cassette containing the smn1 gene controlled by a constitutive expression promoter, and the second AAV vector comprises an expression cassette containing the smn1 gene controlled by a tissue-specific expression promoter.

[0085] In some embodiments, the AAV vector composition provided by the present disclosure comprises a first AAV vector and a second AAV vector, wherein the first AAV vector and the second AAV vector comprise the same promoter controlling the smn1 gene, for example, both may be CAG promoter or Syn promoter.

[0086] In some embodiments, the present disclosure provides an AAV vector composition comprising a first AAV vector and a second AAV vector, wherein the first and second AAV vectors comprise an expression cassette containing a promoter, hsmn1 cDNA, and a tail signal, and the promoter optionally comprises an enhancer. In some embodiments, the promoter is a CAG promoter. The CAG promoter comprises a CMV enhancer, the chicken beta-actin gene promoter, the rabbit beta-globin gene RNA splice site, and the SV40 late 16S intron. In some embodiments, the promoter is a CAG promoter having the sequence set forth in SEQ ID NO:1. In some embodiments, the promoter is a Syn promoter. The Syn promoter comprises a CMV enhancer, a regulatory sequence upstream of the human smn1 gene transcription start site, and the SV40 late 16S intron. In some embodiments, the promoter is a Syn promoter having the sequence set forth in SEQ ID NO:8. In some embodiments, the promoter is selected from the group consisting of the promoters set forth in SEQ ID NO:1, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, and SEQ ID NO:11. In some embodiments, the first AAV vector comprises an expression cassette comprising a constitutive expression promoter, hsmn1 cDNA, and a tail signal, and the second AAV vector comprises an expression cassette comprising a tissue-specific expression promoter, hsmn1 cDNA, and a tail signal. In some embodiments, the first AAV vector comprises an expression cassette comprising a constitutive expression promoter, hsmn1 cDNA, and a tail signal, and the second AAV vector comprises an expression cassette comprising a tissue-specific expression promoter, hsmn1 cDNA, and a tail signal, and the first and second AAV vectors have different capsid types, for example, the capsid of the first AAV vector is selected from a capsid protein tropic to peripheral tissues, and the capsid protein of the second AAV vector is selected from a capsid protein tropic to neural tissues.

[0087] In some embodiments, the constitutive expression promoters provided herein include, but are not limited to, the β-actin promoter, the cytomegalovirus (CMV) promoter, the RSV promoter, the EF1α promoter, the chicken β-actin promoter, the CAG promoter, and the CBA promoter, preferably the CAG promoter; tissue-specific expression promoters include, but are not limited to, the hSyn (human synapsin) promoter, the Syn (synthetic) promoter, the CaMKIIa promoter, the Slc32a1 promoter, the mecp2 promoter, and the GFAP promoter, preferably the Syn promoter. In some embodiments, the CAG promoter is as shown in SEQ ID NO: 1. In some embodiments, the Syn promoter is as shown in SEQ ID NO: 8.

[0088] In some embodiments, the hsmn1 cDNA provided herein comprises an open reading frame sequence of the human smn1 gene; the tail signal includes, but is not limited to, the bovine growth hormone (bGH) polyadenylation signal, simian vacuolating virus 40 (SV40) early polyA, simian vacuolating virus 40 (SV40) late polyA, rabbit globulin polyA, and HSV TK polyA, preferably the bGH polyadenylation signal. In some embodiments, hsmn1 is set forth in SEQ ID NO: 2, SEQ ID NO: 12, or SEQ ID NO: 13, preferably SEQ ID NO: 2. In some embodiments, the bGH polyadenylation signal is set forth in SEQ ID NO: 3.

[0089] In some embodiments, the AAV vector compositions provided herein include an AAV vector comprising an ITR and an expression cassette containing a promoter, hsmn1 cDNA, and a tail signal. In some embodiments, the AAV vector delivery cassette for the smn1 gene comprises ITR sequences at both ends. In some embodiments, the specific ITR used is as shown in SEQ ID NO: 4.

[0090] In some embodiments, the AAV vectors included in the AAV vector compositions provided herein are each independently complementary AAV, such as self-complementary AAV (scAAV) or covalently closed-ended AAV (cceAAV), or single-stranded AAV, such as ssAAV (single-stranded AAV). In some preferred embodiments, the AAV vectors included in the AAV vector compositions provided herein are cceAAV.

[0091] Chimeric AAV vectors

[0092] The present disclosure provides a chimeric AAV vector for delivering the smn1 gene, whose capsid is composed of two or more capsid proteins. In some embodiments, the chimeric AAV vector comprises an expression cassette containing the smn1 gene, wherein the expression cassette comprises a promoter, an hsmn1 cDNA, and a tail signal. In some preferred embodiments, the chimeric AAV vector further comprises an ITR sequence. In some preferred embodiments, the chimeric AAV vector is a complementary AAV, such as scAAV or cceAAV, or a single-stranded AAV, such as ssAAV.

[0093] In some embodiments, the chimeric AAV vector provided by the present disclosure comprises an expression cassette containing the smn1 gene, and its capsid is composed of two or more capsid proteins selected from the following: a natural serotype capsid protein, a mutant thereof, a modified capsid protein, or a full-length or fragment combination of two or more capsid protein amino acid sequences. In some embodiments, the capsid is composed of a capsid protein tropic for peripheral tissues and a capsid protein tropic for neural tissues. In some embodiments, the capsid is composed of AAV9 and AAV1 capsids as AAV9+1 or AAV1+9 capsids, and the specific corresponding chimeric AAV vector may be AAV9+1-N0099. In some embodiments, the capsid protein sequence of AAV9 is shown in SEQ ID NO:5. In some embodiments, the capsid protein sequence of AAV1 is shown in SEQ ID NO:7.

[0094] As used herein, "AAV a+b" and "AAV b+a" are used interchangeably, both meaning that the capsid protein of the AAV vector is composed of AAV a and AAV b capsid proteins. For example, "AAV1+9" and "AAV9+1" are used interchangeably, both meaning that the capsid protein of the AAV vector is composed of AAV1 and AAV9 capsid proteins.

[0095] In some embodiments, the present disclosure provides natural serotype capsid proteins, mutants thereof, modified capsid proteins, or full-length or fragment combinations of two or more capsid protein amino acid sequences, including but not limited to AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV9.47, AAV9 (hu14), AAV10, AAV11, AAV12, AAVrh8, AAVrh10, AAVDJ, and AAVretro; peripheral tissue-tropic capsid proteins include but are not limited to AAV1, AAV2, AAV4, AAV5, AAV6, AAV7, AAV8, and AAV9. Neural tissue-tropic capsid proteins include but are not limited to AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV8, AAV9, AAVrh10, AAVDJ, and AAVretro.

[0096] In some embodiments, the chimeric AAV vectors provided herein comprise an expression cassette containing the smn1 gene, the expression cassette comprising a promoter, an hsmn1 cDNA, and a tail signal, wherein the promoter optionally comprises an enhancer. In some preferred embodiments, the promoter is a CAG promoter. In a more preferred embodiment, the promoter is a Syn promoter. In some embodiments, the promoter is selected from the group consisting of the promoters set forth in SEQ ID NO: 1, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, and SEQ ID NO: 11.

[0097] In some embodiments, the present disclosure provides chimeric AAV vectors comprising an expression cassette containing an smn1 gene and ITR sequences. The expression cassette comprises a promoter, preferably a CAG promoter, more preferably a Syn promoter, an hsmn1 cDNA, and a tail signal, preferably a bovine growth hormone polyadenylation signal. In some embodiments, the chimeric AAV vector comprises an expression cassette containing an smn1 gene, the expression cassette comprising ITR sequences at both ends. In some embodiments, the CAG promoter is as set forth in SEQ ID NO: 1. In some embodiments, hsmn1 is as set forth in SEQ ID NO: 2, SEQ ID NO: 12, or SEQ ID NO: 13, preferably as set forth in SEQ ID NO: 2. In some embodiments, the bovine growth hormone polyadenylation signal is as set forth in SEQ ID NO: 3. In some embodiments, the ITRs are as set forth in SEQ ID NO: 4. In some embodiments, the Syn promoter is as set forth in SEQ ID NO: 8.

[0098] In some embodiments, the AAV vector included in the chimeric AAV vector provided by the present disclosure is a complementary AAV, such as scAAV or cceAAV, or a single-stranded AAV, such as ssAAV. In some preferred embodiments, the chimeric AAV vector provided by the present disclosure is cceAAV.

[0099] AAV vectors

[0100] The present disclosure provides an AAV vector for delivering the smn1 gene, which comprises an expression cassette containing a promoter, hsmn1 cDNA and a tail signal. In some preferred embodiments, the AAV vector further comprises an ITR sequence. In some preferred embodiments, the AAV vector is a complementary AAV, such as scAAV or cceAAV, or a single-stranded AAV, such as ssAAV. In some preferred embodiments, the promoter contained in the AAV vector is a Syn promoter. In some preferred embodiments, the Syn promoter comprises a CMV enhancer, a regulatory sequence upstream of the transcription start site of the human smn1 gene, and an SV40 late 16s intron. In a more preferred embodiment, the Syn promoter is shown in SEQ ID NO: 8.

[0101] In some embodiments, the hsmn1 cDNA contained in the above-mentioned AAV vector for delivering the smn1 gene provided herein comprises the open reading frame sequence of the human smn1 gene, and hsmn1 is shown in SEQ ID NO: 2, SEQ ID NO: 12 or SEQ ID NO: 13, preferably, as shown in SEQ ID NO: 2; the tail signal contained in the AAV vector for delivering the smn1 gene is selected from the group consisting of bovine growth hormone (bGH) polyadenylation signal, simian vacuolating virus 40 (SV40) early polyA, simian vacuolating virus 40 (SV40) late polyA, rabbit globulin polyA and HSV TK polyA, preferably, the tail signal comprises a bovine growth hormone polyadenylation signal, more preferably, the tail signal is shown in SEQ ID NO: 3.

[0102] In some embodiments, the AAV vector provided by the present disclosure has a capsid protein selected from the following: a natural serotype capsid protein, a mutant thereof, a modified capsid protein, or a full-length or fragment combination of two or more capsid protein amino acid sequences.

[0103] In some embodiments, the present disclosure provides natural serotype capsid proteins, mutants thereof, modified capsid proteins, or full-length or fragment combinations of two or more capsid protein amino acid sequences, including but not limited to AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV9.47, AAV9 (hu14), AAV10, AAV11, AAV12, AAVrh8, AAVrh10, AAVDJ and AAVretro.

[0104] In some embodiments, the above-mentioned AAV vector provided by the present disclosure has AAV9, AAV1 or AAV8 capsid protein, for example, selected from AAV9-N0099, AAV1-0099, AAV8-N0099.

[0105] In some preferred embodiments, the above-mentioned AAV vector provided by the present disclosure has AAV9, AAV1 or AAV8 capsid protein, for example, selected from AAV9-N00241.

[0106] In some embodiments, the AAV vectors provided herein comprise an expression cassette containing the smn1 gene and ITR sequences. The expression cassette comprises a Syn promoter, hsmn1 cDNA, and a tail signal, preferably a bovine growth hormone polyadenylation signal. In some embodiments, the chimeric AAV vector comprises an expression cassette containing the smn1 gene, the expression cassette comprising ITR sequences at both ends. In some embodiments, the Syn promoter is as set forth in SEQ ID NO:8. In some embodiments, hsmn1 is as set forth in SEQ ID NO:2, SEQ ID NO:12, or SEQ ID NO:13, preferably as set forth in SEQ ID NO:2. In some embodiments, the bovine growth hormone polyadenylation signal is as set forth in SEQ ID NO:3. In some embodiments, the ITRs are as set forth in SEQ ID NO:4.

[0107] In some embodiments, the above-mentioned AAV vector provided by the present disclosure is a complementary AAV, such as scAAV or cceAAV, or a single-stranded AAV, such as ssAAV. In some preferred embodiments, the chimeric AAV vector provided by the present disclosure is cceAAV.

[0108] Tissue-specific promoter

[0109] The present disclosure provides a tissue-specific expression promoter, the Syn (Synthetic) promoter, for use in expressing the human smn1 gene. In some preferred embodiments, the Syn promoter comprises a CMV enhancer, a regulatory sequence upstream of the human smn1 gene transcription start site, and the SV40 late 16s intron. In a more preferred embodiment, the Syn promoter is as shown in SEQ ID NO: 8.

[0110] In some embodiments, the Syn promoter provided herein is used in an smn1 expression cassette, which comprises the Syn promoter, h smn1 cDNA, and a tail signal.

[0111] In some embodiments, hsmn1 is represented by SEQ ID NO:2, SEQ ID NO:12, or SEQ ID NO:13.

[0112] In some preferred embodiments, hsmn1 is as shown in SEQ ID NO:2.

[0113] In some preferred embodiments, the tail signal is selected from the group consisting of bovine growth hormone (bGH) polyadenosine signal, simian vacuolating virus 40 (SV40) early polyA, simian vacuolating virus 40 (SV40) late polyA, rabbit globulin polyA and HSV TK polyA. Preferably, the tail signal comprises a bovine growth hormone polyadenosine signal. More preferably, the tail signal is as shown in SEQ ID NO: 3.

[0114] In some embodiments, the expression cassette comprising the Syn promoter for expressing the human smn1 gene provided herein is contained in an AAV vector for delivering the smn1 gene. In some preferred embodiments, the AAV vector further comprises an ITR sequence. In some preferred embodiments, the AAV vector is a complementary AAV, such as scAAV or cceAAV, or a single-stranded AAV, such as ssAAV. In some embodiments, the expression cassette for delivering the smn1 gene by the AAV vector comprises ITR sequences at both ends.

[0115] In some embodiments, the AAV vector provided by the present disclosure has a capsid protein selected from the following: a natural serotype capsid protein, a mutant thereof, a modified capsid protein, or a full-length or fragment combination of two or more capsid protein amino acid sequences.

[0116] In some embodiments, the present disclosure provides natural serotype capsid proteins, mutants thereof, modified capsid proteins, or full-length or fragment combinations of two or more capsid protein amino acid sequences, including but not limited to AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV9.47, AAV9 (hu14), AAV10, AAV11, AAV12, AAVrh8, AAVrh10, AAVDJ and AAVretro.

[0117] In some preferred embodiments, the above-mentioned AAV vector provided by the present disclosure has AAV9, AAV1 or AAV8 capsid protein.

[0118] In some embodiments, the above-mentioned AAV vector provided by the present disclosure is a complementary AAV, such as scAAV or cceAAV, or a single-stranded AAV, such as ssAAV. In some preferred embodiments, the chimeric AAV vector provided by the present disclosure is cceAAV.

[0119] smn1 expression cassette and vector

[0120] The present disclosure provides an smn1 expression cassette comprising a Syn promoter, hsmn1 cDNA, and a tail signal. In some preferred embodiments, the Syn promoter comprises a CMV enhancer, a regulatory sequence upstream of the transcription start site of the human smn1 gene, and the SV40 late 16s intron. In a more preferred embodiment, the Syn promoter is set forth in SEQ ID NO:8. In some embodiments, the hsmn1 cDNA provided herein comprises the open reading frame sequence of the human smn1 gene; the tail signal includes, but is not limited to, the bovine growth hormone (bGH) polyadenylation signal, simian vacuolating virus 40 (SV40) early polyA, simian vacuolating virus 40 (SV40) late polyA, rabbit globulin polyA, and HSV TK polyA, preferably the bovine growth hormone polyadenylation signal. In some embodiments, hsmn1 is set forth in SEQ ID NO:2, SEQ ID NO:12, or SEQ ID NO:13, preferably, SEQ ID NO:2. In some embodiments, the bovine growth hormone polyadenylation signal is represented by SEQ ID NO:3.

[0121] The present disclosure provides a vector comprising an smn1 expression cassette, wherein the smn1 expression cassette comprises a Syn promoter, an hsmn1 cDNA, and a tail signal. In some preferred embodiments, the Syn promoter comprises a CMV enhancer, a regulatory sequence upstream of the transcription start site of the human smn1 gene, and the SV40 late 16s intron. In a more preferred embodiment, the Syn promoter is as shown in SEQ ID NO:8. In some embodiments, the hsmn1 cDNA provided herein comprises the open reading frame sequence of the human smn1 gene; the tail signal includes, but is not limited to, the bovine growth hormone (bGH) polyadenylation signal, simian vacuolating virus 40 (SV40) early polyA, simian vacuolating virus 40 (SV40) late polyA, rabbit globulin polyA, and HSV TK polyA, preferably the bovine growth hormone polyadenylation signal. In some embodiments, hsmn1 is as shown in SEQ ID NO:2, SEQ ID NO:12, or SEQ ID NO:13, preferably as shown in SEQ ID NO:2. In some embodiments, the bovine growth hormone polyadenylation signal is represented by SEQ ID NO:3.

[0122] As used herein, vectors include cloning vectors, expression vectors, and the like. In some embodiments, the vectors include, but are not limited to, DNA vectors, RNA vectors, plasmids, transposon vectors, CRISPR / Cas9 vectors, and viral vectors. In some embodiments, the viral vectors include, but are not limited to, lentiviral vectors, retroviral vectors, adenoviral vectors, adeno-associated viral vectors, poxvirus vectors, and herpesvirus vectors.

[0123] host cells

[0124] The present disclosure provides a host cell contacted with an AAV vector, an AAV vector composition, a chimeric AAV vector, or a vector comprising an smn1 expression cassette disclosed herein.

[0125] In some embodiments, the host cell can be a prokaryotic cell, a fungal cell, a yeast cell or a eukaryotic cell, such as a mammalian cell. Suitable prokaryotic cells include, but are not limited to, eubacteria, such as gram-negative or gram-positive organisms, such as Enterobacteriaceae, such as Escherichia, such as Escherichia coli; Enterobacter; Erwinia; Klebsiella; Proteus; Salmonella, such as Salmonella typhimurium; Serratia, such as Serratia marcescens and Shigella; Bacillus, such as Bacillus subtilis and Bacillus licheniformis; Pseudomonas such as Pseudomonas aeruginosa; and Streptomyces. In some embodiments, the cell is a human cell. In some embodiments, the cell is an immune cell. In some embodiments, the host cell includes, for example, CHO cells, such as CHOS cells and CHO-k1 cells, or HEK293 cells, such as HEK293A, HEK293T and HEK293FS.

[0126] Pharmaceutical composition

[0127] The present disclosure provides a pharmaceutical composition comprising an AAV vector, a vector composition, a chimeric AAV vector, or a vector comprising an smn1 expression cassette disclosed herein, and a pharmaceutically acceptable carrier.

[0128] As used herein, the term "pharmaceutical composition" refers to a mixture of an AAV vector composition or chimeric AAV vector of the present disclosure and other chemical components such as carriers, stabilizers, diluents, dispersants, suspending agents, thickeners and / or excipients. The pharmaceutical composition facilitates administration of the AAV vector composition or chimeric AAV vector to a target organism. There are various techniques for administering an AAV vector composition or chimeric AAV vector in the art, including but not limited to: CNS administration, such as intrathecal injection, cerebrospinal fluid injection, intracranial injection (e.g., lateral ventricle), systemic administration routes, such as intramuscular injection, intravenous injection, subcutaneous injection, intraperitoneal injection, oral, transdermal, pulmonary, ocular and topical administration.

[0129] In the present disclosure, the pharmaceutical composition or drug can be configured into a dosage form suitable for administration to a subject via a desired route of administration. The dosage form includes, but is not limited to, tablets, capsules, caplets, pills, lozenges, powders, syrups, brews, suspensions, solutions, emulsions, transdermal patches, suppositories, inhalants, creams, ointments, lotions, pastes, sprays, lyophilized solutions, injections, and gels.

[0130] The term "pharmaceutically acceptable carrier" includes pharmaceutically acceptable materials, compositions, or vehicles, such as liquid or solid fillers, diluents, excipients, solvents, or encapsulating materials, that are involved in carrying or delivering the disclosed AAV vector compositions or chimeric AAV vectors within a subject, or to a subject, so that they can perform their intended function. Each salt or carrier must be "acceptable" in the sense of being compatible with the other ingredients of the formulation and not deleterious to the subject. Some examples of materials that can be used as pharmaceutically acceptable carriers include: sugars such as lactose, glucose, and sucrose; starches such as corn starch and potato starch; cellulose and its derivatives such as sodium carboxymethylcellulose, ethylcellulose, and cellulose acetate; powdered tragacanth; malt; gelatin; talc; excipients such as cocoa butter and suppository waxes; oils such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil, and soybean oil; glycols such as propylene glycol; polyols such as glycerol, sorbitol, mannitol, and polyethylene glycol; esters such as ethyl oleate; Esters and ethyl laurate; agar; buffers such as magnesium hydroxide and aluminum hydroxide; alginic acid; pyrogen-free water; isotonic saline; Ringer's solution; ethanol; phosphate buffered saline; diluents; granulating agents; lubricants; binders; disintegrants; wetting agents; emulsifiers; colorants; release agents; coating agents; sweeteners; flavorings; perfuming agents; preservatives; antioxidants; plasticizers; gelling agents; thickeners; hardening agents; setting agents; suspending agents; surfactants; humectants; carriers; stabilizers; and other nontoxic, compatible substances used in pharmaceutical formulations, or any combination thereof.

[0131] Medical uses

[0132] The present disclosure provides the use of the AAV vectors, vector compositions, chimeric AAV vectors, vectors containing smn1 expression cassettes, or pharmaceutical compositions disclosed herein for the preparation of a medicament for treating or preventing SMN deficiency-related diseases. In some embodiments, the medicament is used in the following method: administering one or more AAV vectors that deliver the smn1 gene, or chimeric AAV vectors that deliver the smn1 gene, to a subject in need thereof simultaneously or sequentially through two or more administration routes, each administration route being independent of each other. In some embodiments, the above-mentioned multiple AAV vectors that deliver the smn1 gene are selected from the AAV vector compositions disclosed in the present disclosure, such as a composition of AAV1-N0099 and AAV9-N0099; the chimeric AAV vector that delivers the smn1 gene is selected from the chimeric AAV vectors disclosed in the present disclosure, such as AAV9+1-N0099. In some embodiments, the above-mentioned AAV vector for delivering the smn1 gene may be any AAV vector for delivering the smn1 gene, such as AAV1-N0099, AAV8-N0099, AAV9-N0099, and AAV9-N00241. In some embodiments, the above-mentioned AAV vector for delivering the smn1 gene may be any AAV vector for delivering the smn1 gene, such as the AAV vector for delivering the smn1 gene provided by the present disclosure comprising a Syn promoter for expressing the human smn1 gene, such as AAV9-N00241.

[0133] The present disclosure provides the AAV vectors, vector compositions, chimeric AAV vectors, vectors comprising an smn1 expression cassette, or pharmaceutical compositions disclosed herein, for use in treating or preventing SMN deficiency-related diseases. In some embodiments, the use is achieved in the following method: administering one or more AAV vectors for delivering the smn1 gene, or chimeric AAV vectors for delivering the smn1 gene, to a subject in need thereof simultaneously or sequentially through two or more administration routes, each administration route being independent of one another. In some embodiments, the above-mentioned multiple AAV vectors for delivering the smn1 gene are selected from the AAV vector compositions disclosed in the present disclosure, such as a composition of AAV1-N0099 and AAV9-N0099; the chimeric AAV vector for delivering the smn1 gene is selected from the chimeric AAV vectors disclosed in the present disclosure, such as AAV9+1-N0099. In some embodiments, the above-mentioned AAV vector for delivering the smn1 gene may be any AAV vector for delivering the smn1 gene, such as AAV1-N0099, AAV8-N0099, AAV9-N0099, and AAV9-N00241. In some embodiments, the above-mentioned AAV vector for delivering the smn1 gene may be any AAV vector for delivering the smn1 gene, such as the AAV vector for delivering the smn1 gene provided by the present disclosure comprising a Syn promoter for expressing the human smn1 gene, such as AAV9-N00241.

[0134] The present disclosure provides a method for expressing SMN1 protein or increasing SMN1 protein expression in a target sample in vitro or in vivo, the method comprising administering to the target sample an AAV vector composition disclosed herein, a chimeric AAV vector disclosed herein, an AAV vector disclosed herein, a vector comprising an SMN1 expression cassette disclosed herein, or a pharmaceutical composition disclosed herein.

[0135] The present disclosure provides uses of the AAV vector composition disclosed herein, the chimeric AAV vector disclosed herein, the AAV vector disclosed herein, the vector comprising an SMN1 expression cassette disclosed herein, or the pharmaceutical composition disclosed herein in the preparation of a medicament for expressing SMN1 protein or increasing SMN1 protein expression in a target sample or in a subject.

[0136] The present disclosure provides an smn1 expression cassette, an AAV vector composition disclosed herein, a chimeric AAV vector disclosed herein, an AAV vector disclosed herein, a vector comprising an smn1 expression cassette disclosed herein, or a pharmaceutical composition disclosed herein, for use in expressing SMN1 protein or increasing SMN1 protein expression in a target sample or in a subject.

[0137] The present disclosure provides a method for treating or preventing a disease associated with SMN deficiency, comprising administering to a subject in need thereof a therapeutically or prophylactically effective amount of the AAV vector, vector composition, chimeric AAV vector, vector comprising an smn1 expression cassette disclosed herein, or pharmaceutical composition disclosed herein.

[0138] In some embodiments, the method comprises administering to a subject in need thereof a therapeutically or prophylactically effective amount of one or more of the AAV vectors, vector compositions, chimeric AAV vectors, vectors comprising an smn1 expression cassette, or pharmaceutical compositions disclosed herein via an IV or ICV route. In some embodiments, the method comprises administering to a subject in need thereof one or more of AAV9-N0099, AAV1-N0099, AAV8-N0099, or AAV9-N00241 via an IV or ICV route.

[0139] The present disclosure provides a method for treating or preventing SMN deficiency-related diseases, the method comprising administering to a subject in need thereof simultaneously or sequentially through two or more administration routes, each administration route being independent of each other, one or more AAV vectors for delivering the smn1 gene, or a chimeric AAV vector for delivering the smn1 gene. In some embodiments, the above-mentioned multiple AAV vectors for delivering the smn1 gene are selected from the AAV vector compositions disclosed in the present disclosure, such as a composition of AAV1-N0099 and AAV9-N0099; the chimeric AAV vector for delivering the smn1 gene is selected from the chimeric AAV vectors disclosed in the present disclosure, such as AAV9+1-N0099. In some embodiments, the above-mentioned AAV vector for delivering the smn1 gene may be any AAV vector for delivering the smn1 gene, such as AAV1-N0099, AAV8-N0099, AAV9-N0099, AAV9-N00241. In some embodiments, the aforementioned AAV vector for delivering the smn1 gene may be any AAV vector for delivering the smn1 gene, such as the AAV vector for delivering the smn1 gene provided by the present disclosure comprising a Syn promoter for expressing the human smn1 gene, for example, AAV9-N00241.

[0140] In some embodiments, the method comprises injecting one or more AAV vectors into the subject in need via the CNS route and simultaneously or sequentially intravenously injecting an AAV vector. In a preferred embodiment, the multiple AAV vectors comprise AAV1 and AAV9 vector compositions, such as a composition of AAV1-N0099 and AAV9-N0099, or an AAV chimeric vector, preferably an AAV1+9 chimeric vector (AAV1+9 chimeric vector and AAV9+1 chimeric vector refer to the same chimeric AAV vector, i.e., a chimeric AAV vector having a capsid composed of AAV1 and AAV9 capsids), such as AAV9+1-N0099. In some preferred embodiments, the one AAV vector is selected from an AAV1 vector, an AAV9 vector or an AAV8 vector, such as AAV1-N0099, AAV8-N0099, AAV9-N0099, AAV9-N00241.

[0141] In some embodiments, the capsid protein sequence of AAV8 is shown in SEQ ID NO:6.

[0142] In some embodiments, SMN deficiency-related diseases include but are not limited to SMA.

[0143] In some embodiments, the administration route includes, but is not limited to, CNS administration routes, such as intrathecal injection, cerebrospinal fluid injection, intracranial injection (e.g., intracerebroventricular injection), systemic administration routes, such as intramuscular injection, intravenous injection, subcutaneous injection.

[0144] As used herein, "disease" refers to any change in the state of the body or some organ that interrupts or interferes with the performance of functions and / or causes symptoms (such as discomfort, dysfunction, adverse stress or even death) in the person suffering from the disease or those who come into contact with it.

[0145] As used herein, "treating" refers to alleviating or ameliorating a disease or disorder (i.e., slowing or arresting the progression of the disease or at least one clinical symptom); or alleviating or ameliorating at least one physical parameter or biomarker associated with the disease or disorder.

[0146] As used herein, "subject" includes animals, such as vertebrates, preferably mammals, such as dogs, cats, pigs, cows, sheep, horses, rodents (e.g., mice, rats, or guinea pigs), or primates (e.g., gorillas, chimpanzees, and humans).

[0147] As used herein, "therapeutically effective dose" refers to an amount that results in a benefit or treatment of a disease compared to a corresponding subject not receiving that amount, but is sufficiently low within the scope of sound medical judgment to avoid serious side effects. The therapeutically effective dose of one or more AAV vectors delivering the smn1 gene, AAV vector composition, or chimeric AAV vector or pharmaceutical composition delivering the smn1 gene described herein will vary with the selected one or more AAV vectors delivering the smn1 gene, AAV vector composition, or chimeric AAV vector or pharmaceutical composition delivering the smn1 gene; the route of administration; the severity of the disease being treated; the age, size, weight, and physical condition of the patient being treated; the medical history of the patient being treated; the duration of treatment; the nature of concurrent treatment; the desired therapeutic effect, and the like, but can still be determined in a routine manner by those skilled in the art.

[0148] As used herein, "sample" means a portion of a larger element. Preferably, a sample is a substance of biological origin. It contains cells and / or other molecular entities to be characterized and / or identified based on, for example, physical, biochemical, chemical and / or physiological characteristics. For example, it refers to any sample derived from a subject of interest that is expected or known to contain cells and / or molecular entities to be characterized. Samples include, but are not limited to, tissue samples (e.g., tumor tissue samples), primary or cultured cells or cell lines, cell supernatants, cell lysates, platelets, serum, plasma, vitreous humor, lymph fluid, synovial fluid, follicular fluid, semen, amniotic fluid, milk, whole blood, blood-derived cells, urine, cerebrospinal fluid, saliva, sputum, tears, sweat, mucus, tumor lysates, tissue culture fluids, tissue extracts such as homogenized tissue, tumor tissue, cell extracts, and combinations thereof.

[0149] AAV vectors, vector compositions, and methods for producing chimeric AAV vectors

[0150] The present disclosure provides a method for producing the AAV vector composition disclosed herein, the method comprising the steps of:

[0151] (a) mixing and reacting a plasmid containing the smn1 gene and AAV ITR elements, a helper plasmid expressing adenovirus elements, and a plasmid containing a desired capsid protein sequence and AAV Rep gene sequence;

[0152] (b) transfecting a host cell with the reactant obtained in step (a);

[0153] (c) lysing the transfected host cells to release an AAV vector;

[0154] (d) using a plasmid containing another desired capsid protein sequence in step (a) and repeating steps (a) to (c) one or more times to produce another one or more AAV vectors;

[0155] (e) mixing the one AAV vector obtained in step (c) with the one or more other AAV vectors obtained in step (d) to produce the AAV vector composition.

[0156] The present disclosure provides a method for producing the chimeric AAV vector disclosed herein, the method comprising the steps of:

[0157] (a) mixing and reacting a plasmid containing the smn1 gene and AAV ITR elements, a helper plasmid expressing adenovirus elements, and a plasmid containing two or more desired capsid protein sequences and AAV Rep gene sequences;

[0158] (b) transfecting a host cell with the reactant obtained in step (a);

[0159] (c) Lysing the transfected host cells to release the AAV chimeric vector.

[0160] The method for producing the AAV vector composition or chimeric AAV vector disclosed in the present disclosure may also be other methods commonly used in the art.

[0161] The present disclosure provides a method for producing the AAV vector disclosed herein, the method comprising the steps of:

[0162] (a) mixing and reacting a plasmid containing the smn1 gene and AAV ITR elements, a helper plasmid expressing adenovirus elements, and a plasmid containing a desired capsid protein sequence and AAV Rep gene sequence;

[0163] (b) transfecting a host cell with the reactant obtained in step (a);

[0164] (c) Lysing the transfected host cells to release the AAV chimeric vector.

[0165] Unless otherwise specified or contradicted by the context, the terms or expressions used in this article should be read in conjunction with the entire content of this article and as understood by one of ordinary skill in the art. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art.

[0166] The various embodiments and preferences disclosed above can be combined with each other (as long as they are not inherently contradictory to each other), and the various embodiments formed by such combination are all considered to be part of the disclosure of this application.

[0167] The following examples will be used to more clearly and specifically illustrate the technical solutions of the present disclosure. It should be understood that these examples are for illustrative purposes only and are in no way intended to limit the scope of protection of the present disclosure. The scope of protection of the present disclosure is defined solely by the claims.

[0168] Example

[0169] The examples described below are exemplary and are intended only to explain the present invention and are not to be construed as limiting the present invention. Where specific techniques or conditions are not specified in the examples, the methods or conditions described in the literature within the art or in the product specifications were used. Where the manufacturer of the reagents or instruments is not specified, all are commercially available conventional products.

[0170] Example 1: AAV vector design.

[0171] Figure 1 shows the schematic design of the linear closed-circle AAV (cceAAV) vector, AAV-N0099, expressing the human SMN1 gene (hsmn1). The cceAAV vector for expressing the human SMN1 gene contains the SMN1 expression cassette, which includes the CAG promoter, the human SMN1 gene (hSMN1), and polyA. The CAG promoter contains the CMV enhancer, the chicken beta-actin gene promoter, the rabbit beta-globin gene RNA splice site, and the SV40 late 16S intron. hsmn1 represents the open reading frame sequence of the human SMN1 gene. PolyA represents the bovine growth hormone polyadenylation signal. Sequence information for the relevant elements is listed in Table 1.

[0172] Table 1. Sequence information of relevant elements of the cceAAV vector expressing the human smn1 gene.

[0173] Example 2. AAV vector production.

[0174] 100 mg of the plasmid containing ITR (ITR sequence: 5'aggaacccctagtgatggagttggccactccctctgcgcgctcgctcgctcactgaggccgcccgggcaaagcccgggcgtcgggcgacctttggtcgcccggcctcagtgagcgagcgagcgcgcagagagggagtggccaa3', SEQ ID NO: 4) and the smn1 expression cassette in Example 1 was added to a 1 L reaction solution containing 100 KU TelN Protelomerase, incubated at 30° C. for 2 h, inactivated the enzyme at 75° C. for 10 min, and the linear closed circular DNA (cceDNA) containing ITR and the smn1 expression cassette in the reaction solution was purified by anion chromatography. HEK293 cells were expanded in CD05 medium to 5 L and inoculated into an Xcellerex XDR 50 disposable bioreactor containing 45 L of medium at a cell density of 0.5 × 10 6 Cells / mL, culture until the cell density reaches 2×10 6 Cells / mL, add 140L culture medium to the reactor, and when the cell density reaches 3×10 6 Cells / mL. If the AAV-smn1 vector produced consists of only one capsid protein, such as AAV9, AAV8, or AAV1, the obtained cceDNA, the helper plasmid pAd DeltaF6 expressing adenoviral elements, and the corresponding plasmids pRep-Cap9, pRep-Cap8, or pRep-Cap1 containing different capsid protein sequences were mixed with FectoVIR (PolyPlus Cat No. 101000004) at a mass-to-volume ratio of 1:1, incubated at room temperature for 15 minutes, added to the reactor, and cultured for another 3 days. If the AAV-smn1 vector produced is composed of two capsid proteins and packaged as a chimeric virus, such as the chimeric viral vector AAV1+9, the obtained cceDNA, the helper plasmid pAd DeltaF6 expressing adenoviral elements, and the plasmids pRep-Cap9, pRep-Cap1, and FectoVIR containing different capsid protein sequences are mixed in a 1:1 mass-to-volume ratio in a reaction vessel. Cell lysis buffer containing omnipotent nuclease is then added to lyse the transfected HEK293 cells to release the AAV viral vector. For information on the pRep-Cap and pAd DeltaF6 plasmids, see Figures 2-5. The relevant AAV capsid protein sequences are listed below.

[0175] AAV9 capsid protein sequence:

[0176] AAV8 capsid protein sequence:

[0177] AAV1 capsid protein sequence:

[0178] After the cell lysate is filtered through a 0.22 μm filter to remove large particles and impurities, it is concentrated by TFF and loaded onto an AAVX affinity chromatography column. The AAV vector is bound to the AAVX affinity column and washed with 5 column volumes of equilibration buffer (20 mM Tris, 0.2 M NaCl, 0.005% PF-68, pH 8.0). The AAV vector bound to the affinity column is then eluted with elution buffer (100 mM NaAc, 0.2 M NaCl, 0.005% PF-68, pH 2.5). The eluted AAV vector is further bound to an anion chromatography column and then passed through the anion chromatography column with solutions containing different concentrations of NaCl from low to high. Solid AAV vectors and hollow AAV vectors are retained from the chromatographic column with different concentrations of NaCl solutions, achieving the purification of the solid AAV vector. After obtaining the solid AAV vector, the concentration of the viral genome in the purified AAV vector is detected and quantified using digital PCR.

[0179] Example 3. Therapeutic effect of AAV expressing smn1 in SMA mouse model.

[0180] The study used triple mutant mice (FVB.Cg-Grm7Tg(smn2)89Ahmb Smn1tm1Msd Tg(smn2*delta7)4299Ahmb / J) as a model animal, namely (smn2+ / +; SMN△7+ / +; Smn- / -). They exhibit symptoms and neuropathological features similar to those of patients with proximal spinal muscular atrophy (SMA). At birth, triple homozygotes are significantly smaller than normal pups. Significant muscle weakness develops on the fifth day after birth, and symptoms gradually worsen over the following week. The mice exhibit an abnormal gait, hindlimb tremors, and a tendency to fall. The average lifespan of this strain of mice is approximately 13 days. Their symptoms are similar to the clinical manifestations of patients with the disease. Based on relevant literature reports on animal models of the disease, combined with the research objectives and feasibility. The (smn2+ / +; SMN△7+ / +; Smn- / -) genetically modified mice (Saiye (Suzhou) Biotechnology, C001348 and C001193) were selected as the model animals for spinal muscular atrophy.

[0181] 3.1 Therapeutic effects of AAV9-N0099 in SMA mouse models via different administration routes.

[0182] The AAV9 vector AAV9-N0099 expressing smn1 was generated according to the method in Example 2.

[0183] Dosing Procedure: Determine the test substance dosage for each group and procedure for temporal vein injection (IV or IV), intracerebroventricular administration (ICV or IVC), and a combination of both, convert and dilute. Negative control groups will remain untreated. Confirm the intended injection groups and target animals (1-day-old mice with homozygous genotype). Each group should contain 10-12 test animals.

[0184] If the injection group is intravenous, place the mouse pups directly on crushed ice for anesthesia; mix the preparation stock solution with an appropriate amount of preparation buffer to obtain a titer of 3×10 12 vg / ml (if it is a single route intravenous injection, the titer is 6×10 12 vg / ml) of the vector solution to be injected, and 50μl of the AAV vector solution is drawn into a microsyringe according to the group and animal weight. When the animal is fully anesthetized and meets the injection requirements, the animal is placed under the LED light on the operating table. The temporal vein is located in front of the ear bud. The bevel of the syringe needle tip is inserted into the temporal vein 2-3mm. After confirming that the bevel of the needle tip is filled with blood, the syringe is gently pushed until the temporal vein turns white. When the target volume is injected (for temporal vein injection: inject according to the dosing volume of 1g body weight / 20μl for newborn mice), the needle is kept in the vein for 10-15 seconds to prevent backflow.

[0185] If the injection group is the intracerebroventricular injection group, first place the mouse pups directly on crushed ice for anesthesia; mix the preparation stock solution with an appropriate amount of preparation buffer to obtain a titer of 8.64×10 12 vg / ml of the vector solution to be injected (if the group is a mixed injection group of two viral serotypes, the genome ratio of the viral vector per unit volume is 1:1). 30μl of AAV vector solution is aspirated into a microsyringe according to the group and animal weight. When the animal is fully anesthetized and meets the injection requirements, the animal is placed under the LED light on the operating table. The injection point for the lateral ventricle injection is confirmed (it is located 0.7mm behind the anterior bregma, 1mm from the sagittal suture, and 2mm deep). The brain injection surface is kept horizontal. Use 75% disinfection to disinfect the area to be injected. Hold the microsyringe vertically and slowly insert the needle. Slowly push the syringe plunger to complete the unilateral injection. Complete the injection on the other side at the symmetrical position of the injection point. Inject 2.5μL unilaterally for a total of 5μl. After each injection, keep the needle in the brain for 10-15 seconds and then slowly withdraw the needle to prevent backflow of the injection solution.

[0186] If combined administration is required, the procedure of first injecting the drug into the temporal vein and then the lateral ventricular injection should be used. That is, after the temporal vein administration is completed, gently touch the mouse's front or hind limb with your fingertips to confirm that the animal has reflexes. Then, place the mouse on ice to maintain anesthesia. Once the animal is fully anesthetized and meets the injection requirements, complete the above lateral ventricular injection procedure.

[0187] After the injection of the above animals was completed, the animals were placed on a micro electric blanket for recovery. After the animals' activity ability was observed to recover, the animals were placed in cages.

[0188] Survival curves and mortality data for each group were obtained using cage-side observation. All animals were cage-side observed twice daily on the day of dosing and throughout the experimental observation period. Animal survival was recorded and survival curves were plotted until the end of the experiment. The experiment ended when the last animal died.

[0189] On the day of administration and throughout the experimental observation period, the body weights of all groups of experimental animals were measured 2-3 times per week until the end of the experiment, and the body weight growth curves of the animals in each group were drawn.

[0190] The survival rate of SMA mice after administration is shown in Figure 6, which shows that simultaneous intravenous and intracerebroventricular administration of AAV9-N0099 resulted in a higher survival rate for SMA disease mice than single intravenous or intracerebroventricular administration. The survival curve of the untreated group decreased significantly within 20 days after administration; compared with the untreated group, the survival rate and survival status of animals in the intravenous (IV), intracerebroventricular (ICV), and intravenous and intracerebroventricular (IV+ICV) administration groups were significantly improved, indicating that the treatment had a positive effect on animal survival. The order of improvement of each treatment method was IV+ICV>ICV>IV>untreated group. In the IV+ICV administration group, the intravenous dose was 6×10 13 vg / kg, and in the IV administration group, the intravenous dose was 1.2×10 14 vg / kg, and the results showed that combining intravenous administration and intracerebroventricular administration could significantly reduce the dose of intravenous administration, thereby reducing the liver and heart toxicity caused by intravenous administration.

[0191] Figure 7 shows the weight changes of SMA mice after treatment, demonstrating that simultaneous intravenous and intracerebroventricular (ICV) administration of AAV9-N0099 resulted in greater weight gain in SMA mice compared to either intravenous or intracerebroventricular (ICV) administration alone. Within 7 days of treatment, all animals in the untreated group showed a gradual increase in weight. Seven days after treatment, the weight of animals in the untreated group showed a significant decrease, which persisted until day 20, when all animals in this group died. Compared to the untreated group, the intravenous (IV), intracerebroventricular (ICV), and IV+ICV (IV+ICV) groups showed significant improvements in weight gain, demonstrating a positive effect of treatment on weight change in the animals. The order of improvement among treatments was IV+ICV > ICV > IV > untreated. Het mice are heterozygous (smn2+ / +; SMN△7+ / +; Smn+ / -) mice and do not exhibit disease.

[0192] 3.2 The therapeutic effects of single-route injection of AAV9-N0099, multi-route injection of AAV9-N0099 or AAV9-N0099, AAV1-N0099 mixed vectors, and multi-route injection of AAV8-N0099 or AAV9-N0099, AAV1-N0099 mixed vectors in the SMA mouse model.

[0193] According to the method in Example 2, the AAV9 vector AAV9-N0099 expressing smn1, the AAV8 vector AAV8-N0099 expressing smn1, and the AAV1 vector AAV1-N0099 expressing smn1 were generated.

[0194] Dosing Procedure: Determine the dose of the test substance for each group for temporal vein injection, intracerebroventricular administration, and a combination of both, convert and dilute the dose. Do not treat the negative control group. Confirm the injection group and target animals (1-day-old mice with homozygous genotype). Each group should contain 10-12 test animals.

[0195] If the injection group is intravenous, place the mouse pups directly on crushed ice for anesthesia; mix the preparation stock solution with an appropriate amount of preparation buffer to obtain a titer of 3×10 12 vg / ml (if it is a single route intravenous injection, the titer is 6×10 12 vg / ml) of the vector solution to be injected. Based on the group and animal weight, 50 μl of the AAV vector solution is drawn into a microsyringe. Once the animal is fully anesthetized and meets the injection requirements, place it under the LED light on the operating table. Locate the temporal vein anterior to the ear bud. Insert the syringe needle tip 2-3 mm into the temporal vein, ensuring that the needle tip is filled with blood. Gently push the syringe until the temporal vein turns white. Once the target volume has been injected, hold the needle in the vein for 10-15 seconds to prevent backflow. Temporal vein injection is complete.

[0196] If the injection group is the intracerebroventricular injection group, first place the mouse pups directly on crushed ice for anesthesia; mix the preparation stock solution with an appropriate amount of preparation buffer to obtain a titer of 8.64×10 12vg / ml of the vector solution to be injected (if the group is a mixed injection group of two viral serotypes, the genome ratio of the viral vector per unit volume is 1:1). 30μl of AAV vector solution is aspirated into a microsyringe according to the group and animal weight. When the animal is fully anesthetized and meets the injection requirements, the animal is placed under the LED light on the operating table. The injection point for the lateral ventricle injection is confirmed (it is located 0.7mm behind the anterior bregma, 1mm from the sagittal suture, and 2mm deep). The brain injection surface is kept horizontal. Use 75% disinfection to disinfect the area to be injected. Hold the microsyringe vertically and slowly insert the needle. Slowly push the syringe plunger to complete the unilateral injection. Complete the injection on the other side at the symmetrical position of the injection point. Inject 2.5μL unilaterally for a total of 5μl. After each injection, keep the needle in the brain for 10-15 seconds and then slowly withdraw the needle to prevent backflow of the injection solution.

[0197] If combined administration is involved, the procedure is to inject into the temporal vein first and then into the lateral ventricle.

[0198] That is, after the temporal vein administration is completed, use the fingertips to touch the front or hind limbs of the mouse. When the animal has reflexes, place the mouse on ice to continue anesthesia. When the animal is fully anesthetized and meets the injection requirements, complete the above intracerebroventricular injection process.

[0199] After the injection of the above animals was completed, the animals were placed on a micro electric blanket for recovery. After the animals' activity ability was observed to recover, the animals were placed in cages.

[0200] Survival curves and mortality data were obtained through cage-side observation. All experimental animals were cage-side observed twice daily on the day of dosing and throughout the experimental observation period. Animal survival was recorded and survival curves were plotted until the end of the experiment. The experiment ended when the last experimental animal died.

[0201] On the day of administration and throughout the experimental observation period, all experimental animals were weighed 2-3 times per week until the end of the experiment, and a weight growth curve was drawn.

[0202] Behavioral ability test procedures: From the 3rd to the 13th day after birth, all experimental groups were tested for turning over reflex once every other day.

[0203] Experimental procedure: (1) Before the experiment, the toes of the young mice in each group were clipped and marked to avoid confusion between groups and numbers during the experiment. (2) During the experiment, the test animals were placed on their side on a flat experimental platform. The direction and angle of each animal should be kept consistent, and the surrounding environment should be kept relatively quiet. (3) The timer started when the animal was placed and the side-lying state met the experimental requirements. When the righting reflex was completed (i.e., the side-lying posture was adjusted to a normal walking posture), the timer ended and the duration of the righting reflex of each animal was counted. (4) The righting reflex was recorded for a maximum of 60 seconds. If it was not completed within 60 seconds, it was considered to be completed and the time was recorded (see Figure 8).

[0204] The survival rate of SMA mice after administration is shown in Figure 9, which shows that the simultaneous intravenous administration of AAV8-N0099 vector and intracerebroventricular administration of AAV9-N0099 and AAV1-N0099 mixed vectors resulted in a higher survival rate for SMA disease mice than single intravenous injection of AAV9-N0099 vector or intracerebroventricular injection of AAV9-N0099 vector.

[0205] The changes in body weight of SMA mice after administration are shown in Figure 10, which shows that the simultaneous intravenous administration of AAV8-N0099 vector and intracerebroventricular administration of AAV9-N0099 and AAV1-N0099 mixed vectors resulted in better weight gain in SMA disease mice than single intravenous injection of AAV9-N0099 vector or intracerebroventricular injection of AAV9-N0099 vector.

[0206] The changes in behavioral ability of SMA mice after drug administration are shown in Figure 11, which shows that the simultaneous intravenous administration of AAV8-N0099 vector and intracerebroventricular administration of AAV9-N0099 and AAV1-N0099 mixed vectors can better restore the behavioral ability of SMA disease mice than single intravenous injection of AAV9-N0099 vector or intracerebroventricular injection of AAV9-N0099 vector, which is manifested as an earlier recovery of righting time to the same level as that of heterozygous mice.

[0207] 3.3 Therapeutic effects of single-route injection of AAV9-N0099, multi-route injection of AAV9-N0099 or AAV9+1-N0099 chimeric vectors, and multi-route injection of AAV8-N0099 or AAV9+1-N0099 chimeric vectors in the SMA mouse model.

[0208] According to the method in Example 2, an AAV9 vector AAV9-N0099 expressing smn1, an AAV8 vector AAV8-N0099 expressing smn1, and an AAV1 chimeric vector AAV1+9-smn1 expressing smn1 were generated.

[0209] Dosing Procedure: Determine the test substance dosage for each group for tail vein injection, intracerebroventricular administration, and a combination of both, convert and dilute the dose. Do not treat the negative control group. Confirm the injection group and target animals (1-day-old mice with homozygous genotype). Each group should contain 10-12 test animals.

[0210] If the injection group is intravenous, place the mouse pups directly on crushed ice for anesthesia; mix the preparation stock solution with an appropriate amount of preparation buffer to obtain a titer of 3×10 12 vg / ml (if it is a single route intravenous injection, the titer is 6×10 12 vg / ml) of the vector solution to be injected. Based on the group and animal weight, 50 μl of the AAV vector solution is drawn into a microsyringe. Once the animal is fully anesthetized and meets the injection requirements, place it under the LED light on the operating table. Locate the temporal vein anterior to the ear bud. Insert the syringe needle tip 2-3 mm into the temporal vein, ensuring that the needle tip is filled with blood. Gently push the syringe until the temporal vein turns white. Once the target volume has been injected, hold the needle in the vein for 10-15 seconds to prevent backflow. Temporal vein injection is complete.

[0211] If the injection group is the intracerebroventricular injection group, first place the mouse pups directly on crushed ice for anesthesia; mix the preparation stock solution with an appropriate amount of preparation buffer to obtain a titer of 8.64×10 12 vg / ml of the vector solution to be injected (if the group is a mixed injection group of two viral serotypes, the genome ratio of the viral vector per unit volume is 1:1). 30μl of AAV vector solution is aspirated into a microsyringe according to the group and animal weight. When the animal is fully anesthetized and meets the injection requirements, the animal is placed under the LED light on the operating table. The injection point for the lateral ventricle injection is confirmed (it is located 0.7mm behind the anterior bregma, 1mm from the sagittal suture, and 2mm deep). The brain injection surface is kept horizontal. Use 75% disinfection to disinfect the area to be injected. Hold the microsyringe vertically and slowly insert the needle. Slowly push the syringe plunger to complete the unilateral injection. Complete the injection on the other side at the symmetrical position of the injection point. Inject 2.5μL unilaterally for a total of 5μl. After each injection, keep the needle in the brain for 10-15 seconds and then slowly withdraw the needle to prevent backflow of the injection solution.

[0212] If combined administration is involved, the procedure is to inject into the temporal vein first and then into the lateral ventricle.

[0213] That is, after the temporal vein administration is completed, use the fingertips to touch the front or hind limbs of the mouse. When the animal has reflexes, place the mouse on ice to continue anesthesia. When the animal is fully anesthetized and meets the injection requirements, complete the above intracerebroventricular injection process.

[0214] After the injection of the above animals, the animals were placed on a micro electric blanket for recovery. After the animals' activity ability was observed to recover, the animals were placed in cages.

[0215] Survival curves and mortality data were obtained through cage-side observation. All animals were cage-side observed twice daily on the day of dosing and throughout the experimental observation period. Animal survival was recorded and survival curves were plotted until the end of the experiment. The experiment ended when the last animal died. All animals were weighed on the day of dosing and throughout the experimental observation period, 2-3 times per week, until the end of the experiment, and weight gain curves were plotted.

[0216] Behavioral ability test procedures: From the 3rd to the 13th day after birth, all experimental groups were tested for turning over reflex once every other day.

[0217] Experimental procedure: (1) Before the experiment, the toes of the young mice in each group were clipped and marked to avoid confusion between groups and numbers during the experiment. (2) During the experiment, the test animals were placed on their side on a flat experimental platform. The direction and angle of each animal should be kept consistent, and the surrounding environment should be kept relatively quiet. (3) The timer started when the animal was placed and the side-lying state met the experimental requirements. When the righting reflex was completed (i.e., the side-lying posture was adjusted to a normal walking posture), the timer ended and the duration of the righting reflex of each animal was counted. (4) The righting reflex was recorded for a maximum of 60 seconds. If it was not completed within 60 seconds, it was considered to be completed and the time was recorded (see Figure 8).

[0218] The survival rate of SMA mice after administration is shown in Figure 12, which shows that the simultaneous intravenous administration of AAV8-N0099 vector and intracerebroventricular administration of AAV1+9-smn1 chimeric vector resulted in a higher survival rate for SMA disease mice than the single intravenous injection of AAV9-N0099 vector or intracerebroventricular injection of AAV9-N0099 vector.

[0219] The changes in body weight of SMA mice after administration are shown in Figure 13 , indicating that simultaneous intravenous administration of AAV8-N0099 vector and intracerebroventricular administration of AAV1+9-smn1 chimeric vector resulted in better weight gain in SMA disease mice compared to single intravenous injection of AAV9-N0099 vector or intracerebroventricular injection of AAV9-N0099 vector.

[0220] The changes in behavioral ability of SMA mice after drug administration are shown in Figure 14, which shows that the simultaneous intravenous administration of AAV8-N0099 vector and intracerebroventricular administration of AAV1+9-smn1 chimeric vector can better restore the behavioral ability of SMA disease mice than the single intravenous injection of AAV9-N0099 vector or intracerebroventricular injection of AAV9-N0099 vector, which is manifested as an earlier recovery time to the same righting time as that of heterozygous mice.

[0221] Example 4. Design and validation of AAV expressing tissue-specific smn1.

[0222] 4.1 Design of cceAAV for tissue-specific expression of smn1.

[0223] Figure 15 shows a schematic diagram of the design of a linear closed-circle AAV (cceAAV) vector, AAV-N00241, for tissue-specific expression of the human smn1 gene (hsmn1). The cceAAV vector for expressing the human smn1 gene contains the smn1 expression cassette, which includes a synthetic, tissue-specific Synthetic promoter, the human smn1 gene (hsmn1), and polyA. The Syn promoter contains a CMV enhancer, a regulatory sequence upstream of the transcription start site of the human smn1 gene, and the SV40 late 16s intron. hsmn1 represents the open reading frame sequence of the human smn1 gene. PolyA represents the bovine growth hormone polyadenylation signal. Sequence information for the relevant elements is listed in Table 2.

[0224] Table 2. Sequence information of relevant elements of the cceAAV vector for tissue-specific expression of the human smn1 gene.

[0225] 4.2 Verify the gene expression efficiency of the tissue-specific SMN1 expression cassette in neuroblastoma cell lines.

[0226] Plasmids N0099, N00238, N00239, N00240, N00241, N00242, and N00243 used in this experiment contain different smn1 expression cassettes, each containing a promoter, a human smn1 (hsmn1) gene, and poly A. The different Syn promoters and human smn1 (hsmn1) genes used are shown in Table 3. Poly A is the bovine growth hormone polyadenylation signal shown in SEQ ID NO: 3.

[0227] Table 3. Sequence information of relevant elements of different plasmids.

[0228] Mouse neuroblastoma cell line N2a cells (Shanghai Cell Bank of Chinese Academy of Sciences, Cat NO. SCSP-5035) were inoculated into 6-well cell culture plates, and 6×10 5 After culturing for 24 hours in a cell culture incubator at 37°C and 5% CO2, 125 μl of Opti-MEM and 2 μg of plasmids containing different smn1 gene expression cassettes were mixed. 125 μl of Opti-MEM and 4 μl of Lipo-3000 (L3000-015) were then mixed and allowed to stand for 5 minutes. Opti-MEM containing the plasmids and Lipo-3000 were then mixed and incubated at room temperature for 10 minutes before adding N2a cells and incubating for another 48 hours. The medium from the 6-well plate was aspirated, and the cells were washed once with 3 ml of pre-chilled PBS at 4°C. The PBS was aspirated, and 200 μl of cell lysis buffer containing 1% PMSF was added. The cells were allowed to stand at 4°C for 10 minutes. The cells in the 6-well plate were lysed by pipetting and transferred to a 1.5 ml tube. The supernatant was aspirated and transferred to another 1.5 ml tube and stored frozen at -20°C. The total protein content of some cell lysates was quantified using a BCA kit. According to the total protein concentration, each cell lysate containing 25 μg of protein was taken, and the corresponding volume of protein electrophoresis loading buffer was added. After treatment at 95 degrees for 10 minutes, PAGE gel electrophoresis was performed. After the protein separated by PAGE gel was transferred to a PVDF membrane, the PVDF membrane loaded with protein was incubated at room temperature for 1 hour using PBST buffer containing HRP-labeled anti-human SMN1 (Themo Fisher, Cat NO.MA5-15857) and anti-b tubulin antibody (GenScript Biotech, Cat NO.A01717). After that, it was washed 3 times with PBST buffer, and after adding ECL color development solution for color development, it was photographed and imaged with a gel imager. Figure 16 shows a comparison of human SMN1 protein expression in N2a cells transfected with plasmids containing different tissue-specific SMN1 expression cassette sequences. Among all the tissue-specific gene expression cassettes screened, the Syn promoter (SEQ ID NO: 8) in plasmid N00241 mediated the highest level of human SMN1 protein expression in N2a cells, comparable to expression mediated by the CAG promoter (SEQ ID NO: 1) in plasmid N0099. Plasmid N00241 will be the focus of future research and development.

[0229] Example 5. Therapeutic Effect of AAV Tissue-Specifically Expressing Smn1 in an SMA Mouse Model

[0230] 5.1 Therapeutic effect of AAV9-N00241 in SMA mouse model via different administration routes.

[0231] The AAV9 vector AAV9-N00241 that tissue-specifically expresses smn1 was generated according to the production method of Example 2 and the element information in Example 4.

[0232] Dosing Procedure: Determine the test substance dosage for each group and procedure for temporal vein injection, intracerebroventricular administration, and a combination of both, convert and dilute. Negative control groups will remain untreated. Confirm the intended injection groups and target animals (1-day-old mice with homozygous genotype). Each group should contain 10-12 test animals.

[0233] If the injection group is intravenous, place the mouse pups directly on crushed ice for anesthesia; mix the preparation stock solution with an appropriate amount of preparation buffer to obtain a titer of 3×10 12 vg / ml (if it is a single route intravenous injection, the titer is 6×10 12 vg / ml) of the vector solution to be injected, and 50μl of the AAV vector solution is drawn into a microsyringe according to the group and animal weight. When the animal is fully anesthetized and meets the injection requirements, the animal is placed under the LED light on the operating table. The temporal vein is located in front of the ear bud. The bevel of the syringe needle tip is inserted into the temporal vein 2-3mm. After confirming that the bevel of the needle tip is filled with blood, the syringe is gently pushed until the temporal vein turns white. When the target volume is injected (for temporal vein injection: inject according to the dosing volume of 1g body weight / 20μl for newborn mice), the needle is kept in the vein for 10-15 seconds to prevent backflow.

[0234] If the injection group is the intracerebroventricular injection group, first place the mouse pups directly on crushed ice for anesthesia; mix the preparation stock solution with an appropriate amount of preparation buffer to obtain a titer of 8.64×10 12 vg / ml of the vector solution to be injected (if the group is a mixed injection group of two viral serotypes, the genome ratio of the viral vector per unit volume is 1:1). 30μl of AAV vector solution is aspirated into a microsyringe according to the group and animal weight. When the animal is fully anesthetized and meets the injection requirements, the animal is placed under the LED light on the operating table. The injection point for the lateral ventricle injection is confirmed (it is located 0.7mm behind the anterior bregma, 1mm from the sagittal suture, and 2mm deep). The brain injection surface is kept horizontal. Use 75% disinfection to disinfect the area to be injected. Hold the microsyringe vertically and slowly insert the needle. Slowly push the syringe plunger to complete the unilateral injection. Complete the injection on the other side at the symmetrical position of the injection point. Inject 2.5μL unilaterally for a total of 5μl. After each injection, keep the needle in the brain for 10-15 seconds and then slowly withdraw the needle to prevent backflow of the injection solution.

[0235] If combined administration is required, the procedure of first injecting the drug into the temporal vein and then the lateral ventricular injection should be used. That is, after the temporal vein administration is completed, gently touch the mouse's front or hind limb with your fingertips to confirm that the animal has reflexes. Then, place the mouse on ice to maintain anesthesia. Once the animal is fully anesthetized and meets the injection requirements, complete the above lateral ventricular injection procedure.

[0236] After the injection of the above animals, the animals were placed on a micro electric blanket for recovery. After the animals' activity ability was observed to recover, the animals were placed in cages.

[0237] Survival curves and mortality data for each group were obtained using cage-side observation. All animals were cage-side observed twice daily on the day of dosing and throughout the experimental observation period. Animal survival was recorded and survival curves were plotted until the end of the experiment. The experiment ended when the last animal died.

[0238] On the day of administration and throughout the experimental observation period, the body weights of all groups of experimental animals were measured 2-3 times per week until the end of the experiment, and the body weight growth curves of the animals in each group were drawn.

[0239] Behavioral ability test procedures: From the 3rd to the 17th day after birth, all experimental groups were tested for turning over reflex once every other day.

[0240] Experimental procedure: (1) Before the experiment, the toes of the young mice in each group were clipped and marked to avoid confusion between groups and numbers during the experiment. (2) During the experiment, the test animals were placed on their side on a flat experimental platform. The direction and angle of each animal should be kept consistent, and the surrounding environment should be kept relatively quiet. (3) The timer started when the animal was placed and the side-lying state met the experimental requirements. When the righting reflex was completed (i.e., the side-lying posture was adjusted to a normal walking posture), the timer ended and the duration of the righting reflex of each animal was counted. (4) The righting reflex was recorded for a maximum of 60 seconds. If it was not completed within 60 seconds, it was considered to be completed and the time was recorded (see Figure 8).

[0241] Figure 17 shows the survival rate of SMA mice after drug administration. Both the untreated and treated groups received injections within 48 hours of birth, but all animals in the untreated group died within 15 days of drug administration. No deaths were observed in the intravenous, intracerebroventricular, or both intravenous and intracerebroventricular administration groups.

[0242] Figure 18 shows the weight changes of SMA mice after drug administration. Approximately 10 days after the start of treatment, the untreated group showed a significant weight decrease, which continued until day 15, when all animals died. The weight of the treated groups gradually increased after drug administration. The order of improvement among treatments was IV+ICV > ICV > IV > untreated group.

[0243] The changes in righting time behavior of SMA mice after drug administration are shown in Figure 19. Compared with the untreated group, the righting time of animals in the intravenous administration, intracerebroventricular administration, and intravenous and intracerebroventricular administration groups were significantly improved.

[0244] During the experiment, the peripheral symptom results of animals in different groups are shown in Table 4, where "+++" indicates severe, "++" indicates moderate, and "+" indicates normal.

[0245] Table 4. Improvement of peripheral symptoms in animals after drug administration

[0246] As shown in Table 4, mice in the untreated group died within 15 days after the start of treatment in the other groups, and no deaths were observed in mice in the other treatment groups. No deaths were observed in mice in the other treatment groups. Compared with the intravenous administration or intracerebroventricular administration groups, the animals in the intravenous administration plus intracerebroventricular administration (IV+ICV) group showed significant improvement and relief in symptoms such as increased purulent secretions in the eyes, inflammation and swelling of the periocular tissues, swelling of the forelimb fingertips, ulceration, necrosis, and shedding, swelling of the fingertips of the hind limbs, ulceration, necrosis, and shedding, and redness, ulceration, necrosis, and shedding of the tail.

[0247] 5.2 Therapeutic effect in SMA mouse model.

[0248] The AAV9 vector AAV9-N0099 expressing smn1 was generated according to the method in Example 2, and the AAV9 vector AAV9-N00241 expressing tissue-specific smn1 was generated by combining the production method in Example 2 and the element information in Example 4.

[0249] Dosing Procedure: Determine the dose of the test substance to be injected and manipulated via the temporal vein, convert it, and dilute it. Do not treat the negative control group. Identify the injection group and target animals (1-day-old mice that have been genotyped and confirmed to be homozygous). Each group should contain 10-12 test animals.

[0250] First, place the mouse pup directly on crushed ice for anesthesia; mix the preparation stock solution with an appropriate amount of preparation buffer to obtain a titer of 6×10 12vg / m of the vector solution to be injected, draw 50μl of the AAV vector solution into a microsyringe according to the group and animal weight. Once the animal is fully anesthetized and meets the injection requirements, place the animal under the LED light on the operating table. Confirm the location of the temporal vein in front of the ear bud. Insert the bevel of the syringe needle into the temporal vein 2-3mm and confirm that the bevel of the needle tip is filled with blood. Slowly push the syringe until the temporal vein turns white. When the target volume is injected (for temporal vein injection: inject according to the dosing volume of 1g body weight / 20μl for newborn mice), keep the needle in the vein for 10-15 seconds to prevent backflow.

[0251] After the injection, the animals were placed on a micro electric blanket for recovery. After the animals' mobility was observed to have recovered, they were placed in cages.

[0252] Survival curves and mortality data for each group were obtained using cage-side observation. All animals were cage-side observed twice daily on the day of dosing and throughout the experimental observation period. Animal survival was recorded and survival curves were plotted until the end of the experiment. The experiment ended when the last animal died.

[0253] On the day of administration and throughout the experimental observation period, the body weights of all groups of experimental animals were measured 2-3 times per week until the end of the experiment, and the body weight growth curves of the animals in each group were drawn.

[0254] The survival rates of SMA mice after administration are shown in Figure 20, demonstrating that AAV9-N00241 treatment resulted in a higher survival rate in SMA mice compared to AAV9-N0099. The survival curve of the untreated group decreased significantly within 20 days after administration. Compared to the untreated group, the survival rates and survival status of animals in the AAV9-N00241 and AAV-N0099 treatment groups were significantly improved, indicating that treatment had a positive impact on animal survival.

[0255] Figure 21 shows the weight changes of SMA mice after dosing, demonstrating that AAV9-N00241 treatment resulted in a more pronounced weight gain in SMA mice compared to AAV9-N0099. The animals showed a gradual increase in weight within 7 days of dosing. Seven days after dosing, the weight of the untreated group showed a significant decrease, which persisted until day 20, when all animals in this group died. Compared to the untreated group, both virus-treated and non-treated groups showed significant improvement in weight gain, demonstrating a positive effect of treatment on weight change in the animals.

[0256] The above descriptions are merely embodiments of the present disclosure and are not intended to limit the scope of protection of the present disclosure. Any equivalent structure or equivalent process transformation made using the contents of the present disclosure specification and drawings, or directly or indirectly applied in other related technical fields, are also included in the scope of protection of the present disclosure.

Claims

1. An AAV vector composition comprising two or more AAV vectors for delivering the SMN1 gene, wherein the AAV vector comprises an expression cassette containing the SMN1 gene, the expression cassette comprising a promoter, human SMN1 (hSMN1) cDNA, and a tail signal. Preferably, the AAV vector further comprises an ITR sequence. Preferably, the AAV vectors are each independently a complementary AAV, such as scAAV or cceAAV, or a single-stranded AAV, such as ssAAV.

2. The AAV vector composition according to claim 1, which comprises a first AAV vector and a second AAV vector, the first and second AAV vectors having capsid proteins of different serotypes respectively, the first AAV vector and the second AAV vector comprising the same or different promoters, wherein the first and second AAV vectors each independently have a capsid protein selected from the following: a native serotype capsid protein, mutants thereof, modified capsid proteins, or a full-length or fragment combination of the amino acid sequences of two or more capsid proteins; Preferably, the first AAV vector has a capsid protein selected from those with tropism for peripheral tissues, and the second AAV vector has a capsid protein selected from those with tropism for neural tissues.

3. The AAV vector composition according to claim 2, wherein the native serotype capsid protein, mutants thereof, modified capsid proteins, or a full-length or fragment combination of the amino acid sequences of two or more capsid proteins includes AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV9.47, AAV9(hu14), AAV10, AAV11, AAV12, AAVrh8, AAVrh10, AAVDJ, and AAVretro; wherein the capsid proteins with tropism for peripheral tissues include AAV1, AAV2, AAV4, AAV5, AAV6, AAV7, AAV8, and AAV9, and the capsid proteins with tropism for neural tissues include AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV8, AAV9, AAVrh10, AAVDJ, and AAVretro.

4. The AAV vector composition according to claim 2 or 3, wherein the first and second AAV vectors have capsid proteins of different serotypes, the first AAV vector having a capsid protein of AAV1 or AAV9, and the second AAV vector having a capsid protein of AAV1 or AAV9.

5. The AAV vector composition according to any one of claims 2-4, wherein the first AAV vector comprises an expression cassette containing the SMN1 gene controlled by a constitutive expression promoter, and the second AAV vector comprises an expression cassette containing the SMN1 gene controlled by a tissue-specific expression promoter; Preferably, the constitutive expression promoter includes β-actin promoter, cytomegalovirus (CMV) promoter, RSV promoter, EF1α promoter, chicken β-actin promoter, CAG promoter, CBA promoter, more preferably CAG promoter, and the tissue-specific expression promoter includes hSyn (human synapsin) promoter, Syn (synthetic) promoter, CaMKIIa promoter, Slc32a1 promoter, mecp2 promoter, GFAP promoter, more preferably Syn promoter.

6. The AAV vector composition according to any one of claims 1-4, wherein the promoter optionally comprises an enhancer, preferably, the promoter is CAG promoter, more preferably, the promoter is Syn promoter.

7. The AAV vector composition according to any one of claims 1-6, wherein the hsmn1 cDNA contains the open reading frame sequence of the human smn1 gene, preferably, hsmn1 is as shown in SEQ ID NO: 2; the tail signal is selected from bovine growth hormone (bGH) polyadenylation signal, simian vacuolating virus 40 (SV40) early polyA, simian vacuolating virus 40 (SV40) late polyA, rabbit globin polyA and HSV TK polyA, preferably, the tail signal comprises bovine growth hormone polyadenylation signal, more preferably, the tail signal is as shown in SEQ ID NO:

3.

8. The AAV vector composition according to claim 5 or 6, wherein the CAG promoter contains CMV enhancer, chicken beta actin gene promoter, rabbit beta globin gene RNA splicing site and SV40 late 16s intron, preferably, CAG promoter is as shown in SEQ ID NO: 1; the Syn promoter contains CMV enhancer, regulatory sequence upstream of the transcription start site of human smn1 gene, SV40 late 16s intron, preferably, Syn promoter is as shown in SEQ ID NO:

8.

9. A chimeric AAV vector for delivering the smn1 gene, the capsid of which is composed of two or more capsid proteins, the chimeric AAV vector comprises an expression cassette containing the smn1 gene, the expression cassette contains a promoter, hsmn1 cDNA and a tail signal, preferably, the chimeric AAV vector further comprises ITR sequence, preferably, the chimeric AAV vector is a complementary AAV, such as scAAV or cceAAV, or a single-stranded AAV, such as ssAAV.

10. The chimeric AAV vector according to claim 9, wherein the capsid is composed of two or more capsid proteins selected from the following: Natural serotype capsid proteins, mutants thereof, modified capsid proteins, or full-length or fragment combinations of the amino acid sequences of two or more capsid proteins; Preferably, the capsid is composed of a capsid protein with tropism for peripheral tissues and a capsid protein with tropism for neural tissues.

11. The chimeric AAV vector according to claim 10, wherein the native serotype capsid protein, its mutant, modified capsid protein, or a combination of full-length or fragment amino acid sequences of two or more capsid proteins includes AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV9.47, AAV9(hu14), AAV10, AAV11, AAV12, AAVrh8, AAVrh10, AAVDJ, and AAVretro; wherein the capsid proteins with tropism for peripheral tissues include AAV1, AAV2, AAV4, AAV5, AAV6, AAV7, AAV8, and AAV9, and the capsid proteins with tropism for neural tissues include AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV8, AAV9, AAVrh10, AAVDJ, and AAVretro.

12. The chimeric AAV vector according to claim 10 or 11, wherein the capsid is composed of AAV1 and AAV9.

13. The chimeric AAV vector according to any one of claims 9-12, wherein the promoter optionally contains an enhancer, preferably, the promoter is the CAG promoter, more preferably, the promoter is the Syn promoter.

14. The chimeric AAV vector according to claim 13, wherein the h smn1 cDNA contains the open reading frame sequence of the human smn1 gene, preferably, hsmn1 is as shown in SEQ ID NO: 2; the tail signal contains the bovine growth hormone (bGH) polyadenylation signal or the simian vacuolating virus 40 (SV40) polyadenylation signal, simian vacuolating virus 40 (SV40) early polyA, simian vacuolating virus 40 (SV40) late polyA, rabbit globin polyA, and HSV TK polyA, preferably, the tail signal contains the bovine growth hormone polyadenylation signal, more preferably, the tail signal is as shown in SEQ ID NO:

3.

15. An AAV vector for delivering the smn1 gene, which contains an expression cassette containing a promoter, h smn1 cDNA, and a tail signal, preferably, the AAV vector further contains an ITR sequence, preferably, the AAV vector is a complementary AAV, such as scAAV or cceAAV, or a single-stranded AAV, such as ssAAV; wherein the promoter is the Syn promoter, preferably, the Syn promoter contains the CMV enhancer, the regulatory sequence upstream of the transcription start site of the human smn1 gene, and the SV40 late 16s intron, more preferably, the Syn promoter is as shown in SEQ ID NO:

8.

16. The AAV vector according to claim 15, wherein the hsmn1 cDNA comprises the open reading frame sequence of the human smn1 gene. Preferably, hsmn1 is as shown in SEQ ID NO: 2; the tail signal is selected from the bovine growth hormone (bGH) polyadenylation signal, simian vacuolating virus 40 (SV40) early polyA, simian vacuolating virus 40 (SV40) late polyA, rabbit globin polyA, and HSV TK polyA. Preferably, the tail signal comprises the bovine growth hormone polyadenylation signal. More preferably, the tail signal is as shown in SEQ ID NO:

3.

17. The AAV vector according to claim 15 or 16, which has a capsid protein selected from the following: a native serotype capsid protein, a mutant thereof, a modified capsid protein, or a combination of the full-length or fragments of the amino acid sequences of two or more capsid proteins; Preferably, the native serotype capsid protein, a mutant thereof, a modified capsid protein, or a combination of the full-length or fragments of the amino acid sequences of two or more capsid proteins includes AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV9.47, AAV9(hu14), AAV10, AAV11, AAV12, AAVrh8, AAVrh10, AAVDJ, and AAVretro; More preferably, the AAV vector has an AAV9 capsid protein.

18. Use of the Syn promoter for expressing the human smn1 gene. Preferably, the Syn promoter comprises a CMV enhancer, a regulatory sequence upstream of the transcription start site of the human smn1 gene, and an SV40 late 16s intron. More preferably, the Syn promoter is as shown in SEQ ID NO:

8.

19. The use according to claim 18, wherein the Syn promoter is used in the smn1 expression cassette, and the smn1 expression cassette comprises the Syn promoter, hsmn1 cDNA, and a tail signal; Preferably, hsmn1 is as shown in SEQ ID NO: 2; Preferably, the tail signal is selected from the bovine growth hormone (bGH) polyadenylation signal, simian vacuolating virus 40 (SV40) early polyA, simian vacuolating virus 40 (SV40) late polyA, rabbit globin polyA, and HSV TK polyA; Preferably, the tail signal comprises the bovine growth hormone polyadenylation signal. More preferably, the tail signal is as shown in SEQ ID NO:

3.

20. The use according to claim 19, wherein the smn1 expression cassette is contained in an AAV vector for delivering the smn1 gene. Preferably, the AAV vector further comprises an ITR sequence. Preferably, the AAV vector is a complementary AAV, such as scAAV or cceAAV, or a single-stranded AAV, such as ssAAV.

21. The use according to claim 20, wherein the AAV vector has a capsid protein selected from the following: a native serotype capsid protein, a mutant thereof, a modified capsid protein, or a combination of full-length or fragmentary sequences of two or more capsid protein amino acid sequences; Preferably, the native serotype capsid protein, a mutant thereof, a modified capsid protein, or a combination of full-length or fragmentary sequences of two or more capsid protein amino acid sequences includes AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV9.47, AAV9(hu14), AAV10, AAV11, AAV12, AAVrh8, AAVrh10, AAVDJ and AAVretro; More preferably, the AAV vector has an AAV9 capsid protein.

22. An smn1 expression cassette, which comprises a Syn promoter, h smn1 cDNA and a tail signal. Preferably, the Syn promoter comprises a CMV enhancer, a regulatory sequence upstream of the transcription start site of the human smn1 gene, and an SV40 late 16s intron. More preferably, the Syn promoter is as shown in SEQ ID NO:

8.

23. A vector, which comprises the smn1 expression cassette according to claim 22.

24. A host cell, which is contacted with the AAV vector composition according to any one of claims 1-8, the chimeric AAV vector according to any one of claims 9-14, the AAV vector according to any one of claims 15-17, or the vector according to claim 23.

25. A pharmaceutical composition, which comprises the AAV vector composition according to any one of claims 1-8, the chimeric AAV vector according to any one of claims 9-14, the AAV vector according to any one of claims 15-17, or the vector according to claim 23, and a pharmaceutically acceptable carrier.

26. A method for expressing SMN1 protein in a target sample, which comprises administering to the target sample the AAV vector composition according to any one of claims 1-8, the chimeric AAV vector according to any one of claims 9-14, the AAV vector according to any one of claims 15-17, the vector according to claim 23, or the pharmaceutical composition according to claim 25.

27. A method for treating or preventing an SMN deficiency-related disease, which comprises administering to a subject in need thereof a therapeutically or prophylactically effective amount of the AAV vector composition according to any one of claims 1-8, the chimeric AAV vector according to any one of claims 9-14, the AAV vector according to any one of claims 15-17, the vector according to claim 23, or the pharmaceutical composition according to claim 25.

28. A method for treating or preventing an SMN deficiency-related disease, comprising administering, to a subject in need thereof, simultaneously or sequentially via two or more administration routes, one or more AAV vectors delivering the smn1 gene, or a chimeric AAV vector delivering the smn1 gene, each administration route being independent of the others.

29. The method according to claim 28, wherein the administration routes include CNS administration routes such as intrathecal injection, cerebrospinal fluid injection, intracranial injection (e.g., lateral ventricle), and systemic administration routes such as intramuscular injection, intravenous injection, and subcutaneous injection.

30. The method according to claim 28 or 29, wherein the plurality of AAV vectors delivering the smn1 gene are selected from the AAV vector compositions according to any one of claims 1-8, and wherein the chimeric AAV vector delivering the smn1 gene is selected from the AAV chimeric AAV vectors according to any one of claims 9-14.

31. The method according to claim 30, comprising injecting one or more AAV vectors into the subject in need thereof via the CNS route and simultaneously or sequentially injecting one AAV vector intravenously; preferably, the plurality of AAV vectors comprise an AAV1 and AAV9 vector composition or an AAV chimeric vector, more preferably the plurality of AAV vectors comprise an AAV1+9 chimeric vector; preferably, the one AAV vector is selected from an AAV9 vector or an AAV8 vector.

32. A method for producing the AAV vector composition according to any one of claims 1-8, comprising the following steps: (a) Mixing and reacting a plasmid containing the smn1 gene and AAV ITR elements, a helper plasmid expressing adenovirus elements, and a plasmid containing a desired capsid protein sequence and an AAV Rep gene sequence; (b) Transfecting a host cell with the reaction product obtained in step (a); (c) Lysing the transfected host cell to release an AAV vector; (d) Using a plasmid containing other desired capsid protein sequences in step (a) and repeating the above steps (a)-(c) once or more to produce another or more AAV vectors; (e) Mixing the one AAV vector obtained in step (c) with the other or more AAV vectors obtained in step (d) to produce the AAV vector composition.

33. A method for producing the chimeric AAV vector according to any one of claims 9-14, comprising the following steps: (a) Mixing and reacting a plasmid containing the smn1 gene and AAV ITR elements, a helper plasmid expressing adenovirus elements, and a plasmid containing two or more desired capsid protein sequences and an AAV Rep gene sequence; (b) Transfecting a host cell with the reaction product obtained in step (a); (c) Lysing the transfected host cell to release the AAV chimeric vector.

34. A method for producing the AAV vector according to any one of claims 15-17, comprising the following steps: (a) Mix and react a plasmid containing the smn1 gene and AAV ITR elements, a helper plasmid expressing adenovirus elements, and a plasmid containing a sequence of a desired capsid protein and an AAV Rep gene sequence; (b) Transfect a host cell with the reaction product obtained in step (a); (c) Lyse the transfected host cell to release the AAV chimeric vector.

Images