Visual pathogen gene in-vitro rapid detection method
By combining loop-mediated isothermal amplification and water-soluble conjugated polymer polythiophene (PMNT), the problems of slow speed and low specificity of pathogenic bacteria gene detection have been solved, and rapid and sensitive pathogenic bacteria gene detection has been achieved, which is suitable for fields such as medicine and epidemic monitoring.
Patent Information
- Application Number
- CN202410328760.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-03-21
- Publication Date
- 2025-09-23
AI Technical Summary
Existing pathogen gene testing is slow, complex to operate, and has low specificity, making it difficult to achieve rapid and sensitive diagnosis of pathogens.
A loop-mediated isothermal amplification method was used in combination with the water-soluble conjugated polymer polythiophene (PMNT). Pathogenic bacterial DNA was amplified through primer design, and visual detection was achieved through color change.
It achieves rapid (within 30 minutes) and highly sensitive pathogen gene detection, is suitable for portable instant testing, does not rely on expensive instruments, and the test results have visualization and relative quantitative capabilities.
Smart Images

Figure CN120683232A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of gene detection, and in particular to a method for rapid in vitro detection of visualized pathogenic bacteria genes. Background Art
[0002] Pathogenic bacteria pose an increasingly serious threat to human health, causing autoimmune diseases, inflammatory bowel disease, metabolic syndrome, and even neuropsychiatric disorders. The emergence of drug-resistant pathogens has further complicated the clinical diagnosis and treatment of pathogenic diseases. Therefore, rapid and sensitive detection of pathogens is crucial. Polymerase chain reaction (PCR), a key method for nucleic acid amplification and molecular diagnosis, offers advantages such as high sensitivity and specificity. However, PCR is time-consuming. Loop-mediated isothermal amplification (LAMP) performs nucleic acid amplification under isothermal conditions (60–65°C) and can be completed within 30–60 minutes, making it a promising alternative to molecular diagnostics.
[0003] LAMP is a simple and easy-to-use amplification reaction with four main signal output modes. During the LAMP reaction, the white precipitate produced as a byproduct of magnesium pyrophosphate indicates positive results, allowing direct visual observation to determine whether the amplification reaction is progressing. However, this method is generally only suitable for large-scale amplification products; it is difficult to detect short-term, micro-amplifications and can sometimes result in errors. Japan's Eiken Co., Ltd. has developed the LA-320C real-time endpoint turbidimeter specifically for LAMP detection, which allows for real-time monitoring of the LAMP amplification process. This method has the advantage of allowing direct, real-time observation of the amplification process, eliminating the error associated with visual observation of the white precipitate. However, its disadvantage is the high cost of the accompanying instrument, the LA-320C endpoint turbidimeter. Agarose gel electrophoresis is the gold standard for amplification detection, but the experimental time is very long. Summary of the Invention
[0004] The purpose of the present invention is to overcome the problems of slow pathogenic bacteria gene detection, complex operation, and low specificity in the existing technology, and to provide a method for rapid in vitro detection of pathogenic bacteria genes. This rapid pathogen detection method has high sensitivity and can obtain accurate diagnosis of pathogens in a short time.
[0005] In order to achieve the above object, the first aspect of the present invention provides a method for rapid in vitro detection of pathogenic bacteria genes by visualization, wherein the method comprises the following steps: S1, extracting DNA from the sample to be tested; S2, performing a loop-mediated isothermal amplification reaction on the DNA extracted from S1 in the presence of DNA polymerase buffer, strand-displacing DNA polymerase, and primer pairs; S3. The reaction solution obtained from the amplification reaction in S2 is mixed with the water-soluble conjugated polymer to react, and the color is observed for visual detection.
[0006] The second aspect of the present invention provides an application of a water-soluble conjugated polymer in in vitro detection of pathogenic bacteria genes.
[0007] A third aspect of the present invention provides an application of a primer pair in in vitro detection of pathogenic bacteria genes, wherein the pathogenic bacteria is Escherichia coli or Enterococcus faecalis; When the pathogenic bacteria is Escherichia coli, the primer pair includes: a primer with a nucleotide sequence shown in SEQ ID NO: 1, a primer with a nucleotide sequence shown in SEQ ID NO: 2, a primer with a nucleotide sequence shown in SEQ ID NO: 3, and a primer with a nucleotide sequence shown in SEQ ID NO: 4; When the target pathogen to be detected is Enterococcus faecalis, the primer pair includes: a primer with a nucleotide sequence shown in SEQ ID NO: 5, a primer with a nucleotide sequence shown in SEQ ID NO: 6, a primer with a nucleotide sequence shown in SEQ ID NO: 7, and a primer with a nucleotide sequence shown in SEQ ID NO: 8.
[0008] Through the above technical solution, the beneficial effects of the present invention include at least: This invention combines loop-mediated isothermal amplification with the visualization effect of the water-soluble conjugated polymer polythiophene (PMNT) to provide a simple, rapid, and efficient solution for pathogenic bacterial gene detection. Through optimized primer design, this invention can be applied not only to specific pathogens such as Escherichia coli, Candida albicans, and Enterococcus faecalis, but also to flexible combinations, enhancing the versatility of detection.
[0009] The present invention's distinguishing feature lies in the use of a water-soluble conjugated polymer. Polythiophene, when bound to nucleic acids, triggers a conformational change, resulting in a color change, enabling visible detection of target nucleic acids. This method is not only rapid (detection completed within 30 minutes) and sensitive, but also does not rely on expensive instrumentation, enabling portable, point-of-care testing. The detection sensitivity of PMNT is consistent with that of gel electrophoresis experiments, and PMNT allows for relative quantification of experimental products.
[0010] In summary, the present invention provides an innovative and easy-to-operate method for detecting pathogenic bacteria genes, which provides a new approach for early diagnosis of diseases. The wide applicability and simplicity of this method make it potentially widely used in fields such as medicine, biotechnology, and epidemic monitoring. The visual rapid pathogen detection method of the present invention is highly sensitive and can obtain accurate diagnosis of pathogenic bacteria in a short period of time. Based on the spatial structural effect of cationic conjugated polymers, the test results have an intuitive visualization effect. It is suitable for the detection of known pathogenic bacteria genes, provides specific probes and primers, and provides an effective means for the rapid detection of various pathogens. BRIEF DESCRIPTION OF THE DRAWINGS
[0011] Figure 1a Schematic diagram of gel electrophoresis results demonstrating the feasibility of loop-mediated isothermal amplification in Example 2 of the present invention; Figure 1b This is a schematic diagram of the feasibility visualization results after adding PMNT in Example 2 of the present invention; Figure 1c A after adding PMNT in Example 2 of the present invention 394nm / A 520nm Schematic diagram of absorbance detection results; Figure 1d Schematic diagram of absorbance spectrum detection results after adding PMNT in Example 2 of the present invention; Figure 2a Schematic diagram of the gel electrophoresis results of the detection limit experiment in Example 3 of the present invention; Figure 2b This is a diagram showing the visualization of the detection limit after adding PMNT in Example 3 of the present invention; Figure 2c A after adding PMNT in Example 3 of the present invention 394nm / A 520nm Schematic diagram of absorbance detection results; Figure 2d 3 is a schematic diagram of the absorbance spectrum detection results after adding PMNT in Example 3 of the present invention; Figure 3a This is a schematic diagram of the gel electrophoresis results with the shortest response time in Example 4 of the present invention; Figure 3b This is a schematic diagram of the visualization results of the shortest response time after adding PMNT in Example 4 of the present invention; Figure 3c A after adding PMNT in Example 4 of the present invention 394nm / A 520nm Schematic diagram of absorbance detection results; Figure 3d Schematic diagram of absorbance spectrum detection results after adding PMNT in Example 4 of the present invention; Figure 4a is a schematic diagram of the gel electrophoresis results of the Escherichia coli specific experiment in Example 5 of the present invention; Figure 4b This is a schematic diagram of the visualization of the specificity of Escherichia coli after adding PMNT in Example 5 of the present invention; Figure 4c The A after adding PMNT in the E. coli specific experiment in Example 5 of the present invention 394nm / A 520nm Schematic diagram of absorbance detection results; Figure 4d Schematic diagram of absorbance spectrum detection results after adding PMNT in the Escherichia coli specific experiment in Example 5 of the present invention; Figure 5a is a schematic diagram of the gel electrophoresis results of the Candida albicans specificity experiment in Example 5 of the present invention; Figure 5b This is a schematic diagram of the specific visualization results of Candida albicans after adding PMNT in Example 5 of the present invention; Figure 5c A is obtained after adding PMNT in the Candida albicans specificity experiment in Example 5 of the present invention. 394nm / A 520nm Schematic diagram of absorbance detection results; Figure 5d 1 is a schematic diagram of the absorbance spectrum detection results after adding PMNT in the Candida albicans specificity experiment in Example 5 of the present invention; Figure 6a Schematic diagram of the gel electrophoresis results of the Enterococcus faecalis specificity experiment in Example 5 of the present invention; Figure 6b This is a schematic diagram of the visualization results of Enterococcus faecalis specificity after adding PMNT in Example 5 of the present invention; Figure 6c A is obtained after adding PMNT in the specific experiment of Enterococcus faecalis in Example 5 of the present invention. 394nm / A 520nm Schematic diagram of absorbance detection results; Figure 6d 1 is a schematic diagram of the absorbance spectrum detection results after adding PMNT in the Enterococcus faecalis specific experiment in Example 5 of the present invention; Figure 7a Schematic diagram of the gel electrophoresis results of the Pseudomonas aeruginosa specificity experiment in Example 5 of the present invention; Figure 7b This is a schematic diagram of the specific visualization results of Pseudomonas aeruginosa after adding PMNT in Example 5 of the present invention; Figure 7c The A value after adding PMNT in the Pseudomonas aeruginosa specific experiment in Example 5 of the present invention is 394nm / A520nm Schematic diagram of absorbance detection results.
[0012] Figure 7d Schematic diagram of absorbance spectrum detection results after adding PMNT in the Pseudomonas aeruginosa specific experiment in Example 5 of the present invention; Figure 8 is a schematic diagram of the gel electrophoresis results of the Escherichia coli specificity experiment in Example 6 of the present invention; Figure 9 Schematic diagram of the gel electrophoresis results of the Enterococcus faecalis specificity experiment in Example 6 of the present invention. DETAILED DESCRIPTION
[0013] The endpoints of the ranges and any values disclosed herein are not limited to the precise ranges or values, and these ranges or values should be understood to include values close to these ranges or values. For numerical ranges, the endpoints of each range, the endpoints of each range and individual point values, and the individual point values can be combined with each other to obtain one or more new numerical ranges, which should be considered to be specifically disclosed herein.
[0014] The first aspect of the present invention provides a method for rapid in vitro detection of pathogenic bacteria genes by visualization, wherein the method comprises the following steps: S1, extracting DNA from the sample to be tested; S2, performing a loop-mediated isothermal amplification reaction on the DNA extracted from S1 in the presence of DNA polymerase buffer, strand-displacing DNA polymerase, and primer pairs; S3. The reaction solution obtained from the amplification reaction in S2 is mixed with the water-soluble conjugated polymer to react, and the color is observed for visual detection.
[0015] The present invention amplifies pathogenic bacterial DNA through a loop-mediated isothermal amplification method, and achieves sensitive and rapid detection of pathogenic bacteria by distinguishing the color change of cationic conjugated polymers before and after amplification. The detection results can be used for immediate diagnosis of infectious diseases caused by pathogenic bacteria.
[0016] The present invention does not particularly limit the method for extracting DNA from the sample to be tested, and conventional DNA extraction methods in the art can be used. A bacterial genomic DNA extraction kit (adsorption column method) can be used to extract bacterial whole genomic DNA.
[0017] According to the present invention, the target pathogenic bacteria may be common pathogenic bacteria. Preferably, the target pathogenic bacteria in the sample to be tested is selected from at least one of Escherichia coli, Candida albicans, Enterococcus faecalis and Pseudomonas aeruginosa.
[0018] The gene detected in the present invention is the phoA Gene, Candida albicans α-INF1 Gene, Enterococcus faecalis efaA Gene, Pseudomonas aeruginosa hypothetical protein Bacterial gene sequences were retrieved from NCBI, and LAMP primers were designed using PrimerExplorer V5. Primer specificity was tested using NCBI BLAST.
[0019] According to the present invention, preferably, when the target pathogen to be detected is Escherichia coli, in S2, the primer pair comprises: a primer having a nucleotide sequence as shown in SEQ ID NO: 1 (denoted as E. coli -F3, nucleotide sequence is GCAATGCTACGGTCCGAG), primers with nucleotide sequence shown in SEQ ID NO: 2 (denoted as E. coli -B3, nucleotide sequence is GATAACCACGCGCCTGTG), primers with nucleotide sequence shown in SEQ ID NO: 3 (denoted as E. coli -FIP, nucleotide sequence ACGAGCGTTAAGCAGCTGTTCGCCGGGTAACGCTCTGGAA) and the primer with the nucleotide sequence shown in SEQ ID NO: 4 (denoted as E. coli -BIP, nucleotide sequence: CGACGTTACGCTTGGCGGTGACGCAGCGTTTTTCCCTG).
[0020] Preferably, when the target pathogen to be detected is Enterococcus faecalis, in S2, the primer pair comprises: a primer having a nucleotide sequence as shown in SEQ ID NO: 5 (denoted as E. faecalis -F3, nucleotide sequence is GGACAGACCCTCACGAAT), the primer of nucleotide sequence shown in SEQ ID NO: 6 (denoted as E. faecalis -B3, nucleotide sequence is TCTGTTTGTTCTTGACCGG), primers with nucleotide sequence shown in SEQ ID NO: 7 (denoted as E. faecalis -FIP, the nucleotide sequence of which is CCTGTTTCTAAGTTCAAGCCGTTAATGAACCGTTACCAGAAGAC) and the primer of the nucleotide sequence shown in SEQ ID NO: 8 (denoted as E. faecalis -BIP, nucleotide sequence is TAATGAAAACGGCCAAAAAAGTTGAACTTGTTAAATATTGTGGCGTA).
[0021] Preferably, when the target pathogen to be detected is Candida albicans, in S2, the primer pair comprises: a primer having a nucleotide sequence as shown in SEQ ID NO: 9 (denoted as C.albicans-F3, nucleotide sequence CAATGGAAAGATCCTTCTCAA), a primer with the nucleotide sequence shown in SEQ ID NO: 10 (denoted as C.albicans -B3, nucleotide sequence is TGTTATCTCTCTTGTGTGTCAT), the primer of nucleotide sequence shown in SEQ ID NO: 11 (denoted as C.albicans -FIP, the nucleotide sequence of which is AGGTTTCGTCGTATGAAGTGGTATTCTGATGAAGATACAAATGCT) and the primer of the nucleotide sequence shown in SEQ ID NO: 12 (denoted as C.albicans -BIP, nucleotide sequence: CAACGAAGTCAATCTGGAACCAAAATTGCTGAAATTTTCGCG).
[0022] Preferably, when the target pathogen to be detected is Pseudomonas aeruginosa, in S2, the primer pair comprises: a primer having a nucleotide sequence as shown in SEQ ID NO: 13 (denoted as P.aeruginosa -F3, nucleotide sequence CAAGCGCAAGATAGTCGCC), primers with the nucleotide sequence shown in SEQ ID NO: 14 ( P.aeruginosa -B3, nucleotide sequence is TCCGCTTGAACAGGCTGGTG), the primer of nucleotide sequence shown in SEQ ID NO: 15 (denoted as P.aeruginosa -FIP, nucleotide sequence GAAGATATCCGGCTGGTTGCTTTTCAAGAGGGAATGCCGCAGT) and a primer with the nucleotide sequence shown in SEQ ID NO: 16 (denoted as P.aeruginosa -BIP, nucleotide sequence is AACGGATCATCGGCATCCTGGTTTTCATCGCCGTCCACAGGTAGA).
[0023] After the loop-mediated isothermal amplification reaction was completed, the reaction solution was subjected to gel electrophoresis. The gel electrophoresis results showed that, in the presence of a DNA polymerase buffer and a strand-displacing DNA polymerase, a primer pair consisting of a primer having a nucleotide sequence shown in SEQ ID NO: 1, a primer having a nucleotide sequence shown in SEQ ID NO: 2, a primer having a nucleotide sequence shown in SEQ ID NO: 3, and a primer having a nucleotide sequence shown in SEQ ID NO: 4 could specifically amplify and detect Escherichia coli. phoA Gene; a primer pair consisting of a primer having a nucleotide sequence shown in SEQ ID NO: 5, a primer having a nucleotide sequence shown in SEQ ID NO: 6, a primer having a nucleotide sequence shown in SEQ ID NO: 7, and a primer having a nucleotide sequence shown in SEQ ID NO: 8 can specifically amplify Enterococcus faecalis efaA gene; a primer pair consisting of a primer having a nucleotide sequence shown in SEQ ID NO: 9, a primer having a nucleotide sequence shown in SEQ ID NO: 10, a primer having a nucleotide sequence shown in SEQ ID NO: 11, and a primer having a nucleotide sequence shown in SEQ ID NO: 12 can specifically amplify a gene of Candida albicans α-INF1 Gene; a primer pair consisting of a primer having a nucleotide sequence shown in SEQ ID NO: 13, a primer having a nucleotide sequence shown in SEQ ID NO: 14, a primer having a nucleotide sequence shown in SEQ ID NO: 15, and a primer having a nucleotide sequence shown in SEQ ID NO: 16 can specifically amplify a gene of Pseudomonas aeruginosa hypothetical protein genes, thus enabling specific detection of Escherichia coli, Enterococcus faecalis, Candida albicans, and Pseudomonas aeruginosa using specific primer pairs in a loop-mediated isothermal amplification reaction.
[0024] In order to further improve the specificity of pathogenic bacteria gene amplification, preferably, when the target pathogen to be detected is Escherichia coli, the molar ratio of the primer with the nucleotide sequence shown in SEQ ID NO: 1, the primer with the nucleotide sequence shown in SEQ ID NO: 2, the primer with the nucleotide sequence shown in SEQ ID NO: 3 and the primer with the nucleotide sequence shown in SEQ ID NO: 4 is 1: (0.5-2): (4-8): (4-8).
[0025] Preferably, when the target pathogenic bacteria to be detected is Enterococcus faecalis, the molar ratio of the primer with the nucleotide sequence shown in SEQ ID NO: 5, the primer with the nucleotide sequence shown in SEQ ID NO: 6, the primer with the nucleotide sequence shown in SEQ ID NO: 7 and the primer with the nucleotide sequence shown in SEQ ID NO: 8 is 1: (0.5-2): (4-8): (4-8).
[0026] Preferably, when the target pathogen to be detected is Candida albicans, the molar ratio of the primer with the nucleotide sequence shown in SEQ ID NO: 9, the primer with the nucleotide sequence shown in SEQ ID NO: 10, the primer with the nucleotide sequence shown in SEQ ID NO: 11 and the primer with the nucleotide sequence shown in SEQ ID NO: 12 is 1: (0.5-2): (4-8): (4-8).
[0027] Preferably, when the target pathogen to be detected is Pseudomonas aeruginosa, the molar ratio of the primer with the nucleotide sequence shown in SEQ ID NO: 13, the primer with the nucleotide sequence shown in SEQ ID NO: 14, the primer with the nucleotide sequence shown in SEQ ID NO: 15 and the primer with the nucleotide sequence shown in SEQ ID NO: 16 is 1: (0.5-2): (4-8): (4-8).
[0028] The present invention does not particularly limit the ratio of DNA polymerase buffer, strand displacement DNA polymerase, primers, and DNA extracted from S1 during the loop-mediated isothermal amplification reaction. Conventional usage ratios in the art can be used, as long as the gene template can be rapidly amplified in a PCR instrument. In order to amplify an appropriate number of copies in a relatively short period of time, thereby making the detection speed faster and the detection results more accurate, preferably, in S2, based on 25 ng of DNA extracted from S1, the amount of the strand displacement DNA polymerase used is such that the enzyme activity of the strand displacement DNA polymerase is 2-10 U, the amount of the primer pair used is 90-180 pmol, and the amount of the DNA polymerase buffer used is 9-15 μL.
[0029] To amplify an appropriate number of copies, the loop-mediated isothermal amplification reaction preferably includes incubating at 58-66°C for 20-60 minutes in a PCR instrument. Preferably, the loop-mediated isothermal amplification reaction is followed by incubation at 90-100°C for 1-10 minutes to inactivate the strand-displacing DNA polymerase.
[0030] According to the present invention, the water-soluble conjugated polymer is preferably poly[3-methyl-4-(3-(N,N,N-triethylammonium)propoxy)-2,5-thiophene]. Poly[3-methyl-4-(3-(N,N,N-triethylammonium)propoxy)-2,5-thiophene] (PMNT) has excellent visualization effects. The structure of poly[3-methyl-4-(3-(N,N,N-triethylammonium)propoxy)-2,5-thiophene] is shown below: Preferably, the degree of polymerization n is 8-50, more preferably 10-30.
[0031] In order to further improve the visualization effect, preferably, in S3, when performing visual detection, the amount of the water-soluble conjugated polymer used is 1-50 nmol based on 25 ng of DNA extracted in S1.
[0032] According to the present invention, preferably, the method further comprises: mixing the reaction solution obtained by the amplification reaction in S2 with a water-soluble conjugated polymer to react, and measuring the absorbance ratio (A) of the reaction solution at wavelengths of 394 nm and 520 nm. 394nm / A 520nm ). A 394nm / A 520nm A value greater than or equal to 1.2 is considered a positive result. 394nm / A 520nm A value less than 1.2 is considered a negative result. A positive result indicates that the sample to be tested contains DNA corresponding to the corresponding pathogen. If the sample to be tested is human blood or tissue, it indicates infection with the corresponding pathogen. 394nm / A 520nm , which can not only further verify the accuracy of the visualization results, but also relatively quantify the number of pathogenic bacteria in the sample to be tested.
[0033] Preferably, when measuring the absorbance ratio of the reaction solution at wavelengths of 394 nm and 520 nm, the amount of the water-soluble conjugated polymer used is 1-50 nmol, based on 25 ng of DNA extracted from S1.
[0034] A second aspect of the present invention provides the use of a water-soluble conjugated polymer for in vitro detection of pathogenic bacterial genes, particularly poly[3-methyl-4-(3-(N,N,N-triethylammonium)propoxy)-2,5-thiophene] (PMNT). PMNT produces a color change when bound to nucleic acids, enabling visual detection of nucleic acids by observing this color change.
[0035] A third aspect of the present invention provides an application of a primer pair in in vitro detection of pathogenic bacteria genes, wherein the pathogenic bacteria is Escherichia coli or Enterococcus faecalis; When the pathogenic bacteria is Escherichia coli, the primer pair includes: a primer with a nucleotide sequence shown in SEQ ID NO: 1, a primer with a nucleotide sequence shown in SEQ ID NO: 2, a primer with a nucleotide sequence shown in SEQ ID NO: 3, and a primer with a nucleotide sequence shown in SEQ ID NO: 4; When the target pathogen to be detected is Enterococcus faecalis, the primer pair includes: a primer with a nucleotide sequence shown in SEQ ID NO: 5, a primer with a nucleotide sequence shown in SEQ ID NO: 6, a primer with a nucleotide sequence shown in SEQ ID NO: 7, and a primer with a nucleotide sequence shown in SEQ ID NO: 8.
[0036] The present invention will be described in detail below through examples and comparative examples. In the following examples, unless otherwise specified, conventional methods are used; and the reagents and materials used, unless otherwise specified, can be obtained from commercial sources.
[0037] In the following examples, unless otherwise specified, the primers E. coli -F3's nucleotide sequence is shown in SEQ ID NO: 1, E. coli -B3's nucleotide sequence is shown in SEQ ID NO: 2, E. coli -The nucleotide sequence of FIP is shown in SEQ ID NO: 3, E. coli -The nucleotide sequence of BIP is shown in SEQ ID NO: 4, E. faecalis -The nucleotide sequence of F3 is shown in SEQ ID NO: 5, E. faecalis -B3's nucleotide sequence is shown in SEQ ID NO: 6, E. faecalis-The nucleotide sequence of FIP is shown in SEQ ID NO: 7, E. faecalis -The nucleotide sequence of BIP is shown in SEQ ID NO: 8, C.albicans -F3's nucleotide sequence is shown in SEQ ID NO: 9, C.albicans -B3's nucleotide sequence is shown in SEQ ID NO: 10, C.albicans -The nucleotide sequence of FIP is shown in SEQ ID NO: 11, C.albicans -The nucleotide sequence of BIP is shown in SEQ ID NO: 12, P.aeruginosa -F3's nucleotide sequence is shown in SEQ ID NO: 13, P.aeruginosa -B3's nucleotide sequence is shown in SEQ ID NO: 14, P.aeruginosa -The nucleotide sequence of FIP is shown in SEQ ID NO: 15, P.aeruginosa The nucleotide sequence of -BIP is shown in SEQ ID NO: 16.
[0038] In the following examples, the degree of polymerization n of PMNT is 16.617.
[0039] Example 1 This example is used to illustrate the method for extracting DNA from a sample to be tested.
[0040] The strains used were purchased from China General Microbiological Culture Collection Administration Center, Escherichia coli ( Escherichia coli ), strain TOP10, accession number 1.12875; Candida albicans ( Candida albicans ), accession number 2.4144; Enterococcus faecalis ( Enterococcus faecalis ), accession number 1.10682; Pseudomonas aeruginosa ( Pseudomonas aeruginosa ), accession number 1.10274. Whole-genome DNA was extracted using a bacterial genomic DNA extraction kit (adsorption column method) (Beijing Tiangen Technology Co., Ltd.) as follows: Escherichia coli, Candida albicans, Enterococcus faecalis, and Pseudomonas aeruginosa strains stored at -80°C were inoculated into 10 mL of liquid culture medium, respectively. After incubation at 37°C for 8-12 hours, 1 mL of bacterial solution was collected for bacterial DNA extraction.
[0041] Take 1 mL of bacterial sample, centrifuge (12000 rpm, 1 min), and discard the supernatant.
[0042] Escherichia coli and Pseudomonas aeruginosa (Gram-negative bacteria) culture: Add 0.2 mL of GA solution to the precipitate and shake until mixed. Then add 4 μL of RNase A (100 mg / mL), mix thoroughly, and let it stand at room temperature for 10 minutes.
[0043] Add 110 μL of TE buffer and 70 μL of lysozyme solution (50 mg / mL) to the precipitate of Candida albicans and Enterococcus faecalis (Gram-positive bacteria) bacterial suspension, incubate in a 37°C water bath for 30 min, then add 4 μL of RNase A (100 mg / mL), mix well, and let stand at room temperature for 10 min.
[0044] Then, 0.02 mL of proteinase K (10 mg / mL) was added and mixed evenly, and digested in a 70°C water bath for 10 min.
[0045] After complete digestion, add 220 μL of anhydrous ethanol, vortex to mix, transfer the solution to the adsorption column, place it at room temperature for 2 minutes, centrifuge it at 12000 rpm for 2 minutes, discard the waste liquid, and place the adsorption column in a collection tube.
[0046] Add 0.5 mL of GD buffer, centrifuge at 12,000 rpm for 1 min, and discard the waste liquid.
[0047] Add 0.6 mL of PW rinse solution, centrifuge at 12,000 rpm for 1 min, discard the waste solution, repeat this step twice, centrifuge at 12,000 rpm for 2 min, and discard the waste solution.
[0048] Change to a clean centrifuge tube, place the adsorption column on the centrifuge tube, add 0.15 mL of TE elution buffer, let it stand at room temperature for 2 minutes, and centrifuge at 12000 rpm for 2 minutes to obtain the required DNA sample.
[0049] The genomic DNA concentration was quantified based on the absorbance at 260 nm using a Nano Drop photometer.
[0050] The extracted strain DNA was quantified by Nano Drop detection and diluted to 10 ng / μL for storage.
[0051] Example 2 This example is used to illustrate the LAMP amplification method of target genes.
[0052] 1. Prepare loop-mediated isothermal amplification reaction solution: join in Bst DNA polymerase (8U / μL) 1 μL, Bst DNA Buffer 12.5 μL, Primers E. coli -FIP (10 μM) 4 μL, E. coli -BIP (10 μM) 4 μL, E. coli -F3 (10 μM) 0.5 μL, E. coli 0.5 μL of -B3 (10 μM). 2.5 μL of E. coli DNA template was added to the positive control group, and 2.5 μL of deionized water was added to the negative control group.
[0053] Incubate at 65°C for 30 min in a PCR instrument, and then maintain at 94°C for 2 min.
[0054] After the reaction was completed, the reaction solution was taken for gel electrophoresis experiment. Figure 1a This is a schematic diagram of the gel electrophoresis results showing the feasibility of loop-mediated isothermal amplification. Figure 1a It can be seen that the gel results show that the positive result amplifies the target band, while the negative result has no target band, indicating that the E. coli primer design is reasonable.
[0055] 2. PMNT visual detection: Take out the 10 mM PMNT stock solution and dilute it to 1 mM PMNT working solution.
[0056] Add 5 μL of PMNT to 25 μL of reaction solution, shake, and observe the color for visual detection.
[0057] 3. A 394nm and A 520nm Absorbance detection: Take out 25 μL of reaction solution, add 10 μL of PMNT working solution, place it under the enzyme marker for absorbance scanning and A 394nm and A 520nm The absorbance at two points is detected, and the ratio is calculated after the detection.
[0058] Figure 1b This is a schematic diagram of the feasibility visualization results after adding PMNT. Figure 1c and Figure 1d The figure is a schematic diagram of the absorbance detection results after adding PMNT. Figure 1b Visualization and Figure 1c and Figure 1d The absorbance test results show that the positive sample is at a higher position in the spectrum. 394nm / A 520nm The ratio is about 1.4, while the negative samples are at a lower position, and their A 394nm / A 520nm The ratio is approximately 1.0, which is consistent with the gel amplification results, proving that the scheme is feasible.
[0059] Example 3 This example is used to illustrate the system detection limit experimental method.
[0060] 1. DNA sample dilution and amplification reaction: join in Bst DNA polymerase (8U / μL) 1 μL, Bst DNA Buffer 12.5 μL, Primers E. coli -FIP (10 μM) 4 μL, E. coli -BIP (10 μM) 4 μL, E. coli -F3 (10 μM) 0.5 μL, E. coli -B3 (10 μM) 0.5 μL. 10 ng / μL E. coli DNA sample was added from 10 -1 ng / μL were diluted to 10 -8 ng / μL. 2.5 μL of DNA of different concentrations was added to the reaction solution.
[0061] Place in a PCR instrument and incubate at 65°C for 30 min, then maintain at 94°C for 2 min.
[0062] After the reaction was completed, the reaction solution was taken for gel electrophoresis experiment.
[0063] 2. Result analysis: Figure 2a This is a schematic diagram of the gel electrophoresis results of the detection limit experiment. According to the gel electrophoresis results, at 10 -1 ng / μL and 10 -2 ng / μL, there is an amplified band, so at 2.5×10 -2 ng E. coli DNA sample can be amplified.
[0064]
[0065] According to the above calculation formula, the number of bases in the whole genome of E. coli is 4,705,562. At 30 min, the detection limit of the system is 787.2. Therefore, the system can amplify at least 1×10 3 DNA.
[0066] 3. PMNT visual detection and absorbance detection: Add 5 μL of PMNT working solution to 25 μL of reaction solution, shake, and observe the color for visual detection.
[0067] Take out 25 μL of reaction solution, add 10 μL of PMNT working solution, place it under the enzyme marker for absorbance scanning and A 394nm and A 520nm Absorbance detection, and ratio calculation after detection.
[0068] Figure 2b This is a diagram showing the visualization of the detection limit after adding PMNT. Figure 2c and Figure 2d Figure 3 is a schematic diagram of the absorbance detection results after adding PMNT. The visual results and absorbance detection results are consistent with the gel amplification results, indicating that PMNT can identify trace amounts of amplification.
[0069] The detection limit of PMNT after 30 min of amplification was 1×10 3 DNA copy number.
[0070] Example 4 This embodiment is used to illustrate the detection experimental method of the shortest response time.
[0071] 1. Prepare loop-mediated isothermal amplification reaction solution: join in Bst DNA polymerase (8U / μL) 1 μL, Bst DNA Buffer 12.5 μL, Primers E. coli -FIP (10 μM) 4 μL, E. coli -BIP (10 μM) 4 μL, E. coli -F3 (10 μM) 0.5 μL, E. coli -B3 (10 μM) 0.5 μL. E. coli DNA sample (10 ng / μL) 2.5 μL.
[0072] Place the tube in a PCR instrument and incubate at 65°C for 0 min, 5 min, 10 min, 15 min, 20 min, 25 min, 30 min, and 60 min, then maintain at 94°C for 2 min.
[0073] 2. Result analysis: After the reaction was completed, the reaction solution was taken for gel electrophoresis experiment.
[0074] Figure 3a Schematic diagram of the gel electrophoresis results of the shortest response time of the present invention. According to the gel electrophoresis results, the shortest amplification time of the reaction is 15 min.
[0075] 3. PMNT visual detection and absorbance detection: Add 5 μL of PMNT working solution to 25 μL of reaction solution, shake, and observe the color for visual detection.
[0076] Take out 25 μL of reaction solution, add 10 μL of PMNT working solution, place it under the enzyme marker for absorbance scanning and A 394nm and A 520nmAbsorbance detection, and ratio calculation after detection. Figure 3b This is a visualization diagram of the shortest response time after adding PMNT. Figure 3c and Figure 3d The diagram is a schematic diagram of the absorbance test results after adding PMNT. It can be seen from the figure that the positive samples at 15min, 20min, 25min, 30min, and 60min are at a higher position in the spectrum. 394nm / A 520nm The ratio fluctuates around 1.4, while the negative samples are at a lower position, and their A 394nm / A 520nm The ratio is approximately 1.0. It can also be seen from the absorption spectra that the spectra at 20 min, 25 min, 30 min, and 60 min are essentially overlapping, as are the spectra at 0 min, 5 min, and 10 min, while the spectra at 15 min are somewhere in between. Therefore, 15 min represents an experimental group with an incomplete reaction, and the shortest response time of this system is 20 min.
[0077] Example 5 This example is used to illustrate the specificity and universality of the method for rapid in vitro detection of visualized pathogenic bacteria genes provided by the present invention.
[0078] 1. Escherichia coli specificity test: join in Bst DNA polymerase (8U / μL) 1 μL, Bst DNA Buffer 12.5 μL, Primers E. coli -FIP (10 μM) 4 μL, E. coli -BIP (10 μM) 4 μL, E. coli -F3 (10 μM) 0.5 μL, E. coli 0.5 μL of -B3 (10 μM). 2.5 μL of Escherichia coli DNA template was added to positive samples, and 2.5 μL each of Candida albicans, Enterococcus faecalis, and Pseudomonas aeruginosa were added to negative samples.
[0079] Incubate at 65°C for 30 min in a PCR instrument, and then maintain at 94°C for 2 min.
[0080] After the reaction was completed, the reaction solution was taken for gel electrophoresis experiment.
[0081] Figure 4a This is a schematic diagram of the gel electrophoresis results of the E. coli specificity experiment. From the gel results, it can be seen that the positive result amplifies the target band, while the negative result has no target band, indicating that the system is specific.
[0082] Add 5 μL of PMNT working solution to 25 μL of reaction solution, shake, and observe the color for visual detection.
[0083] Take out 25 μL of reaction solution, add 10 μL of PMNT working solution, place it under the enzyme marker for absorbance scanning and A 394nm and A 520nm Absorbance detection, and ratio calculation after detection.
[0084] Figure 4b This is a schematic diagram of the specific visualization of E. coli after adding PMNT. Figure 4c and Figure 4d is a schematic diagram of the absorbance detection results after adding PMNT. The visual results and absorbance detection results are consistent with the gel amplification results.
[0085] 2. Candida albicans specificity test: join in Bst DNA polymerase (8U / μL) 1 μL, Bst DNA Buffer 12.5 μL, Primers C.albicans -FIP (10 μM) 4 μL, C.albicans -BIP (10 μM) 4 μL, C.albicans -F3 (10 μM) 0.5 μL, C.albicans -B3 (10 μM) 0.5 μL. 2.5 μL of Candida albicans DNA template was added to positive samples, and 2.5 μL each of Escherichia coli, Enterococcus faecalis, and Pseudomonas aeruginosa were added to negative samples.
[0086] Place in a PCR instrument and incubate at 65°C for 30 min, then maintain at 94°C for 2 min.
[0087] After the reaction was completed, the reaction solution was taken for gel electrophoresis experiment.
[0088] Figure 5a This is a schematic diagram of the gel electrophoresis results of the Candida albicans specificity experiment. From the gel results, it can be seen that the positive result amplifies the target band, while the negative result has no target band, indicating that the system is specific.
[0089] Add 5 μL of PMNT working solution to 25 μL of reaction solution, shake, and observe the color for visual detection.
[0090] Take out 25 μL of reaction solution, add 10 μL of PMNT working solution, place it under the enzyme marker for absorbance scanning and A 394nm and A 520nm Absorbance detection, and ratio calculation after detection.
[0091] Figure 5b This is a schematic diagram of the visualization results of Candida albicans specificity after adding PMNT. Figure 5c and Figure 5d is a schematic diagram of the absorbance detection results after adding PMNT. The visual results and absorbance detection results are consistent with the gel amplification results.
[0092] 3. Enterococcus faecalis specific test: join in Bst DNA polymerase (8U / μL) 1 μL, Bst DNA Buffer 12.5 μL, Primers E. faecalis -FIP (10 μM) 4 μL, E. faecalis -BIP (10 μM) 4 μL, E. faecalis -F3 (10 μM) 0.5 μL, E. faecalis 0.5 μL of -B3 (10 μM). 2.5 μL of E. coli DNA sample (10 ng / μL). 2.5 μL of Enterococcus faecalis DNA template was added to positive samples, and 2.5 μL each of E. coli, Candida albicans, and Pseudomonas aeruginosa were added to negative samples.
[0093] Incubate at 65°C for 30 min in a PCR instrument, and then maintain at 94°C for 2 min.
[0094] After the reaction was completed, the reaction solution was taken for gel electrophoresis experiment.
[0095] Figure 6a This is a schematic diagram of the gel electrophoresis results of the Enterococcus faecalis specificity experiment. From the gel results, it can be seen that the positive result amplifies the target band, while the negative result has no target band, indicating that the system is specific.
[0096] Add 5 μL of PMNT working solution to 25 μL of reaction solution, shake, and observe the color for visual detection.
[0097] Take out 25 μL of reaction solution, add 10 μL of PMNT working solution, place it under the enzyme marker for absorbance scanning and A 394nm and A 520nm Absorbance detection, and ratio calculation after detection.
[0098] Figure 6b This is a schematic diagram of the visualization results of Enterococcus faecalis specificity after adding PMNT. Figure 6c and Figure 6d is a schematic diagram of the absorbance detection results after adding PMNT. The visual results and absorbance detection results are consistent with the gel amplification results.
[0099] 4. Pseudomonas aeruginosa specificity test: join in Bst DNA polymerase (8U / μL) 1 μL, Bst DNA Buffer 12.5 μL, Primers P.aeruginosa -FIP (10 μM) 4 μL, P.aeruginosa -BIP (10 μM) 4 μL, P.aeruginosa -F3 (10 μM) 0.5 μL, P.aeruginosa -B3 (10 μM) 0.5 μL. 2.5 μL of Pseudomonas aeruginosa DNA template was added to positive samples, and 2.5 μL each of Escherichia coli, Candida albicans, and Enterococcus faecalis was added to negative samples.
[0100] Place in a PCR instrument and incubate at 65°C for 30 min, then maintain at 94°C for 2 min.
[0101] After the reaction was completed, the reaction solution was taken for gel electrophoresis experiment.
[0102] Figure 7a Schematic diagram of the gel electrophoresis results of the Pseudomonas aeruginosa specificity experiment in Example 5 of the present invention. From the gel results, it can be seen that the positive result amplifies the target band, while the negative result has no target band, indicating that the system is specific.
[0103] Add 5 μL of PMNT working solution to 25 μL of reaction solution, shake, and observe the color for visual detection.
[0104] Take out 25 μL of reaction solution, add 10 μL of PMNT working solution, place it under the enzyme marker for absorbance scanning and A 394nm and A 520nm Absorbance detection. Calculate the ratio after detection.
[0105] Figure 7b This is a schematic diagram of the specific visualization results of Pseudomonas aeruginosa after adding PMNT. Figure 7c and Figure 7d Schematic diagram of the absorbance detection results after adding PMNT. The visual results and absorbance detection results are consistent with the gel amplification results.
[0106] From the above results, it can be seen that Escherichia coli, Candida albicans, Enterococcus faecalis, and Pseudomonas aeruginosa are all suitable for this system, proving that the system has universal applicability.
[0107] Example 6 The E. coli specificity experiment and the Enterococcus faecalis specificity experiment were respectively carried out according to the method of Example 5, except that different primer pairs were used.
[0108] The primers for the Ywbb gene of Escherichia coli used are as follows: E. coli -F3:GGCGGTATGGCGATTTGG (SEQ ID NO: 17), E. coli -B3: CCTGCTCACGAAACGAGTG (SEQ ID NO: 18), E. coli -FIP: AGGAAGCCACCGTTTTCTGCTTCGATTTCACTGGTCGGGATC (SEQ ID NO: 19), E. coli -BIP: TCCTGGTGGTGATTAACGCGGGCGTTTTGCGTAAAGTCGG (SEQ ID NO: 20), The 23sRNA gene primers of Enterococcus faecalis used are as follows: E. faecalis -F3:CGTAGACCCGAAACCATGTG (SEQ ID NO: 21), E. faecalis -B3:ACAGTGCTCTACCTCCATCA (SEQ ID NO: 22), E. faecalis -FIP:AACGTACGTGGGTTCGGTCCTTCTACCCATGTCCAGGTTGA (SEQ ID NO: 23), E. faecalis -BIP: GATGAGGTGTGGGTAGCGGAGACGAGGCTAGCCCTAAAGCT (SEQ ID NO: 24).
[0109] Figure 8 This is a schematic diagram of the gel electrophoresis results of the E. coli specificity experiment. From the gel results, it can be seen that target bands are amplified in E. coli and Pseudomonas aeruginosa, indicating that the primer specificity is not high.
[0110] Figure 9 This is a schematic diagram of the gel electrophoresis results of the Enterococcus faecalis specificity experiment. From the gel results, it can be seen that the target bands are amplified in all four bacteria, indicating that the primer specificity is not high.
[0111] The preferred embodiments of the present invention are described in detail above, but the present invention is not limited thereto. Within the technical concept of the present invention, various simple variations of the technical solution of the present invention may be made, including combining the various technical features in any other appropriate manner. These simple variations and combinations should also be regarded as the contents disclosed by the present invention and fall within the scope of protection of the present invention.
Claims
1. A method for rapid in vitro detection of pathogenic bacteria genes, characterized in that: The method comprises the following steps: S1, extracting DNA from the sample to be tested; S2, performing a loop-mediated isothermal amplification reaction on the DNA extracted from S1 in the presence of DNA polymerase buffer, strand-displacing DNA polymerase, and primer pairs; S3. The reaction solution obtained from the amplification reaction in S2 is mixed with the water-soluble conjugated polymer to react, and the color is observed for visual detection.
2. The method according to claim 1, characterized in that The target pathogenic bacteria in the sample to be tested is selected from at least one of Escherichia coli, Candida albicans, Enterococcus faecalis and Pseudomonas aeruginosa.
3. The method according to claim 2, characterized in that When the target pathogen to be detected is Escherichia coli, in S2, the primer pair includes: a primer having a nucleotide sequence shown in SEQ ID NO: 1, a primer having a nucleotide sequence shown in SEQ ID NO: 2, a primer having a nucleotide sequence shown in SEQ ID NO: 3, and a primer having a nucleotide sequence shown in SEQ ID NO: 4; And / or, when the target pathogen to be detected is Enterococcus faecalis, in S2, the primer pair includes: a primer having a nucleotide sequence shown in SEQ ID NO: 5, a primer having a nucleotide sequence shown in SEQ ID NO: 6, a primer having a nucleotide sequence shown in SEQ ID NO: 7, and a primer having a nucleotide sequence shown in SEQ ID NO: 8; And / or, when the target pathogen to be detected is Candida albicans, in S2, the primer pair includes: a primer having a nucleotide sequence shown in SEQ ID NO: 9, a primer having a nucleotide sequence shown in SEQ ID NO: 10, a primer having a nucleotide sequence shown in SEQ ID NO: 11, and a primer having a nucleotide sequence shown in SEQ ID NO: 12; And / or, when the target pathogen detected is Pseudomonas aeruginosa, in S2, the primer pair includes: a primer with a nucleotide sequence shown in SEQ ID NO: 13, a primer with a nucleotide sequence shown in SEQ ID NO: 14, a primer with a nucleotide sequence shown in SEQ ID NO: 15, and a primer with a nucleotide sequence shown in SEQ ID NO:
16.
4. The method according to claim 3, characterized in that When the target pathogen to be detected is Escherichia coli, the molar ratio of the primer of the nucleotide sequence shown in SEQ ID NO: 1, the primer of the nucleotide sequence shown in SEQ ID NO: 2, the primer of the nucleotide sequence shown in SEQ ID NO: 3, and the primer of the nucleotide sequence shown in SEQ ID NO: 4 is 1: (0.5-2): (4-8): (4-8); and / or, when the target pathogen to be detected is Enterococcus faecalis, the molar ratio of the primer having the nucleotide sequence shown in SEQ ID NO: 5, the primer having the nucleotide sequence shown in SEQ ID NO: 6, the primer having the nucleotide sequence shown in SEQ ID NO: 7, and the primer having the nucleotide sequence shown in SEQ ID NO: 8 is 1:(0.5-2):(4-8):(4-8); and / or, when the target pathogen to be detected is Candida albicans, the molar ratio of the primer having the nucleotide sequence set forth in SEQ ID NO: 9, the primer having the nucleotide sequence set forth in SEQ ID NO: 10, the primer having the nucleotide sequence set forth in SEQ ID NO: 11, and the primer having the nucleotide sequence set forth in SEQ ID NO: 12 is 1:(0.5-2):(4-8):(4-8); And / or, when the target pathogen detected is Pseudomonas aeruginosa, the molar ratio of the primer with the nucleotide sequence shown in SEQ ID NO: 13, the primer with the nucleotide sequence shown in SEQ ID NO: 14, the primer with the nucleotide sequence shown in SEQ ID NO: 15 and the primer with the nucleotide sequence shown in SEQ ID NO: 16 is 1: (0.5-2): (4-8): (4-8).
5. The method according to any one of claims 1 to 4, characterized in that In S2, based on 25 ng of DNA extracted from S1, the amount of the strand displacement DNA polymerase used is such that the enzyme activity of the strand displacement DNA polymerase is 2-10 U, the amount of the primer pair used is 90-180 pmol, and the amount of the DNA polymerase buffer used is 9-15 μL; Preferably, the conditions of the loop-mediated isothermal amplification reaction include: incubating at 58-66° C. for 20-60 min in a PCR instrument.
6. The method according to any one of claims 1 to 5, characterized in that The water-soluble conjugated polymer is poly[3-methyl-4-(3-(N,N,N-triethylammonium)propoxy)-2,5-thiophene].
7. The method according to any one of claims 1 to 6, characterized in that In S3, when visual detection was performed, the amount of water-soluble conjugated polymer used was 1-50 nmol based on 25 ng of DNA extracted in S1.
8. The method according to any one of claims 1 to 7, characterized in that The method further comprises: mixing the reaction solution obtained from the amplification reaction in S2 with a water-soluble conjugated polymer to react, and measuring the ratio of the absorbance of the reaction solution at wavelengths of 394 nm and 520 nm, wherein a ratio greater than or equal to 1.2 is considered a positive result, and a ratio less than 1.2 is considered a negative result; Preferably, when measuring the absorbance ratio of the reaction solution at wavelengths of 394 nm and 520 nm, the amount of the water-soluble conjugated polymer used is 1-50 nmol, based on 25 ng of DNA extracted from S1.
9. Use of a water-soluble conjugated polymer in in vitro detection of pathogenic bacteria genes, preferably use of poly[3-methyl-4-(3-(N,N,N-triethylammonium)propoxy)-2,5-thiophene] in in vitro detection of pathogenic bacteria genes.
10. Use of a primer pair in in vitro detection of pathogenic bacteria genes, wherein: The pathogenic bacteria are Escherichia coli or Enterococcus faecalis; When the pathogenic bacteria is Escherichia coli, the primer pair includes: a primer with a nucleotide sequence shown in SEQ ID NO: 1, a primer with a nucleotide sequence shown in SEQ ID NO: 2, a primer with a nucleotide sequence shown in SEQ ID NO: 3, and a primer with a nucleotide sequence shown in SEQ ID NO: 4; When the target pathogen to be detected is Enterococcus faecalis, the primer pair includes: a primer with a nucleotide sequence shown in SEQ ID NO: 5, a primer with a nucleotide sequence shown in SEQ ID NO: 6, a primer with a nucleotide sequence shown in SEQ ID NO: 7, and a primer with a nucleotide sequence shown in SEQ ID NO: 8.