KASP molecular marker of wheat stripe rust resistance gene Yr29, primer group and application

Abstract

The invention relates to the technical field of molecular biology, and particularly discloses a KASP molecular marker of a wheat stripe rust resistance gene Yr29, a primer group and application, and the sequence of the wheat stripe rust resistance related gene is shown as SEQ ID NO.3; the KASP molecular marker is any one of Yr29K2 and Yr29K3 or a combination of the Yr29K2 and the Yr29K3; the sequence of the molecular marker Yr29K2 is as shown in SEQ ID NO.1, and N in the SEQ ID NO.1 is C or G; the sequence of the molecular marker Yr29K3 is as shown in SEQ ID NO. 2, and N in the SEQ ID NO. 2 is G or A. The KASP molecular marker provided by the invention is used for detecting wheat stripe rust resistance, so that stripe rust resistant wheat is screened, and wheat breeding is facilitated.

Description

Technical Field

[0001] The present invention relates to the technical field of molecular biology, and in particular to a KASP molecular marker, a primer set and an application of a wheat stripe rust resistance gene Yr29. Background Art

[0002] Wheat stripe rust is caused by Puccinia striiformis ( Pucciniastriiformis f. sp. tritici ) is an airborne fungal disease of wheat, classified as a Category I wheat disease. With the emergence of new pathogenic groups of stripe rust, most high-level resistance genes have lost their effectiveness, and the breeding of wheat varieties resistant to stripe rust has once again become a key focus in the breeding field. The discovery and utilization of new stripe rust-resistance genes is crucial for ensuring safe wheat production in my country, and related work is urgent.

[0003] At present, there are 4 adult plant resistance genes in wheat that show multiple effects, namely Yr18 / Lr34 / Pm38 / Sr57 、 Yr29 / Lr46 / Pm39 / Sr58 (hereinafter referred to as Yr29 / Lr46 ) , Yr30 / Lr27 / Sr2 / PmZH84 / Sb3 / Pbc1, Yr46 / Lr67 / Pm46 / Sr55 They are also resistant to stripe rust, leaf rust, stem rust and powdery mildew. Yr18 / Lr34 / Pm38 / Sr57 and Yr46 / Lr67 / Pm46 / Sr55 was cloned. Yr18 Although it is widely used, it is not effective when used alone and needs to be polymerized with other resistance sites to play a better resistance role. In addition to disease resistance, Yr18 It is also easy to cause premature aging of the plant, which is not conducive to the later filling of the plant, so it is rarely used in the country. Yr46 Due to the control of plant height Rht-4D Non-superior alleles are linked, so dwarf varieties after the Green Revolution generally do not contain this locus. Utilizing adult plant resistance with mixed resistance is an important direction for wheat rust breeding. However, because its resistance effect is not as strong as that of a single major gene, it requires gene aggregation to be more effective. Early selection using conventional techniques is difficult, and most breeding units lack the ability to accurately identify disease resistance, resulting in the underutilization of this type of resistance source. Therefore, there is an urgent need to continuously discover and utilize new broad-spectrum disease resistance gene resources to broaden the approaches to wheat disease resistance breeding and variety identification. Summary of the Invention

[0004] To develop a method for identifying wheat stripe rust-resistant varieties based on molecular markers associated with wheat stripe rust resistance, the present invention provides a KASP molecular marker, primer set, and application for the wheat stripe rust resistance gene Yr29. The KASP molecular marker provided by the present invention is used to detect wheat stripe rust resistance, thereby screening for stripe rust-resistant wheat and facilitating wheat breeding.

[0005] The present invention provides an application of a detection reagent for a KASP molecular marker of a wheat stripe rust resistance-related gene in identifying wheat varieties resistant to stripe rust. The sequence of the wheat stripe rust resistance-related gene is shown in SEQ ID NO.3; the KASP molecular marker is Yr29K2 and / or Yr29K3 ; Molecular markers Yr29K2 The sequence is shown in SEQ ID NO.1, where N is C or G; molecular marker Yr29K3 The sequence is shown in SEQ ID NO.2, where N is G or A.

[0006] The present invention detects KASP molecular markers Yr29K2 and / or Yr29K3 , detect wheat stripe rust resistance, thereby screening stripe rust-resistant wheat varieties and further realizing wheat breeding.

[0007] Furthermore, the detection reagent contains detection Yr29K2 Primer sets and / or detection Yr29K3 Primer set; Detection Yr29K2 The primer set includes primers having nucleotide sequences as shown in SEQ ID NO.4 to SEQ ID NO.6; Detection Yr29K3 The primer set includes primers whose nucleotide sequences are shown as SEQ ID NO.7 to SEQ ID NO.9.

[0008] The present invention also provides a primer set, which is used to amplify the KASP molecular marker of the wheat stripe rust resistance-related gene. Yr29K2 or Yr29K3 ; Amplified molecular markers Yr29K2 The primer set includes primers having nucleotide sequences as shown in SEQ ID NO.4 to SEQ ID NO.6; Amplified molecular markers Yr29K3 The primer set includes primers whose nucleotide sequences are shown as SEQ ID NO.7 to SEQ ID NO.9.

[0009] The present invention also provides a chip, which includes the primer set.

[0010] The present invention also provides a detection kit, which includes the primer set.

[0011] The invention also provides an application of the KASP molecular marker, the primer set, the chip or the detection kit, wherein the application is: (1) Detection of wheat genes resistant to both rust and powdery mildew Yr29 / Lr46 ; (2) Identification of wheat varieties resistant to stripe rust; (3) Breeding of wheat varieties resistant to stripe rust.

[0012] Furthermore, the method for identifying wheat varieties resistant to stripe rust is: Extract genomic DNA of the wheat variety to be tested and amplify molecular markers Yr29K2 PCR amplification was performed with the primer set; The PCR amplification product is subjected to typing detection. If the test result shows that the genotype of the marker target SNP is "CC" homozygous or "CG" heterozygous, the wheat to be tested is a candidate wheat with stripe rust resistance; if the genotype of the marker target SNP is "GG" homozygous, the wheat to be tested is a candidate wheat with stripe rust susceptibility.

[0013] Furthermore, the method for identifying wheat varieties resistant to stripe rust is: Extract genomic DNA of the wheat variety to be tested and amplify molecular markers Yr29K3 PCR amplification was performed with the primer set; The PCR amplification products are subjected to typing detection. If the test result shows that the genotype of the marker target SNP is "AA" homozygous or "AG" heterozygous, the wheat to be tested is a candidate for wheat with stripe rust resistance; if the genotype of the marker target SNP is "GG" homozygous, the wheat to be tested is a candidate for wheat with stripe rust susceptibility.

[0014] Furthermore, the method for identifying wheat varieties resistant to stripe rust is: Extract genomic DNA of wheat varieties to be tested and use molecular markers Yr29K2 and Yr29K3 The primer set is used for PCR amplification. Yr29K2 The primer set amplification result is CC or CG, and the molecular marker Yr29K3 When the amplification result of the primer set is AA or AG, it indicates that the wheat material is a disease-resistant wheat material.

[0015] Furthermore, the PCR amplification reaction system was as follows: 2 μL of HiGeno 2×Probe Mix B; DNA template was 100 ng DNA at a concentration of 50 ng / μL; 0.0448 μL of primer mixture solution; ddH2O was added to make up to 6 μL; The primer mixture solution is obtained by mixing the forward primer F1, the forward primer F2, the universal reverse primer R and ddH2O in a volume ratio of 12:12:30:46.

[0016] Compared with the prior art, the present invention has the following beneficial effects: The KASP molecular marker provided by the present invention is used to identify wheat stripe rust resistance. The KASP molecular marker primer set is used to amplify the wheat genomic DNA to be tested, and then the amplified product is subjected to typing detection to identify the stripe rust resistance wheat.

[0017] The present invention provides a wheat gene that is resistant to both rust and powdery mildew Yr29 / Lr46 KASP molecular markers can accurately predict wheat rust and powdery mildew resistance genes Yr29 / Lr46 , which is of great significance for the subsequent molecular breeding of wheat with resistance to rust and powdery mildew. Yr29 / Lr46 The KASP molecular marker is a specific marker for the combined resistance gene in the adult stage of wheat, which solves the problem of lack of resistance ability in screening the adult stage in the current wheat disease resistance breeding.

[0018] The present invention provides a method for amplifying the wheat rust and powdery mildew resistance gene. Yr29 / Lr46 The KASP molecular marker and primer set thereof can be rapidly and high-throughput applied to molecular-assisted disease resistance breeding of wheat, thereby accelerating the process of wheat breeding for combined disease resistance. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments or the description of the prior art. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0020] Figure 1 For the molecular marker in Example 2 of the present invention Yr29K2 Scatter plot of amplification typing of the primer set for the disease-resistant parent (Jimai 44), the disease-susceptible parent (Jimai 229), and 170 wheat varieties; In the figure, Figure 1 a is a molecular marker Yr29K2 Scatter plot of amplification typing of the primer set for the resistant parent, susceptible parent, and 170 wheat varieties; Figure 1 b is a box plot of disease response type; among them, HEX is on the X-axis, FAM is on the Y-axis, ++ indicates the same typing as the resistant parent, and -- indicates the same typing as the susceptible parent.

[0021] Figure 2 For the molecular marker in Example 2 of the present invention Yr29K3 Scatter plot of amplification typing of the primer set for the resistant parent, susceptible parent, and 170 wheat varieties; In the figure, Figure 2 a is a molecular marker Yr29K2 Scatter plot of amplification typing of the primer set for the resistant parent, susceptible parent, and 170 wheat varieties; Figure 2 b is a box plot of disease response type; among them, HEX is on the X-axis, FAM is on the Y-axis, ++ indicates the same typing as the resistant parent, and -- indicates the same typing as the susceptible parent.

[0022] Figure 3 The genetic fine map and the location map of differential SNP markers of candidate genes constructed by KASP markers developed from SNP information of 660K chip and resequencing data in Example 1 of the present invention; In the figure, Figure 3 A is Yr29 / Lr46 Fine positioning map of Figure 3 B is Yr29 / Lr46 Physical map of Figure 3 C is the location map of the candidate genes and the differential SNP markers in the resistant and susceptible parents. DETAILED DESCRIPTION

[0023] The specific embodiments of the present invention are described in detail below, but it should be understood that the scope of protection of the present invention is not limited by the specific embodiments. Based on the embodiments in the present invention, all other embodiments obtained by those of ordinary skill in the art without making creative work are within the scope of protection of the present invention. The experimental methods described in the embodiments of the present invention are conventional methods unless otherwise specified, and the materials, reagents, etc. used in the following embodiments can be obtained from commercial sources unless otherwise specified.

[0024] The test materials used in the examples of the present invention and their preparation are as follows: The wheat material used in the embodiments of the present invention is common wheat, specifically Jimai 44 material bred by the Crop Research Institute of Shandong Academy of Agricultural Sciences and its derivative varieties.

[0025] Example 1: A KASP molecular marker for wheat stripe rust resistance-related genes and its application.

[0026] 1. Construction of genetic populations and genetic analysis 1. Wheat materials for testing The parents used in genetic population construction were Jimai 44 and Jimai 229.

[0027] Among them, the disease-resistant parent, Jimai 44, is a wheat variety developed by the Crop Research Institute of the Shandong Academy of Agricultural Sciences with adult resistance to stripe rust, leaf rust, and powdery mildew. Jimai 229, another variety developed by the Crop Research Institute of the Shandong Academy of Agricultural Sciences, is susceptible to all of the aforementioned diseases. F1 hybrids were generated using Jimai 229 as the female parent and the disease-resistant wheat Jimai 44 as the male parent. The F1 hybrids were self-pollinated to produce the F2 hybrids. F2 plants were then repeatedly self-pollinated using the "single seed transmission" method to generate the sixth-generation recombinant inbred line population (F6RILs), which is used for genetic analysis, fine mapping, and positional cloning.

[0028] The common wheat cultivar Xiaoyan 22 was used as a susceptible control and was obtained from the National Crop Germplasm Resource Bank.

[0029] 2. Phenotypic evaluation of the test population and phenotypic data analysis The procedures and methods for field resistance assessment at the adult plant stage were as follows: 295 F6RILs were sown at two experimental sites: Yangling (34°17′N, 108°04′E, 519 m above sea level) and Jiangyou (31°53′N, 104°47′E, ​​571 m above sea level). A completely randomized block design with two replicates was used, with approximately 20 seeds per family per replicate. Each family was sown in two rows, 1.0 m long and 25 cm apart. Every 20 rows, two rows of Xiaoyan 22 were planted as the susceptible indicator variety. Within the plots, 50 seeds of Mingxian 169 were sown every 1.5 m between plots as triggering rows.

[0030] Jiangyou belongs to the winter breeding area of ​​stripe rust. The climatic conditions in this area are suitable for the natural occurrence and spread of stripe rust, so there is no need for artificial inoculation. Yangling belongs to the occasional occurrence area of ​​stripe rust. Artificial inoculation is carried out in mid-March every year when wheat grows to the jointing stage. Irrigation is carried out once a week before inoculation. If it rains, it can be omitted. Artificial inoculation in the field uses a mixture of the current popular stripe rust species CYR32, CYR33 and CYR34. It is generally chosen after 6 pm. At this time, the air in the field is humid and water droplets often condense on the leaves, which is very conducive to stripe rust infection. The artificial inoculation method is as follows:

[0031] First, uredia spores of stripe rust fungi were thoroughly mixed with paraffin oil at a volume ratio of 1:300. The mixture was then sprayed onto the inducing strain, Mingxian 169, using a sprayer. The leaves were then covered with plastic bags to retain moisture and the bags were opened before noon the following day. Stripe rust disease incidence was surveyed annually based on actual conditions. The main indicators were infection type (IT) and disease severity (DS). The infection type was determined using the Line and Qayoum 9-point scale (0-6 for resistant, 7-9 for susceptible). Surveys were conducted twice, during the peak and final stages of the outbreak. In some years, only the final stage of the outbreak was surveyed, as the flag leaves of the susceptible control were often covered with stripe rust spores and the disease was at its most severe.

[0032] For homozygous families, only one value is recorded; for segregating families, two or more values ​​are often recorded. Subsequently, the maximum disease severities (MDS) were selected as the indicator for analysis of variance (ANOVA) and correlation analysis. The AOV function in QTLI CiMapping v4.2 software was used to calculate the broad-sense heritability based on the variance results. The formula is as follows:

[0033] h2 b = σ2 g / ( σ2 g + σ2ge / e + σ2 ε / re ),in σ2 g =( MS g – MS ge ) / re , σ2ge =( MS ge – MS e ) / r, σ2 ε = MS ε ; In the above formula, h2 b represents heritability, σ2 g represents the genotype variance, σ2ge represents the genotype-environment interaction effect, σ2 ε represents the error; e is the number of environments, and r is the number of repetitions within each environment; re represents the total number of observations; MS g represents the genotype mean square; MSge represents the genotype × environment interaction mean square; MS ε stands for mean square error / residual mean square.

[0034] The results of variance analysis showed that there were extremely significant differences in stripe rust resistance among different genotypes, and the correlation coefficient among the five environments was 0.87, which showed a good correlation, thus clarifying the validity of the phenotypic data.

[0035] 2. Construction of genetic linkage map (1) Whole-genome scanning QTL positioning analysis combined with wheat 660K chip When wheat reached the three-leaf stage, fresh leaves were collected from the susceptible parent and 295 F6 RIL families, and wheat genomic DNA was extracted using the CTAB method. After passing quality control, DNA from the parent and offspring populations was sent to Beijing Biobio Biotechnology Co., Ltd. for genotyping using a wheat 660K SNP array. Based on the genotyping results, SNP genotype calling and allele clustering were performed using the polyploid version of Affymetrix Genotyping Console™ (AGC) software. With reference to the genotypes of the parents, the genotypes of each locus in each RIL family were converted to "A," "B," and "X." Genotypes consistent with Jimai 44 were designated "A," those consistent with Jimai 229 were designated "B," and heterozygous or missing genotypes were designated "X." According to the screening criteria for polymorphic SNP markers for constructing genetic linkage maps: PHR / polymorphism, missing value <5%, major allele frequency (MAF) ≤ 95%, and segregation ratio of 1:1 determined by chi-square test ( P >0.001). Linkage analysis was performed using QTLI CiMapping v4.1 and JoinMap 4.0 software, and the results were visualized using Mapchart v2.3. Recombination rates were converted to genetic distances (cM) using the Kosambi function. A representative marker for each cosegregating marker group was selected using the "Bin" function in CiMapping v4.1, and a genetic map corresponding to each linkage group was constructed using the "Map" function.

[0036] 3. Fine Mapping and Cloning of Candidate Genes and Design of KASP Molecular Markers Further research was conducted using the remaining heterozygous population. Yr29 / Lr46 Combined with the high-generation genetic analysis population of Jimai 229 / Jimai 44, which only contains Yr29 / Lr46The remaining heterozygous families JMHIF9, JMHIF10, JMHIF20, and JMHIF21 were self-pollinated to create F2 secondary segregation populations. Approximately 200 F2 plants were selected from each heterozygous line as the basic segregation population. Based on the phenotype and segregation of the F2 plants, the populations in which the target trait was controlled by a single gene (with a segregation ratio of 3:1 for disease resistance:susceptibility) were screened for preliminary and fine mapping. The F2 segregation population required for fine mapping exceeded 5,000 plants, consisting of F2 or F 2:3 Composition of derived populations. Using the F2 segregating populations constructed above (n=5796), families with extreme phenotypes were selected to construct disease-resistant / susceptible mixed pools based on the identification results under multiple environments: 30 susceptible families (genotypes yr29 / yr29 , i.e. recessive homozygous), to construct a susceptible homozygous pool; 30 dominant homozygous disease-resistant families (genotype Yr29 / Yr29 ) to construct a disease-resistant pool. Genotyping and RNA-Seq were performed on the two pools and the two parents, respectively, using a wheat 660K SNP array. Furthermore, 10× genome resequencing was performed on each parent of the segregating population. The specific steps were as follows:

[0037] (1) For SNP chip typing data: After mining the differential SNPs between the resistance and susceptible pools, the chromosome distribution and genetic and physical location information of the differential SNP sites are obtained based on the reference integrated genetic map and physical map. The Perl language program is used to calculate the number of differential SNPs contained in each megabase pair (Mb) or each genetic distance centimole (cM) to understand the enrichment of SNP distribution on the chromosome and thus determine the possible range of the target gene; (2) For RNA-Seq data, the sequencing data is aligned to the Chinese Spring reference genome (IWGSC RefSeq v2.1) sequence and SNP calling is performed and the index value of the SNP site is calculated (the proportion of a certain genotype to the total genotype). In most regions of the genome, due to the free combination between genes, the above index value is approximately 0.5; in the gene region that controls the target trait, the index values ​​of the two extreme mixed pools will be significantly different, which can quickly complete the preliminary positioning and roughly lock the target gene in a certain interval on the chromosome, which is the 650Mb~690Mb interval of chromosome 1BL.

[0038] The positioning intervals of the above methods were integrated to develop SNP-based KASP molecular markers or InDel markers based on small fragment insertions and deletions, and the F2 segregating population was genotyped. After obtaining the phenotypic and genotypic data of the F2 segregating population under multiple environments, the data were analyzed using two methods: quality traits and quantitative traits. For quality traits, Joinmap software was used to combine phenotypes and genotypes according to the Kosambi function to calculate the recombination exchange rate and draw a linkage map; for quantitative traits, the inclusive composite interval mapping (ICIM) method was used to select QTL positioning using QTLIciMapping V4.1 software. Finally, the results of the two methods were combined to verify the positioning intervals. After determining that the target gene interval is in the range of 670Mb~680Mb of the Chinese Spring reference genome, appropriate flanking markers at both ends were selected, such as AX5708 and AX0417 Screening for key recombinants in a large F2 population ( Figure 3 A), by analyzing and confirming the genotypes and phenotypes of these key recombinants, combined with the newly developed molecular markers in the fine mapping process, the marker and phenotype (corresponding to Yr29 / Lr46 The linkage relationship between the genotypes of dominant homozygous and heterozygous materials is determined by whether the offspring phenotypes are separated) and the closer flanking markers are determined. Finally, the target interval is locked in uucw.k23 and AX1895 The corresponding interval is 678.764Mb~679.037Mb of chromosome 1B in the Chinese Spring reference genome v.2.1 ( Figure 3 A and Figure 3 B). According to the gene annotation and transcription expression results of Chinese Spring, only 4 high-confidence genes were expressed, namely: TraesCS1B03G1218000, TraesCS1B03G1218500, TraesCS1B03G1218900, TraesCS1B03G1219000 WRKYfamily transcription factor, S-type anion channel, ATP-dependent zincmetalloprotease FtsH 1, and Carboxypeptidase were annotated respectively. TraesCS1B03G1218500 It was induced to express by stripe rust and preliminarily identified as an important candidate gene. Its nucleotide sequence is shown in SEQ ID NO.3.

[0039] SEQ ID NO.3:

[0040] Based on the SNP differences of this gene in the resistant and susceptible parents, two sets of molecular markers for this gene were developed and designed using Primer 5.0 software. Yr29K2 、 Yr29K3 , whose physical location is Figure 3 The stability of the molecular marker was verified in subsequent recombinant strains and natural populations. Yr29K2 Located on chromosome 1B of wheat chromosome group 670273834 ( Figure 3 C), whose nucleotide sequence is shown in SEQ ID NO.1. The molecular marker Yr29K3 Located on chromosome 1B of wheat chromosome group 670273715 ( Figure 3 C), whose nucleotide sequence is shown in SEQ ID NO.2.

[0041] SEQ ID NO.1: 5'-CACCTGGATGTGCAGCCAGCAGAGGTAGCGGTGCTGCCCAATGGCGAGCCCTGGCCGTTTCCTCCGGTTTCCNATCAGTGCGTTCGGAATGTGCCTGGGCGTGAGCAGCCAGGCAATGTTGTGGAAGACTCTTTCGTCGGAGCACTCC-3'. Among them, N is C or G.

[0042] SEQ ID NO.2: 5'-GTTGTGGAAGACTCTTTCGTCGGAGCACTCCACGGGGTTCCTTGGCGTGCACCCCGCCGTCAACCGCGTCCTCTNGTGGGCCTCCGTCGCCCTCACCGTCATTGTGTCCATCACGTACCTACTCAAGGTTGTGTTCTACTTCGAGGCCGT-3'. Among them, N is A or G.

[0043] 4. KASP molecular marker primer design and verification (1) Primer design Molecular markers Yr29K2 、 Yr29K3 Primer design is shown in Table 1. Molecular markers Yr29K2 and Yr29K3 Both include forward primer F1, forward primer F2 and universal reverse primer R.

[0044] SEQ ID NO.4:5'- gaaggtgaccaagttcatgctACATTCCGAACGCACTGATG-3'.

[0045] The FAM probe sequence is underlined.

[0046] SEQ ID NO.5:5'- gaaggtcggagtcaacggatt ACATTCCGAACGCACTGATC-3'.

[0047] The HEX probe sequence is underlined.

[0048] SEQ ID NO. 6: 5'-TAACCACCTGGATGTGCAGC-3'.

[0049] SEQ ID NO.7:5'- gaaggtgaccaagttcatgct CGTCAACCGCGTCCTCTG-3'.

[0050] The FAM probe sequence is underlined.

[0051] SEQ ID NO.8:5'- gaaggtcggagtcaacggatt CGTCAACCGCGTCCTCTA-3'.

[0052] The HEX probe sequence is underlined.

[0053] SEQ ID NO.9: 5'-CTTGAGTAGGTACGTGATGGAC-3'.

[0054] (2) Molecular detection of stripe rust resistance genes in 170 major wheat varieties The molecular markers shown in Table 1 Yr29K2 or Yr29K3 The primer set was used to detect stripe rust resistance genes in 170 wheat cultivars. The specific steps are as follows:

[0055] Extract genomic DNA from the wheat cultivar to be tested and use it as a template for PCR amplification using the primers listed in Table 1.

[0056] The PCR amplification reaction system was as follows: 2 μL of HiGeno 2×Probe Mix B; 100 ng of DNA template (DNA concentration was 50 ng / μL); 0.0448 μL of primer mixture solution; and ddH2O to make up to 6 μL.

[0057] The primer mixture solution is obtained by mixing the forward primer F1, the forward primer F2, the universal reverse primer R and ddH2O in a volume ratio of 12:12:30:46.

[0058] The reaction program of the PCR amplification was as follows: pre-denaturation: 94°C / 15 min; denaturation: 94°C / 20 s; annealing: 58°C (-0.6°C) / 1 min / 10 cycles; denaturation: 94°C / 20 s; annealing: 55°C / 1 min / 30 cycles; low temperature cycle: 16°C / ∞.

[0059] For the use of molecular markers Yr29K2 The amplification results were analyzed using the primer set. If the genotype was homozygous for "CC" or heterozygous for "CG", the wheat to be tested was a wheat material resistant to wheat stripe rust; if the genotype was homozygous for "GG", the wheat to be tested was a wheat material susceptible to wheat stripe rust.

[0060] Depend on Figure 1 From a, we can see that Yr29K2 The "CC" homozygous type can be amplified in the disease-resistant parent, and all "CC" homozygous types or "CG" heterozygous types are possible target gene materials. Figure 1 From b, we can see that the “CC” homozygous type, i.e., the material containing the target gene, has better resistance in the adult stage than the “GG” homozygous type. Yr29K2 It can detect the resistance of wheat to stripe rust. Yr29K2 The specific results of the genotypes and stripe rust phenotypes detected by the primer sets are shown in Table 2 .

[0061] As can be seen from Table 2, Yr29K2 The "CC" and "GG" genotypes can be amplified in the resistant and susceptible parents, respectively, and the populations can be genotyped. Among the 170 main wheat varieties mentioned above, the "CC" homozygous genotype and the "CG" heterozygous genotype both carry the target gene, and their stripe rust resistance phenotype (severity value) is lower than that of the "GG" genotype material (which does not carry the target gene). The wheat materials carrying this gene have better resistance in the field. The above results show that the use of molecular markers can Yr29K2 Resistance testing for wheat stripe rust can be performed.

[0062] Yr29K2As a functional molecular marker of the candidate gene, it co-segregated with the stripe rust resistance phenotype in a large genetic population (more than 5,000 F2 plants), indicating that the marker is closely linked to the target gene. Compared with previous molecular markers, it is closer to the target gene in genetic distance and is less likely to recombine under natural conditions, further ensuring the accuracy of this marker for wheat stripe rust resistance detection. In addition, Yr29K2 As a high-throughput KASP molecular marker, another advantage is that it can quickly and efficiently detect large population samples, and is simple and easy to operate, ensuring the timeliness of field selection, which traditional SSR markers cannot achieve.

[0063] For the use of molecular markers Yr29K3 The amplification results of the primer set were analyzed. If the genotype was homozygous for "AA" or heterozygous for "AG", the wheat to be tested was a wheat material resistant to wheat stripe rust; if the genotype was homozygous for "GG", the wheat to be tested was a wheat material susceptible to wheat stripe rust.

[0064] Depend on Figure 2 From a, we can see that Yr29K3 The "AA" homozygous type can be amplified in the disease-resistant parent, and all "AA" homozygous types or "AG" heterozygous types are possible target gene materials. Figure 2 From b, we can see that the “AA” homozygous type, i.e., the material containing the target gene, has better resistance in the adult stage than the “GG” homozygous type material. Yr29K3 It can detect the resistance of wheat to stripe rust. Yr29K3 The specific results of the genotypes and stripe rust phenotypes detected by the primer sets are shown in Table 3.

[0065] From Table 3, we can see that Yr29K3 The "AA" and "GG" genotypes can be amplified in the resistant and susceptible parents, respectively, and the populations can be genotyped. Among the 170 main wheat varieties mentioned above, the "AA" homozygous genotype and the "AG" heterozygous genotype both carry the target gene, and their stripe rust resistance phenotype (severity value) is lower than that of the "GG" genotype material (which does not carry the target gene). The wheat materials carrying this gene have better resistance in the field. The above results show that the use of molecular markers can Yr29K3 Resistance testing for wheat stripe rust can be performed.

[0066] Yr29K3As a functional molecular marker of the candidate gene, it co-segregated with the stripe rust resistance phenotype in a large genetic population (more than 5,000 F2 plants), indicating that the marker is closely linked to the target gene. Compared with previous molecular markers, it is closer to the target gene in genetic distance and is less likely to recombine under natural conditions, further ensuring the accuracy of this marker for wheat stripe rust resistance detection. In addition, Yr29K3 As a high-throughput KASP molecular marker, another advantage is that it can quickly and efficiently detect large population samples, and is simple and easy to operate, ensuring the timeliness of field selection, which traditional SSR markers cannot achieve.

[0067] When the present invention involves a numerical range, it should be understood that both endpoints of each numerical range and any value between the two endpoints can be selected. To avoid redundancy, the present invention describes preferred embodiments.

[0068] Although preferred embodiments of the present invention have been described, additional changes and modifications to these embodiments may occur to those skilled in the art once the basic inventive concepts become known.

[0069] Obviously, those skilled in the art may make various modifications and variations to the present invention without departing from the spirit and scope of the present invention. Thus, if such modifications and variations fall within the scope of the claims and their equivalents, the present invention is intended to include such modifications and variations.

Claims

1. Application of a KASP molecular marker detection reagent for wheat stripe rust resistance-related genes in identifying wheat varieties resistant to stripe rust, characterized in that: The sequence of the wheat stripe rust resistance-related gene is shown in SEQ ID NO.3; the KASP molecular marker is Yr29K2 and / or Yr29K3 ; Molecular markers Yr29K2 The sequence is shown in SEQ ID NO.1, where N is C or G; molecular marker Yr29K3 The sequence is shown in SEQ ID NO.2, where N is G or A.

2. The use of the KASP molecular marker detection reagent for wheat stripe rust resistance-related genes according to claim 1 in identifying wheat varieties resistant to stripe rust, characterized in that: The detection reagent contains detection Yr29K2 Primer sets and / or detection Yr29K3 Primer set; Detection Yr29K2 The primer set includes primers having nucleotide sequences as shown in SEQ ID NO.4 to SEQ ID NO.6; Detection Yr29K3 The primer set includes primers whose nucleotide sequences are shown as SEQ ID NO.7 to SEQ ID NO.

9.

3. A primer set, characterized in that: The primer set is used to amplify the KASP molecular marker of the wheat stripe rust resistance-related gene described in claim 1 Yr29K2 or Yr29K3 ; Amplified molecular markers Yr29K2 The primer set includes primers having nucleotide sequences as shown in SEQ ID NO.4 to SEQ ID NO.6; Amplified molecular markers Yr29K3 The primer set includes primers whose nucleotide sequences are shown as SEQ ID NO.7 to SEQ ID NO.

9.

4. A chip, characterized in that: Comprising the primer set according to claim 3.

5. A detection kit, characterized in that: Comprising the primer set according to claim 3.

6. Use of the primer set according to claim 3, the chip according to claim 4 or the detection kit according to claim 5, characterized in that: The applications are: (1) Detection of wheat genes resistant to both rust and powdery mildew Yr29 / Lr46 ; (2) Identification of wheat varieties resistant to stripe rust; (3) Breeding of wheat varieties resistant to stripe rust.

7. The use according to claim 6, characterized in that Methods for identifying wheat varieties resistant to stripe rust are: Extract genomic DNA of the wheat variety to be tested and amplify molecular markers Yr29K2 PCR amplification was performed with the primer set; The PCR amplification products are subjected to typing detection. If the test result shows that the genotype of the marker target SNP is "CC" homozygous or "CG" heterozygous, the wheat to be tested is a candidate for wheat with stripe rust resistance; if the genotype of the marker target SNP is "GG" homozygous, the wheat to be tested is a candidate for wheat with stripe rust susceptibility.

8. The use according to claim 6, characterized in that Methods for identifying wheat varieties resistant to stripe rust are: Extract genomic DNA of the wheat variety to be tested and amplify molecular markers Yr29K3 PCR amplification was performed with the primer set; The PCR amplification products are subjected to typing detection. If the test result shows that the genotype of the marker target SNP is "AA" homozygous or "AG" heterozygous, the wheat to be tested is a candidate for wheat with stripe rust resistance; if the genotype of the marker target SNP is "GG" homozygous, the wheat to be tested is a candidate for wheat with stripe rust susceptibility.

9. The use according to claim 6, characterized in that Methods for identifying wheat varieties resistant to stripe rust are: Extract genomic DNA of wheat varieties to be tested and use molecular markers Yr29K2 and Yr29K3 The primer set is used for PCR amplification. Yr29K2 The primer set amplification result is CC or CG, and the molecular marker Yr29K3 When the amplification result of the primer set is AA or AG, it indicates that the wheat material is a disease-resistant wheat material.

10. The use according to any one of claims 7 to 9, characterized in that: The PCR amplification reaction system was as follows: 2 μL of HiGeno 2×Probe Mix B; the DNA template was 100 ng of DNA at a concentration of 50 ng / μL; 0.0448 μL primer mixture solution; ddH2O makes up to 6 μL; The primer mixture solution is obtained by mixing the forward primer F1, the forward primer F2, the universal reverse primer R and ddH2O in a volume ratio of 12:12:30:46.

Images