Method for eliminating O-xyloylation modification of recombinant protein

By using the CRISPR/Cas9 system to knock out the Xylt2 gene in mammalian cells, the problem of O-xylosylation modification of recombinant proteins was solved, the homogeneity and stability of recombinant proteins were improved, the production risk was reduced, and efficient quality control was achieved.

CN120683174APending Publication Date: 2025-09-23SHANGHAI WUXI BIOLOGIC TECH CO LTD
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202410334011.7
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2024-03-22
Publication Date
2025-09-23

AI Technical Summary

Technical Problem

Existing technologies make it difficult to effectively eliminate O-xylosylation modification on recombinant proteins without changing the amino acid sequence of the G4S linker, leading to problems such as product stability and immunogenicity, and large differences in production batches, affecting product quality control.

Method used

By designing an sgRNA sequence targeting the Xylt2 gene, the CRISPR/Cas9 system was used to knock out the Xylt2 gene in mammalian cells, reducing the O-xylosyltransferase activity of the host cells, thereby eliminating the O-xylosylation modification of the recombinant protein.

Benefits of technology

This method significantly reduces the O-xylosylation modification of the recombinant protein without changing the G4S linker sequence, improves the homogeneity and stability of the recombinant protein, reduces the difficulty and risk of production quality control, and avoids potential effects on the protein structure.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure HDA0004754462790000011
    Figure HDA0004754462790000011
  • Figure HDA0004754462790000012
    Figure HDA0004754462790000012
  • Figure HDA0004754462790000013
    Figure HDA0004754462790000013
Patent Text Reader

Abstract

Provided herein is a method of eliminating O-xyloylation modification of a recombinant protein, comprising constructing a mammalian cell having reduced O-xyloylation activity. The cell construction comprises the following steps: transfecting a cell by using a CRISPR / Cas9 vector containing an sgRNA sequence of a targeted Xylt2 gene; and harvesting the transformed cell with the O-xylosylation activity reduced and the Xylt2 gene knocked out.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of biopharmaceuticals, and more particularly to a method for eliminating O-xylosylation modification on recombinant proteins. Background Art

[0002] In recent years, with the tremendous success of biopharmaceuticals, especially monoclonal antibodies, in the treatment of tumors and immune diseases, more complex biopharmaceuticals, such as bispecific antibodies, antibody-drug conjugates (ADCs), and Fc fusion proteins, are being developed to meet growing clinical needs. The flexible connexin (G4S)n linker, composed of GGGGS repeating peptides of varying lengths, is widely used to connect peptides of different regions in complex proteins due to its high structural flexibility and resistance to protease degradation.

[0003] Controlling post-translational modification (PTM) of recombinant proteins is crucial to product quality. Glycosylation is the most common form of PTM in recombinant proteins, and mainly includes two forms: N-glycosylation and O-glycosylation. N-glycosylation generally occurs on aspartic acid within the conserved motif (aspartic acid-X-serine / threonine) of recombinant proteins. O-glycosylation often occurs on serine or threonine residues, but the motif is not conserved. Due to the potential impact of glycoform levels on the in vivo half-life, stability, activity, and immunogenicity of recombinant proteins, glycoform control is particularly important for the development of such drugs.

[0004] In 2013, Wen et al. first reported that Ser in the (G4S)n linker with n>2 in bispecific antibodies or fusion proteins expressed in Chinese hamster ovary cells (CHO) would undergo O-xylosylation modification. The level of O-xylosylation increased with the number of GSG repeat motifs and had a certain degree of clone specificity (Analytical Chemistry 2013, 85(9), 4805–12). In the same year, Spencer et al. found that the O-glycosylation group on the G4S linker was a structure with xylose as the core. This sugar chain structure was very similar to the core sugar chain structure of proteoglycans such as chondroitin sulfate and heparin sulfate. The xylose binding site of both is on serine, and it is speculated that both may be catalyzed by O-xylosyl transferase. In addition, the O-xylosylation level of the G4S linker in the fusion protein expressed by HEK293 cells is approximately 10 times higher than that expressed by CHO cells (David Spencer et al., Journal of Pharmaceutical Sciences 2013, 102(11), 3920–3924.). O-xylosylation increases the heterogeneity of the recombinant protein, which may further affect product stability, activity, and immunogenicity. Production batch differences pose a serious challenge to product quality control. Therefore, eliminating O-xylosylation on the G4S linker is a problem and challenge that needs to be solved urgently.

[0005] WO2012 / 088461 and WO2019 / 233842 have reported that altering the GSG residue sequence in the G4S linker can reduce or eliminate O-xylosylation levels, thereby improving the homogeneity and stability of recombinant proteins. Wen et al. also reported that mutating the S residue in the G4S linker to A or the G residue after S to Proline can completely eliminate O-xylosylation. However, due to the characteristics of the G4S polypeptide itself, altering its sequence may affect its flexibility or sensitivity to proteolytic enzymes. An ideal solution would be to eliminate O-xylosylation without altering the G4S linker protein sequence, and such a method is urgently needed in this field. Summary of the Invention

[0006] The present invention provides methods and materials that can eliminate O-xylosylation modification of recombinant proteins without changing the G4S linker protein sequence. Specifically, the present invention eliminates O-xylosylation modification of recombinant proteins, especially O-xylosylation modification on the G4S linker, by reducing the activity of host cell O-xylosyltransferase. The present invention designs an sgRNA sequence targeting a specific exon of the Xylt2 gene, and transfects the sgRNA sequence and the encoding endonuclease sequence into mammalian cells. Under the guidance of the sgRNA, the endonuclease cuts the target sequence site, causing the intracellular non-homologous recombination repair (NHEJ) mechanism, thereby introducing base insertions or deletions, which in turn leads to frameshift mutations in the Xylt2 gene or the premature introduction of stop codons, ultimately making the Xylt2 gene unable to translate into normal Xylt2 protein. Inactivated Xylt2 cannot exert its O-xylosyltransferase activity and cannot add xylose to the serine of the G4S linker. Therefore, the recombinant protein expressed by cells with the Xylt2 gene knocked out does not have O-xylosylation modification on the G4S linker. The present invention not only specifically knocks out the Xylt2 gene in mammalian cells to eliminate O-xylosylation modification, but also has no significant impact on the growth and metabolism of the cells themselves. Furthermore, it avoids the potential impact of altering the amino acid sequence of the G4S linker of the recombinant protein itself, reduces the complexity of the recombinant protein PTM, improves homogeneity, and significantly reduces the difficulty and risk of quality control in recombinant protein production.

[0007] In one aspect, the present invention provides a method for eliminating O-xylosyltransferase activity in host cells, the method comprising: a) transfecting cells with a CRISPR / Cas9 vector comprising an sgRNA sequence targeting the Xylt2 gene; and b) harvesting transformed cells with reduced O-xylosylation activity in which the Xylt2 gene is knocked out.

[0008] The present invention also provides mammalian cells constructed using the above-mentioned method of the present invention.

[0009] The present invention also provides a mammalian cell, wherein the genomic Xylt2 sequence thereof has a deletion corresponding to position 1760640 of the sequence shown in NCBI accession number NW_003613846.1.

[0010] The present invention also provides a method for eliminating O-xylosylation modification of a recombinant protein, comprising using the aforementioned cell provided by the present invention as a host cell to express the recombinant protein.

[0011] The present invention also provides an sgRNA for knocking out the xytl2 gene using the CRISPR / Cas9 system, wherein the sequence of the sgRNA is selected from:

[0012] i. the nucleotide sequence consisting of positions 2 to 20, the nucleotide sequence consisting of positions 1 to 20, the nucleotide sequence consisting of positions 1 to 23, or the nucleotide sequence consisting of positions 2 to 23 in SEQ ID NO: 1;

[0013] ii. the nucleotide sequence consisting of positions 2-20, the nucleotide sequence consisting of positions 1-20, the nucleotide sequence consisting of positions 1-23, or the nucleotide sequence consisting of positions 2-23 of SEQ ID NO: 2;

[0014] iii. the nucleotide sequence consisting of positions 2 to 20 or the nucleotide sequence consisting of positions 1 to 20 in SEQ ID NO: 3;

[0015] iv. the nucleotide sequence consisting of positions 2-20 or the nucleotide sequence consisting of positions 1-20 in SEQ ID NO: 4; and

[0016] v. A nucleotide sequence obtained by replacing T bases in any of the above sequences with U bases.

[0017] The present invention also provides an sgRNA primer pair for knocking out the xytl2 gene using the CRISPR / Cas9 system, selected from:

[0018] i. a forward primer having a sequence as shown in SEQ ID NO: 5, and

[0019] A reverse primer having a sequence as shown in SEQ ID NO: 6;

[0020] ii. a forward primer having a sequence as shown in SEQ ID NO: 7, and

[0021] A reverse primer having a sequence as shown in SEQ ID NO: 8;

[0022] iii. a forward primer having a sequence as shown in SEQ ID NO: 9, and

[0023] A reverse primer with a sequence as shown in SEQ ID NO: 10;

[0024] iv. a forward primer having a sequence as shown in SEQ ID NO: 11, and

[0025] The reverse primer has a sequence as shown in SEQ ID NO: 12.

[0026] The present invention also provides a CRISPR / Cas9 vector comprising the sgRNA of the present invention as described above.

[0027] The present invention also provides a kit for reducing host cell O-xylosyltransferase activity and a kit for eliminating recombinant protein O-xylosylation modification, comprising the sgRNA of the present invention as described above. In some embodiments, the sgRNA is contained in the primer pair of the present invention or the vector of the present invention as described above. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] The drawings in the specification are used to assist in understanding the technical solutions, technical features, and technical effects of the present invention. The drawings may be used to explain the claims but do not constitute a limitation on the scope of protection of the claims.

[0029] Figure 1 Agarose gel electrophoresis analysis of the proportion of INDELs generated in different cell populations 24 hours after transfection. "M" represents Tiangen MD101 DNA marker I; "1-2" represent the results of PCR products from negative control cell populations transfected with scramble sequences instead of sgRNA, before and after T7 endonuclease digestion; "3" to "10" represent the results of PCR products from cell populations transfected with different sgRNAs, before and after T7 endonuclease digestion. Cell populations 3 and 4 were transfected with sgRNA1, cell populations 5 and 6 were transfected with sgRNA2, cell populations 7 and 8 were transfected with sgRNA3, and cell populations 9 and 10 were transfected with sgRNA4.

[0030] Figure 2 :The results of heparin sulfate resistance flow cytometry analysis of different clones. Among them, the "wild-type clone" is the clone without Xylt2 gene knockout, which was obtained by monoclonal sorting from the negative control cell group transfected with Scramble sequence instead of sgRNA; the "negative control" is the unstained result of the wild-type clone; the "positive control" is the stained result of the wild-type clone. "Clone 1" corresponds to sgRNA1, which is Figure 1 The cell population shown in Figure 4 was obtained by monoclonal sorting.

[0031] Figure 3 : A partial enlarged view of the alignment of the sequencing of clone 1 with NW_003613846.1, showing the deletion corresponding to position 1760640 of NW_003613846.1.

[0032] Figure 4 Figure A: O-xylosylation results of dual antibody containing G4S linker secreted by wild-type clone; Figure B: O-xylosylation results of dual antibody containing G4S linker secreted by Xylt2 gene knockout clone 1. DETAILED DESCRIPTION

[0033] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the invention belongs. All publications, patent applications, patents and other references mentioned herein are incorporated by reference in their entirety to form the disclosure herein.

[0034] Herein, unless otherwise specified, numerical values, regardless of whether or not they are accompanied by approximate expressions such as "approximately", "around", or "nearly", include the listed numerical values ​​themselves and numerical values ​​within a certain range of difference that can be understood by those skilled in the art to be equivalent thereto, such as a range of ±25, ±20%, ±15%, ±10%, ±9%, ±8%, ±7%, ±6%, ±5%, ±4%, ±3%, ±2%, ±1% or smaller.

[0035] Herein, unless otherwise specified, “a” or “1” before a name, quantifier or unit indicates the presence or quantity of at least one, thus encompassing a plural meaning.

[0036] Unless otherwise specified herein, numerical ranges expressed as endpoints are deemed to specifically disclose both endpoints and all real numbers between those endpoints, as well as any combinations thereof. Unless otherwise specified, when multiple optional numerical ranges or values ​​are specifically described for the same indicator or parameter, those endpoints and values ​​may be combined in any manner, and the resulting ranges are expressly disclosed herein.

[0037] In this document, features such as steps arranged with letters or numbers such as "a", "b", ..., "I", "II", ..., "(first) (1)", "(second) (2)", etc., have no ordering meaning, only distinction or counting meaning, unless otherwise specified.

[0038] Herein, "elimination" is synonymous with "reduction", including reducing the level of the target parameter or indicator to zero in theory, zero in practice, or undetectable, i.e., below the detection limit. For example, "elimination" and "reduction" can be characterized as a reduction in the level of the target parameter or indicator compared to a comparable control in which the method of the present invention is not implemented. Those skilled in the art know how to set comparable controls in comparative experiments. For example, in one embodiment, "reduction in O-xylosylation activity" can be characterized as a reduction in O-xylosylation activity compared to a matched control cell line containing a wild-type Xylt2 gene. For another example, in one embodiment, "elimination of O-xylosylation modification of a recombinant protein" can be characterized as a reduction in the level of O-xylosylation compared to a recombinant protein expressed by a matched control host cell containing a wild-type Xylt2 gene.

[0039] The present invention provides a method for constructing mammalian cells with reduced O-xylosylation activity, comprising: a) transfecting cells with a CRISPR / Cas9 vector comprising an sgRNA sequence targeting the Xylt2 gene; and b) harvesting the transformed cells with reduced O-xylosylation activity in which the Xylt2 gene is knocked out.

[0040] In this article, "Xylt2 knockout" refers to the inability of cells to express a functional Xylt2 enzyme through CRISPR editing of the Xylt2 gene. This includes situations where one or more deletions, insertions, or substitutions within the Xylt2 gene occur. This can be characterized by reduced Xylt2 enzyme activity and / or reduced O-xylosylation levels.

[0041] In one embodiment, the sgRNA sequence targets an exon of the Xylt2 gene, and the exon is selected from exon 1, exon 2, exon 3, exon 8, and a combination thereof. In some specific embodiments, the sgRNA sequence is an sgRNA sequence targeting exon 2, targeting exon 8, or a combination thereof.

[0042] Herein, "sgRNA sequence" refers to the sequence used to characterize an sgRNA. This can refer to either an RNA sequence containing U bases or a DNA sequence derived by replacing U bases with T bases. The latter is typically used to construct sgRNA primers and CRISPR vectors. Because the sgRNA sequence derived by replacing U bases with T bases corresponds exactly to the sense strand sequence of its target site, it is also referred to as the "sgRNA target sequence."

[0043] As one of the contents, the present invention provides an sgRNA for knocking out the xytl2 gene using the CRISPR / Cas9 system, wherein the sgRNA sequence is selected from:

[0044] i. the nucleotide sequence consisting of positions 2 to 20, the nucleotide sequence consisting of positions 1 to 20, the nucleotide sequence consisting of positions 1 to 23, or the nucleotide sequence consisting of positions 2 to 23 in SEQ ID NO: 1;

[0045] ii. the nucleotide sequence consisting of positions 2-20, the nucleotide sequence consisting of positions 1-20, the nucleotide sequence consisting of positions 1-23, or the nucleotide sequence consisting of positions 2-23 of SEQ ID NO: 2;

[0046] iii. the nucleotide sequence consisting of positions 2 to 20 or the nucleotide sequence consisting of positions 1 to 20 in SEQ ID NO: 3;

[0047] iv. the nucleotide sequence consisting of positions 2-20 or the nucleotide sequence consisting of positions 1-20 in SEQ ID NO: 4; and

[0048] v. A nucleotide sequence obtained by replacing T bases in any of the above sequences with U bases.

[0049] As one of the contents, the present invention provides a CRISPR / Cas9 vector comprising the sgRNA sequence of the present invention. Herein, "CRISPR / Cas9 vector" refers to a CRISPR vector or vector system comprising a Cas9 sequence, and is also referred to herein as a "CRISPR vector" or "Cas9 vector". The vector can be, for example, a viral vector or a plasmid. Among them, the Cas9 protein and gRNA can be contained in the same vector, or they can be contained in different vectors to form a co-transfection vector system. The gRNA includes a customized sgRNA sequence and a downstream gRNA scaffold sequence thereof. In one embodiment, the preparation of the CRISPR / Cas9 vector of the present invention includes cloning the sgRNA sequence into a CRISPR starting vector comprising a Cas9 sequence and a gRNA scaffold sequence. In one embodiment, the CRISPR starting vector is a single vector comprising both a Cas9 sequence and a gRNA scaffold sequence. CRISPR starting vectors are widely available commercially, such as lentiCRISPRv2, pX260, pX330, hCas9, etc. In some embodiments, the CRISPR / Cas9 vector is constructed using the pX330 plasmid as a starting vector and contains the pX330 plasmid containing the sgRNA sequence.

[0050] As used herein, unless otherwise specified or a specific meaning can be inferred from the context, "transfection" and "transformation" are synonymous and both broadly refer to the introduction of exogenous genes into recipient cells (also known as host cells). When "transformation" is used as an attributive and modifier, such as in "transformed cells," it broadly refers to cells that contain the introduced exogenous genes.

[0051] Typically, constructing a CRISPR / Cas9 vector containing an sgRNA involves synthesizing two complementary oligonucleotides, also known as "primers," one of which contains the sgRNA sequence. This pair of primers is then annealed to form a double stranded strand that is then ligated into the starting vector to construct the CRISPR / Cas9 vector containing the sgRNA. Therefore, the present invention also provides an sgRNA primer pair for knocking out the xytl2 gene using the CRISPR / Cas9 system, selected from:

[0052] i. a forward primer having a sequence as shown in SEQ ID NO: 5, and

[0053] A reverse primer having a sequence as shown in SEQ ID NO: 6;

[0054] ii. a forward primer having a sequence as shown in SEQ ID NO: 7, and

[0055] A reverse primer having a sequence as shown in SEQ ID NO: 8;

[0056] iii. a forward primer having a sequence as shown in SEQ ID NO: 9, and

[0057] A reverse primer with a sequence as shown in SEQ ID NO: 10;

[0058] iv. a forward primer having a sequence as shown in SEQ ID NO: 11, and

[0059] The reverse primer has a sequence as shown in SEQ ID NO: 12.

[0060] Preferably, step b), i.e., harvesting Xylt2 gene-knockout transformed cells with reduced O-xylosylation activity, comprises selecting monoclonal cells from the transformed cell population for subsequent expansion and culture. In some embodiments, the present invention utilizes single cell printing (SCP) to obtain Xylt2 gene-knockout monoclonal cells.

[0061] Preferably, the present invention also includes testing the knockout cells for O-xylosylation levels, and optionally, cells with low O-xylosylation levels can be selected accordingly. Preferably, in some embodiments, anti-heparan sulfate (HS) flow cytometry is used to detect cells with reduced O-xylosylation levels. The first glycosyl (xylose) of the HS sugar chain and the G4S linker O-xylose sugar chain is catalyzed by the xylosyltransferase encoded by the Xylt2 gene, and the expression of Xylt2 can be indirectly judged by the HS expression level. Since Xylt2 is expressed intracellularly and HS is a membrane protein, the flow cytometry method can more conveniently and quickly detect the expression of membrane proteins, so clones with low O-xylosylation levels can be obtained by screening clones with low HS expression by the flow cytometry method.

[0062] In some embodiments, the anti-HS flow cytometric analysis comprises the following steps:

[0063] 1) After collecting cloned cells by centrifugation, fix the cells with paraformaldehyde solution (e.g., approximately 4% concentration) at room temperature for 15-30 minutes;

[0064] 2) Wash the cells, stain them with HS antibody solution, and incubate at room temperature for about 1 to 2 hours;

[0065] 3) washing the cells and incubating the cells with the secondary antibody solution in the dark for about 0.5 to 1 hour; and

[0066] 4) After washing the cells, analyze the cells using a flow cytometer.

[0067] The method of the present invention is applicable to various host cells to knock out Xylt2 and thus reduce the O-xylose level of the expression product. In some embodiments, the host cell is a mammalian cell, such as a CHO cell. The expression product can be any recombinant protein, such as a monoclonal antibody, an engineered antibody such as a bispecific, multispecific antibody, or a various fusion protein, such as an Fc fusion protein. In some embodiments, the fusion protein comprises a (G4S)n linker. At this time, the present invention can eliminate O-xylosylation modification without changing the G4S linker protein sequence. Herein, "(G4S)n" is synonymous with "G4S linker", and n is a natural number greater than or equal to 1; in some cases, n is greater than or equal to 2, such as 3, 4, 5 or greater. In some embodiments, the host cell expresses a human IgG1 bispecific antibody containing a G4S linker, such as a human IgG1 bispecific antibody formed by connecting an IgG1 and a single-chain Fv fragment via a G4S linker.

[0068] The present invention also provides a mammalian cell with reduced O-xylosylation activity, constructed using the method of the present invention. The present invention also provides a mammalian cell having a genomic Xylt2 sequence having a deletion corresponding to position 1,760,640 of the sequence set forth in NCBI Accession No. NW_003613846.1, exhibiting reduced O-xylosylation activity. In some embodiments, the cell is a mammalian cell, such as a CHO cell.

[0069] Based on the cells obtained by the present invention, the present invention also provides a method for eliminating O-xylosylation modification of a recombinant protein, comprising using the cells of the present invention as host cells to express the recombinant protein. The recombinant protein can be any recombinant protein, such as a monoclonal antibody, an engineered antibody such as a bispecific or multispecific antibody, or various fusion proteins, such as an Fc fusion protein. In some embodiments, the fusion protein comprises a (G4S)n linker.

[0070] In addition, the present invention also provides a kit for reducing host cell O-xylosyltransferase activity and a kit for eliminating recombinant protein O-xylosylation modification, which contain the sgRNA of the present invention described above. In some embodiments, the sgRNA is contained in the primer pair of the present invention or the vector of the present invention described above, that is, the primer pair and the vector contain the sequence of the sgRNA. In other words, in some embodiments, the kit of the present invention contains the CRISPR / Cas9 vector of the present invention described above and / or the sgRNA primer pair described above that can be used to construct the CRISPR / Cas9 vector of the present invention and can be used to knock out the xytl2 gene using the CRISPR / Cas9 system. The kit also contains instructions for constructing cells according to the method of the present invention and / or instructions for eliminating recombinant protein O-xylosylation modification according to the method of the present invention. The instructions can be physical instructions, such as a manual included in the kit packaging or printed on the packaging material, or they can be electronic instructions accessed through address information such as a link or QR code provided on the packaging.

[0071] Example

[0072] The technical solutions of the present invention will be described in more detail below with reference to specific embodiments. The following embodiments are merely illustrative and do not constitute any limitation or restriction on the technical solutions of the present invention. The specific materials, steps, conditions, values, or numerical ranges and other technical parameters in the following embodiments are merely examples and are not exhaustive or limiting.

[0073] I. Construction of the CRISPR / Cas9 System

[0074] Step 1: Design and select sgRNA target sequences for the exons of the target gene Xylt2, and design and synthesize primers based on the selected sgRNA target sequences.

[0075] The target gene Xylt2 sequence was obtained from the NCBI Reference Sequence: NW_003613846.1 (https: / / www.ncbi.nlm.nih.gov / nuccore / NW_003613846.1). The sequence from positions 1756631 to 1763880 represents the coding gene for Xylt2, with gene ID 100759604. The gene is 7250 bp long. Exon analysis was performed using the NCBI website https: / / www.ncbi.nlm.nih.gov / gene / 100759604. sgRNA target sequences were designed and selected using the online sgRNA design software http: / / chopchop.cbu.uib.no / . The main principle for primer design was to include a BbsI restriction site at the 5' end of the primer; if the first base of the target sequence was not G, it was replaced with G. The specific sgRNA target sequence, exon, and primer sequences are shown below:

[0076] Target sequence:

[0077] sgRNA1:CGTCTTAGGTTTGAGCCCAGGGG (SEQ ID NO: 1), located in exon 8;

[0078] sgRNA2: GCGGGTGACACCTTGGCGCATGG (SEQ ID NO: 2), located in exon 3;

[0079] sgRNA3:ACCATGAACCACCAGCATGT (SEQ ID NO: 3), located in exon 2;

[0080] sgRNA4: GAGGCACTAATGGGCGCTGC (SEQ ID NO: 4), located in exon 1;

[0081] Primer sequences ("F" indicates forward primer, "R" indicates reverse primer):

[0082] sgRNA1-F:CACCGGTCTTAGGTTTGAGCCCAG(SEQ ID NO:5)

[0083] sgRNA1-R:AAACCTGGGCTCAAACCTAAGACC(SEQ ID NO:6)

[0084] sgRNA2-F:CACCGCGGGTGACACCTTGGCGCA(SEQ ID NO:7)

[0085] sgRNA2-R:AAACTGCGCCAAGGTGTCACCCGC (SEQ ID NO:8)

[0086] sgRNA3-F:CACCGCCATGAACCACCAGCATGT(SEQ ID NO:9)

[0087] sgRNA3-R:AAACACATGCTGGTGGTTCATGGC (SEQ ID NO:10)

[0088] sgRNA4-F:CACCGAGGCACTAATGGGCGCTGC (SEQ ID NO:11)

[0089] sgRNA4-R:AAACGCAGCGCCCATTAGTGCCTC (SEQ ID NO:12)

[0090] Step 2: Clone the sgRNA sequence into the starting vector to obtain a vector that co-expresses sgRNA and endonuclease, that is, a CRISPR / Cas9 vector system containing sgRNA (hereinafter referred to as the second vector).

[0091] Specifically, the above primer pairs were annealed to obtain a double-stranded DNA insert with sticky ends. The annealing reaction conditions were 95°C for 5 minutes, 95°C-85°C at -1°C / s, and 85°C-25°C at -0.1°C / s. The starting vector px330 was digested with BbsI endonuclease, recovered by agarose gel electrophoresis, and purified to obtain an enzyme-digested vector fragment. The enzyme digestion reaction conditions were 37°C for 120 minutes. The insert and the enzyme-digested vector fragment were ligated using Solution I (TaKaRa), transformed into competent E. coli TOP10 cells (Tiangen), and extracted and purified using an endotoxin-free plasmid extraction kit (Macherey-Nagel, 740549) to obtain a second vector.

[0092] II. Transfection and Knockout

[0093] The cells are transfected with a second vector, a CRISPR / Cas9 vector containing sgRNA, to knock out the Xylt2 gene, thereby forming Xylt2 gene knockout transformed cells. The details are as follows:

[0094] Step 3: Transfect the second vector into suspension cultured CHO-K1 cells using electroporation. After culturing for 24-48 hours, take a portion of the cells, centrifuge and precipitate the cells for later use.

[0095] III. CRISPR Editing Efficiency Test

[0096] The T7E1 assay was used to determine the editing efficiency of each sgRNA. The details are as follows:

[0097] Step 4: Based on the sgRNA target sequence, design and synthesize amplification primers before and after the target position:

[0098] sgRNA1-F:TTAAGCAGGATGAAGAAGAGCC (SEQ ID NO: 13),

[0099] sgRNA1-R: CCTGGAAATGGTCGTCATAGA (SEQ ID NO: 14);

[0100] sgRNA2-F:ACTTGCTCTGTCCCTTCTGTGT (SEQ ID NO:15),

[0101] sgRNA2-R: CTCAGGTTGATGAAGAAGTCCC (SEQ ID NO: 16);

[0102] sgRNA3-F: AGGCTTCCGAGTCTAGCTTCTT (SEQ ID NO: 17),

[0103] sgRNA3-R: TCTTCCCAGTCCACAGTACCTT (SEQ ID NO: 18);

[0104] sgRNA4-F: GTAGGGGCAGTGCTGGTAAA (SEQ ID NO: 19),

[0105] sgRNA4-R: CACTTTGGAGTGAAGCTGTTGT (SEQ ID NO: 20).

[0106] The transformed cell sample with the target gene knocked out by transfection was used as a template to perform PCR reaction to obtain a PCR product containing the target gene fragment. Specifically, genomic DNA of the transformed cells was extracted using the DNeasy genomic extraction kit (QIAGEN). The PCR reaction was performed using the High-Fidelity 2X Master Mix PCR Kit according to the instructions in the kit's manufacturer's instructions. The PCR amplification program was as follows: 98°C for 2 minutes; denaturation at 98°C for 15 seconds, annealing at 60°C for 30 seconds, and extension at 72°C for 30 seconds; followed by 35 cycles of extension at 72°C for 5 minutes, and storage at 4°C.

[0107] Step 5: Purify and recover the PCR product amplified in step 4, then denature and anneal to form a polymer. The denaturation and annealing polymerization reaction conditions are: 95°C, 5 minutes, 95°C-85°C at 2°C / s, and 85°C-25°C at 0.1°C / s.

[0108] Step 6: The polymerized product obtained in step 5 was digested with Vazyme T7 endonuclease I, and then the digested product was analyzed by 2% agarose gel electrophoresis to obtain the proportion of INDELs in each cell population, such as Figure 1 The proportion of INDELs in cell populations 1-2, which served as negative controls, was approximately 0%, while the proportions of INDELs in cell populations 3-10 were approximately 9.7%, 10.2%, 8.0%, 7.5%, 6.9%, 10.5%, 5.7%, and 4.6%, respectively.

[0109] IV. Single clone picking and expansion

[0110] SCP was used to pick single clones of knockout cells from a high-indole cell population and amplify the selected single clones. The details are as follows:

[0111] Step 7: Cell populations 4 and 8 were selected for SCP monoclonal sorting, and sorted into 96-well cell plates at a rate of one cell per well. The cells were cultured at 36.5° C. for 7-11 days until the confluence reached 60-70%.

[0112] V. Screening for clones with low O-xylosylation levels

[0113] Step 8: Perform anti-heparin sulfate (HS) flow cytometric analysis on the amplified monoclonal cells to screen out candidate clones with low O-xylosylation levels. The details are as follows:

[0114] Clones were screened using homogeneous time-resolved fluorescence (HTRF). Recovered clones were expanded into 24-well plates and screened for anti-HS staining using flow cytometry: cells were collected by centrifugation and fixed with 4% paraformaldehyde for approximately 15 minutes at room temperature. After washing with PBS, the HS antibody Anti-Heparan Sulfate (10E4 epitope) (amsbio) was diluted 1:500 in 0.5% BSA (PBS) and incubated at room temperature for approximately 1-2 hours. After washing, the secondary antibody Goat anti-Mouse IgM, FITC (invitrogen) was diluted 1:1000 in 0.5% BSA and incubated at room temperature in the dark for 0.5-1 hour. After washing, the cells were analyzed by flow cytometry.

[0115] The flow cytometry analysis results are shown in Figure 2 The wild-type clone had a higher HS expression level, while the representative clone 1 had a significantly lower HS expression level than the wild-type clone. Therefore, clone 1 was selected as a candidate clone and expanded into a shake tube for culture. The "wild-type clone" was a clone in which the Xylt2 gene was not knocked out, and was obtained by single-clone sorting from a negative control cell population transfected with the Scramble sequence instead of sgRNA; the "clone 1" was transfected with sgRNA1 and was obtained by Figure 1 The cell population shown in Figure 4 was obtained by monoclonal sorting.

[0116] VI. Sequencing Verification of Successful Xylt2 Knockout

[0117] Step 9: Perform Sanger sequencing on the candidate clones to verify the successful knockout of Xylt2. Specific steps include: extracting the genome of the candidate monoclonal cells above, taking 50-100 ng of genomic DNA as a PCR template; designing sequencing primers for the target gene fragment, and performing PCR amplification on the genomic DNA of the candidate clones. Sequencing primer sequences include:

[0118] sgRNA1-F: CACTGGCACTCTGCAGGTAA (SEQ ID NO: 21),

[0119] sgRNA1-R: ATGGAGTCCTTACCCCTCCC (SEQ ID NO: 22);

[0120] sgRNA3-F: AGTCTGGACCTCAACTTGCC (SEQ ID NO: 23),

[0121] sgRNA3-R: GAAGTGATGTGGCCCAGATC (SEQ ID NO: 24).

[0122] The PCR reaction conditions were as follows: 35 cycles of 98°C for 10s, 60°C for 5s, and 72°C for 30s, followed by annealing and extension at 72°C for 5min. The PCR products were recovered by agarose gel electrophoresis and purified before Sanger sequencing.

[0123] The sequencing results are as follows Figure 3 As shown, according to the base numbering of NCBI Reference Sequence: NW_003613846.1, a base deletion occurred at position 1760640 in the target gene Xylt2 of clone 1. The above mutation caused the Xylt2 gene to be knocked out.

[0124] VII. Expression of Recombinant Protein and Detection of O-Xylose Levels

[0125] Step 10: Expand and culture the clones with successful Xylt2 knockout, express and harvest the recombinant protein, and obtain the recombinant protein without O-xylosylation modification. The details are as follows.

[0126] The clone with the Xylt2 gene successfully knocked out was expanded and cultured at 36.5°C, 6% CO2, and 85% humidity. The clone recombinantly expressed a humanized IgG1 bispecific antibody formed by connecting IgG1 and a single-chain Fv fragment via a G4S linker. The expressed recombinant protein was harvested and tested by deglycosylation reduction mass spectrometry (DRM) to verify that it was free of O-xylosylation modification. The DRM results are as follows Figure 4 As shown in Figure 1 . The peaks at molecular weights of 77003.0 and 77134.0 in Figure A are xylosylation peaks, and the O-xylose level of the bispecific antibody secreted by the wild-type clone was measured to be 30.0%. Figure B shows that the O-xylose level of the bispecific antibody secreted by Xylt2 gene knockout clone 1 was below the detection limit, indicating that Xylt2 gene knockout effectively eliminates O-xylosylation on the bispecific antibody with a G4S linker.

Claims

1. A method for constructing a mammalian cell with reduced O-xylosylation activity, comprising: a) Transfecting cells with a CRISPR / Cas9 vector containing an sgRNA sequence targeting the Xylt2 gene; and b) Harvesting Xylt2 gene knockout transformed cells with reduced O-xylosylation activity.

2. The method of claim 1, wherein the sgRNA sequence targets an exon of the Xylt2 gene, and the exon is selected from exon 1, exon 2, exon 3, exon 8, and a combination thereof.

3. The method according to claim 1, wherein The sgRNA sequence is selected from: i. the nucleotide sequence consisting of positions 2 to 20, the nucleotide sequence consisting of positions 1 to 20, the nucleotide sequence consisting of positions 1 to 23, or the nucleotide sequence consisting of positions 2 to 23 in SEQ ID NO: 1; ii. the nucleotide sequence consisting of positions 2-20, the nucleotide sequence consisting of positions 1-20, the nucleotide sequence consisting of positions 1-23, or the nucleotide sequence consisting of positions 2-23 of SEQ ID NO: 2; iii. the nucleotide sequence consisting of positions 2 to 20 or the nucleotide sequence consisting of positions 1 to 20 in SEQ ID NO: 3; iv. the nucleotide sequence consisting of positions 2-20 or the nucleotide sequence consisting of positions 1-20 in SEQ ID NO: 4; and v. A nucleotide sequence obtained by replacing T bases in any of the above sequences with U bases.

4. The method according to claim 1, wherein Also has one or more of the following characteristics: a) the CRISPR / Cas9 vector is a pX330 plasmid containing the sgRNA sequence; b) Step b) comprises obtaining Xylt2 gene knockout monoclonal cells by SCP sorting; c) step b) comprises selecting cells with reduced O-xylosylation levels by anti-heparin sulfate flow cytometry; and / or d) The mammalian cells are CHO cells.

5. A mammalian cell, characterized in that One or more of the following: a) constructed using the method of claim 1; b) its genomic Xylt2 sequence has a deletion corresponding to position 1760640 of the sequence set forth in NCBI accession number NW_003613846.1; c) The cells are CHO cells.

6. A method for eliminating O-xylosylation modification of a recombinant protein, comprising using the cell of claim 5 as a host cell to express the recombinant protein.

7. An sgRNA for knocking out the Xytl2 gene using the CRISPR / Cas9 system, wherein the sequence of the sgRNA is selected from: i. the nucleotide sequence consisting of positions 2 to 20, the nucleotide sequence consisting of positions 1 to 20, the nucleotide sequence consisting of positions 1 to 23, or the nucleotide sequence consisting of positions 2 to 23 in SEQ ID NO: 1; ii. the nucleotide sequence consisting of positions 2-20, the nucleotide sequence consisting of positions 1-20, the nucleotide sequence consisting of positions 1-23, or the nucleotide sequence consisting of positions 2-23 of SEQ ID NO: 2; iii. the nucleotide sequence consisting of positions 2 to 20 or the nucleotide sequence consisting of positions 1 to 20 in SEQ ID NO: 3; iv. the nucleotide sequence consisting of positions 2-20 or the nucleotide sequence consisting of positions 1-20 in SEQ ID NO: 4; and v. A nucleotide sequence obtained by replacing T bases in any of the above sequences with U bases.

8. sgRNA primer pairs for knocking out the xytl2 gene using the CRISPR / Cas9 system, selected from: i. a forward primer having a sequence as shown in SEQ ID NO: 5, and A reverse primer having a sequence as shown in SEQ ID NO: 6; ii. a forward primer having a sequence as shown in SEQ ID NO: 7, and A reverse primer having a sequence as shown in SEQ ID NO: 8; iii. a forward primer having a sequence as shown in SEQ ID NO: 9, and A reverse primer with a sequence as shown in SEQ ID NO: 10; iv. a forward primer having a sequence as shown in SEQ ID NO: 11, and The reverse primer has a sequence as shown in SEQ ID NO:

12.

9. A CRISPR / Cas9 vector comprising an sgRNA sequence selected from i) to iv) of claim 7; and / or, the vector can be, for example, a pX330 plasmid comprising the sgRNA.

10. A kit comprising: The sgRNA according to claim 7, and Instructions for constructing a cell according to the method of claim 1; and / or The sgRNA is contained in the primer pair of claim 8 or the vector of claim 9.

Citation Information

Patent Citations

  • Linker peptides and polypeptides comprising same

    WO2012088461A2

  • Peptidic linker with reduced post-translational modification

    WO2019233842A1