DNA vaccine plasmid of tembusu virus as well as construction method and application of DNA vaccine plasmid

Abstract

The invention discloses a DNA vaccine plasmid of a tembusu virus as well as a construction method and application of the DNA vaccine plasmid, and relates to the technical field of molecular biology. The DNA vaccine plasmid of the tembusu virus comprises an expression vector pcDNA3.1-prME containing a 5AA-STING gene segment, and a DNA vaccine plasmid of the tembusu virus, the 5AA-STING gene segment is a gene segment formed by introducing a coding sequence of five amino acids at the N end of the tembusu virus NS1 on an STING gene segment. The invention further provides a construction method and application of the DNA vaccine plasmid of the tembusu virus, the DNA vaccine plasmid of the tembusu virus is favorable for efficiently assembling into a subvirion with a stronger immune effect, and the DNA vaccine plasmid of the tembusu virus can co-express an immune stimulant STING molecule while expressing the structural protein of the tembusu virus to be assembled into the subvirion, so that the DNA vaccine plasmid of the tembusu virus has a good application prospect. The polypeptide is a key molecule for recognizing a double-stranded DNA signal channel in cells, and the immune protection effect is further enhanced.

Description

Technical Field

[0001] The present invention relates to the field of biomolecule technology, and in particular to a DNA vaccine plasmid of Tembusu virus and a construction method and application thereof. Background Art

[0002] Tembusu virus disease mainly causes egg production decline syndrome in poultry (ducks, geese, and chickens) and can also cause severe encephalitis. The mortality rate is about 20%. The pathogen was quickly identified as Tembusu virus (TMUV), a mosquito-borne flavivirus belonging to the Flaviviridae family and Flavivirus genus.

[0003] To prevent various animal viruses from infecting livestock and poultry, animal vaccines have become one of the main solutions for livestock and poultry virus prevention. DNA vaccines have shown significant advantages in animal vaccine research and development. Their technical characteristics and clinical application potential make them an important development direction for the next generation of vaccines. They have the following specific advantages: (1) High safety, no risk of toxic reversion. DNA vaccines avoid the risk of virulence reversion of traditional attenuated live vaccines by encoding pathogen-specific antigen genes rather than the entire pathogen. For example, for highly contagious diseases such as avian influenza and swine fever, DNA vaccines only express a single viral protein, eliminating the need for live viruses and reducing biosafety risks. In addition, plasmid DNA degrades slowly in the host, and no cases of gene integration or autoimmune reactions have been found. The safety of long-term application has been verified through multiple animal studies.

[0004] (2) Strong and long-lasting immunogenicity. DNA vaccines can activate both humoral and cellular immunity, and are particularly good at inducing cytotoxic T lymphocyte (CTL) responses, which are crucial for clearing intracellular pathogens (such as viruses).

[0005] (3) Low production cost and simple process. DNA vaccines usually use plasmids as carriers and can be mass-produced through E. coli fermentation. The purification process is simple and the cost is significantly lower than traditional inactivated vaccines or recombinant protein vaccines.

[0006] (4) Flexible design and rapid response. Genetic engineering technology allows for rapid modification of antigen genes to respond to pathogen mutations. In addition, DNA vaccines have a short development cycle.

[0007] (5) Stability and storage and transportation advantages. DNA molecules are resistant to high temperatures and can be made into freeze-dried dosage forms, which do not require cold chain transportation and are suitable for use in remote areas or resource-scarce environments.

[0008] However, the current prevention and control measures for the disease are mainly carried out through vaccination. Although commercialized live attenuated vaccines and inactivated vaccines are available, the immune effect of existing commercial inactivated vaccines is not ideal and requires multiple booster immunizations, which increases the stress response of the ducks. The existing live attenuated vaccines are all obtained through traditional continuous passage methods, which have high safety risks. With the emergence of new genotype strains, the large variation of their antigen E genes has also reduced the protective effect of the current vaccines. Summary of the Invention

[0009] The purpose of the present invention is to provide a DNA vaccine plasmid for Tembusu virus and its construction method and application. The DNA vaccine plasmid for Tembusu virus is conducive to the high-efficiency assembly into subviral particles with stronger immune effects. While expressing the structural proteins of TMUV to assemble into subviral particles, it can also co-express the immune stimulator STING molecule to further enhance the immune protection effect.

[0010] The present invention is achieved through the following technical solutions: The present invention provides a DNA vaccine plasmid for Tembusu virus, wherein the DNA vaccine plasmid comprises an expression vector pcDNA3.1-prME containing a 5AA-STING gene segment; The 5AA-STING gene fragment is a gene fragment formed by introducing the coding sequence of the N-terminal 5 amino acids of Tembusu virus NS1 into the STING gene fragment.

[0011] Furthermore, in some embodiments of the present application, the 5AA-STING gene fragment is inserted from the cleavage site between the E protein and the NS1 protein of the expression vector pcDNA3.1-prME; and / or The prME gene segment in the expression vector pcDNA3.1-prME is a prME gene segment derived from flavivirus.

[0012] Furthermore, in some embodiments of the present application, the 5AA-STING gene fragment has a nucleotide sequence shown in SEQ ID NO: 1; The nucleotide sequence of the DNA vaccine plasmid is shown in SEQ ID NO: 2.

[0013] In a second aspect, the present application further provides a method for constructing the DNA vaccine plasmid of the Tembusu virus described in the first aspect, comprising the following steps: Step 1: Provide expression vector pcDNA3.1-prME and pCAGGS-duSTING-Flag template; Step 2: Transfect the expression vector pcDNA3.1-prME with EcoR V and EcoR1. Double enzyme digestion and subsequent liquid recovery to obtain a linear vector; Step 3: Using the pCAGGS-duSTING-Flag template, the upstream primer was used to introduce the coding sequence of the N-terminal 5 amino acids of Tembusu virus NS1 to obtain the 5AA-STING gene fragment; Step 4: Use homologous recombination to ligate the linear pcDNA3.1-prME and 5AA-STING gene fragment to obtain pcDNA3.1-prME-5AA-STING plasmid.

[0014] Furthermore, in some embodiments of the present application, the nucleotide sequence used to compile the coding sequence of the N-terminal 5 amino acids of the Tembusu virus NS1 is shown in SEQ ID NO: 3.

[0015] Furthermore, in some embodiments of the present application, the nucleotide sequence of the upstream primer is as shown in SEQ ID NO.4: GTGAACGTGAACGCCGACACGGGGTGCTCAATCATGTCTCAGGAACCGCAGCA.

[0016] Furthermore, in some embodiments of the present application, providing the expression vector pcDNA3.1-prME comprises the following steps: Step 1.11: Providing a prME gene segment derived from a flavivirus, wherein the prME gene segment retains the anchor sequence of the C protein; Step 1.12: Optimize the prME gene fragment using avian parasitic codons to obtain a prME DNA fragment; Step 1.13: Clone the prME DNA fragment into the eukaryotic expression vector pcDNA3.1 to obtain the pcDNA3.1-prME expression vector.

[0017] Furthermore, in some embodiments of the present application, a screening step 5 is also included, which specifically includes: screening the obtained pcDNA3.1-prME-5AA-STING plasmid for mutation-free, and screening for mutation-free pcDNA3.1-prME-5AA-STING vectors.

[0018] In a third aspect, the present application also includes the use of the DNA vaccine plasmid of Tembusu virus described in the first aspect or the DNA vaccine plasmid of Tembusu virus constructed by the construction method of the DNA vaccine plasmid of Tembusu virus described in the second aspect in Tembusu virus vaccine.

[0019] Furthermore, in some embodiments of the present application, the DNA vaccine plasmid of Tembusu virus co-expresses the immune stimulator STING molecule while expressing the structural proteins of duck Tembusu virus to assemble into subviral particles.

[0020] Compared with the prior art, the present invention has the following advantages and beneficial effects: The present invention provides a DNA vaccine plasmid for Tembusu virus, and its construction method and application. A 5AA-STING gene fragment containing the coding sequence for the N-terminal five amino acids of Tembusu virus NS1 is introduced into an expression vector. This allows the TMUV vaccine loaded with the expression vector to express TMUV structural proteins and assemble into subviral particles while also co-expressing the immune stimulator STING molecule. The overexpressed STING molecule enhances the immune response. Furthermore, the STING molecule serves as a key molecule in the cGAS-STING DNA recognition signaling pathway, further activating the DNA vaccine pathway and achieving an immune-enhancing effect. Furthermore, in the present application, the pcDNA3.1-prME-5AA-STING vector formed by inserting the 5AA-STING gene fragment into the pcDNA3.1-prME vector utilizes the viral polyprotein's own cleavage site to independently initiate translation of the STING molecule, leaving no excess amino acids at the C-terminus of the E protein. This addresses the prior art issue of Tembusu virus E protein, where excess amino acids are easily left at the C-terminus during prME assembly, significantly affecting the assembly of the prME protein into subviral particles and thus the immune response. The Tembusu virus DNA vaccine plasmid provided in this application ensures that the prME protein maintains the most faithful amino acid sequence after translation, with no redundant amino acids at the C-terminus of the E protein. This ensures the fidelity of the prME protein sequence and the subviral particle formation of the prME protein that closely resembles the subviral particle formation during actual infection. The STING molecule is a key molecule in the intracellular double-stranded DNA signaling pathway. Its overexpression can directly activate immune pathways and can also be stimulated by the vaccine DNA, further enhancing the effectiveness of immune protection. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 Schematic diagram of pcDNA3.1-prME-5AA-STING and pcDNA3.1-prME-IRES-STING plasmids constructed in the Examples and Comparative Examples of the present application; Figure 2 The WB structure diagrams obtained by verifying the protein expression of the pcDNA3.1-prME-5AA-STING and pcDNA3.1-prME-IRES-STING plasmids constructed in the Examples and Comparative Examples of the present application using the WB program; Figure 3The procedures and result diagrams of the challenge and protection experiments with pcDNA3.1-prME-5AA-STING, pcDNA3.1 empty plasmid, and pcDNA3.1-prME plasmid provided in this application (panels B and C in the figure); among them, GAPDH is an internal reference gene, the expression of which is usually constant and serves as a reference when determining the expression level of the target protein. DETAILED DESCRIPTION

[0022] The following will clearly and completely describe the technical solutions of this application in conjunction with the embodiments. Obviously, the embodiments described are only part of the embodiments of this application, not all of them. Based on the embodiments in this application, all other embodiments obtained by ordinary technicians in this field without making creative efforts are within the scope of protection of this application.

[0023] Those skilled in the art will understand that, unless otherwise defined, all terms (including technical and scientific terms) used herein have the same meaning as commonly understood by those skilled in the art to which this application belongs. It should also be understood that terms such as those defined in common dictionaries should be understood to have meanings consistent with their meanings in the context of the prior art and, unless specifically defined as such, will not be interpreted in an idealized or overly formal sense.

[0024] It will be understood by those skilled in the art that, unless otherwise stated, the singular forms "a," "an," "said," and "the" used herein may also include the plural forms. It should be further understood that the term "comprising" used in the specification of this application refers to the presence of the stated features, integers, steps, operations, elements, and / or components, but does not preclude the presence or addition of one or more other features, integers, steps, operations, elements, components, and / or groups thereof. The term "and / or" used herein includes all or any unit and all combinations of one or more associated listed items.

[0025] The present invention is achieved through the following technical solutions: The present invention provides a DNA vaccine plasmid for Tembusu virus, wherein the DNA vaccine plasmid comprises an expression vector pcDNA3.1-prME containing a 5AA-STING gene segment; The 5AA-STING gene fragment is a gene fragment formed by introducing the coding sequence of the N-terminal 5 amino acids of Tembusu virus NS1 into the STING gene fragment. The 5AA-STING gene fragment is inserted into the cleavage site between the E protein and the NS1 protein of the expression vector pcDNA3.1-prME.

[0026] Wherein, the prME gene fragment in the expression vector pcDNA3.1-prME is a prME gene fragment derived from a flavivirus.

[0027] Among them, STING is a key molecule downstream of the DNA sensor cGAS (cyclic GMP-AMP synthase) molecule. It triggers conformational changes by sensing the second messenger cGAMP generated by cGAS, translocates from the endoplasmic reticulum to the Golgi apparatus, recruits TBK1 and IRF3, and induces the expression of type I interferon (IFN-β) and inflammatory factors; at the same time, it can activate the NF-κB pathway, promote the release of pro-inflammatory factors such as IL-6 and TNF-α, and coordinate innate and adaptive immune responses. Activated STING can enhance the antigen presentation ability of dendritic cells (DCs), promote the loading of antigen peptides on MHC-I molecules, and upregulate co-stimulatory molecules (such as CD40 and CD86), driving CD8 + T cell expansion and killing function. However, when STING co-expresses different proteins with other DNA fragments, a P2A sequence with ribosome skipping function is usually added between the two proteins, but this method will cause the 2A peptide segment to remain at the C-terminus of the first protein. In this application, the E protein in Tembusu virus is its main envelope protein, which forms the viral envelope together with the auxiliary prM protein. The assembly of Tembusu virus virions is a rigorous process, so the presence of excess amino acids at the C-terminus of the E protein will significantly affect the assembly of prM / E protein into subviral particles, ultimately affecting the immune effect.

[0028] Therefore, in the DNA vaccine plasmid of Tembusu virus provided in the present application, the cleavage site of the viral polyprotein itself is used to insert the 5AA-STING gene fragment to initiate the translation of STING alone, so that while different proteins are co-expressed, the immune effect of the STING molecule can be exerted and the DNA vaccine activation pathway can be promoted to achieve the effect of immune enhancement. It can also solve the problem that the residual 2A peptide segment at the C-terminus of the E protein affects the assembly of the prM / E protein into subviral particles.

[0029] Specifically, the 5AA-STING gene fragment has the nucleotide sequence shown in SEQ ID NO: 1; The nucleotide sequence of the DNA vaccine plasmid is shown in SEQ ID NO: 2.

[0030] In a second aspect, the present application further provides a method for constructing the DNA vaccine plasmid of the Tembusu virus described in the first aspect, comprising the following steps: Step 1: Provide expression vector pcDNA3.1-prME and pCAGGS-duSTING-Flag template; Step 2: Transfect the expression vector pcDNA3.1-prME with EcoR V and EcoR 1. Double enzyme digestion and subsequent liquid recovery to obtain a linear vector; Step 3: Using the pCAGGS-duSTING-Flag template, the upstream primer was used to introduce the coding sequence of the N-terminal 5 amino acids of Tembusu virus NS1 to obtain the 5AA-STING gene fragment; Step 4: Use homologous recombination to ligate the linear pcDNA3.1-prME and 5AA-STING gene fragment to obtain pcDNA3.1-prME-5AA-STING plasmid.

[0031] The expression vector pcDNA3.1-prME can be assembled using pcDNA3.1(+) and prME, or can be purchased from the market. The method for assembling the expression vector pcDNA3.1-prME using pcDNA3.1(+) and prME can include the following steps: Step 1.11: Providing a prME gene segment derived from a flavivirus, wherein the prME gene segment retains the anchor sequence of the C protein; Step 1.12: Optimize the prME gene fragment using avian tropism codons to obtain the prME DNA fragment; Step 1.13: Clone the prME DNA fragment into the eukaryotic expression vector pcDNA3.1(+) to obtain the pcDNA3.1-prME expression vector.

[0032] In the present application, prME of flavivirus is used as an immunogen, which can self-assemble into subviral particles without nucleocapsid. The subviral particles have a structure similar to that of viral particles and are good immunogens.

[0033] The eukaryotic expression vector pcDNA3.1(+) was purchased from a commercial source.

[0034] The pCAGGS-duSTING-Flag template was also purchased commercially. For details, please refer to the paper "Duckstimulator of interferon genes plays an important role in host anti-duckplague virus infection through an IFN-dependent signaling pathway" (Chen S, Wu Z, Zhang J, et al. Cytokine, 2018, 102: 191-199.) Wherein, the nucleotide sequence of the upstream primer is as shown in SEQ ID NO.4: GTGAACGTGAACGCCGACACGGGGTGCTCAATCATGTCTCAGGAACCGCAGCA; and the nucleotide sequence introduced for compiling the coding sequence of the N-terminal 5 amino acids of the Tembusu virus NS1 is shown in SEQ ID NO: 3.

[0035] Among them, using double cut enzyme EcoR V and EcoR I. The expression vector pcDNA3.1-prME is subjected to double enzyme digestion and then the liquid is recovered to obtain a linear vector, which specifically includes the following steps: (1) Prepare the double enzyme digestion reaction system in a PCR tube as follows:

[0036] (2) After gentle mixing, incubate at 37°C for 1 hour, then purify and recover the linear plasmid using a DNA liquid recovery kit, and use a NanoDrop2000 instrument to measure the concentration and set aside.

[0037] Among them, the coding sequence of the N-terminal 5 amino acids of Tembusu virus NS1 was introduced by upstream primer using pCAGGS-duSTING-Flag template, which specifically includes the following steps: (1) Prepare the PCR system in the PCR tube as follows:

[0038] (2) After gentle mixing, amplify the PCR according to the following program: pre-denaturation at 98°C for 2 min, denaturation for 10 s, annealing for 10 s, extension for 10 s / kb, for a total of 30 cycles, and final extension for 5 min.

[0039] (3) After confirmation of correctness through agarose gel identification, the DNA fragments were purified and recovered using a DNA liquid recovery kit, and the concentration was measured using a NanoDrop2000 instrument and set aside.

[0040] The linear pcDNA3.1-prME and 5AA-STING gene fragments were ligated using homologous recombination to obtain the pcDNA3.1-prME-5AA-STING plasmid. This step was completed using a commercially available homologous recombination kit. The specific steps were performed according to the kit instructions: (1) Prepare the PCR system in the PCR tube as follows:

[0041] (2) After gentle mixing, incubate at 50°C for 20 min, and then directly transform into DH5α Escherichia coli competent cells.

[0042] (3) Take 10 μL of the cooled recombinant product and add it to 100 μL of competent cells. Tap the tube wall several times to mix well and place on ice for 25 min.

[0043] (4) Heat shock at 42°C for 60 seconds and incubate on ice for 2 minutes.

[0044] (5) Add 500 μL of SOC or LB liquid culture medium and shake at 37°C, 200 rpm for 60 min.

[0045] (6) Centrifuge at 5,000 rpm for 4 min and discard the supernatant to 100 μL. Resuspend the cells in the remaining culture medium and spread evenly on a plate containing the correct resistance using a sterile spreader.

[0046] (7) After the bacterial solution is absorbed, turn the plate upside down and incubate it at 37°C overnight; pick a single clone for identification.

[0047] In addition, the method further includes a screening step 5, which specifically includes: screening the obtained pcDNA3.1-prME-5AA-STING plasmid for mutations, and screening for pcDNA3.1-prME-5AA-STING vectors for mutations.

[0048] In a third aspect, the present application also includes the use of the DNA vaccine plasmid of Tembusu virus described in the first aspect or the DNA vaccine plasmid of Tembusu virus constructed by the construction method of the DNA vaccine plasmid of Tembusu virus described in the second aspect in Tembusu virus vaccine.

[0049] The DNA vaccine plasmid of the Tembusu virus provided in the present application can co-express the immune stimulator STING molecule while expressing the structural proteins of the duck Tembusu virus to assemble into subviral particles.

[0050] The following will clearly and completely describe the technical solutions of the present invention in conjunction with the embodiments. Obviously, the embodiments described are only some embodiments of the present invention, not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative efforts are within the scope of protection of the present invention.

[0051] Experimental Materials Plasmids, cells and experimental animals pcDNA3.1(+), pCAGGS-duSTING-Flag, BHK21 cells, and TMUV E protein antiserum were preserved and provided by the Poultry Disease Prevention and Control Center of the College of Veterinary Medicine, Sichuan Agricultural University; SPF duck embryos were purchased from Shandong Haotai Experimental Animal Breeding Co., Ltd.; the duck Tembusu virus strain TMUV-MC strain was donated by the College of Veterinary Medicine, Huazhong Agricultural University.

[0052] Main test kits The homologous recombination kit Hieff Clone® Universal II One Step Cloning Kit was purchased from Shanghai Yisheng Biotechnology; Ultra-fidelity PCR enzyme KOD One™ PCR Master Mix was purchased from Shanghai Toyobo; Transfection reagent TransIntro EL Transfection Reagent was purchased from Beijing Quanshijin Biotechnology Co., Ltd. DNA restriction endonucleases were purchased from Beijing NEB Biotechnology; RIPA buffer was purchased from Thermo Fisher.

[0053] Example 1: The construction of the DNA vaccine plasmid of Tembusu virus specifically includes the following steps: 1. Obtain pcDNA3.1-prME expression vector The prME gene fragment of CQW1 (retaining the anchor sequence of the C protein (its nucleotide sequence is: GGGGGATCCTGCTCCTGGGTGATCATGCTGCTGCCCATCGTGGCCGGG), that is, the last 16 amino acids of the C protein (the amino acid sequence compiled is: GGSCSWVIMLLPIVAG), this sequence is the signal peptide of the prM protein) was sent to Jiutian Gene Company for sequence optimization (using avian tropic codons) and then the whole gene was synthesized into a DNA fragment. It was then cloned into the eukaryotic expression vector pcDNA3.1(+) to obtain the pcDNA3.1-prME expression plasmid to enhance expression and avoid prokaryotic toxicity of the gene.

[0054] 2. Construction of pcDNA3.1-prME-5AA-STING expression vector 2.1. The pcDNA3.1-prME plasmid obtained above was used EcoR V and EcoR I was used for double enzyme digestion and the liquid was recovered to obtain a linear vector for standby use.

[0055] 2.2. Using the pCAGGS-duSTING-Flag template, the coding sequence of the N-terminal 5 amino acids of Tembusu virus NS1 was introduced through the upstream primer to obtain the 5AA-STING gene fragment.

[0056] 2.3. Use homologous recombination to ligate linear pcDNA3.1-prME with 5AA-STING to obtain pcDNA3.1-prME-5AA-STING plasmid. After sequencing to confirm the absence of mutations, extract and obtain pcDNA3.1-prME-5AA-STING plasmid. Figure 1 shown.

[0057] Comparative Example: Compared with the embodiment, step 2.2 in this comparative example is: using pCAGGS-duSTING-Flag template, a high-fidelity PCR kit is used to amplify the duSTING-Flag gene sequence fragment; using pACYC CQW1-IRES-mC as a template, amplify the IRES gene fragment; finally, use the fusion PCR method to obtain the IRES-STING gene fragment. Step 2.3 is: using homologous recombination method to connect the linear pcDNA3.1-prME with the DNA fragment IRES-STING, screening to obtain the pcDNA3.1-prME-IRES-STING plasmid, and sending it for sequencing to confirm that there is no mutation to obtain the pcDNA3.1-prME-IRES-STING plasmid, such as Figure 1 shown.

[0058] To verify the expression of the pcDNA3.1-prME-5AA-STING plasmid provided in this application, the applicant used an endotoxin removal kit to extract the pcDNA3.1-prME-5AA-STING plasmid and the pcDNA3.1-prME-IRES-STING plasmid, respectively, for later use. Subsequently, the pcDNA3.1-prME-5AA-STING plasmid and the pcDNA3.1-prME-IRES-STING plasmid were transfected into BHK-21 cells pre-plated in 6-well plates at a rate of 2 μg per well, following the instructions for the TransIntroEL Transfection Reagent.

[0059] 48 hours after transfection, cells were lysed with RIPA buffer, supernatant samples were harvested, and protein expression was verified using conventional Western blotting procedures. Figure 2 As shown, WB structure shows that although pcDNA3.1-prME-IRES-STING and pcDNA3.1-prME-5AA-STING can both efficiently express the E protein of Tembusu virus and the duck STING molecule after transfection into cells, the expression level of the latter pcDNA3.1-prME-5AA-STING is higher; it can be seen that the pcDNA3.1-prME-5AA-STING plasmid provided in this application has a higher overall expression efficiency.

[0060] The applicant further evaluated a vaccine based on the pcDNA3.1-prME-5AA-STING plasmid, as follows: Seven-day-old SPF ducklings were used for the challenge and protection experiment. The procedure of the challenge experiment is shown in Figure 3 A. Seven-day-old ducklings were randomly divided into three groups, each with 10 ducklings. Each duckling was immunized with 200µg of either the empty pcDNA3.1 plasmid (empty control group), the pcDNA3.1-prME plasmid (pcDNA3.1-prME immunized group), or the pcDNA3.1-prME-5AA-STING plasmid (pcDNA3.1-prME-5AA-STING immunized group). Immunizations were administered once intramuscularly in the thigh, and weight changes and clinical symptoms were monitored daily. On day 14 after immunization, each duck was challenged with 200µL of the virulent TMUV-MC strain (106.6TCID50 / mL). Weight changes, clinical symptoms, and mortality were monitored daily until significant weight recovery began.

[0061] See Figure 3 During the 14-day observation period following plasmid immunization, no significant differences in duckling weight were observed between groups (p>0.05). However, after virulent challenge, the different immunization groups exhibited significantly different responses: ducklings in the empty control group experienced a sustained and sharp weight loss (average daily decrease of 4.7%) from day 4 to 5 after challenge, with weight gain not resuming until day 6. Animals in this group generally exhibited clinical symptoms such as decreased appetite and activity, with three developing progressive hindlimb paralysis. Ultimately, the cumulative mortality rate in this group reached 40% (4 / 10), with a survival rate of 60%.

[0062] The pcDNA3.1-prME-immunized group experienced negative weight gain (average daily decrease of 2.4%) starting on day 3 post-challenge, which persisted until day 6 when positive weight gain resumed. Although 80% (8 / 10) of this group exhibited transient depression and decreased food intake, only one developed hind limb motor impairment. Ultimately, 30% (3 / 10) of the animals succumbed to Tembusu virus infection, with a survival rate of 70%.

[0063] Notably, the pcDNA3.1-prME-5AA-STING immunization group demonstrated the best protective efficacy. Only two individuals (20%) developed mild clinical symptoms after challenge, and the group experienced only a brief, slight decrease in body weight on day 5 after challenge. The ultimate survival rate reached 90%, significantly different from the empty vector immunization group (p<0.01) and significantly higher than the pcDNA3.1-prME single immunization group (p<0.05).

[0064] In summary, this application provides a DNA vaccine plasmid for Tembusu virus that, while expressing authentic structural proteins (facilitating efficient assembly into immunogenic subviral particles), also co-expresses an immune-enhancing protein molecule (using duck STING as an example). Duck STING can enhance the immune protection of Tembusu virus DNA vaccines and can be used as an immunopotentiator in DNA vaccine development. Compared to prior art methods that use components such as P2A, the construction method for the DNA vaccine plasmid for Tembusu virus provided in this application ensures that the C-terminus of the key structural protein, E, is free of any redundant amino acids, ensuring the fidelity of the prME protein sequence and enabling the assembly of the prME protein into subviral particles in a manner most closely resembling nature after translation.

[0065] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present application, rather than to limit them. Although the present application has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or make equivalent replacements for some or all of the technical features therein. These modifications or replacements do not deviate the essence of the corresponding technical solutions from the scope of the technical solutions of the embodiments of the present application.

Claims

1. A DNA vaccine plasmid for Tembusu virus, characterized in that: The DNA vaccine plasmid includes an expression vector pcDNA3.1-prME containing a 5AA-STING gene fragment; The 5AA-STING gene fragment is a gene fragment formed by introducing the coding sequence of the N-terminal 5 amino acids of Tembusu virus NS1 into the STING gene fragment.

2. The DNA vaccine plasmid of Tembusu virus according to claim 1, characterized in that The 5AA-STING gene fragment is inserted into the cleavage site between the E protein and the NS1 protein of the expression vector pcDNA3.1-prME; and / or The prME gene segment in the expression vector pcDNA3.1-prME is a prME gene segment derived from flavivirus.

3. The DNA vaccine plasmid of Tembusu virus according to claim 1, characterized in that The 5AA-STING gene fragment has the nucleotide sequence shown in SEQ ID NO: 1; The nucleotide sequence of the DNA vaccine plasmid is shown in SEQ ID NO:

2.

4. The method for constructing the DNA vaccine plasmid of Tembusu virus according to any one of claims 1 to 3, characterized in that: The following steps are involved: Step 1: Provide expression vector pcDNA3.1-prME and pCAGGS-duSTING-Flag template; Step 2: Transfect the expression vector pcDNA3.1-prME with EcoR V and EcoR 1. Double enzyme digestion and subsequent liquid recovery to obtain a linear vector; Step 3: Using the pCAGGS-duSTING-Flag template, the upstream primer was used to introduce the coding sequence of the N-terminal 5 amino acids of Tembusu virus NS1 to obtain the 5AA-STING gene fragment; Step 4: Use homologous recombination to ligate the linear pcDNA3.1-prME and 5AA-STING gene fragment to obtain pcDNA3.1-prME-5AA-STING plasmid.

5. The method for constructing a DNA vaccine plasmid of Tembusu virus according to claim 4, characterized in that: The nucleotide sequence used to compile the coding sequence of the N-terminal 5 amino acids of the Tembusu virus NS1 is shown in SEQ ID NO:

3.

6. The method for constructing a DNA vaccine plasmid of Tembusu virus according to claim 4, characterized in that: The nucleotide sequence of the upstream primer is as shown in SEQ ID NO.4: GTGAACGTGAACGCCGACACGGGGTGCTCAATCATGTCTCAGGAACCGCAGCA.

7. The method for constructing a DNA vaccine plasmid of Tembusu virus according to claim 4, characterized in that: The provision of the expression vector pcDNA3.1-prME comprises the following steps: Step 1.11: Providing a prME gene segment derived from a flavivirus, wherein the prME gene segment retains the anchor sequence of the C protein; Step 1.12: Optimize the prME gene fragment using avian parasitic codons to obtain a prME DNA fragment; Step 1.13: Clone the prME DNA fragment into the eukaryotic expression vector pcDNA3.1 to obtain the pcDNA3.1-prME expression plasmid.

8. The method for constructing a DNA vaccine plasmid for Tembusu virus according to claim 4, characterized in that: The method further includes a screening step 5, which specifically includes: screening the obtained pcDNA3.1-prME-5AA-STING plasmid for mutation-free conditions, and screening the pcDNA3.1-prME-5AA-STING plasmid for mutation-free conditions.

9. Use of the DNA vaccine plasmid of Tembusu virus according to any one of claims 1 to 3 or the DNA vaccine plasmid of Tembusu virus constructed by the construction method of the DNA vaccine plasmid of Tembusu virus according to any one of claims 4 to 8 in a Tembusu virus vaccine.

10. The use of the DNA vaccine plasmid of Tembusu virus according to claim 9, characterized in that: The DNA vaccine plasmid of Tembusu virus expresses the structural proteins of duck Tembusu virus to assemble into subviral particles, and co-expresses the immune stimulator STING molecule.

Images