Streptococcus pneumoniae capsular polysaccharides and conjugates thereof

Abstract

The present invention relates to activated Streptococcus pneumoniae serotype 10A, 22F or 33F polysaccharides and methods of making the same. The invention also relates to immunogenic conjugates comprising Streptococcus pneumoniae serotype 10A, 22F or 33F polysaccharides covalently linked to a carrier protein, methods for their preparation and immunogenic compositions and vaccines comprising the same.

Description

[0001] This application is a divisional application of the invention patent application 201580005247.5 of the same name filed on January 15, 2015. [Field of the Invention]

[0002] The present invention relates to activated Streptococcus pneumoniae serotype 10A, 22F or 33F polysaccharides and methods for preparing the same. The present invention also relates to immunogenic conjugates comprising a Streptococcus pneumoniae serotype 10A, 22F or 33F polysaccharide covalently linked to a carrier protein, methods for preparing the same, and immunogenic compositions and vaccines comprising the same.

background

[0003] Streptococcus pneumoniae is a gram-positive, lancet-shaped coccus that is usually seen in pairs (diplococci), but can also be present in short chains or as single cells. They grow readily as flash colonies on blood agar plates and exhibit alpha hemolysis unless grown anaerobically (in which case they exhibit beta hemolysis). Cells of most pneumococcal serotypes have a capsule that is a polysaccharide coating surrounding each cell. This capsule is a determinant of virulence in humans because it interferes with phagocytosis by preventing antibodies from attaching to bacterial cells. There are currently more than 90 known pneumococcal capsular serotypes identified, of which the 23 most common serotypes cause approximately 90% of invasive disease worldwide. As a vaccine, pneumococcal polysaccharide coatings can confer a reasonable degree of immunity against S. pneumoniae in individuals with a well-developed or robust immune system, but capsular polysaccharides conjugated to a suitable carrier protein allow for the generation of an immune response in infants and the elderly, who are also at the highest risk of pneumococcal infection.

[0004] Invasive disease from seven serotypes (4, 6B, 9V, 14, 18C, 19F, and 23F) has virtually disappeared since the introduction of the first 7-valent pneumococcal conjugate vaccine (PCV7 or Prevnar) in 2000. The addition of serotypes 1, 3, 5, 6A, 7F, and 19A in Prevnar 13 further reduced the amount of invasive pneumococcal disease.

[0005] None of the currently available pneumococcal vaccines provide adequate protection against serotypes 10A, 22F, or 33F of S. pneumoniae in humans, especially children under the age of 2. Therefore, there is a need for immunogenic compositions that can be used to induce an immune response against serotypes 10A, 22F, or 33F of S. pneumoniae. Summary of the invention

[0006] In one aspect, the present disclosure provides a method for preparing activated S. pneumoniae serotype 10A, 22F or 33F capsular polysaccharide, the method comprising the steps of:

[0007] (a) reacting an isolated serotype 10A, 22F or 33F capsular polysaccharide with an oxidizing agent; and

[0008] (b) Quenching the oxidation reaction by adding a quencher, resulting in activated S. pneumoniae serotype 10A, 22F or 33F polysaccharide.

[0009] In a further aspect, the present invention relates to activated S. pneumoniae serotype 10A, 22F or 33F capsular polysaccharide obtained or obtainable by the activation method disclosed herein.

[0010] In other aspects, the present disclosure provides a method for preparing an immunogenic conjugate comprising a S. pneumoniae serotype 10A, 22F, or 33F polysaccharide covalently linked to a carrier protein, the method comprising the steps of:

[0011] (a) mixing an activated serotype 10A, 22F or 33F polysaccharide obtained or obtainable by the method disclosed herein with a carrier protein; and,

[0012] (b) reacting the mixed activated serotype 10A, 22F or 33F polysaccharide and carrier protein with a reducing agent to form a serotype 10A, 22F or 33F polysaccharide:carrier protein conjugate.

[0013] In other aspects, the present disclosure provides a serotype 10A, 22F or 33F polysaccharide:carrier protein conjugate obtained or obtainable by the methods disclosed herein.

[0014] In other aspects, the present disclosure provides immunogenic compositions and vaccines comprising the immunogenic conjugates disclosed herein.

[0015] In other aspects, the present disclosure provides methods of treating or preventing a S. pneumoniae infection, disease, or condition associated with serotype 10A, 22F, or 33F S. pneumoniae in a subject, the methods comprising the step of administering a therapeutically or prophylactically effective amount of an immunogenic composition or vaccine disclosed herein.

Brief description of the attached figure

[0016] Figure 1 The structure of the repeating unit of the S. pneumoniae capsular polysaccharide serotype 10A is shown.

[0017] Figure 2 The structure of the repeating unit of the S. pneumoniae capsular polysaccharide serotype 22F is shown.

[0018] Figure 3 The structure of the repeating unit of the S. pneumoniae capsular polysaccharide serotype 33F is shown.

[0019] Figure 4 Shown are the molecular weights of activated serotype 22F polysaccharide as a function of the amount of oxidizing agent at 23°C with and without a quenching step.

[0020] Figure 5 Shown are the molecular weights of activated serotype 22F polysaccharide as a function of the amount of oxidizing agent at 4°C with and without a quenching step.

[0021] Figure 6 Shown are the molecular weights of activated serotype 33F polysaccharide as a function of the amount of oxidizing agent at 2 to 8°C with or without a quenching step or at 23°C without a quenching step. [Detailed description of the invention]

[0022] The present invention can be more easily understood by referring to the following detailed description of the preferred embodiments of the present invention and the examples included herein. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those generally understood by those of ordinary skill in the art to which the present invention belongs. Although any method and material similar or equivalent to the methods and materials described herein can be used in the practice or testing of the present invention, certain preferred methods and materials are described herein. In describing embodiments and advocating the present invention, certain terms will be used according to the definitions shown below.

[0023] As used herein, the singular forms "a," "an," and "the" include plural referents unless otherwise indicated. Thus, for example, reference to "a method" includes one or more methods and / or steps of the type described herein and / or which will become apparent to one of ordinary skill in the art upon reading this disclosure.

[0024] As used herein, the term "molecular weight" of a polysaccharide or carrier protein-polysaccharide conjugate refers to the molecular weight calculated by size exclusion chromatography (SEC) in combination with a multi-angle laser light scattering detector (MALLS).

[0025] As used herein, the term "degree of oxidation" (DO) refers to the number of sugar repeating units per aldehyde group produced when an isolated polysaccharide is activated with an oxidizing agent. The degree of oxidation of a polysaccharide can be determined using conventional methods known to those skilled in the art.

[0026] It should be noted that in the present disclosure, terms such as "comprising," "including," "containing," "having," "having," and the like may have the meanings ascribed to them in U.S. patent law; for example, they may mean "include," "comprise," "contain," and the like. Such terms refer to the inclusion of a specified ingredient or group of ingredients without excluding any other ingredients. Terms such as "consisting essentially of" and "consisting essentially of" have the meanings ascribed to them in U.S. patent law, for example, they allow for the inclusion of additional ingredients or steps that do not detract from the novel or essential characteristics of the invention, that is, they exclude additional, uncited ingredients or steps that detract from the novel or essential characteristics of the invention. The terms "consisting of" and "consisting of" have the meanings ascribed to them in U.S. patent law; that is, these terms are closed-ended. Thus, these terms refer to the inclusion of a specified ingredient or group of ingredients and to the exclusion of all other components.

[0027] As used herein, the term "conjugate" or "glycoconjugate" refers to a polysaccharide covalently conjugated to a carrier protein. The glycoconjugates of the present invention and immunogenic compositions comprising the same may contain a certain amount of free polysaccharide.

[0028] As used herein, the term "serotype 10A saccharide conjugate" or "serotype 10A conjugate" refers to an isolated S. pneumoniae serotype 10A capsular polysaccharide covalently conjugated to a carrier protein.

[0029] As used herein, the term "serotype 22F saccharide conjugate" or "serotype 22F conjugate" refers to an isolated Streptococcus pneumoniae serotype 22F capsular polysaccharide covalently conjugated to a carrier protein.

[0030] As used herein, the term "serotype 33F saccharide conjugate" or "serotype 33F conjugate" refers to an isolated S. pneumoniae serotype 33F capsular polysaccharide covalently conjugated to a carrier protein.

[0031] As used herein, the term "serotype 10A polysaccharide" refers to the S. pneumoniae serotype 10A capsular polysaccharide.

[0032] As used herein, the term "serotype 22F polysaccharide" refers to the S. pneumoniae serotype 22F capsular polysaccharide.

[0033] As used herein, the term "serotype 33F polysaccharide" refers to the S. pneumoniae serotype 33F capsular polysaccharide.

[0034] As used herein, the term "free polysaccharide" refers to capsular polysaccharide that is not covalently conjugated to a carrier protein but is still present in the capsular polysaccharide-carrier protein conjugate composition. The free polysaccharide may be non-covalently associated with (i.e., non-covalently bound to, adsorbed to, or captured on or non-covalently bound to, adsorbed to, or captured on) the polysaccharide-carrier protein conjugate.

[0035] After final purification of the serotype 10A, 22F or 33F capsular polysaccharide-carrier protein conjugate, the percentage of free polysaccharide is measured. Preferably, it is determined within 4 weeks after final purification. It is expressed as a percentage of the total polysaccharide in the sample.

[0036] As used herein, "conjugation," "conjugated," and "conjugated" refer to the process by which the S. pneumoniae capsular polysaccharide is covalently linked to a carrier protein.

[0037] The term "subject" refers to a mammal, including humans, or to a bird, fish, reptile, amphibian, or any other animal. The term "subject" also includes household pets or research animals. Non-limiting examples of household pets and research animals include dogs, cats, pigs, rabbits, rats, mice, gerbils, hamsters, guinea pigs, ferrets, monkeys, birds, snakes, lizards, fish, turtles, and frogs. The term "subject" also includes livestock animals. Non-limiting examples of livestock animals include alpacas, bison, camels, cattle, deer, pigs, horses, llamas, mules, donkeys, sheep, goats, rabbits, reindeer, yaks, chickens, geese, and turkeys.

[0038] In the preparation of a polyvalent conjugate pneumococcal vaccine for the prevention of invasive diseases caused by the organism Streptococcus pneumoniae (also known as pneumococcus), selected S. pneumoniae serotypes are grown to provide the polysaccharides needed to produce the vaccine. The cells are grown in a fermentor and lysis is induced at the end of the fermentation by adding sodium deoxycholate or an alternative lysis agent. The lysis broth is then harvested for downstream purification and recovery of the capsular polysaccharide surrounding the bacterial cells. After activation and conjugation to a carrier protein, the polysaccharide is included in the final vaccine product and confers immunity to the selected S. pneumoniae serotype in the vaccine's target population.

[0039] The immunogenicity of polysaccharide: carrier protein conjugates depends on several factors, including the size of the polysaccharide. Polysaccharide size is a quality attribute determined in each production batch and must be appropriately controlled. High molecular weight capsular polysaccharides are able to induce a certain antibody immune response due to the higher titer of epitopes present on the surface of the antigen. It is generally preferred to prevent or limit undesirable reduction in polysaccharide size during the preparation of the conjugate to preserve the immunogenicity of the polysaccharide. In addition, it is important to reduce the batch-to-batch variability of polysaccharide molecular weight during the activation step and subsequent conjugation process to maintain consistency in the quality attributes of the conjugate.

[0040] Reductive amination chemistry (RAC) has been demonstrated by the present inventors to be a suitable method for preparing S. pneumoniae serotype 10A, 22F, or 33F capsular polysaccharide-protein carrier conjugates. The RAC method involves activation of the polysaccharide by oxidation and subsequent conjugation of the activated polysaccharide to the protein carrier by reduction. Serotype 10A, 33F, and 22F polysaccharides have been shown to be particularly sensitive polysaccharides and are susceptible to degradation and size reduction during the oxidation step of conjugate preparation. In addition, the use of hitherto known activation methods has produced activated serotype 10A, 33F, and 22F polysaccharides with variable molecular weights.

[0041] Therefore, there exists a significant need for methods for preparing activated S. pneumoniae serotype 10A, 22F, or 33F polysaccharides having a controlled and consistent molecular weight.

[0042] The present invention relates to a method for preparing an activated polysaccharide of Streptococcus pneumoniae serotype 10A, 22F or 33F. Specifically, the present invention relates to a method for preparing an activated polysaccharide of Streptococcus pneumoniae serotype 10A, 22F or 33F, comprising the following steps:

[0043] (a) reacting an isolated serotype 10A, 22F or 33F polysaccharide with an oxidizing agent; and,

[0044] (b) Quenching the oxidation reaction by adding a quencher, resulting in activated S. pneumoniae serotype 10A, 22F or 33F polysaccharide.

[0045] [Isolation and purification of serotype 10A, 22F or 33F polysaccharides]

[0046] The structures of serotype 10A, 22F and 33F polysaccharides are disclosed in the literature (see, for example, Kamerling J PC. Pneumococcal polysaccharides: a chemical view. In: Tomasz A, editor. Streptococcus pneumoniae, molecular biology and mechanisms of disease. New York, NY: Mary Ann Liebert, Inc.; 2000. pp. 81-114).

[0047] As in Figure 1As shown in , the polysaccharide repeat unit of serotype 22F consists of a branched polysaccharide backbone (one glucuronic acid (GlcpA), one glucose pyranose (Glcp), one galactofuranose (Galf), and two rhamnopyranose (Rhap)), in which the αGlcp branch is attached to the C3 hydroxyl group of βRhap 45. Approximately 80% of the C2 hydroxyl groups of the βRhap residues in the polysaccharide repeat unit are O-acetylated.

[0048] As in Figure 2 As shown in , the polysaccharide repeating unit of serotype 10A is composed of two D-galactofuranose, three D-galactopyranose, one N-acetylgalactosamine, and a phosphate bond connected to the sugar chain through a D-ribitol.

[0049] As in Figure 3 As shown in , the polysaccharide repeating unit of serotype 33F is composed of three D-galactopyranoses, two D-galactofuranoses, and one D-glucopyranose. Notably, the 5-D-galactofuranose residue in approximately 90% of the 33F polysaccharide repeating units is O-acetylated. Serotype 10A, 22F, and 33F capsular polysaccharides can be obtained directly from bacteria using isolation methods known to those skilled in the art (see, for example, methods disclosed in U.S. Patent Application Publication Nos. 20060228380, 20060228381, 20070184071, 20070184072, 20070231340, and 20080102498, or WO2008118752). Alternatively, they can be produced using synthetic methods.

[0050] Serotype 10A, 22F and 33F S. pneumoniae strains used to produce the respective polysaccharides used in the immunogenic conjugates of the invention can be obtained from established culture collections or clinical samples.

[0051] Purified serotype 10A, 22F and 33F polysaccharides are obtained by methods well known to those skilled in the art. Preferably, the bacterial cells are grown in a soybean-based culture medium. After fermentation of the bacterial cells producing S. pneumoniae serotype 10A, 22F or 33F capsular polysaccharides, the bacterial cells are lysed to produce cell lysates. Any lytic agent is used to lyse the bacterial cells. "Lysing agent" is any reagent that helps to rupture the cell wall and release the autolysin that causes cell lysis, including, for example, detergents. As used herein, "detergent" refers to any anionic or cationic detergent that can induce the lysis of bacterial cells. Representative examples of such detergents for use in the methods of the present invention include sodium deoxycholate (DOC), N-lauroylsarcosine, sodium chenodeoxycholate and saponin.

[0052] In one embodiment of the present invention, the lysing agent used to lyse bacterial cells is DOC. DOC is the sodium salt of the bile acid deoxycholic acid, which is typically derived from a biological source such as cows or cattle. DOC activates the LytA protein, an autolysin involved in cell wall growth and division in Streptococcus pneumoniae. The LytA protein has a choline binding domain in its C-terminal portion, and mutations in the lytA gene are known to produce LytA mutants that are resistant to lysis using DOC.

[0053] In one embodiment of the invention, the lysing agent used to lyse bacterial cells is a lysing agent of non-animal origin. Non-animal-derived lysing agents for use within the methods of the invention include agents from non-animal sources that have a similar mode of action to that of DOC (i.e., affecting LytA function and leading to lysis of S. pneumoniae cells). Such non-animal-derived lysing agents include, but are not limited to, analogs of DOC, surfactants, detergents, and structural analogs of choline. In one embodiment, the non-animal-derived lysing agent is selected from decanesulfonic acid, tert-octylphenoxypoly(ethylene oxide)ethanol (e.g. CA-630, CAS#: 9002-93-1, available from Sigma Aldrich, St. Louis, MO), octylphenol ethylene oxide condensate (e.g. In another embodiment, the non-animal derived cleavage agent is N-lauroyl sarcosine. In another embodiment, the cleavage agent is sodium N-lauroyl sarcosinate.

[0054] Capsular polysaccharide can then be purified from the cell lysate using purification techniques known in the art, including centrifugation, depth filtration, precipitation, ultrafiltration, treatment with activated carbon, diafiltration, and / or the use of column chromatography (see, e.g., U.S. Patent Application Publication Nos. 20060228380, 20060228381, 20070184071, 20070184072, 20070231340, and 20080102498 or WO2008118752). The purified serotype 10A, 22F, or 33F polysaccharide can then be used in the preparation of immunogenic conjugates.

[0055] Preferably, in order to produce a serotype 22F conjugate or serotype 33F conjugate with favorable filterability characteristics and / or yield, the polysaccharide is tailored to a lower molecular weight (MW) range prior to conjugation to the carrier protein. Advantageously, the size of the purified serotype 22F polysaccharide or serotype 33F polysaccharide is reduced while retaining key features of the polysaccharide structure, such as, for example, the presence of O-acetyl groups. Preferably, the size of the purified serotype 22F polysaccharide or serotype 33F polysaccharide is reduced by mechanical homogenization.

[0056] In a preferred embodiment, the size of the purified polysaccharide is reduced by high pressure homogenization. High pressure homogenization achieves high shear rates by pumping the process stream through a flow path of sufficiently small dimensions. The shear rate is increased by using a higher applied homogenization pressure, and the exposure time can be increased by recirculating the feed stream through the homogenizer.

[0057] High pressure homogenization methods are particularly suitable for reducing the size of purified serotype 22F polysaccharide or serotype 33F polysaccharide while retaining structural features of the polysaccharide, such as the presence of O-acetyl groups.

[0058] Isolated serotype 22F polysaccharide obtained by purifying serotype 22F capsular polysaccharide from S. pneumoniae lysate and optionally tailoring the purified polysaccharide can be characterized by various parameters including, for example, molecular weight, mM acetate per mM serotype 22F polysaccharide.

[0059] In a preferred embodiment, the tailored serotype 22F polysaccharide has a molecular weight between 400 kDa and 700 kDa. The isolated serotype 33F polysaccharide obtained by purifying serotype 33F capsular polysaccharide from S. pneumoniae lysate and optionally tailoring the purified polysaccharide can be characterized by various parameters including, for example, molecular weight and mM acetate per mM serotype 33F polysaccharide.

[0060] The degree of O-acetylation of the polysaccharide can be determined by any method known in the art, for example, by proton NMR (Lemercinier and Jones (1996) Carbohydrate Research 296; 83-96, Jones and Lemercinier (2002) J. Pharmaceutical and Biomedical Analysis 30; 1233-1247, WO 05 / 033148 or WO 00 / 56357). Another commonly used method is described in Hestrin (1949) J. Biol. Chem. 180; 249-261. Preferably, the presence of O-acetyl groups is determined by ion HPLC analysis. In a preferred embodiment, the isolated serotype 22F polysaccharide is obtained by a method comprising the following steps:

[0061] - preparing a fermentation culture of serotype 22F Streptococcus pneumoniae bacterial cells;

[0062] - lysing bacterial cells in the fermentation culture; and,

[0063] - Purification of serotype 22F polysaccharide from fermentation culture.

[0064] In a preferred embodiment, isolated serotype 22F polysaccharide is obtained by a process comprising the steps of:

[0065] - preparing a fermentation culture of serotype 22F Streptococcus pneumoniae bacterial cells;

[0066] - lysing bacterial cells in the fermentation culture;

[0067] - purifying serotype 22F polysaccharide from the fermentation culture; and,

[0068] - Tailoring of the serotype 22F polysaccharide by mechanical tailoring, preferably by high pressure homogenization.

[0069] In a preferred embodiment, the isolated serotype 22F polysaccharide is obtained by a process comprising the steps of:

[0070] - preparing a fermentation culture of serotype 22F Streptococcus pneumoniae bacterial cells;

[0071] - lysing bacterial cells in the fermentation culture;

[0072] - purifying serotype 22F polysaccharide from the fermentation culture; and

[0073] - cutting of the serotype 22F polysaccharide by mechanical cutting, preferably by high pressure homogenization,

[0074] The isolated serotype 22F polysaccharide has a molecular weight between 400 kDa and 700 kDa.

[0075] In a preferred embodiment, the isolated serotype 33F polysaccharide is obtained by a process comprising the steps of:

[0076] - preparing a fermentation culture of serotype 33F Streptococcus pneumoniae bacterial cells;

[0077] - lysing bacterial cells in the fermentation culture; and,

[0078] - Purification of serotype 33F polysaccharide from fermentation cultures.

[0079] In a preferred embodiment, the isolated serotype 33F polysaccharide is obtained by a process comprising the steps of:

[0080] - preparing a fermentation culture of serotype 33F Streptococcus pneumoniae bacterial cells;

[0081] - lysing bacterial cells in the fermentation culture;

[0082] - purifying serotype 33F polysaccharide from the fermentation culture; and,

[0083] - Tailoring of the serotype 33F polysaccharide by mechanical tailoring, preferably by high pressure homogenization.

[0084] The isolated serotype 10A polysaccharide obtained by purifying serotype 10A capsular polysaccharide from S. pneumoniae lysate and optionally tailoring the purified polysaccharide can be characterized by different parameters including, for example, molecular weight.Preferably, the isolated serotype 10A polysaccharide is not tailored.

[0085] In a preferred embodiment, isolated serotype 10A polysaccharide is obtained by a process comprising the steps of:

[0086] - preparing a fermentation culture of serotype 10A Streptococcus pneumoniae bacterial cells;

[0087] - lysing bacterial cells in the fermentation culture; and,

[0088] - Purification of serotype 10A polysaccharide from fermentation cultures.

[0089] Activation of serotype 10A, 22F, or 33F polysaccharides

[0090] The isolated serotype 10A, 22F or 33F polysaccharide is activated by a method comprising the following steps:

[0091] (a) reacting an isolated serotype 10A, 22F or 33F polysaccharide with an oxidizing agent; and,

[0092] (b) Quenching the oxidation reaction by adding a quencher, resulting in activated S. pneumoniae serotype 10A, 22F or 33F polysaccharide.

[0093] In preferred embodiments, the concentration of serotype 10A, 22F, or 33F polysaccharide in step (a) is between 0.1 mg / mL and 10 mg / mL. In preferred embodiments, the concentration of serotype 10A, 22F, or 33F polysaccharide in step (a) is between 0.5 mg / mL and 5 mg / mL. In preferred embodiments, the concentration of serotype 10A, 22F, or 33F polysaccharide in step (a) is between 1 mg / mL and 3 mg / mL. In preferred embodiments, the concentration of serotype 22F or 33F polysaccharide in step (a) is about 2 mg / mL. In preferred embodiments, the concentration of serotype 10A polysaccharide in step (a) is about 2.5 mg / mL.

[0094] In a preferred embodiment, the oxidizing agent is periodate, which oxidizes vicinal hydroxyl groups to form carbonyl or aldehyde groups and causes the cleavage of CC bonds.

[0095] The term "periodate" includes periodate and periodic acid. The term also includes metaperiodate (IO4 - ) and orthoperiodate (IO6 5- ). The term "periodate" also includes various salts of periodate, including sodium periodate and potassium periodate. In a preferred embodiment, the oxidizing agent is sodium periodate. In a preferred embodiment, the periodate used for oxidation of serotype 10A, 22F, or 33F polysaccharides is metaperiodate. In a preferred embodiment, the periodate used for oxidation of serotype 10A, 22F, or 33F polysaccharides is sodium metaperiodate.

[0096] In preferred embodiments, the polysaccharide is reacted with 0.01 to 10 molar equivalents, 0.05 to 5 molar equivalents, 0.1 to 1 molar equivalents, 0.5 to 1 molar equivalents, 0.7 to 0.8 molar equivalents, 0.01 to 0.2 molar equivalents, 0.05 to 0.5 molar equivalents, 0.05 to 0.2 molar equivalents, 0.1 to 0.3 molar equivalents of the oxidant. In preferred embodiments, the polysaccharide is reacted with about 0.05 molar equivalents, 0.1 molar equivalents, 0.15 molar equivalents, 0.2 molar equivalents, 0.25 molar equivalents, 0.3 molar equivalents, 0.35 molar equivalents, 0.4 molar equivalents, 0.45 molar equivalents, 0.5 molar equivalents, 0.55 molar equivalents, 0.6 molar equivalents, 0.65 molar equivalents, 0.7 molar equivalents, 0.75 molar equivalents, 0.8 molar equivalents of the oxidant. In a preferred embodiment, the polysaccharide is reacted with about 0.10 molar equivalents of the oxidant. In a preferred embodiment, the polysaccharide is reacted with about 0.15 molar equivalents of the oxidant. In a preferred embodiment, the polysaccharide is reacted with about 0.25 molar equivalents of the oxidant. In a preferred embodiment, the polysaccharide is reacted with about 0.5 molar equivalents of the oxidant. In a preferred embodiment, the polysaccharide is reacted with about 0.8 molar equivalents of the oxidant.

[0097] In preferred embodiments, the reaction duration in step (a) is between 1 and 50 hours, between 1 and 40 hours, between 1 and 30 hours, between 1 and 25 hours, between 1 and 20 hours, between 1 and 10 hours, 10 to 50 hours, 10 to 40 hours, 10 to 30 hours, 10 to 20 hours. In preferred embodiments, when the polysaccharide is a serotype 10A polysaccharide, the reaction duration in step (a) is between 1 and 10 hours. In preferred embodiments, when the polysaccharide is a serotype 10A polysaccharide, the reaction duration in step (a) is about 1 hour, 2 hours, 3 hours, 4 hours, 5 hours, 6 hours, 7 hours, 8 hours, 9 hours, 10 hours. In preferred embodiments, when the polysaccharide is a serotype 10A polysaccharide, the reaction duration in step (a) is about 4 hours. In preferred embodiments, when the polysaccharide is a serotype 22F polysaccharide, the reaction duration in step (a) is between 10 hours and 20 hours. In a preferred embodiment, when the polysaccharide is a serotype 22F polysaccharide, the reaction duration in step (a) is about 10 hours, 11 hours, 12 hours, 13 hours, 14 hours, 15 hours, 16 hours, 17 hours, 18 hours, 19 hours, 20 hours. In a preferred embodiment, when the polysaccharide is a serotype 33F polysaccharide, the reaction duration in step (a) is between 15 hours and 25 hours. In a preferred embodiment, when the polysaccharide is a serotype 33F polysaccharide, the reaction duration in step (a) is about 15 hours, 16 hours, 17 hours, 18 hours, 19 hours, 20 hours, 21 hours, 22 hours, 23 hours, 24 hours or 25 hours. In a preferred embodiment, when the polysaccharide is a serotype 33F polysaccharide, the reaction duration in step (a) is about 20 hours.

[0098] In preferred embodiments, the reaction temperature of step (a) is maintained between 1° C. and 30° C., between 1° C. and 10° C., between 10° C. and 20° C., between 20° C. and 30° C., between 2° C. and 8° C. In preferred embodiments, the reaction temperature of step (a) is maintained at about 5° C.

[0099] In a preferred embodiment, step (a) is performed in a buffer selected from sodium phosphate, potassium phosphate, 2-(N-morpholino)ethanesulfonic acid (MES) or Bis-Tris. In a preferred embodiment, step (a) is performed in a potassium phosphate buffer. In a preferred embodiment, step (a) is performed in a sodium phosphate buffer.

[0100] In preferred embodiments, the buffer has a concentration between 1 mM and 500 mM, between 1 mM and 300 mM, between 50 mM and 200 mM. In preferred embodiments, the buffer has a concentration of about 100 mM.

[0101] In preferred embodiments, the pH in step (a) is between 4 and 8, between 5 and 7, between 5.5 and 6.5. In preferred embodiments, the pH in step (a) is about 6. In preferred embodiments, the pH in step (a) is about 5.8.

[0102] In one embodiment, the quencher is selected from a vicinal diol, a 1,2-amino alcohol, an amino acid, glutathione, a sulfite, a bisulfate, a dithionite, a metabisulfite, a thiosulfate, a phosphite, a hypophosphite, or a phosphorous acid.

[0103] In one embodiment, the quencher is a 1,2-amino alcohol of the formula

[0104]

[0105] where R 1 is selected from H, methyl, ethyl, propyl or isopropyl.

[0106] In one embodiment, the quencher is selected from the sodium and potassium salts of sulfurous acid, hydrogen sulfate, dithionite, metabisulfite, thiosulfate, phosphorous acid, hypophosphorous acid, or phosphorous acid.

[0107] In one embodiment, the quencher is an amino acid. In one embodiment, the amino acid is selected from serine, threonine, cysteine, cystine, methionine, proline, hydroxyproline, tryptophan, tyrosine and histidine.

[0108] In one embodiment, the quencher is a sulfite such as bisulfate, dithionite, metabisulfite, thiosulfate.

[0109] In one embodiment, the quencher is a compound comprising two vicinal hydroxyl groups (ie, two hydroxyl groups covalently attached to two adjacent carbon atoms) (vicinal diol).

[0110] Preferably, the quencher is a compound of formula (II)

[0111]

[0112] , where R 1 and R 2 Each is independently selected from H, methyl, ethyl, propyl or isopropyl.

[0113] In a preferred embodiment, the quencher is glycerol, ethylene glycol, propylene-1,2-diol, butane-1,2-diol or butane-2,3-diol, ascorbic acid. In a preferred embodiment, the quencher is butane-2,3-diol.

[0114] In preferred embodiments, the oxidant is neutralized by adding 0.1 to 10 molar equivalents, 0.5 to 5 molar equivalents, 0.5 to 3 molar equivalents, 0.5 to 2 molar equivalents of the quencher. In preferred embodiments, the oxidant is neutralized by adding about 0.5 molar equivalents, 1 molar equivalent, 1.5 molar equivalents, 2 molar equivalents, 2.5 molar equivalents, 3 molar equivalents of the quencher. In preferred embodiments, the oxidant is neutralized by adding about 2 molar equivalents of the quencher.

[0115] In a preferred embodiment, the duration of step (b) is between 0.1 hour and 10 hours, between 0.5 hour and 5 hours or between 0.5 hour and 2 hours. In a preferred embodiment, the duration of step (b) is about 0.5 hour, 1 hour, 1.5 hours, 2.5 hours or 3 hours.

[0116] In preferred embodiments, the reaction temperature in step (b) is maintained between 1° C. and 30° C., between 1° C. and 25° C., between 1° C. and 20° C., between 1° C. and 10° C., between 10° C. and 20° C., between 2° C. and 8° C. In preferred embodiments, the reaction temperature in step (b) is maintained at about 1° C., 2° C., 3° ​​C., 4° C., 5° C., 6° C., 7° C., or 8° C.

[0117] In preferred embodiments, the pH in step (b) is between 4 and 8, between 5 and 7, between 5.5 and 6.5. In preferred embodiments, the pH in step (a) is about 6.

[0118] In a preferred embodiment, the activated serotype 10A, 22F or 33F polysaccharide is purified. The activated serotype 10A, 22F or 33F polysaccharide can be purified by methods known to those skilled in the art, such as gel permeation chromatography (GPC), dialysis or ultrafiltration / diafiltration. For example, the activated polysaccharide can be purified by concentration and diafiltration using an ultrafiltration device.

[0119] In a preferred embodiment, the isolated serotype 10A polysaccharide is activated by a method comprising the steps of:

[0120] (a) reacting the isolated serotype 10A polysaccharide with periodate; and,

[0121] (b) The oxidation reaction was quenched by the addition of butane-2,3-diol, resulting in activated serotype 10A polysaccharide.

[0122] In a preferred embodiment, the isolated serotype 10A polysaccharide is activated by a method comprising the steps of:

[0123] (a) reacting isolated serotype 10A polysaccharide with periodate at a temperature between 2°C and 8°C; and,

[0124] (b) The oxidation reaction was quenched by the addition of butane-2,3-diol at a temperature between 2°C and 8°C, resulting in activated serotype 10A polysaccharide.

[0125] In a preferred embodiment, the isolated serotype 10A polysaccharide is activated by a method comprising the steps of:

[0126] (a) reacting isolated serotype 10A polysaccharide with 0.2 to 0.3 molar equivalents of periodate at a temperature between 2°C and 8°C; and,

[0127] (b) The oxidation reaction is quenched by adding 0.5 to 2 molar equivalents of butane-2,3-diol at a temperature between 2°C and 8°C, resulting in activated serotype 10A polysaccharide.

[0128] In a preferred embodiment, the isolated serotype 22F polysaccharide is activated by a method comprising the steps of:

[0129] (a) reacting the isolated serotype 22F polysaccharide with periodate; and,

[0130] (b) The oxidation reaction was quenched by the addition of butane-2,3-diol, resulting in activated serotype 22F polysaccharide.

[0131] In a preferred embodiment, the isolated serotype 22F polysaccharide is activated by a method comprising the steps of:

[0132] (a) reacting isolated serotype 22F polysaccharide with periodate at a temperature between 2°C and 8°C; and,

[0133] (b) The oxidation reaction was quenched by the addition of butane-2,3-diol at a temperature between 2°C and 8°C, resulting in activated serotype 22F polysaccharide.

[0134] In a preferred embodiment, the isolated serotype 22F polysaccharide is activated by a method comprising the steps of:

[0135] (a) reacting isolated serotype 22F polysaccharide with 0.05 to 0.2 molar equivalents of periodate at a temperature between 2°C and 8°C; and,

[0136] (b) quenching the oxidation reaction by adding 2 to 3 molar equivalents, preferably 2 molar equivalents, of butane-2,3-diol at a temperature between 2°C and 8°C, resulting in activated serotype 22F polysaccharide.

[0137] In a preferred embodiment, the isolated serotype 33F polysaccharide is activated by a method comprising the steps of:

[0138] (a) reacting the isolated serotype 33F polysaccharide with periodate; and,

[0139] (b) The oxidation reaction was quenched by the addition of butane-2,3-diol, resulting in activated serotype 33F polysaccharide.

[0140] In a preferred embodiment, the isolated serotype 33F polysaccharide is activated by a method comprising the steps of:

[0141] (a) reacting isolated serotype 33F polysaccharide with periodate at a temperature between 2°C and 8°C; and,

[0142] (b) The oxidation reaction was quenched by the addition of butane-2,3-diol at a temperature between 2°C and 8°C, resulting in activated serotype 33F polysaccharide.

[0143] In a preferred embodiment, the isolated serotype 33F polysaccharide is activated by a method comprising the steps of:

[0144] (a) reacting isolated serotype 33F polysaccharide with 0.05 to 0.2 molar equivalents of periodate at a temperature between 2°C and 8°C; and,

[0145] (b) The oxidation reaction is quenched by adding 0.5 to 1.5 molar equivalents of butane-2,3-diol at a temperature between 2°C and 8°C, resulting in activated serotype 33F polysaccharide.

[0146] In a preferred embodiment, the present invention relates to activated serotype 10A capsular polysaccharide obtained or obtainable by the method disclosed herein above.

[0147] In a preferred embodiment, the present invention relates to activated serotype 22F capsular polysaccharide obtained or obtainable by the method disclosed herein above.

[0148] In a preferred embodiment, the present invention relates to an activated serotype 33F capsular polysaccharide obtained or obtainable by the method disclosed herein above.

[0149] In preferred embodiments, the activated serotype 10A polysaccharide obtained from step (b) has a molecular weight of between 20% and 100%, between 30% and 95%, between 40% and 95%, between 60% and 95%, between 85% and 95% or about 90% of the molecular weight of the isolated polysaccharide used in step (a).

[0150] In preferred embodiments, the activated serotype 10A polysaccharide obtained from step (b) has a molecular weight of at least 20%, 25%, 30%, 35%, 40% or 45% of the molecular weight of the isolated polysaccharide used in step (a). In preferred embodiments, the activated serotype 10A polysaccharide obtained from step (b) has a molecular weight of at least 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% of the molecular weight of the isolated polysaccharide used in step (a).

[0151] In preferred embodiments, the activated serotype 22F polysaccharide obtained from step (b) has a molecular weight between 50% and 100%, 60% to 95%, 85% to 95% or about 90% of the molecular weight of the isolated polysaccharide used in step (a).

[0152] In preferred embodiments, the activated serotype 22F polysaccharide obtained from step (b) has a molecular weight of at least 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% of the molecular weight of the isolated polysaccharide used in step (a).

[0153] In preferred embodiments, the activated serotype 33F polysaccharide obtained from step (b) has a molecular weight between 50% and 100%, 60% to 95%, 85% to 95% or about 90% of the molecular weight of the isolated polysaccharide used in step (a).

[0154] In a preferred embodiment, the activated serotype 33F polysaccharide obtained from step (b) has a molecular weight of at least 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% of the molecular weight of the isolated polysaccharide used in step (a).

[0155] In preferred embodiments, the degree of oxidation of the activated serotype 10A, 22F or 33F polysaccharide is between 2 and 30, between 2 and 25, between 2 and 20, between 2 and 15, between 2 and 10, between 2 and 5, between 5 and 30, between 5 and 25, between 5 and 20, between 5 and 15, between 5 and 10, between 10 and 30, between 10 and 25, between 10 and 20, between 10 and 15, between 5 and 25, between 10 and 30, between 15 and 30, between 15 and 25, between 15 and 20, between 20 and 30, between 20 and 25. In preferred embodiments, the degree of oxidation of the activated serotype 10A, 22F or 33F polysaccharide is between 2 and 10, between 4 and 8, between 4 and 6, between 6 and 8, between 6 and 12, between 8 and 14, between 9 and 11, between 10 and 16, between 12 and 16, between 14 and 18, between 16 and 20, between 16 and 18, between 18 and 22, between 18 and 20.

[0156] In preferred embodiments, the activated serotype 10A polysaccharide has a molecular weight of between 50 kDa and 400 kDa, between 50 kDa and 350 kDa, between 50 kDa and 300 kDa, between 50 kDa and 250 kDa, between 50 kDa and 200 kDa, between 100 kDa and 300 kDa, between 100 kDa and 250 kDa, or between 100 kDa and 200 kDa. In preferred embodiments, the activated serotype 10A polysaccharide has a molecular weight of between 50 kDa and 300 kDa. In preferred embodiments, the activated serotype 10A polysaccharide has a molecular weight of between 100 kDa and 200 kDa. In preferred embodiments, the activated serotype 10A polysaccharide has a molecular weight of between 100 kDa and 200 kDa and a degree of oxidation of between 5 and 20, between 5 and 15, between 8 and 14, between 8 and 12, or between 9 and 11. In a preferred embodiment, the activated serotype 10A polysaccharide has a molecular weight between 100 kDa and 200 kDa and a degree of oxidation between 9 and 11.

[0157] In preferred embodiments, the activated serotype 22F polysaccharide has a molecular weight of between 25 kDa and 1000 kDa, between 100 kDa and 1000 kDa, between 300 kDa and 800 kDa, between 300 kDa and 700 kDa, between 300 kDa and 600 kDa, between 400 kDa and 1000 kDa, between 400 kDa and 800 kDa, between 400 kDa and 700, or between 400 kDa and 600 kDa. In preferred embodiments, the activated serotype 22F polysaccharide has a molecular weight of between 300 kDa and 800 kDa. In preferred embodiments, the activated serotype 22F polysaccharide has a molecular weight of between 400 kDa and 800 kDa. In preferred embodiments, the activated serotype 22F polysaccharide has a molecular weight of between 400 kDa and 600 kDa. In preferred embodiments, the activated serotype 22F polysaccharide has a molecular weight between 400 kDa and 800 kDa and a degree of oxidation between 10 and 25, between 10 and 20, between 12 and 20, or between 14 and 18. In preferred embodiments, the activated serotype 22F polysaccharide has a molecular weight between 400 kDa and 800 kDa and a degree of oxidation between 10 and 20.

[0158] In preferred embodiments, the activated serotype 22F polysaccharide comprises at least 0.1 mM, 0.2 mM, 0.3 mM, 0.4 mM, 0.5 mM, 0.6 mM, or 0.7 mM, or about 0.8 mM acetate per mM serotype 22F polysaccharide. In preferred embodiments, the activated serotype 22F polysaccharide comprises at least 0.5, 0.6, or 0.7 mM acetate per mM serotype 22F polysaccharide. In preferred embodiments, the activated serotype 22F polysaccharide comprises at least 0.6 mM acetate per mM serotype 22F polysaccharide. In preferred embodiments, the activated serotype 22F polysaccharide comprises at least 0.7 mM acetate per mM serotype 22F polysaccharide.

[0159] In a preferred embodiment, the activated serotype 22F polysaccharide has a molecular weight of between 400 kDa and 800 kDa and comprises at least 0.6 mM acetate per mM serotype 22F polysaccharide.

[0160] In a preferred embodiment, the activated serotype 22F polysaccharide has a molecular weight between 400 kDa and 800 kDa, a degree of oxidation between 12 and 20, and comprises at least 0.6 mM acetate per mM serotype 22F polysaccharide.

[0161] In preferred embodiments, the activated serotype 33F polysaccharide has a molecular weight of between 50 kDa and 1250 kDa, between 200 kDa and 1200 kDa, between 500 kDa and 1200 kDa, between 500 kDa and 1000 kDa, between 700 kDa and 1200 kDa, between 800 kDa and 1200 kDa, between 800 kDa and 1100 kDa, between 900 kDa and 1200 kDa, or between 800 kDa and 1000 kDa. In preferred embodiments, the activated serotype 33F polysaccharide has a molecular weight of between 500 kDa and 1000 kDa. In another preferred embodiment, the activated serotype 33F polysaccharide has a molecular weight of between 50 kDa and 600 kDa, between 50 kDa and 500 kDa, or between 50 kDa and 400 kDa.

[0162] In preferred embodiments, the activated serotype 33F polysaccharide comprises at least 0.1 mM, 0.2 mM, 0.3 mM, 0.4 mM, 0.5 mM, 0.6 mM, 0.7 mM, or 0.8 or about 0.9 mM acetate per mM serotype 33F polysaccharide. In preferred embodiments, the activated serotype 33F polysaccharide comprises at least 0.6 mM, 0.7 mM, or 0.8 mM acetate per mM serotype 33F polysaccharide. In preferred embodiments, the activated serotype 33F polysaccharide comprises at least 0.6 mM acetate per mM serotype 33F polysaccharide. In preferred embodiments, the activated serotype 33F polysaccharide comprises at least 0.7 mM acetate per mM serotype 33F polysaccharide.

[0163] In a preferred embodiment, the activated serotype 33F polysaccharide has a molecular weight of between 800 kDa and 1200 kDa and comprises at least 0.7 mM acetate per mM serotype 33F polysaccharide. In a preferred embodiment, the activated serotype 33F polysaccharide has a molecular weight of between 800 kDa and 1200 kDa, comprises at least 0.7 mM acetate per mM serotype 33F polysaccharide and has a degree of oxidation of between 10 and 20.

[0164] In a preferred embodiment, the activated serotype 33F polysaccharide has a molecular weight of between 50 kDa and 200 kDa and comprises at least 0.7 mM acetate per mM serotype 33F polysaccharide.

[0165] In a preferred embodiment, the activated serotype 33F polysaccharide has a molecular weight of between 50 kDa and 200 kDa, comprises at least 0.7 mM acetate per mM serotype 33F polysaccharide, and has a degree of oxidation of between 10 and 20.

[0166] In an embodiment, the activated serotype 10A, 22F or 33F polysaccharide is freeze-dried, optionally in the presence of a cryoprotectant / lyoprotectant. In a preferred embodiment, the cryoprotectant / lyoprotectant is selected from sucrose, trehalose, raffinose, stachyose, melezitose, dextran, mannitol, lactitol and palatinitol. In a preferred embodiment, the cryoprotectant / lyoprotectant is sucrose. The freeze-dried activated polysaccharide can then be mixed with a solution comprising a carrier protein.

[0167] In another embodiment, activated serotype 10A, 22F, or 33F polysaccharide is mixed with a carrier protein and, optionally, freeze-dried in the presence of a cryoprotectant / lyoprotectant. In a preferred embodiment, the cryoprotectant / lyoprotectant is selected from sucrose, trehalose, raffinose, stachyose, melezitose, dextran, mannitol, lactitol, and palatinitol. In a preferred embodiment, the cryoprotectant / lyoprotectant is sucrose. The co-lyophilized polysaccharide and carrier protein can then be resuspended in solution and reacted with a reducing agent.

[0168] In embodiments, the present invention relates to lyophilized activated serotype 10A polysaccharide. In embodiments, the present invention relates to lyophilized activated serotype 22F polysaccharide. In embodiments, the present invention relates to lyophilized activated serotype 33F polysaccharide. In embodiments, the present invention relates to co-lyophilized activated serotype 10A polysaccharide and a protein carrier. In preferred embodiments, the protein carrier is CRM 197 In an embodiment, the present invention relates to a co-lyophilized activated serotype 22F polysaccharide and a protein carrier. In a preferred embodiment, the protein carrier is CRM 197 In an embodiment, the present invention relates to a co-lyophilized activated serotype 33F polysaccharide and a protein carrier. In a preferred embodiment, the protein carrier is CRM 197 . [Using carrier protein conjugated activated serotype 10A, 22F or 33F polysaccharide]

[0169] The activated serotype 10A, 22F or 33F polysaccharide disclosed herein may be conjugated to a carrier protein by a method comprising the following steps:

[0170] (a) mixing activated serotype 10A, 22F or 33F polysaccharide with a carrier protein; and,

[0171] (b) reacting the mixed activated serotype 10A, 22F or 33F polysaccharide and carrier protein with a reducing agent to form a serotype 10A, 22F or 33F polysaccharide:carrier protein conjugate.

[0172] Compared to reductive amination in aqueous phase (wherein the O-acetylation level of the polysaccharide is significantly reduced), conjugation of activated serotype 22F or 33F polysaccharide to a protein carrier by reductive amination in dimethyl sulfoxide (DMSO) is suitable for preserving the O-acetyl content of the polysaccharide. In a preferred embodiment, steps (a) and (b) are carried out in DMSO.

[0173] In a preferred embodiment, step (a) comprises dissolving lyophilized serotype 10A, 22F or 33F polysaccharide in an aqueous solution comprising a carrier protein or in a solution comprising a carrier protein and DMSO. In a preferred embodiment, step (a) comprises dissolving co-lyophilized serotype 10A, 22F or 33F polysaccharide and a carrier protein in an aqueous solution or in DMSO.

[0174] When steps (a) and (b) are carried out in an aqueous solution, the solution comprises a buffer, preferably selected from PBS, MES, HEPES, Bis-tris, ADA, PIPES, MOPSO, BES, MOPS, DIPSO, MOBS, HEPPSO, POPSO, TEA, EPPS, Bicine or HEPB, with a pH between 6.0 and 8.5, between 7 and 8, or between 7 and 7.5. In a preferred embodiment, the buffer is PBS. In a preferred embodiment, the pH is about 7.3.

[0175] In preferred embodiments, the concentration of activated serotype 10A, 22F or 33F polysaccharide in step (a) is between 0.1 mg / mL and 10 mg / mL, between 0.5 mg / mL and 5 mg / mL, between 0.5 mg / mL and 2 mg / mL. In preferred embodiments, the concentration of the activated serotype 10A, 22F or 33F polysaccharide in step (a) is about 0.1 mg / mL, 0.2 mg / mL, 0.3 mg / mL, 0.4 mg / mL, 0.5 mg / mL, 0.6 mg / mL, 0.7 mg / mL, 0.8 mg / mL, 0.9 mg / mL, 1 mg / mL, 1.1 mg / mL, 1.2 mg / mL, 1.3 mg / mL, 1.4 mg / mL, 1.5 mg / mL, 1.6 mg / mL, 1.7 mg / mL, 1.8 mg / mL, 1.9 mg / mL, 2 mg / mL, 2.1 mg / mL, 2.2 mg / mL, 2.3 mg / mL, 2.4 mg / mL, 2.5 mg / mL, 2.6 mg / mL, 2.7 mg / mL, 2.8 mg / mL, 2.9 mg / mL or 3 mg / mL.

[0176] In preferred embodiments, the initial ratio (weight / weight) of activated serotype 10A, 22F or 33F polysaccharide to carrier protein is between 5:1 and 0.1:1, between 2:1 and 0.1:1, between 2:1 and 1:1, between 1.5:1 and 1:1, between 0.1:1 and 1:1, between 0.3:1 and 1:1, between 0.6:1 and 1:1.2. In preferred embodiments, the initial ratio of activated serotype 10A, 22F or 33F polysaccharide to carrier protein is about 0.6:1 and 1:1.2. In preferred embodiments, the initial ratio of activated serotype 10A, 22F or 33F polysaccharide to carrier protein is about 0.4:1, 0.5:1, 0.6:1, 0.7:1, 0.8:1, 0.9:1, 1:1, 1.1:1, 1.2:1, 1.3:1, 1.4:1, 1.5:1, 1.6:1, 1.7:1, 1.8:1, 1.9:1, 2:1.

[0177] In preferred embodiments, in step (b), the activated serotype 10A, 22F or 33F polysaccharide is reacted with between 0.1 and 10 molar equivalents, between 0.5 and 5 molar equivalents, between 0.5 and 2.5 molar equivalents of the reducing agent. In preferred embodiments, in step (b), the activated serotype 10A, 22F or 33F is reacted with about 0.5, 0.6, 0.7, 0.8, 0.9, 1, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2, 2.1, 2.2, 2.3, 2.4 or 2.5 molar equivalents of the reducing agent.

[0178] In embodiments, the reducing agent is sodium cyanoborohydride, sodium triacetoxyborohydride, sodium or zinc borohydride (in the presence of a Bronsted or Lewis acid), an amine borane such as pyridine borane, 2-methylpyridine borane, 2,6-diborane-methanol, dimethylamine-borane, t-BuMe i PrN-BH3, benzylamine-BH3 or 5-ethyl-2-methylpyridine borane (PEMB). In a preferred embodiment, the reducing agent is sodium cyanoborohydride.

[0179] In a preferred embodiment, the duration of step (b) is between 1 hour and 50 hours, 5 hours and 30 hours, 10 hours and 30 hours, 15 hours and 30 hours, 20 hours and 30 hours, 5 hours and 25 hours, 10 hours and 25 hours, 15 hours and 25 hours. In a preferred embodiment, the duration of step (b) is about 20 hours, 21 hours, 22 hours, 23 hours, 24 hours, 25 hours, 26 hours, 27 hours, 28 hours.

[0180] In preferred embodiments, the reaction temperature in step (b) is maintained between 10° C. and 40° C., between 15° C. and 30° C., between 20° C. and 26° C., between 21° C. and 25° C. In preferred embodiments, the reaction temperature in step (b) is maintained at about 21° C., 22° C., 23° C., 24° C., or 25° C.

[0181] In a preferred embodiment, the method for preparing an immunogenic conjugate comprising a serotype 10A, 22F or 33F polysaccharide covalently linked to a carrier protein further comprises a step of capping (quenching) unreacted aldehyde by adding NaBH4 (step c). In a preferred embodiment, in step (c), unreacted aldehyde is capped by adding 0.1 to 10 molar equivalents, 0.5 to 5 molar equivalents, or 1 to 3 molar equivalents of NaBH4. In a preferred embodiment, in step (c), unreacted aldehyde is capped by adding about 2 molar equivalents of NaBH4.

[0182] In a preferred embodiment, the duration of step (c) is between 0.1 hours and 10 hours, between 0.5 hours and 5 hours or between 2 hours and 4 hours. In a preferred embodiment, the duration of step (c) is about 3 hours.

[0183] In preferred embodiments, the reaction temperature in step (c) is maintained between 10 and 40° C., between 15 and 30° C., or between 20 and 26° C. In preferred embodiments, the reaction temperature in step (c) is maintained at about 23° C.

[0184] After serotype 10A, 22F or 33F polysaccharide is conjugated to a carrier protein, the polysaccharide-protein conjugate can be purified (enriched for the polysaccharide-protein conjugate) by various techniques known to those skilled in the art. These techniques include dialysis, concentration / diafiltration procedures, tangential flow filtration precipitation / elution, column chromatography (DEAE or hydrophobic interaction chromatography) and depth filtration. In a preferred embodiment, the carrier protein is non-toxic and non-reactogenic and can be obtained in sufficient quantity and purity. The carrier protein should be amenable to standard conjugation methods.

[0185] In a preferred embodiment, the activated serotype 10A, 22F or 33F polysaccharide is conjugated to a carrier protein selected from DT (diphtheria toxin), TT (tetanus toxoid) or fragment C of TT, CRM197 (a non-toxic but antigenically identical variant of diphtheria toxin), other DT point mutants such as CRM176, CRM228, CRM 45 (Uchida et al. J. Biol. Chem.218; 3838-3844, 1973); CRM 9, CRM102, CRM 103 and CRM107 and other mutations described by Nicholls and Youle in Genetically Engineered Toxins, Ed: Frankel, Maecel Dekker Inc, 1992; deletion of Glu-148 or mutation of Glu-148 to Asp, Gln or Ser and / or deletion of Ala 158 or mutation of Ala158 to Gly and other mutations disclosed in US 4709017 or US 4950740; mutation of at least one or more residues Lys 516, Lys 526, Phe 530 and / or Lys 534 and other mutations disclosed in US 5917017 or US 6455673; or US 5843711, pneumolysin of pneumococcus (Kuo et al. (1995) Infect Immun 63; 2706-13), including ply detoxified in a certain manner, such as dPLY-GMBS (WO 04081515, PCT / EP2005 / 010258) or dPLY-formaldehyde, PhtX, including PhtA, PhtB, PhtD, PhtE (the sequence of PhtA, PhtB, PhtD or PhtE is disclosed in WO 00 / 37105 or WO 00 / 39299) and fusions of Pht proteins, such as PhtDE fusion, PhtBE fusion, Pht AE (WO 01 / 98334, WO 03 / 54007, WO2009 / 000826), OMPC (meningococcal outer membrane protein - usually extracted from Neisseria meningitidis serogroup B - EP0372501), PorB (from Neisseria meningitidis), PD (Haemophilus influenzae protein D - see, for example, EP 0594610 B), or immunologically functional equivalents thereof, synthetic peptides (EP0378881, EP0427347), heat shock proteins (WO 93 / 17712, WO 94 / 03208), pertussis proteins (WO 98 / 58668, EP0471177), cytokines, lymphokines, growth factors or hormones (WO1091 / 01146), artificial proteins comprising multiple human CD4+ T cell epitopes from antigens derived from various pathogens (Falugi et al. (2001) Eur J Immunol 31; 3816-3824) such as N19 protein (Baraldoi et al. (2004) Infect Immun 72; 4884-7), pneumococcal surface protein PspA (WO 02 / 091998), iron uptake protein (WO 01 / 72337), Clostridium difficile (C.difficile toxin A or B (WO 00 / 61761). In one embodiment, the activated serotype 10A, 22F, or 33F polysaccharide is conjugated to DT (diphtheria toxoid). In another embodiment, the activated serotype 10A, 22F, or 33F polysaccharide is conjugated to TT (tetanus toxoid). In another embodiment, the activated serotype 10A, 22F, or 33F polysaccharide is conjugated to fragment C of TT. In another embodiment, the activated serotype 10A, 22F, or 33F polysaccharide is conjugated to PD (Haemophilus influenzae protein D—see, e.g., EP 0 594 610 B).

[0186] In a preferred embodiment, activated serotype 10A, 22F or 33F polysaccharides are conjugated to CRM 197 Protein. The CRM 197 The protein is a nontoxic form of diphtheria toxin, but is immunologically indistinguishable from diphtheria toxin. 197 Non-toxigenic phage β197 generated by nitrosoguanidine mutagenesis of a toxigenic β-rod phage tox- Produced by infected Corynebacterium diphtheriae (Uchida, T. et al. 1971, Nature New Biology 233:8-11). CRM was purified by ultrafiltration, ammonium sulfate precipitation and ion exchange chromatography. 197 .CRM 197 The protein has the same molecular weight as diphtheria toxin but differs from it by a single base change in the structural gene (guanine to adenine). This single base change causes an amino acid substitution (glutamic acid to glycine) in the mature protein and eliminates the toxic properties of diphtheria toxin. CRM 197 Proteins are safe and effective T cell-dependent carriers of carbohydrates. About CMR 197 Further details of its production can be found in, for example, US 5,614,382.

[0187] In a preferred embodiment, the activated serotype 10A, 22F or 33F polysaccharide disclosed herein is conjugated to a CRM by a method comprising the steps of 197 :

[0188] (a) Activated serotype 10A, 22F or 33F polysaccharide and CRM 197 mix;

[0189] (b) Mixing activated serotype 10A, 22F or 33F polysaccharide and CRM 197 Reaction with sodium cyanoborohydride to form serotype 10A, 22F, or 33F polysaccharide:CRM197 conjugates.

[0190] In a preferred embodiment, the activated serotype 10A, 22F or 33F polysaccharide disclosed herein is conjugated to a CRM by a method comprising the steps of 197 :

[0191] (a) Activated serotype 10A, 22F or 33F polysaccharide and CRM 197 mix;

[0192] (b) Mixing activated serotype 10A, 22F or 33F polysaccharide and CRM 197 Reaction with sodium cyanoborohydride to form serotype 10A, 22F, or 33F polysaccharide:CRM197 conjugates;

[0193] Wherein steps (a) and (b) are carried out in DMSO.

[0194] In a preferred embodiment, the activated serotype 10A, 22F or 33F polysaccharide disclosed herein is conjugated to a CRM by a method comprising the steps of 197 :

[0195] (a) Activated serotype 10A, 22F or 33F polysaccharide and CRM 197 mix;

[0196] (b) Mixing activated serotype 10A, 22F or 33F polysaccharide and CRM 197 Reaction with 0.5 to 2 molar equivalents of sodium cyanoborohydride to form serotype 10A, 22F or 33F polysaccharide: CRM 197 conjugates;

[0197] Wherein steps (a) and (b) are carried out in DMSO.

[0198] In an embodiment, the present invention relates to an immunogenic conjugate obtainable by or by the method disclosed herein. In a preferred embodiment, the present invention relates to an immunogenic conjugate obtainable by or by conjugating (by reductive amination) a serotype 10A, 22F or 33F activated polysaccharide as disclosed herein to a carrier protein. In a preferred embodiment, the present invention relates to an immunogenic conjugate obtainable by or by conjugating (by reductive amination in DMSO) a serotype 10A, 22F or 33F activated polysaccharide as disclosed herein to a carrier protein. In a preferred embodiment, the carrier protein is CRM 197 .

[0199] Serotype 10A immunogenic conjugate

[0200] In preferred embodiments, the serotype 10A immunogenic conjugate has a molecular weight between 500 kDa and 15,000 kDa, between 500 kDa and 10,000 kDa, between 2,000 kDa and 10,000 kDa, or between 3,000 kDa and 8,000 kDa. In preferred embodiments, the serotype 10A immunogenic conjugate has a molecular weight between 3,000 kDa and 8,000 kDa. The molecular weight of the immunogenic conjugate is measured by SEC-MALLS.

[0201] In preferred embodiments, the serotype 10A immunogenic conjugate comprises less than about 50%, 45%, 40%, 35%, 30%, 25%, 20%, or 15% free serotype 10A polysaccharide compared to the total amount of serotype 10A polysaccharide. In preferred embodiments, the serotype 10A immunogenic conjugate comprises less than about 25% free serotype 10A polysaccharide compared to the total amount of serotype 10A polysaccharide. In preferred embodiments, the serotype 10A immunogenic conjugate comprises less than about 20% free serotype 10A polysaccharide compared to the total amount of serotype 10A polysaccharide. In preferred embodiments, the serotype 10A immunogenic conjugate comprises less than about 15% free serotype 10A polysaccharide compared to the total amount of serotype 10A polysaccharide.

[0202] In preferred embodiments, the ratio of serotype 10A polysaccharide to carrier protein in the conjugate (weight / weight) is between 0.5 and 3. In preferred embodiments, the ratio of serotype 10A polysaccharide to carrier protein in the conjugate is between 0.5 and 2, between 0.5 and 1.5, between 0.5 and 1, between 1 and 1.5, between 1 and 2. In preferred embodiments, the ratio of serotype 10A polysaccharide to carrier protein in the conjugate is between 0.8 and 1.4. In preferred embodiments, the ratio of serotype 10A capsular polysaccharide to carrier protein in the conjugate is between 0.8 and 1.2.

[0203] Size exclusion chromatography medium (CL-4B) can be used to determine the relative molecular size distribution of the conjugate. Size exclusion chromatography (SEC) is used in a gravity feed column to analyze the molecular size distribution of the conjugate. Large molecules are excluded from the pores in the medium and elute faster than small molecules. A fraction collector is used to collect the column eluate. The fractions are tested colorimetrically by carbohydrate assay. To determine Kd, the column is calibrated to determine the fraction at which the molecule is completely excluded (V0), (Kd = 0), and the fraction representing the maximum retention (V i ), (Kd=1). The fraction (V e ) According to the expression Kd=(V e -V0) / (V i -V0) is related to Kd.

[0204] In preferred embodiments, at least 30% of the serotype 10A immunogenic conjugates have a Kd of less than or equal to 0.3 in a CL-4B column. In preferred embodiments, at least 40% of the serotype 10A immunogenic conjugates have a Kd of less than or equal to 0.3 in a CL-4B column. In preferred embodiments, at least 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, or 85% of the serotype 10A immunogenic conjugates have a Kd of less than or equal to 0.3 in a CL-4B column. In preferred embodiments, at least 60% of the serotype 10A immunogenic conjugates have a Kd of less than or equal to 0.3 in a CL-4B column. In preferred embodiments, between 50% and 80% of the serotype 10A immunogenic conjugates have a Kd of less than or equal to 0.3 in a CL-4B column.

[0205] The degree of conjugation is the number of lysine residues in the carrier protein that are conjugated to the target polysaccharide. Evidence of lysine modification of the carrier protein due to covalent linkage to the polysaccharide is obtained by amino acid analysis using conventional methods known to those skilled in the art. Conjugation results in a relative abundance of the CRM used to generate the conjugate material. 197 Protein starting material, a reduction in the number of lysine residues recovered.

[0206] In preferred embodiments, the degree of conjugation of the immunogenic conjugate is between 2 and 15, between 2 and 13, between 2 and 10, between 2 and 8, between 2 and 6, between 2 and 5, between 2 and 4, between 3 and 15, between 3 and 13, between 3 and 10, between 3 and 8, between 3 and 6, between 3 and 5, between 3 and 4, between 5 and 15, between 5 and 10, between 8 and 15, between 8 and 12, between 10 and 15, or between 10 and 12. In preferred embodiments, the degree of conjugation of the immunogenic conjugate is between 6 and 8.

[0207] Serotype 22F immunogenic conjugate

[0208] In preferred embodiments, the immunogenic conjugate comprises at least 0.1 mM, 0.2 mM, 0.3 mM, 0.4 mM, 0.5 mM, 0.6 mM, or 0.7 mM, or about 0.8 mM acetate per mM serotype 22F polysaccharide. In preferred embodiments, the immunogenic conjugate comprises at least 0.5 mM, 0.6 mM, or 0.7 mM acetate per mM serotype 22F polysaccharide. In preferred embodiments, the immunogenic conjugate comprises at least 0.6 mM acetate per mM serotype 22F polysaccharide. In preferred embodiments, the immunogenic conjugate comprises at least 0.7 mM acetate per mM serotype 22F polysaccharide.

[0209] In preferred embodiments, the ratio of the number of mM of acetate per mM of serotype 22F polysaccharide in the immunogenic conjugate to the number of mM of acetate per mM of serotype 22F polysaccharide in the isolated polysaccharide is at least 0.6, 0.65, 0.7, 0.75, 0.8, 0.85, 0.9 or 0.95. In preferred embodiments, the ratio of the number of mM of acetate per mM of serotype 22F polysaccharide in the immunogenic conjugate to the number of mM of acetate per mM of serotype 22F polysaccharide in the isolated polysaccharide is at least 0.7. In preferred embodiments, the ratio of the number of mM of acetate per mM of serotype 22F polysaccharide in the immunogenic conjugate to the number of mM of acetate per mM of serotype 22F polysaccharide in the isolated polysaccharide is at least 0.9.

[0210] In preferred embodiments, the ratio of the number of mM of acetate per mM of serotype 22F polysaccharide in the immunogenic conjugate to the number of mM of acetate per mM of serotype 22F polysaccharide in the activated polysaccharide is at least 0.6, 0.65, 0.7, 0.75, 0.8, 0.85, 0.9 or 0.95. In preferred embodiments, the ratio of the number of mM of acetate per mM of serotype 22F polysaccharide in the immunogenic conjugate to the number of mM of acetate per mM of serotype 22F polysaccharide in the activated polysaccharide is at least 0.7. In preferred embodiments, the ratio of the number of mM of acetate per mM of serotype 22F polysaccharide in the immunogenic conjugate to the number of mM of acetate per mM of serotype 22F polysaccharide in the activated polysaccharide is at least 0.9.

[0211] In preferred embodiments, the serotype 22F immunogenic conjugate has a molecular weight of between 400 kDa and 15,000 kDa, between 500 kDa and 10,000 kDa, between 2,000 kDa and 10,000 kDa, between 3,000 kDa and 8,000 kDa, or between 3,000 kDa and 5,000 kDa. In preferred embodiments, the serotype 22F immunogenic conjugate has a molecular weight of between 3,000 kDa and 5,000 kDa. The molecular weight of the immunogenic conjugate is measured by SEC-MALLS.

[0212] In preferred embodiments, the serotype 22F immunogenic conjugate comprises less than about 50%, 45%, 40%, 35%, 30%, 25%, 20%, or 15% free serotype 22F polysaccharide compared to the total amount of serotype 22F polysaccharide. In preferred embodiments, the serotype 22F immunogenic conjugate comprises less than about 40% free serotype 22F polysaccharide compared to the total amount of serotype 22F polysaccharide. In preferred embodiments, the serotype 22F immunogenic conjugate comprises less than about 25% free serotype 22F polysaccharide compared to the total amount of serotype 22F polysaccharide. In preferred embodiments, the serotype 22F immunogenic conjugate comprises less than about 20% free serotype 22F polysaccharide compared to the total amount of serotype 22F polysaccharide. In preferred embodiments, the serotype 22F immunogenic conjugate comprises less than about 15% free serotype 22F polysaccharide compared to the total amount of serotype 22F polysaccharide.

[0213] In a preferred embodiment, the ratio of serotype 22F polysaccharide to carrier protein in the conjugate (weight / weight) is between 0.5 and 3. In a preferred embodiment, the ratio of serotype 22F polysaccharide to carrier protein in the conjugate is between 0.5 and 2, between 0.5 and 1.5, between 0.8 and 1.2, between 0.5 and 1, between 1 and 1.5, or between 1 and 2. In a preferred embodiment, the ratio of serotype 22F polysaccharide to carrier protein in the conjugate is between 0.8 and 1.2. In a preferred embodiment, the ratio of serotype 22F capsular polysaccharide to carrier protein in the conjugate is between 0.9 and 1.1.

[0214] In preferred embodiments, at least 30% of the serotype 22F immunogenic conjugates have a Kd of less than or equal to 0.3 on a CL-4B column. In preferred embodiments, at least 40% of the immunogenic conjugates have a Kd of less than or equal to 0.3 on a CL-4B column. In preferred embodiments, at least 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, or 85% of the serotype 22F immunogenic conjugates have a Kd of less than or equal to 0.3 on a CL-4B column. In preferred embodiments, at least 60% of the serotype 22F immunogenic conjugates have a Kd of less than or equal to 0.3 on a CL-4B column. In preferred embodiments, between 50% and 80% of the serotype 22F immunogenic conjugates have a Kd of less than or equal to 0.3 on a CL-4B column. In a preferred embodiment, between 65% and 80% of the serotype 22F immunogenic conjugates have a Kd less than or equal to 0.3 in a CL-4B column.

[0215] In preferred embodiments, the degree of conjugation of the immunogenic conjugate is between 2 and 15, between 2 and 13, between 2 and 10, between 2 and 8, between 2 and 6, between 2 and 5, between 2 and 4, between 3 and 15, between 3 and 13, between 3 and 10, between 3 and 8, between 3 and 6, between 3 and 5, between 3 and 4, between 4 and 7, between 5 and 15, between 5 and 10, between 8 and 15, between 8 and 12, between 10 and 15, or between 10 and 12. In preferred embodiments, the degree of conjugation of the immunogenic conjugate is between 4 and 7.

[0216] Serotype 33F immunogenic conjugate

[0217] In preferred embodiments, the immunogenic conjugate comprises at least 0.1 mM, 0.2 mM, 0.3 mM, 0.4 mM, 0.5 mM, 0.6 mM, or 0.7 mM, or about 0.8 mM acetate per mM serotype 33F polysaccharide. In preferred embodiments, the immunogenic conjugate comprises at least 0.5 mM, 0.6 mM, or 0.7 mM acetate per mM serotype 33F polysaccharide. In preferred embodiments, the immunogenic conjugate comprises at least 0.6 mM acetate per mM serotype 33F polysaccharide. In preferred embodiments, the immunogenic conjugate comprises at least 0.7 mM acetate per mM serotype 33F polysaccharide.

[0218] In preferred embodiments, the ratio of the number of mM of acetate per mM of serotype 33F polysaccharide in the immunogenic conjugate to the number of mM of acetate per mM of serotype 33F polysaccharide in the isolated polysaccharide is at least 0.6, 0.65, 0.7, 0.75, 0.8, 0.85, 0.9 or 0.95. In preferred embodiments, the ratio of the number of mM of acetate per mM of serotype 33F polysaccharide in the immunogenic conjugate to the number of mM of acetate per mM of serotype 33F polysaccharide in the isolated polysaccharide is at least 0.7. In preferred embodiments, the ratio of the number of mM of acetate per mM of serotype 33F polysaccharide in the immunogenic conjugate to the number of mM of acetate per mM of serotype 33F polysaccharide in the isolated polysaccharide is at least 0.9.

[0219] In preferred embodiments, the ratio of the number of mM acetate per mM serotype 33F polysaccharide in the immunogenic conjugate to the number of mM acetate per mM serotype 33F polysaccharide in the activated polysaccharide is at least 0.6, 0.65, 0.7, 0.75, 0.8, 0.85, 0.9 or 0.95. In preferred embodiments, the ratio of the number of mM acetate per mM serotype 33F polysaccharide in the immunogenic conjugate to the number of mM acetate per mM serotype 33F polysaccharide in the activated polysaccharide is at least 0.7. In preferred embodiments, the ratio of the number of mM acetate per mM serotype 33F polysaccharide in the immunogenic conjugate to the number of mM acetate per mM serotype 33F polysaccharide in the activated polysaccharide is at least 0.9.

[0220] In preferred embodiments, the serotype 33F immunogenic conjugate has a molecular weight of between 500 kDa and 30,000 kDa, between 500 kDa and 25,000 kDa, between 500 kDa and 20,000 kDa, between 500 kDa and 15,000 kDa, between 500 kDa and 10,000 kDa, between 1,000 kDa and 10,000 kDa, between 1,000 kDa and 8,000 kDa, between 1,000 kDa and 5,000 kDa, between 2,000 kDa and 10,000 kDa, between 2,000 kDa and 8,000 kDa, or between 2,000 kDa and 5,000 kDa. In preferred embodiments, the serotype 33F immunogenic conjugate has a molecular weight of between 1,000 kDa and 5,000 kDa. The molecular weight of the immunogenic conjugate is measured by SEC-MALLS.

[0221] In preferred embodiments, the serotype 33F immunogenic conjugate comprises less than about 50%, 45%, 40%, 35%, 30%, 25%, 20%, or 15% free serotype 33F polysaccharide compared to the total amount of serotype 33F polysaccharide. In preferred embodiments, the serotype 33F immunogenic conjugate comprises less than about 25% free serotype 33F polysaccharide compared to the total amount of serotype 33F polysaccharide. In preferred embodiments, the serotype 33F immunogenic conjugate comprises less than about 20% free serotype 33F polysaccharide compared to the total amount of serotype 33F polysaccharide. In preferred embodiments, the serotype 33F immunogenic conjugate comprises less than about 15% free serotype 33F polysaccharide compared to the total amount of serotype 33F polysaccharide.

[0222] In preferred embodiments, the ratio of serotype 33F polysaccharide to carrier protein (weight / weight) in the conjugate is between 0.4 and 3. In preferred embodiments, the ratio of serotype 33F polysaccharide to carrier protein in the conjugate is between 0.5 and 2, between 0.5 and 1.5, between 0.5 and 1, between 1 and 1.5, between 1 and 2. In preferred embodiments, the ratio of serotype 33F polysaccharide to carrier protein in the conjugate is between 0.5 and 1.5. In preferred embodiments, the ratio of serotype 33F capsular polysaccharide to carrier protein in the conjugate is between 0.5 and 1.2.

[0223] In preferred embodiments, at least 30% of the serotype 33F immunogenic conjugates have a Kd of less than or equal to 0.3 in a CL-4B column. In preferred embodiments, at least 40% of the immunogenic conjugates have a Kd of less than or equal to 0.3 in a CL-4B column. In preferred embodiments, at least 45%, 50%, 55%, 60%, 65% of the serotype 33F immunogenic conjugates have a Kd of less than or equal to 0.3 in a CL-4B column. In preferred embodiments, at least 60% of the serotype 33F immunogenic conjugates have a Kd of less than or equal to 0.3 in a CL-4B column. In preferred embodiments, between 40% and 80% of the serotype 33F immunogenic conjugates have a Kd of less than or equal to 0.3 in a CL-4B column. In preferred embodiments, between 45% and 65% of the serotype 33F immunogenic conjugates have a Kd of less than or equal to 0.3 in a CL-4B column.

[0224] In preferred embodiments, the degree of conjugation of the immunogenic conjugate is between 1 and 15, between 2 and 13, between 2 and 10, between 2 and 8, between 2 and 6, between 2 and 5, between 2 and 4, between 3 and 15, between 3 and 13, between 3 and 10, between 3 and 8, between 3 and 6, between 3 and 5, between 3 and 4, between 5 and 15, between 5 and 10, between 8 and 15, between 8 and 12, between 10 and 15, or between 10 and 12. In preferred embodiments, the degree of conjugation of the immunogenic conjugate is between 3 and 6.

[0225] Immunogenic composition

[0226] The term "immunogenic composition" relates to any pharmaceutical composition containing an antigen, such as a microorganism or a component thereof, which composition can be used to elicit an immune response in a subject.

[0227] As used herein, "immunogenicity" means the ability of an antigen (or epitope of an antigen) (such as a bacterial capsular polysaccharide) or a glycoconjugate or immunogenic composition comprising the antigen to elicit an immune response (humoral or cell-mediated or both) in a host such as a mammal.

[0228] In a preferred embodiment, the immunogenic composition comprises a serotype 10A, 22F or 33F conjugate obtainable by the methods disclosed herein. In a preferred embodiment, the immunogenic composition comprises a serotype 10A, 22F or 33F conjugate obtainable by the methods disclosed herein.

[0229] In an embodiment, the immunogenic compositions disclosed herein, when administered to a subject, induce the formation of antibodies capable of binding to serotype 10A S. pneumoniae. In an embodiment, the immunogenic compositions disclosed herein, when administered to a subject, induce the formation of antibodies capable of binding to serotype 10A S. pneumoniae as measured by a standard ELISA assay.

[0230] In embodiments, the immunogenic compositions disclosed herein, when administered to a subject, induce the formation of antibodies capable of killing serotype 10A S. pneumoniae in an opsonophagocytic assay as disclosed herein.

[0231] In an embodiment, the immunogenic compositions disclosed herein, when administered to a subject, induce the formation of antibodies capable of binding to serotype 22F S. pneumoniae. In an embodiment, the immunogenic compositions disclosed herein, when administered to a subject, induce the formation of antibodies capable of binding to serotype 22F S. pneumoniae as measured by a standard ELISA assay.

[0232] In embodiments, the immunogenic compositions disclosed herein, when administered to a subject, induce the formation of antibodies capable of killing serotype 22F S. pneumoniae in an opsonophagocytic assay as disclosed herein.

[0233] In an embodiment, the immunogenic compositions disclosed herein, when administered to a subject, induce the formation of antibodies capable of binding to serotype 33F S. pneumoniae. In an embodiment, the immunogenic compositions disclosed herein, when administered to a subject, induce the formation of antibodies capable of binding to serotype 33F S. pneumoniae as measured by a standard ELISA assay.

[0234] In embodiments, the immunogenic compositions disclosed herein, when administered to a subject, induce the formation of antibodies capable of killing serotype 33F S. pneumoniae in an opsonophagocytic assay as disclosed herein.

[0235] The preparation of the immunogenic compositions of the present invention can be achieved using art-recognized methods. For example, serotype 10A, 22F or 33F conjugates can be formulated with a physiologically acceptable vehicle to prepare the composition. Examples of such vehicles include, but are not limited to, water, buffered saline, polyols (e.g., glycerol, propylene glycol, liquid polyethylene glycol) and glucose solutions. In a preferred embodiment, the immunogenic composition may include at least one additional antigen. In a preferred embodiment, the immunogenic composition may include at least one additional S. pneumoniae capsular polysaccharide.

[0236] In a preferred embodiment, the immunogenic composition may comprise at least one additional S. pneumoniae capsular polysaccharide conjugated to a carrier protein. In a preferred embodiment, the carrier protein is CRM 197 .

[0237] In certain embodiments, the immunogenic composition comprises one or more adjuvants. As defined herein, an "adjuvant" is a substance used to enhance the immunogenicity of the immunogenic composition of the present invention. Thus, adjuvants are typically administered to enhance the immune response and are well known to those skilled in the art. Suitable adjuvants for enhancing the efficacy of the composition include, but are not limited to:

[0238] (1) Aluminum salts (alum), such as aluminum hydroxide, aluminum phosphate, aluminum sulfate, etc.;

[0239] (2) Oil-in-water emulsion formulations (with or without other specific immunostimulants such as muramyl peptides (defined below) or bacterial cell wall components), such as, for example,

[0240] (a) MF59 (PCT Publication No. WO 90 / 14837), which contains 5% squalene, 0.5% 5Tween 80, and 0.5% Span 85 (optionally containing varying amounts of MTP-PE (see below), although this is not required)), formulated into submicron particles using a microfluidizer such as a Model 110Y Microfluidizer (Microfluidics, Newton, MA),

[0241] (b) SAF containing 10% squalene, 0.4% Tween 80, 5% pluronic-block polymer L121 and thr-MDP (see below) that was microfluidized into a submicron emulsion or vortexed to produce an emulsion of larger particle size, and

[0242] (c)Ribi TMAdjuvant system (RAS), (Corixa, Hamilton, MT), containing 2% squalene, 0.2% Tween 80 and one or more bacterial cell wall components derived from 3-O-deacylated monophosphoryl lipid A (MPL) as described in U.S. Patent No. 4,912,094 (Corixa) TM ), trehalose dimycolate (TDM) and cell wall skeleton (CWS), preferably MPL + CWS (Detox TM );

[0243] (3) Saponin adjuvants, such as Quil A or STIMULON TM QS-21 (Antigenics, Framingham, MA) (U.S. Patent No. 5,057,540) or particles derived therefrom such as ISCOMs (immunostimulating complexes);

[0244] (4) bacterial lipopolysaccharide, synthetic lipid A analogs such as aminoalkylaminoglucosamine phosphate compounds (AGP), or derivatives or analogs thereof, which are available from Corixa and are described in U.S. Patent No. 6,113,918; one such AGP is 2-[(R)-3-tetradecanoyloxytetradecanoylamino]ethyl 2-deoxy-4-Ophosphono-3-O-[(R)-3-tetradecanoyloxytetradecanoyl]-2-[(R)-3-tetradecanoyloxytetradecanoylamino]-bD-glucopyranoside, which is also known as 529 (formerly RC529), which is formulated in aqueous form or a stable emulsion, synthetic polynucleotides such as oligonucleotides containing CpG motifs (U.S. Patent No. 6,207,646);

[0245] (5) cytokines, such as interleukins (e.g., IL-1, IL-2, IL-4, IL-5, IL-6, IL-7, IL-12, IL-15, IL-18, etc.), interferons (e.g., gamma interferon), granulocyte macrophage colony-stimulating factor (GM-CSF), macrophage colony-stimulating factor (M-CSF), tumor necrosis factor (TNF), costimulatory molecules 87-1 and 87-2, etc.;

[0246] (6) detoxified mutants of bacterial ADP-ribosylating toxins such as cholera toxin (CT) in wild-type or mutant form, for example, in which glutamic acid at amino acid position 29 is replaced by another amino acid, preferably histidine (according to published international patent application No. WO 00 / 18434 (see also WO 02 / 098368 and WO 02 / 098369)), pertussis toxin (PT) or Escherichia coli (E. coli) heat-labile toxin (LT), in particular LT-K63, LT-R72, CT-S109, PT-K9 / G129 (see, for example, WO 93 / 13302 and WO 92 / 19265); and

[0247] (7) Other substances used as immunostimulants to enhance the efficacy of the composition.

[0248] Muramyl peptides include, but are not limited to, N-acetyl-muramyl-L-threonyl-D-isoglutamine (thr-MDP), N-acetyl-n-muramyl-L-alanine-2-(1′-2′-dipalmitoyl-sn-glycero-3-hydroxyphosphoryloxy)-ethylamine (MTP-PE), and the like.

[0249] In an embodiment of the present invention, the immunogenic composition as disclosed herein comprises a CpG oligonucleotide as an adjuvant. As used herein, a CpG oligonucleotide refers to an immunostimulatory CpG oligodeoxynucleotide (CpG ODN), and therefore, unless otherwise indicated, these terms are used interchangeably. An immunostimulatory CpG oligodeoxynucleotide contains (optionally in certain preferred base contexts) one or more immunostimulatory CpG motifs that are unmethylated cytosine-guanine dinucleotides. The methylation state of the CpG immunostimulatory motif generally refers to the cytosine residue in the dinucleotide. An immunostimulatory oligonucleotide containing at least one unmethylated CpG dinucleotide is an oligonucleotide that contains a 5' unmethylated cytosine linked to a 3' guanine by a phosphate bond and activates the immune system by binding to Toll-like receptor 9 (TLR-9). In another embodiment, the immunostimulatory oligonucleotide may contain one or more methylated CpG dinucleotides, which will activate the immune system through TLR9, but not as strongly as if the CpG motif were not methylated. CpG immunostimulatory oligonucleotides may comprise one or more palindromic sequences which, in turn, may comprise CpG dinucleotides. CpG oligonucleotides have been described in numerous issued patents, published patent applications, and other publications, including U.S. Patent Nos. 6,194,388; 6,207,646; 6,214,806; 6,218,371; 6,239,116, and 6,339,068.

[0250] In an embodiment of the invention, the immunogenic composition as disclosed herein comprises any one of the CpG oligonucleotides described on page 3, line 22 to page 12, line 36 of WO2010 / 125480.

[0251] Different classes of CpG immunostimulatory oligonucleotides have been identified. These classes are referred to as classes A, B, C, and P, and are described in more detail in WO 2010 / 125480, page 3, line 22 to page 12, line 36. The methods of the present invention include the use of these different classes of CpG immunostimulatory oligonucleotides.

[0252] In an embodiment of the present invention, the immunogenic composition as disclosed herein comprises a class A CpG oligonucleotide. Preferably, the "class A" CpG oligonucleotide of the present invention has the following nucleic acid sequence: 5'GGGGACGACGTCGTGGGGGGG 3' (SEQ ID NO: 1). Some non-limiting examples of class A oligonucleotides include: 5'G*G*G_G_A_C_G_A_C_G_T_C_G_T_G_G*G*G*G*G*G 3' (SEQ ID NO: 2); wherein * refers to a phosphorothioate bond and - refers to a phosphodiester bond.

[0253] In an embodiment of the present invention, the immunogenic composition as disclosed herein comprises a Class B CpG oligonucleotide. In one embodiment, the CpG oligonucleotide used in the present invention is a Class B CpG oligonucleotide represented by at least the following formula: 5′ XXCGXX3′, wherein X1, X2, X3, and X4 are nucleotides. In one embodiment, X2 is adenine, guanine, or thymine. In another embodiment, X3 is cytosine, adenine, or thymine.

[0254] The class B CpG oligonucleotide sequences of the present invention are those described extensively above in U.S. Patent Nos. 6,194,388, 6,207,646, 6,214,806, 6,218,371, 6,239,116, and 6,339,068. Exemplary sequences include, but are not limited to, those disclosed in the latter applications and patents.

[0255] In an embodiment, a "class B" CpG oligonucleotide of the invention has the following nucleic acid sequence:

[0256] 5'TCGTCGTTTTTCGGTGCTTT 3' (SEQ ID NO:3), or

[0257] 5'TCGTCGTTTTTCGGTCGTTTT 3'(SEQ ID NO:4), or

[0258] 5'TCGTCGTTTTGTCGTTTTGTCGTT 3'(SEQ ID NO:5), or

[0259] 5'TCGTCGTTTCGTCGTTTTGTCGTT 3'(SEQ ID NO:6), or

[0260] 5'TCGTCGTTTTGTCGTTTTTTTCGA 3' (SEQ ID NO:7).

[0261] In any of these sequences, all linkages may be phosphorothioate linkages. In another embodiment, in any of these sequences, one or more linkages may be phosphodiester linkages, preferably between the "C" and "G" of the CpG motif to produce a semi-soft CpG oligonucleotide. In any of these sequences, ethyl-uridine or a halogen may be substituted for the 5'T; examples of halogen substitutions include, but are not limited to, bromo-uridine or iodo-uridine substitutions.

[0262] Some non-limiting examples of B-class oligonucleotides include:

[0263] 5'T*C*G*T*C*G*T*T*T*T*T*C*G*G*T*G*C*T*T*T*T 3'(SEQ ID NO:8), or

[0264] 5'T*C*G*T*C*G*T*T*T*T*T*C*G*G*T*C*G*T*T*T*T 3'(SEQ ID NO:9), or

[0265] 5'T*C*G*T*C*G*T*T*T*T*G*T*C*G*T*T*T*T*G*T*C*G*T*T 3'(SEQ ID NO:10), or

[0266] 5'T*C*G*T*C*G*T*T*T*C*G*T*C*G*T*T*T*T*G*T*C*G*T*T 3'(SEQ ID NO:11), or

[0267] 5'T*C*G*T*C*G*T*T*T*T*T*G*T*C*G*T*T*T*T*T*T*T*T*C*G*A 3' (SEQ ID NO: 12), wherein * refers to a phosphorothioate bond.

[0268] In an embodiment of the invention, the immunogenic composition as disclosed herein comprises a C-class CpG oligonucleotide. In an embodiment, the "C-class" CpG oligonucleotide of the invention has the following nucleic acid sequence:

[0269] 5'TCGCGTCGTTCGGCGCGCGCCG 3' (SEQ ID NO:13), or

[0270] 5'TCGTCGACGTTCGGCGCGCGCCG 3' (SEQ ID NO:14), or

[0271] 5'TCGGACGTTCGGCGCGCGCCG 3' (SEQ ID NO:15), or

[0272] 5'TCGGACGTTCGGCGCGCCG 3' (SEQ ID NO:16), or

[0273] 5'TCGCGTCGTTCGGCGCGCCG 3' (SEQ ID NO:17), or

[0274] 5'TCGACGTTCGGCGCGCGCCG 3' (SEQ ID NO:18), or

[0275] 5'TCGACGTTCGGCGCGCCG 3' (SEQ ID NO:19), or

[0276] 5'TCGCGTCGTTCGGCGCCG 3' (SEQ ID NO:20), or

[0277] 5'TCGCGACGTTCGGCGCGCGCCG 3' (SEQ ID NO:21), or

[0278] 5'TCGTCGTTTTCGGCGCGCGCCG 3' (SEQ ID NO:22), or

[0279] 5'TCGTCGTTTTCGGCGGCCGCCG 3' (SEQ ID NO:23), or

[0280] 5'TCGTCGTTTTACGGCGCCGTGCCG 3' (SEQ ID NO:24), or

[0281] 5'TCGTCGTTTCGGCGCGCGCCGT 3' (SEQ ID NO: 25).

[0282] In any of these sequences, all linkages may be phosphorothioate linkages. In another embodiment, in any of these sequences, one or more linkages may be phosphodiester linkages, preferably between the "C" and "G" of the CpG motif that produces a semi-soft CpG oligonucleotide.

[0283] Some non-limiting examples of C-class oligonucleotides include:

[0284] 5’T*C_G*C_G*T*C_G*T*T*C_G*G*C*G*C_G*C*G*C*C*G 3’ (SEQ ID NO:26), or

[0285] 5’T*C_G*T*C_G*A*C_G*T*T*C_G*G*C*G*C_G*C*G*C*C*G 3’ (SEQ ID NO:27), or

[0286] 5’T*C_G*G*A*C_G*T*T*C_G*G*C*G*C_G*C*G*C*C*G 3’ (SEQ ID NO:28), or

[0287] 5’T*C_G*G*A*C_G*T*T*C_G*G*C*G*C*G*C*C*G 3’ (SEQ ID NO:29), or

[0288] 5’T*C_G*C_G*T*C_G*T*T*C_G*G*C*G*C*G*C*C*G 3’ (SEQ ID NO:30), or

[0289] 5’T*C_G*A*C_G*T*T*C_G*G*C*G*C_G*C*G*C*C*G 3’ (SEQ ID NO:31), or

[0290] 5’T*C_G*A*C_G*T*T*C_G*G*C*G*C*G*C*C*G 3’ (SEQ ID NO:32), or

[0291] 5’T*C_G*C_G*T*C_G*T*T*C_G*G*C*G*C*C*G 3’ (SEQ ID NO:33), or

[0292] 5’T*C_G*C_G*A*C_G*T*T*C_G*G*C*G*C_G*C*G*C*C*G 3’ (SEQ ID NO:34), or

[0293] 5’T*C*G*T*C*G*T*T*T*T*C*G*G*C*G*C*G*C*G*C*C*G 3’ (SEQ ID NO:35), or

[0294] 5’T*C*G*T*C*G*T*T*T*T*C*G*G*C*G*G*C*C*G*C*C*G 3’ (SEQ ID NO:36), or

[0295] 5'T*C*G*T*C_G*T*T*T*T*A*C_G*G*C*G*C*C_G*T*G*C*C*G 3' (SEQ ID NO: 37), or

[0296] 5'T*C_G*T*C*G*T*T*T*T*C*G*G*C*G*C*G*C*G*C*C*G*T 3' (SEQ ID NO: 38), wherein * refers to a phosphorothioate bond and _ refers to a phosphodiester bond.

[0297] In any of these sequences, ethyl-uridine or a halogen may be substituted for the 5'T; examples of halogen substitutions include, but are not limited to, bromo-uridine or iodo-uridine substitutions.

[0298] In an embodiment of the present invention, the immunogenic composition as disclosed herein includes a P class CpG oligonucleotide. In an embodiment, the CpG oligonucleotide for the present invention is a P class CpG oligonucleotide containing a 5'TLR activation domain and at least 2 palindromes, a palindrome being a 5' palindrome having a length of at least 6 nucleotides, which is directly or via a spacer connected to a 3' palindrome having a length of at least 8 nucleotides, wherein the oligonucleotide includes at least one YpR dinucleotide. In an embodiment, the oligonucleotide is not T*C_G*T*C_G*A*C_G*T*T*C_G*G*C*G*C_G*C*G*C*C*G (SEQ ID NO: 27). In one embodiment, the P class CpG oligonucleotide includes at least one unmethylated CpG dinucleotide. In another embodiment, the TLR activation domain is TCG, TTCG, TTTCG, TYpR, TTYpR, TTTYpR, UCG, UUCG, UUUCG, TTT or TTTT. In another embodiment, the TLR activation domain is within the 5' palindrome. In another embodiment, the TLR activation domain is immediately 5' of the 5' palindrome.

[0299] In an embodiment, a "P-class" CpG oligonucleotide of the present invention has the following nucleic acid sequence: 5'TCGTCGACGATCGGCGCGCGCCG 3' (SEQ ID NO: 39).

[0300] In the described sequences, all linkages may be phosphorothioate linkages. In another embodiment, one or more linkages may be phosphodiester linkages, preferably between the "C" and "G" of the CpG motif to produce a semi-soft CpG oligonucleotide. In any of these sequences, ethyl-uridine or a halogen may be substituted for the 5'T; examples of halogen substitutions include, but are not limited to, bromo-uridine or iodo-uridine substitutions.

[0301] Non-limiting examples of P-class oligonucleotides include:

[0302] 5'T*C_G*T*C_G*A*C_G*A*T*C_G*G*C*G*C_G*C*G*C*C*G 3'(SEQ ID NO:40)

[0303] , where * refers to a phosphorothioate bond and _ refers to a phosphodiester bond.

[0304] In one embodiment, the oligonucleotide comprises at least one phosphorothioate linkage. In another embodiment, all internucleotide linkages of the oligonucleotide are phosphorothioate linkages. In another embodiment, the oligonucleotide comprises at least one phosphodiester-like linkage. In another embodiment, the phosphodiester-like linkage is a phosphodiester linkage. In another embodiment, a lipophilic group is conjugated to the oligonucleotide. In one embodiment, the lipophilic group is cholesterol.

[0305] In an embodiment, all internucleotide linkages of the CpG oligonucleotides disclosed herein are phosphodiester bonds ("soft" oligonucleotides, as described in PCT application WO2007 / 026190). In another embodiment, the CpG oligonucleotides of the present invention are endowed with resistance to degradation (e.g., stabilized). "Stabilized oligonucleotides" refer to oligonucleotides that are relatively tolerant to degradation in vivo (e.g., via exo- or endonucleases). Nucleic acid stabilization can be achieved by backbone modification. Oligonucleotides with phosphorothioate linkages provide maximum activity and protect oligonucleotides from degradation by exo- and endonucleases in cells.

[0306] Immunostimulatory oligonucleotide can have chimeric backbone, and it has the combination of phosphodiester linkage and phosphorothioate linkage.For purposes of the present invention, chimeric backbone refers to the main chain of partial stabilization, wherein at least one internucleotide linkage is phosphodiester or phosphodiester sample linkage, wherein at least one other internucleotide linkage is the internucleotide linkage of stabilization, wherein said at least one phosphodiester linkage or phosphodiester sample linkage and the linkage of said at least one stabilization are different.When said phosphodiester linkage is preferably located in the CpG motif, such molecule is referred to as "semi-soft", as described in PCT application WO2007 / 026190.

[0307] In some embodiments, the CpG oligonucleotide is a CpG oligonucleotide having a length of 6 to 100 nucleotides, preferably 8 to 30 nucleotides. ...

[0308] In embodiments, the CpG oligonucleotides disclosed herein comprise substitutions or modifications, such as in the base and / or sugar, as described in paragraphs 134 to 147 of WO 2007 / 026190.

[0309] In an embodiment, the CpG oligonucleotides of the present invention are chemically modified. Examples of chemical modifications are known to those skilled in the art and are described in, for example, Uhlmann E. et al. (1990), Chem. Rev. 90: 543, S. Agrawal, Ed., Humana Press, Totowa, USA 1993; Crooke, ST et al. (1996) Annu. Rev. Pharmacol. Toxicol. 36: 107-129; and Hunziker J. et al., (1995), Mod. Synth. Methods 7: 331-417. The oligonucleotides according to the present invention may have one or more modifications, wherein each modification is located at a specific phosphodiester internucleoside bridge and / or a specific β-D-ribose unit and / or at a specific natural nucleobase position compared to an oligonucleotide of the same sequence consisting of natural DNA or RNA.

[0310] In some embodiments of the invention, the CpG-containing nucleic acid can be simply mixed with the immunogenic carrier according to methods known to those skilled in the art (see, eg, WO 03 / 024480).

[0311] In a specific embodiment of the invention, any immunogenic composition disclosed herein comprises 2 μg to 100 mg of CpG oligonucleotide, preferably 0.1 mg to 50 mg of CpG oligonucleotide, preferably 0.2 mg to 10 mg of CpG oligonucleotide, preferably 0.3 mg to 5 mg of CpG oligonucleotide, preferably 0.5 to 2 mg of CpG oligonucleotide, preferably 0.75 to 1.5 mg of CpG oligonucleotide. In a preferred embodiment, the immunogenic composition disclosed herein comprises about 1 mg of CpG oligonucleotide. In a preferred embodiment, the adjuvant is an aluminum-based adjuvant selected from aluminum phosphate, aluminum sulfate and aluminum hydroxide. In one embodiment, the immunogenic composition described herein comprises the adjuvant aluminum phosphate.

[0312] In a preferred embodiment, the immunogenic composition of the present invention further comprises at least one of a buffer, a cryoprotectant, a salt, a divalent cation, a nonionic detergent, an inhibitor of free radical oxidation, a diluent, or a carrier.

[0313] The immunogenic composition may optionally comprise a pharmaceutically acceptable carrier. Pharmaceutically acceptable carriers include those approved by federal regulatory agencies, state governments, or other regulatory agencies for use in animals (including humans and non-human animals), or listed in the U.S. Pharmacopoeia or other generally recognized pharmacopeias. The term carrier can be used to refer to a diluent, adjuvant, excipient, or vehicle administered with the pharmaceutical composition. Water, saline solutions, and aqueous dextrose and glycerol solutions can be used as liquid carriers, particularly for injectable solutions. Examples of suitable pharmaceutical carriers are described in "Remington's Pharmaceutical Sciences" by E.W. Martin. The formulation should be adapted to the mode of administration.

[0314] The immunogenic composition optionally may comprise one or more physiologically acceptable buffers selected from, but not limited to, Tris (trimethylamine), phosphate, acetate, borate, citrate, glycine, histidine, and succinate. In certain embodiments, the formulation is buffered to a pH range of about 5.0 to about 7.0, preferably about 5.5 to about 6.5.

[0315] The immunogenic composition optionally may comprise one or more nonionic surfactants, including but not limited to polyoxyethylene sorbitan fatty acid esters, polysorbate-80 (Tween 80), polysorbate-60 (Tween 60), polysorbate-40 (Tween 40) and polysorbate-20 (Tween 20), polyoxyethylene alkyl ethers, including but not limited to Brij 58, Brij 35 and others such as Triton X-100; Triton X-114, NP40, Span 85 and the Pluronic series of nonionic surfactants (e.g., Pluronic 121), with the preferred component polysorbate-80 being present at a concentration of about 0.001% to about 2% (up to about 0.25% is preferred) or polysorbate-40 being present at a concentration of about 0.001% to 1% (up to about 0.5% is preferred).

[0316] The present invention also relates to vaccines comprising the immunogenic composition of the present invention.

[0317] Methods for inducing immune responses and protecting against infection

[0318] The present disclosure also includes methods for using the immunogenic compositions described herein.For example, one embodiment of the present disclosure provides a method of inducing an immune response against S. pneumoniae comprising administering to a subject an immunogenic amount of any of the immunogenic compositions described herein.

[0319] One embodiment of the present disclosure provides a method of protecting a subject from infection with Streptococcus pneumoniae, or a method of preventing infection with Streptococcus pneumoniae, or a method of reducing the severity of or delaying the onset of at least one symptom associated with an infection caused by Streptococcus pneumoniae, the method comprising administering to the subject an immunogenic amount of any immunogenic composition described herein. One embodiment of the present disclosure provides a method of protecting a subject from infection with serotype 10A Streptococcus pneumoniae, or a method of preventing infection with serotype 10A Streptococcus pneumoniae, or a method of reducing the severity of or delaying the onset of at least one symptom associated with an infection caused by serotype 10A Streptococcus pneumoniae, the method comprising administering to the subject an immunogenic amount of any immunogenic composition described herein.

[0320] One embodiment of the present disclosure provides a method for treating or preventing a pneumococcal infection, disease, or condition associated with serotype 10A pneumococcus in a subject, the method comprising administering to the subject a therapeutically or prophylactically effective amount of an immunogenic composition as described herein. Another embodiment provides a method for treating or preventing a pneumococcal infection, disease, or condition associated with serotype 10A pneumococcus in a subject, the method comprising generating a polyclonal or monoclonal antibody preparation from the immunogenic composition as described herein, and using the antibody preparation to confer passive immunity to the subject. In one embodiment, the present disclosure relates to the use of an immunogenic conjugate or immunogenic composition disclosed herein for the manufacture of a medicament for protecting a subject from infection with Streptococcus pneumoniae, and / or preventing infection with Streptococcus pneumoniae, and / or reducing the severity or delaying the onset of at least one symptom associated with infection caused by Streptococcus pneumoniae, and / or protecting a subject from infection with serotype 10A Streptococcus pneumoniae, and / or preventing infection with serotype 10A Streptococcus pneumoniae, and / or reducing the severity or delaying the onset of at least one symptom associated with infection caused by serotype 10A Streptococcus pneumoniae. One embodiment of the present disclosure provides a method of protecting a subject from infection with serotype 22F Streptococcus pneumoniae, or preventing infection with serotype 22F Streptococcus pneumoniae, or reducing the severity or delaying the onset of at least one symptom associated with infection caused by serotype 22F Streptococcus pneumoniae, the method comprising administering to the subject an immunogenic amount of any immunogenic composition described herein.

[0321] One embodiment of the present disclosure provides a method for treating or preventing a pneumococcal infection, disease, or condition associated with serotype 22F pneumococcus in a subject, the method comprising administering to the subject a therapeutically or prophylactically effective amount of an immunogenic composition as described herein. Another embodiment provides a method for treating or preventing a pneumococcal infection, disease, or condition associated with serotype 22F pneumococcus in a subject, the method comprising generating a polyclonal or monoclonal antibody preparation from the immunogenic composition as described herein, and using the antibody preparation to confer passive immunity to the subject.

[0322] In one embodiment, the present disclosure relates to the use of an immunogenic conjugate or immunogenic composition disclosed herein for the manufacture of a medicament for protecting a subject from infection with Streptococcus pneumoniae, and / or preventing infection with Streptococcus pneumoniae, and / or reducing the severity of or delaying the onset of at least one symptom associated with infection caused by Streptococcus pneumoniae, and / or protecting a subject from infection with serotype 22F Streptococcus pneumoniae, and / or preventing infection with serotype 22F Streptococcus pneumoniae, and / or reducing the severity of or delaying the onset of at least one symptom associated with infection caused by serotype 22F Streptococcus pneumoniae. One embodiment of the present disclosure provides a method of protecting a subject from infection with serotype 33F Streptococcus pneumoniae, or preventing infection with serotype 33F Streptococcus pneumoniae, or reducing the severity of or delaying the onset of at least one symptom associated with infection caused by serotype 33F Streptococcus pneumoniae, the method comprising administering to a subject an immunogenic amount of any immunogenic composition described herein.

[0323] One embodiment of the present disclosure provides a method for treating or preventing a pneumococcal infection, disease, or condition associated with serotype 33F pneumococcus in a subject, the method comprising administering to the subject a therapeutically or prophylactically effective amount of an immunogenic composition as described herein. Another embodiment provides a method for treating or preventing a pneumococcal infection, disease, or condition associated with serotype 33F pneumococcus in a subject, the method comprising generating a polyclonal or monoclonal antibody preparation from the immunogenic composition as described herein, and using the antibody preparation to confer passive immunity to the subject.

[0324] In one embodiment, the present disclosure relates to the use of an immunogenic conjugate or immunogenic composition disclosed herein for the manufacture of a medicament for protecting a subject from infection with Streptococcus pneumoniae and / or preventing infection with Streptococcus pneumoniae and / or reducing the severity of or delaying the onset of at least one symptom associated with infection caused by Streptococcus pneumoniae and / or protecting a subject from infection with serotype 33F Streptococcus pneumoniae and / or preventing infection with serotype 33F Streptococcus pneumoniae and / or reducing the severity of or delaying the onset of at least one symptom associated with infection caused by serotype 33F Streptococcus pneumoniae. An "immune response" to an immunogenic composition is the occurrence of a humoral and / or cell-mediated immune response in a subject to a molecule present in the immunogenic composition or vaccine composition of interest. For the purposes of the present disclosure, a "humoral immune response" is an antibody-mediated immune response and involves the induction and production of antibodies that recognize and bind to an antigen in the immunogenic composition or vaccine of the present disclosure with a certain affinity, while a "cell-mediated immune response" is an immune response mediated by T cells and / or other white blood cells. A "cell-mediated immune response" is initiated by the presentation of antigenic epitopes associated with class I or class II molecules of the major histocompatibility complex (MHC), CD1, or other non-classical MHC-like molecules. This activates antigen-specific CD4+ T helper cells or CD8+ cytotoxic T lymphocytes ("CTLs"). CTLs have specificity for peptide antigens presented in association with proteins encoded by classical or non-classical MHC and expressed on the cell surface. CTLs help induce and promote the intracellular destruction of intracellular microorganisms, or the lysis of cells infected by such microorganisms. Another aspect of cellular immunity involves antigen-specific responses by helper T cells. Helper T-cells are used to help stimulate the function and focus the activity of non-specific effector cells directed against cells displaying peptides or other antigens associated with classical or non-classical MHC molecules on their surfaces. A "cell-mediated immune response" also refers to the production of cytokines, chemokines, and other such molecules produced by activated T cells and / or other white blood cells (including those derived from CD4+ and CD8+ T cells). The ability of a particular antigen or composition to stimulate a cell-mediated immune response can be determined by a number of assays, such as by lymphocyte proliferation (lymphocyte activation) assays, CTL cytotoxic cell assays, by assaying T lymphocytes specific for the antigen in sensitized subjects, or by measuring cytokines produced by T cells in response to restimulation with the antigen. Such assays are well known in the art. See, for example, Erickson et al. (1993) J. Immunol. 151: 4189-4199 and Doe et al. (1994) Eur. J. Immunol. 24: 2369-2376.

[0325] As used herein, "treatment" (including variations thereof, e.g., "treating" or "therapeutic") means any one or more of: (i) prevention of infection or reinfection, such as in conventional vaccines, (ii) reduction in the severity of symptoms or elimination of symptoms, and (iii) substantial or complete elimination of the pathogen or condition involved. Thus, treatment may be achieved prophylactically (before infection) or therapeutically (after infection). In the present disclosure, prophylactic treatment is the preferred mode. According to specific embodiments of the present disclosure, compositions and methods are provided for treating (including prophylactic and / or therapeutic immunization) a host animal against infection with serotype 10A Streptococcus pneumoniae. According to specific embodiments of the present invention, compositions and methods are provided for treating (including prophylactic and / or therapeutic immunization) a host animal against infection with serotype 22F Streptococcus pneumoniae. According to specific embodiments of the present disclosure, compositions and methods are provided for treating (including prophylactic and / or therapeutic immunization) a host animal against infection with serotype 33F Streptococcus pneumoniae. The methods of the present disclosure are used to confer prophylactic and / or therapeutic immunity to a subject. The methods of the present disclosure can also be performed on subjects for biomedical research applications.

[0326] "Immunogenic amount" and "immunologically effective amount" are used interchangeably herein and refer to the amount of an antigen or immunogenic composition sufficient to elicit an immune response, either a cellular (T-cell) or humoral (B-cell or antibody) response, or both, as measured by standard assays known to those skilled in the art.

[0327] In a preferred embodiment, the subject is a human. In a most preferred embodiment, the subject is a neonate (ie, less than 3 months old), an infant (ie, from 3 months to 1 year old), or a toddler (ie, from 1 year old to 4 years old).

[0328] In an embodiment, the immunogenic compositions disclosed herein are used as vaccines.

[0329] In such embodiments, the subject to be vaccinated may be less than 1 year old. For example, the subject to be vaccinated may be about 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months or 12 months old. In embodiments, the subject to be vaccinated is about 2, 4 or 6 months old. In another embodiment, the subject to be vaccinated is less than 2 years old. For example, the subject to be vaccinated may be about 12-15 months old. In some cases, as little as one dose of the immunogenic composition according to the present invention is needed, but in some cases, a second, third or fourth dose (see protocol section) may be given.

[0330] In an embodiment of the present invention, the subject to be vaccinated is an adult 50 years of age or older, more preferably an adult 55 years of age or older. In an embodiment, the subject to be vaccinated is an adult 65 years of age or older, 70 years of age or older, 75 years of age or older, or 80 years of age or older.

[0331] In an embodiment, the subject to be vaccinated is an immunocompromised individual, particularly a human.An immunocompromised individual is generally defined as a person who exhibits a diminished or reduced ability to mount normal humoral or cellular defenses against attack by an infectious agent.

[0332] In embodiments of the invention, the immunocompromised subject to be vaccinated has a disease or condition that weakens the immune system and results in an insufficient antibody response to protect against or treat pneumococcal disease.

[0333] In an embodiment, the disease is a primary immunodeficiency disorder. Preferably, the primary immunodeficiency disorder is selected from the group consisting of: combined T and B cell immunodeficiency, antibody deficiency, well-defined syndrome, immune dysregulation disease, phagocytic disorder, innate immune deficiency, autoinflammatory disorder, and complement deficiency. In an embodiment, the primary immunodeficiency disorder is selected from the primary immunodeficiency disorders disclosed on page 24, line 11 to page 25, line 19 of PCT application WO2010 / 125480.

[0334] In a specific embodiment of the invention, the immunocompromised subject to be vaccinated has a disease selected from the group consisting of HIV infection, acquired immune deficiency syndrome (AIDS), cancer, chronic heart or lung disorders, congestive heart failure, diabetes, chronic liver disease, alcoholism, cirrhosis, spinal fluid leaks, cardiomyopathy, chronic bronchitis, emphysema, chronic obstructive pulmonary disease (COPD), spleen dysfunction (such as sickle cell disease), asplenia (asplenia), hematological malignancies, leukemia, multiple myeloma, Hodgkin's disease, lymphoma, renal failure, nephrotic syndrome, and asthma.

[0335] In an embodiment of the invention, the immunocompromised subject to be vaccinated suffers from malnutrition.

[0336] In a specific embodiment of the present invention, the immunocompromised subject to be vaccinated is taking a drug or undergoing a treatment that reduces the body's resistance to infection. In an embodiment, the drug is selected from the drugs disclosed on page 26, line 33 to page 26, line 40 of PCT application WO2010 / 125480.

[0337] In a particular embodiment of the invention, the immunocompromised subject to be vaccinated is a smoker.

[0338] In a specific embodiment of the present invention, the immunocompromised subject to be vaccinated has less than 5 x 10 9 cells / L, or less than 4 x 10 9 cells / L, or less than 3 x 10 9 cells / L, or less than 2 x 10 9 cells / L, or less than 1 x 10 9 cells / L, or less than 0.5 x 10 9 cells / L, or less than 0.3 x 10 9 cells / L, or less than 0.1 x 10 9 White blood cell count (WBC) in cells per liter.

[0339] White blood cell count (WBC): The number of white blood cells (WBC) in the blood. WBC is usually measured as part of a CBC (complete blood count). White blood cells are infection-fighting cells in the blood and are different from the red (oxygen-carrying) blood cells called erythrocytes. There are different types of white blood cells, including neutrophils (polymorphonuclear leukocytes; PMNs), band cells (mildly immature neutrophils), T-type lymphocytes (T cells), B-type lymphocytes (B cells), monocytes, eosinophils, and basophils. All types of white blood cells are reflected in the white blood cell count. The normal range for white blood cell count is usually between 4300 and 10800 cells per cubic millimeter of blood. This may also be called the white blood cell count and can be expressed in international units as 4.3-10.8 x 10 9 cells / liter.

[0340] In a specific embodiment of the present invention, the immunocompromised subject to be vaccinated has neutropenia. In a specific embodiment of the present invention, the immunocompromised subject to be vaccinated has less than 2 x 10 9 cells / L, or less than 1 x 10 9 cells / L, or less than 0.5 x 10 9 cells / L, or less than 0.1 x 10 9 cells / L, or less than 0.05 x 10 9 Neutrophil counts in cells / L.

[0341] Low white blood cell count, or "neutropenia," is a condition characterized by abnormally low levels of neutrophils circulating in the blood. Neutrophils are a specialized type of white blood cell that helps prevent and fight infection. The most common reason cancer patients experience neutropenia is as a side effect of chemotherapy. Chemotherapy-induced neutropenia increases a patient's risk of infection and can disrupt cancer treatment.

[0342] In a specific embodiment of the present invention, the immunocompromised subject to be vaccinated has less than 500 / mm 3 CD4+ cell count, or less than 300 / mm 3 CD4+ cell count, or less than 200 / mm 3 CD4+ cell count less than 100 / mm 3 CD4+ cell count less than 75 / mm 3 CD4+ cell count, or less than 50 / mm 3 CD4+ cell count.

[0343] CD4 cell tests are usually reported as 1 mm 3 The normal CD4 count is between 500 and 1600, and the CD8 count is between 375 and 1100. The CD4 count drops dramatically in people with HIV.

[0344] In an embodiment of the present invention, any immunocompromised subject disclosed herein is a man or a woman.

[0345] The amount of conjugate in the composition is typically calculated based on the total polysaccharide, both conjugated and unconjugated, for the conjugate. For example, a conjugate with 20% free polysaccharide will have approximately 80mcg of conjugated polysaccharide and approximately 20mcg of unconjugated polysaccharide in a 100mcg polysaccharide dose. When calculating the dose of the conjugate, the contribution of protein to the conjugate is typically not taken into account. Typically, each dose will contain 0.1 to 100mcg, specifically 0.1 to 10mcg, more specifically 1 to 10mcg, and even more specifically 1 to 5μg of polysaccharide. Preferably, each dose will contain approximately 1.1, 2, 2.2, 3, 3.3, 4, or 4.4μg of polysaccharide.

[0346] The optimal amounts of the components of a particular immunogenic composition or vaccine can be determined by standard studies involving observation of an appropriate immune response in a subject.Following the initial vaccination, the subject may receive one or several appropriately spaced booster immunizations.

[0347] Can be by proliferation assay, by measuring the cytolysis assay of the ability of its specific target cell of T cell lysis such as chromium release assay, or by measuring the level of B cell activity (by measuring the level of circulating antibodies specific to the antigen in serum) to measure the effect of antigen as immunogen.Can also be by measuring the serum level of the antigen-specific antibody induced after administering antigen, and more specifically, by measuring the ability of the opsonization phagocytosis ability of specific white blood cells of the antibody that enhances to detect immune response, as described herein.The protection level of immune response can be measured by attacking the immunized host with the antigen that has been administered.For example, if the antigen that is desired for its immune response is bacterium, then the protection level induced by the antigen of immunogenic amount is measured by detecting percentage survival rate or percentage mortality rate after attacking animal with described bacterial cell.In one embodiment, can be by measuring at least one symptom relevant to bacterial infection, for example, the fever relevant to infection measures protection amount.The amount of each antigen in multi-antigen or multi-component vaccine or immunogenic composition can change relative to each other component, and can be measured by method well known to those skilled in the art.Such method can comprise the method for measuring immunogenicity and / or efficacy in vivo.

[0348] The present disclosure also provides antibodies and antibody compositions that specifically and selectively bind to the capsular polysaccharide or glycoconjugate of the present disclosure. In some embodiments, antibodies are produced after the capsular polysaccharide or glycoconjugate of the present disclosure is administered to a subject. In some embodiments, the present disclosure provides purified or isolated antibodies against one or more capsular polysaccharides or glycoconjugates of the present disclosure. In some embodiments, the antibodies of the present disclosure have function, such as by killing bacteria in an animal efficacy model or measuring via opsonophagocytic killing. In some embodiments, the antibodies of the present disclosure confer passive immunity to a subject. By using techniques well known to those skilled in the art, the present disclosure also provides polynucleotide molecules encoding antibodies or antibody fragments of the present disclosure, as well as cells, cell lines (such as hybridoma cells or other engineered cell lines for the recombinant production of antibodies) or transgenic animals that produce antibodies or antibody compositions of the present disclosure. [Example]

[0349] Example 1: Serotype 22F polysaccharide-CRM 197 Preparation of conjugates

[0350] 1.1. Preparation of Isolated S. pneumoniae Serotype 22F Polysaccharide

[0351] Serotype 22F capsular polysaccharide can be obtained directly from bacteria using isolation methods known to those skilled in the art. (See, for example, the methods disclosed in U.S. Patent Application Publication Nos. 20060228380, 20060228381, 20070184071, 20070184072, 20070231340, and 20080102498 or WO2008118752.) Serotype 22F Streptococcus pneumoniae is grown in inoculation bottles and subsequently transferred to an inoculation fermentor. Once the target optical density is reached, the cells are transferred to a production fermentor. The fermentation broth is inactivated by the addition of N-lauroylsarcosine and purified by ultrafiltration and diafiltration.

[0352] Using PANDA 2K (GEA Niro Soavi), purified S. pneumoniae serotype 22F polysaccharide was tailored by high pressure homogenization to produce isolated S. pneumoniae serotype 22F polysaccharide.

[0353] 1.2. Oxidation of isolated S. pneumoniae serotype 22F capsular polysaccharide

[0354] Oxidation of the polysaccharide was performed in 100 mM potassium phosphate buffer (pH 5.8 ± 0.2) obtained by sequentially adding calculated amounts of 500 mM potassium phosphate buffer (pH 5.8) and WFI (to provide a final polysaccharide concentration of 2.0 g / L). The reaction pH was adjusted to approximately 5.8 when necessary. After pH adjustment, the reaction temperature was lowered to 5 ± 3°C. Oxidation was initiated by adding 0.10 ± 0.02 molar equivalents (MEq) of sodium periodate. The target oxidation reaction time was 16 ± 1 hours at 5 ± 3°C.

[0355] The oxidation reaction was quenched with 2 MEq of 2,3-butanediol by continuous stirring at 5 ± 3 °C for 1-2 hours.

[0356] The activated polysaccharide was concentrated and diafiltered using a 100K MWCO ultrafiltration cartridge. Diafiltration was performed against 35 diafiltration volumes of WFI. The purified activated polysaccharide was stored at 5 ± 3°C. The purified activated sugar was characterized by, among other things, (i) molecular weight measured by SEC-MALLS, (ii) the presence of O-acetyl groups, and (iii) the degree of oxidation.

[0357] SEC-MALLS is used to determine the molecular weight of polysaccharides and polysaccharide-protein conjugates. SEC is used to separate polysaccharides by hydrodynamic volume. Refractive index (RI) and multi-angle laser light scattering (MALLS) detectors are used to determine molecular weight. When light interacts with a substance, it scatters, and the amount of scattered light is related to the concentration, dn / dc (specific refractive index increment) squared, and the molar mass of the substance. Molecular weight measurements are calculated based on the readings of the scattered light signal from the MALLS detector and the concentration signal from the RI detector.

[0358] The degree of oxidation of the activated polysaccharide (DO = moles of sugar repeating units / moles of aldehyde) was determined as follows:

[0359] The number of moles of sugar repeating units is determined by various colorimetric methods, such as, for example, the anthrone method. Polysaccharides are first broken down into monosaccharides by the action of sulfuric acid and heat. The anthrone sugar-measuring reagent reacts with hexoses to form a yellow-green complex, the absorbance of which is read spectrophotometrically at 625 nm. Within the range of the assay, the absorbance is directly proportional to the amount of hexose present. The MBTH colorimetric method is also used to determine the number of moles of aldehydes. The MBTH assay involves forming an azine compound by reacting aldehyde groups (from a given sample) with 3-methyl-2-benzothiazolone hydrazone (MBTH assay reagent). Excess 3-methyl-2-benzothiazolone hydrazone is oxidized to form a reactive cation. The reactive cation reacts with the azine to form a blue chromophore. The resulting chromophore is then read spectrophotometrically at 650 nm.

[0360] 1.3. Activated S. pneumoniae serotype 22F polysaccharide and CRM 197 Conjugation

[0361] The conjugation method consists of the following steps:

[0362] a. Mix with sucrose excipient and freeze-dry.

[0363] b. Reconstitution of Lyophilized Polysaccharides and CRM 197 .

[0364] c. Conjugating the activated polysaccharide to CRM 197 And add a cap

[0365] d. Purification of the conjugate.

[0366] a. Mix with sucrose and freeze-dry

[0367] The activated polysaccharide was mixed with sucrose (50% w / v in WFI) to a ratio of 25 g sucrose per gram of activated polysaccharide. The mixed mixture was then lyophilized in bottles. After lyophilization, the bottles containing the lyophilized activated polysaccharide were stored at -20 ± 5°C. The calculated amount of CRM was frozen and lyophilized separately.197 Protein (target S / P input ratio = 1). 197 Store at -20±5℃.

[0368] 【b. Lyophilized activated polysaccharide and CRM 197 Protein reconstruction

[0369] Reconstitute the lyophilized activated polysaccharide in anhydrous dimethyl sulfoxide (DMSO). After the polysaccharide is completely dissolved, add an equal amount of anhydrous DMSO to the lyophilized CRM. 197 to rebuild.

[0370] 【c. Conjugating the activated polysaccharide to CRM 197 And add a cap]

[0371] CRM to be rebuilt 197 Combine the reconstituted activated polysaccharide (in DMSO) with the reconstituted activated polysaccharide in a conjugation reaction vessel. The final polysaccharide concentration in the reaction solution is 1 g / L. Initiate conjugation by adding 1.5 ± 0.1 M eq of sodium cyanoborohydride to the reaction mixture and incubate the reaction at 23 ± 2°C for 20 ± 2 hours. Terminate the conjugation reaction by adding 2 M eq of sodium borohydride. Incubate the capping reaction at 23 ± 2°C for 3 ± 1 hour.

[0372] [d. Purification of the conjugate]

[0373] The conjugate solution was diluted 1:5 with ice-cold 5 mM succinate-0.9% saline (pH 6.0) in the formulation for purification by tangential flow filtration using a 100K MWCO membrane, using 5 mM succinate-0.9% saline (pH 6.0) as the medium for 20X diafiltration. After the diafiltration was complete, the conjugate retentate was further diluted, filtered through a 0.22 μm filter, and stored at 2-8°C.

[0374] Table 1 contains serotype 22F polysaccharide-CRM obtained by the method of the present invention 197 Characterization data of the conjugates. Specifically, conjugates 5 and 6 in the table were obtained as disclosed in Example 1.

[0375] Compared with the conjugate produced by the RAC-aqueous method, the serotype 22F polysaccharide-CRM produced by the RAC-DMSO method 197 The conjugates provided better yields and exhibited better batch-to-batch consistency in MW, as well as significantly lower levels of percent free sugars and higher carrier protein (lysine) modifications, as shown in Table 1.

[0376] [Table 1 - Serotype 22F conjugates]

[0377] Conjugate number 1 2 3 4 5 6 water water water DMSO DMSO DMSO MW of activated polysaccharide, kDa 488 803 410 639 709 416 DO 17.3 15 10.3 14.6 14.4 13.7 Input ratio 0.8 0.8 1 0.8 1 1 Conjugate yield % 66 63 46 70 62 75 Free sugar% 18 43 45 <5 <5 8 MW of the conjugate 1024 3544 462 3911 3734 4453 Carbohydrate-protein ratio 1.6 1.1 1.45 0.8 0.65 1.0 Modified Lys(AAA) 2.3 N / A N / A 6.1 N / A 4.7

[0378] The percent conjugate yield was calculated as follows: (amount of polysaccharide in the conjugate x 100) / amount of activated polysaccharide.

[0379] Example 2: Serotype 10A polysaccharide-CRM 197 Preparation of conjugates

[0380] 2.1. Preparation of Isolated S. pneumoniae Serotype 10A Polysaccharide

[0381] Isolated serotype 10A polysaccharide was obtained as disclosed in Example 1.1, except that the purified polysaccharide was not tailored.

[0382] 2.2. Oxidation of isolated S. pneumoniae serotype 10A capsular polysaccharide

[0383] The calculated volume of 0.1M potassium phosphate buffer (pH 6.0) and water for injection (WFI) was added to the polysaccharide solution to obtain a final concentration of 2.5 g / L polysaccharide and a final concentration of 25 mM potassium phosphate buffer, and if necessary, the pH was adjusted to approximately 6.0. The diluted polysaccharide was then cooled to 5 ± 3 ° C. Oxidation was initiated by adding 0.25 ± 0.02 molar equivalents (MEq) of sodium periodate solution. The oxidation reaction time was approximately 4 hours at 5 ± 3 ° C. The oxidation reaction was quenched with 1 MEq of 2,3-butanediol by continuous stirring at 5 ± 3 ° C for 1-2 hours.

[0384] After reaching the target reaction time, the activated polysaccharide was concentrated using a 30K MWCO Millipore ultrafiltration cartridge. Diafiltration was subsequently performed against 20 times of the diafiltration volume of WFI. The purified activated polysaccharide was stored at 5 ± 3 ° C. The purified activated polysaccharide was characterized by, among other things, (i) molecular weight measured by SEC-MALLS, and (ii) degree of oxidation.

[0385] [2.3 Activated Streptococcus pneumoniae serotype 10A polysaccharide and CRM 197 Conjugation

[0386] The conjugation reaction consists of the following steps:

[0387] a. Mix with sucrose excipient and freeze-dry.

[0388] b. Reconstitution of Lyophilized Polysaccharides and CRM 197 .

[0389] c. Conjugating the activated polysaccharide to CRM 197 And add a cap

[0390] d. Purification of the conjugate.

[0391] a. Mixed with sucrose

[0392] The activated polysaccharide was mixed with sucrose to a ratio of 25±2.5 g sucrose per gram of activated polysaccharide. The bottled mixed mixture was then lyophilized. After lyophilization, the bottles containing the lyophilized activated polysaccharide were stored at -20±5°C.

[0393] 【b. Lyophilized activated polysaccharide and CRM 197 Protein reconstruction

[0394] Reconstitute the lyophilized activated polysaccharide in anhydrous dimethyl sulfoxide (DMSO). After the polysaccharide is completely dissolved, add an equal amount of anhydrous DMSO to the calculated CRM. 197 to rebuild.

[0395] 【c. Conjugating the activated polysaccharide to CRM 197 And add a cap]

[0396] CRM to be rebuilt 197 Add the reconstituted activated polysaccharide (in DMSO) to the conjugation reaction vessel. The final polysaccharide concentration is 1 g / L. Perform conjugation by adding 1.2 ± 0.1 MEq of sodium cyanoborohydride to the reaction mixture. Incubate the reaction at 23 ± 2°C for 24 ± 2 hours. Terminate the conjugation reaction by adding 2 MEq of sodium borohydride. Incubate the capping reaction at 23 ± 2°C for 3 ± 1 hour.

[0397] The conjugation reaction was terminated by adding 2 MEq of sodium borohydride. The capping reaction was carried out at 23±2°C for 3±1 hours.

[0398] [d. Purification of the conjugate]

[0399] The conjugate solution was then diluted 5x (by volume) into ice-cold 5 mM succinate-0.9% saline (pH 6.0) and 20x diafiltered using 5 mM succinate-0.9% saline (pH 6.0). After the initial diafiltration was complete, the conjugate retentate was transferred through a 0.22 μm filter. The conjugate was further diluted with 5 mM succinate / 0.9% saline (pH 6) and, after the final 0.22 μm filtration step, stored at 2-8°C.

[0400] Table 2 contains serotype 10A polysaccharide-CRM obtained by the method of the present invention 197 Characterization data of the conjugates. Specifically, conjugates 4 to 6 in Table 2 were obtained as disclosed in Example 2.

[0401] Compared with the conjugate produced by the RAC-aqueous method, the serotype 10A polysaccharide-CRM produced by the RAC-DMSO method 197The conjugates provided better yields and exhibited better batch-to-batch consistency in MW, as well as significantly lower levels of percent free sugars and higher carrier protein (lysine) modifications, as shown in Table 2.

[0402] [Table 2. Serotype 10A conjugates]

[0403] Conjugate number 1 2 3 4 5 6 water water water DMSO DMSO DMSO DO 12.2 12.2 12.8 10.3 10.8 10.5 MW of activated sugar, kDa 157 157 163 170 170 170 Input ratio 1.0 1.0 1.0 1.1 1.1 1.1 Yield % 71 34 50 82 73 66 Free sugar% 20 31 26 6.8 6.4 9.7 MW of the conjugate, kDa 1550 968 3050 4034 3463 5540 Carbohydrate-protein ratio 1.6 2.6 1.6 1.1 1.2 1.0 Lys modified AAA 2.6 N / A N / A 6.9 6.7 6.1

[0404] Example 3: Serotype 33F polysaccharide-CRM 197 Preparation of conjugates

[0405] 3.1. Preparation of Isolated S. pneumoniae Serotype 33F Polysaccharide

[0406] Isolated serotype 33F polysaccharide was obtained as disclosed in Example 1.1.

[0407] 3.2. Oxidation of isolated S. pneumoniae serotype 33F capsular polysaccharide

[0408] The calculated volume of 0.1M potassium phosphate buffer (pH 6.0) and water for injection (WFI) is added to the polysaccharide solution to obtain a final polysaccharide concentration of 2g / L. If necessary, the pH is adjusted to approximately 6.0. The diluted polysaccharide is subsequently cooled to 5±3°C. Oxidation is initiated by adding 0.1 molar equivalent (MEq) of sodium periodate solution. The oxidation reaction time is about 20 hours at 5±3°C. The oxidation reaction is quenched with 1MEq of 2,3-butanediol by continuous stirring at 5±3°C for about 1 hour. After reaching the target reaction time, the activated polysaccharide is concentrated using a 100K MWCO Millipore ultrafiltration cartridge. Diafiltration is then performed for 40 times of diafiltration volume of WFI. The purified activated polysaccharide is stored at 5±3°C. The purified activated sugar is characterized by, among other things, (i) molecular weight measured by SEC-MALLS and (ii) degree of oxidation.

[0409] [3.3 Activated S. pneumoniae serotype 33F polysaccharide and CRM 197 Conjugation

[0410] Using the activated 33F polysaccharide obtained in Example 3.2, a serotype 33F polysaccharide-CRM197 conjugate was obtained by a method similar to that of Example 1.3.

[0411] Compared with the conjugate produced by the RAC-aqueous method, the serotype 33F polysaccharide-CRM produced by the RAC-DMSO method 197 The conjugates provided better yields and exhibited better batch-to-batch consistency in the maintenance of O-acetyl levels as well as overall lower levels of percent free sugars and higher carrier protein (lysine) modifications, as shown in Table 3.

[0412]

[0413] LOQ = Limit of Quantitation

[0414] Example 4: Effect of Quenching on the Molecular Weight of Activated Serotype 22F and 33F Polysaccharides

[0415] Activation of 22F and 33F polysaccharides was performed at either 4°C or 22°C. Both temperatures gave similar DO values. However, the elevated temperature resulted in faster decomposition of the activated polysaccharide, thereby reducing the MW of the activated polysaccharide (e.g., when comparing Figure 4 (22℃) and Figure 5 (shown at 4°C), 4°C is generally preferred for activation reactions. In addition, the activation data show that quenching of unreacted NaIO4 after oxidation is a necessary step for activation, especially for activation using higher amounts of NaIO4. Figure 6 The graph shown in Figure 3 shows that the MW of the activated 33F polysaccharide is relatively stable when increasing concentrations of periodate are used for activation (with quenching), while such MW is highly variable when no quenching step is used. Under specific conditions designed to achieve the targeted degree of oxidation, the molecular weight of the activated polysaccharide is less variable when a quenching step is used. The addition of a quencher after oxidation helps maintain the structural integrity of the activated polysaccharide until purification is completed, for example, by ultrafiltration and diafiltration.

[0416] [Example 5: Opsonophagocytic activity assay (OPA)]

[0417] The immunogenicity of the conjugates obtained by the methods disclosed herein can be assessed using the adjusted phagocytosis assay (OPA) described below.

[0418] Groups of 30 6-7 week old female Swiss Webster mice were immunized subcutaneously with 0.001 μg, 0.01 μg, or 0.1 μg of the test conjugate at week 0. Mice were boosted with the same dose of the conjugate at week 3 and subsequently bled at week 4. Serotype-specific OPA was performed on week 4 serum samples.

[0419] A validated adjusted phagocytic activity (OPA) assay was used to measure functional antibodies specific for S. pneumoniae serotypes 10A, 22F, or 33F in murine serum. The assay reaction was established to measure the ability of capsular polysaccharide-specific immunoglobulins to opsonize bacteria, trigger complement deposition, and thereby promote phagocytosis and killing of bacteria by phagocytes. The OPA titer was defined as the reciprocal dilution that resulted in a 50% reduction in bacterial counts relative to control wells without test serum. The OPA titer was interpolated from two dilutions encompassing this 50% kill cutoff.

[0420] The OPA method is based on the method described by Hu et al., Clin Diagn Lab Immunol 2005; 12 (February (2)): 287–95 with the following modifications. Test sera were serially diluted 2.5-fold and added to microtiter assay plates. Live serotype 10A, 22F, and 33F target bacterial strains were added to the wells and the plates were shaken at 25°C (serotype 22F) or 37°C (serotypes 10A and 33F) for 30 minutes. Differentiated HL-60 cells (phagocytes) and serum from young rabbits (3 to 4 weeks old, 12.5% ​​final concentration) was added to the wells and the plates were shaken at 37°C for 45 minutes (serotypes 22F and 33F) or 60 minutes (serotype 10A). To stop the reaction, 80 μL of 0.9% NaCl was added to all wells, mixed, and 10 μL aliquots were transferred to MultiScreen HTS HV filter plates containing 200 μL of water. The liquid was filtered through the plate under vacuum, and 150 μL of HySoy medium was added to each well and filtered through. The filter plate was then incubated overnight at 37°C, 5% CO2 and then fixed with decolorizing solution (Bio-Rad). The plate was then stained with Coomassie blue and decolored once. ImmunoSpot Colonies were imaged and counted on a 400 nm t-cell culture plate. Raw colony counts were used to plot killing curves and calculate OPA titers.

[0421] The serotype 10A polysaccharide-CRM obtained as disclosed in Examples 1 to 3 was tested in the above disclosed OPA assay 197 Conjugate, serotype 22F polysaccharide-CRM 197 Conjugate and serotype 33F polysaccharide-CRM 197 conjugates and found to be immunogenic.

[0422] This manual also includes the following:

[0423] 1. A method for preparing activated Streptococcus pneumoniae serotype 10A, 22F or 33F capsular polysaccharide, the method comprising the following steps:

[0424] (a) reacting an isolated serotype 10A, 22F or 33F capsular polysaccharide with an oxidizing agent; and

[0425] (b) Quenching the oxidation reaction by adding a quencher, resulting in activated S. pneumoniae serotype 10A, 22F or 33F polysaccharide.

[0426] 2. The method of embodiment 1, wherein the concentration of serotype 10A, 22F or 33F polysaccharide in step (a) is between 0.5 mg / mL and 5 mg / mL.

[0427] 3. The method of embodiment 1 or 2, wherein in step (a) the polysaccharide is reacted with 0.01 to 10 molar equivalents, 0.05 to 5 molar equivalents, 0.1 to 1 molar equivalents, 0.5 to 1 molar equivalents, 0.7 to 0.8 molar equivalents, 0.01 to 0.2 molar equivalents, 0.05 to 0.5 molar equivalents, 0.05 to 0.2 molar equivalents, 0.1 to 0.3 molar equivalents of an oxidant.

[0428] 4. The method of any one of embodiments 1 to 3, wherein in step (a) the polysaccharide is reacted with 0.05 to 0.3 molar equivalents of an oxidizing agent.

[0429] 5. The method of any one of embodiments 1 to 4, wherein the oxidizing agent is periodate.

[0430] 6. The method of any one of embodiments 1 to 4, wherein the oxidizing agent is sodium metaperiodate.

[0431] 7. The process of any one of embodiments 1 to 6, wherein the reaction temperature in step (a) is maintained between 1°C and 10°C.

[0432] 8. The method of any one of embodiments 1 to 7, wherein the reaction temperature in step (a) is about 5°C or about 5°C.

[0433] 9. The method of any one of embodiments 1 to 8, wherein the duration of step (a) is between about 1 hour and 25 hours.

[0434] 10. The method of any one of embodiments 1 to 9, wherein the quencher is selected from a vicinal diol, a 1,2-amino alcohol, an amino acid, glutathione, a sulfite, a bisulfate, a dithionite, a pyrosulfite, a thiosulfate, a phosphite, a hypophosphite, or a phosphorous acid.

[0435] 11. The method of any one of embodiments 1 to 9, wherein the quencher is a compound of formula (II)

[0436] , where R 1 and R 2 Each is independently selected from H, methyl, ethyl, propyl or isopropyl.

[0437] 12. The method of any one of embodiments 1 to 9, wherein the quencher is selected from glycerol, ethylene glycol, propane-1,2-diol, butane-1,2-diol, or butane-2,3-diol.

[0438] 13. The method of any one of embodiments 1 to 9, wherein the quencher is butane-2,3-diol.

[0439] 14. The method of any one of embodiments 1 to 13, wherein the oxidation reaction is quenched by adding 0.1 to 10, 0.5 to 5, 0.5 to 3, or 0.5 to 2 molar equivalents of a quencher.

[0440] 15. The method of any one of embodiments 1 to 13, wherein the oxidation reaction is quenched by adding 0.5 to 2 molar equivalents of a quenching agent.

[0441] 16. The process of any one of embodiments 1 to 15, wherein the reaction temperature in step (b) is maintained between 1°C and 10°C.

[0442] 17. The method of any one of embodiments 1 to 16, wherein the reaction temperature in step (b) is about 4°C.

[0443] 18. The method of any one of embodiments 1 to 17, wherein the duration of step (b) is between 0.5 and 2 hours.

[0444] 19. The method of any one of embodiments 1 to 18, wherein the activated polysaccharide is purified after step (b).

[0445] 20. The method of any one of embodiments 1 to 19, wherein the isolated polysaccharide is an isolated S. pneumoniae serotype 10A polysaccharide.

[0446] 21. The method of embodiment 20, wherein the isolated S. pneumoniae serotype 10A polysaccharide is obtained by a method comprising the steps of:

[0447] (a) preparing a fermentation culture of serotype 10A Streptococcus pneumoniae bacterial cells;

[0448] (b) lysing bacterial cells in the fermentation culture; and

[0449] (c) purifying serotype 10A polysaccharide from the fermentation culture.

[0450] 22. An activated Streptococcus pneumoniae serotype 10A capsular polysaccharide obtained by the method of any one of embodiments 1 to 21.

[0451] 23. An activated Streptococcus pneumoniae serotype 10A capsular polysaccharide obtainable by the method of any one of embodiments 1 to 21.

[0452] 24. The activated S. pneumoniae serotype 10A capsular polysaccharide of any one of embodiments 22 or 23, wherein the polysaccharide has a molecular weight of between 50 kDa and 400 kDa, between 50 kDa and 350 kDa, between 50 kDa and 300 kDa, between 50 kDa and 250 kDa, between 50 kDa and 200 kDa, between 100 kDa and 300 kDa, between 100 kDa and 250 kDa, or between 100 kDa and 200 kDa.

[0453] 25. The activated S. pneumoniae serotype 10A capsular polysaccharide of any one of embodiments 22 or 23, wherein the polysaccharide has a molecular weight between 50 kDa and 300 kDa.

[0454] 26. The activated S. pneumoniae serotype 10A capsular polysaccharide of any one of embodiments 22 or 23, wherein the polysaccharide has a molecular weight between 100 kDa and 200 kDa.

[0455] 27. The activated S. pneumoniae serotype 10A capsular polysaccharide of any one of embodiments 22 to 26, wherein the polysaccharide has a degree of oxidation of between 5 and 20, between 5 and 15, between 8 and 14, between 8 and 12, or between 9 and 11.

[0456] 28. The activated S. pneumoniae serotype 10A capsular polysaccharide of any one of embodiments 22 to 26, wherein the polysaccharide has a degree of oxidation of between 9 and 11.

[0457] 29. The method of any one of embodiments 1 to 19, wherein the isolated polysaccharide is isolated S. pneumoniae serotype 22F polysaccharide.

[0458] 30. The method of embodiment 29, wherein the isolated S. pneumoniae serotype 22F polysaccharide is obtained by a method comprising the steps of:

[0459] (a) preparing a fermentation culture of serotype 22F Streptococcus pneumoniae bacterial cells;

[0460] (b) lysing bacterial cells in the fermentation culture;

[0461] (c) purifying serotype 22F polysaccharide from the fermentation culture; and

[0462] (d) tailoring the serotype 22F polysaccharide by mechanical shearing, preferably by high pressure homogenization.

[0463] 31. An activated Streptococcus pneumoniae serotype 22F capsular polysaccharide obtained by the method of any one of embodiments 1 to 19 or 29 or 30.

[0464] 32. An activated Streptococcus pneumoniae serotype 22F capsular polysaccharide obtainable by the method of any one of embodiments 1 to 19 or 29 or 30.

[0465] 33. The activated S. pneumoniae serotype 22F capsular polysaccharide of any one of embodiments 31 or 32, wherein the polysaccharide has a molecular weight of between 25 kDa and 1000 kDa, between 100 kDa and 1000 kDa, between 300 kDa and 800 kDa, between 300 kDa and 700 kDa, between 300 kDa and 600 kDa, between 400 kDa and 1000 kDa, between 400 kDa and 800 kDa, between 400 kDa and 700 kDa, or between 400 kDa and 600 kDa.

[0466] 34. The activated S. pneumoniae serotype 22F capsular polysaccharide of any one of embodiments 31 or 32, wherein the polysaccharide has a molecular weight between 300 kDa and 800 kDa.

[0467] 35. The activated S. pneumoniae serotype 22F capsular polysaccharide of any one of embodiments 31 or 32, wherein the polysaccharide has a molecular weight between 400 kDa and 600 kDa.

[0468] 36. The activated S. pneumoniae serotype 22F capsular polysaccharide of any one of embodiments 31 to 35, wherein the polysaccharide has a degree of oxidation of between 10 and 25, between 10 and 20, between 12 and 20, or between 14 and 18.

[0469] 37. The activated S. pneumoniae serotype 22F capsular polysaccharide of any one of embodiments 31 to 35, wherein the polysaccharide has a degree of oxidation between 10 and 20.

[0470] 38. The activated S. pneumoniae serotype 22F capsular polysaccharide of any one of embodiments 31 to 37, wherein the polysaccharide comprises at least 0.6 mM acetate per mM serotype 22F polysaccharide.

[0471] 39. The method of any one of embodiments 1 to 19, wherein the isolated polysaccharide is an isolated S. pneumoniae serotype 33F polysaccharide.

[0472] 40. The method of embodiment 39, wherein the isolated S. pneumoniae serotype 33F polysaccharide is obtained by a method comprising the steps of:

[0473] (a) preparing a fermentation culture of serotype 33F Streptococcus pneumoniae bacterial cells;

[0474] (b) lysing bacterial cells in the fermentation culture;

[0475] (c) purifying serotype 33F polysaccharide from the fermentation culture; and

[0476] (d) tailoring the serotype 33F polysaccharide by mechanical shearing, preferably by high pressure homogenization.

[0477] 41. An activated Streptococcus pneumoniae serotype 33F capsular polysaccharide obtained by the method of any one of embodiments 1 to 19 or 39 or 40.

[0478] 42. An activated Streptococcus pneumoniae serotype 33F capsular polysaccharide obtainable by the method of any one of embodiments 1 to 19 or 39 or 40.

[0479] 43. The activated S. pneumoniae serotype 33F capsular polysaccharide of embodiment 39 or 40, wherein the polysaccharide has a molecular weight of between 50 kDa and 1250 kDa, between 200 kDa and 1200 kDa, between 500 kDa and 1200 kDa, between 500 kDa and 1000 kDa, between 700 kDa and 1200 kDa, between 800 kDa and 1200 kDa, between 800 kDa and 1100 kDa, between 900 kDa and 1200 kDa, or between 800 kDa and 1000 kDa.

[0480] 44. The activated S. pneumoniae serotype 33F capsular polysaccharide of embodiment 39 or 40, wherein the polysaccharide has a molecular weight between 500 kDa and 1000 kDa.

[0481] 45. The activated S. pneumoniae serotype 33F capsular polysaccharide of embodiment 39 or 40, wherein the polysaccharide has a molecular weight between 50 kDa and 400 kDa.

[0482] 46. ​​The activated S. pneumoniae serotype 33F capsular polysaccharide of any one of embodiments 41 to 45, wherein the polysaccharide has a degree of oxidation between 10 and 20.

[0483] 47. The activated S. pneumoniae serotype 33F capsular polysaccharide of any one of embodiments 41 to 34, wherein the polysaccharide comprises at least 0.7 mM acetate per mM serotype 33F polysaccharide.

[0484] 48. The method of any one of embodiments 1 to 47, wherein the activated polysaccharide is freeze-dried after step (b).

[0485] 49. A method for preparing an immunogenic conjugate comprising a polysaccharide of Streptococcus pneumoniae serotype 10A, 22F or 33F covalently linked to a carrier protein, the method comprising the steps of:

[0486] (a) mixing an activated serotype 10A, 22F or 33F polysaccharide obtained or obtainable by the method of any one of embodiments 1 to 19 with a carrier protein; and,

[0487] (b) reacting the mixed activated serotype 10A, 22F or 33F polysaccharide and carrier protein with a reducing agent to form a serotype 10A, 22F or 33F polysaccharide:carrier protein conjugate.

[0488] 50. The method of embodiment 49, further comprising the steps of:

[0489] (c) capping the unreacted aldehyde in the serotype 10A, 22F or 33F polysaccharide:carrier protein conjugate.

[0490] 51. The method of embodiment 49 or 50, wherein steps (a) and (b) are performed in DMSO.

[0491] 52. The method of embodiment 49 or 50, wherein steps (a) and (b) are performed in aqueous solution.

[0492] 53. The method of any one of embodiments 49 to 52, wherein the activated polysaccharide and protein carrier are co-lyophilized after step (a).

[0493] 54. The method of embodiment 53, wherein step (b) is performed in DMSO.

[0494] 55. The method of embodiment 53, wherein step (b) is performed in aqueous solution.

[0495] 56. The method of any one of embodiments 49 to 55, wherein the concentration of the activated polysaccharide in step (b) is between 0.1 mg / mL and 10 mg / mL, between 0.5 mg / mL and 5 mg / mL, or between 0.5 mg / mL and 2 mg / mL.

[0496] 57. The method of any one of embodiments 49 to 55, wherein the concentration of the activated polysaccharide in step (b) is between 0.5 mg / mL and 2 mg / mL.

[0497] 58. The method of any one of embodiments 49 to 57, wherein the initial ratio of activated serotype 10A, 22F or 33F polysaccharide to carrier protein is between 5:1 and 0.1:1, between 2:1 and 0.1:1, between 2:1 and 1:1, between 1.5:1 and 1:1, between 0.1:1 and 1:1, between 0.3:1 and 1:1 or between 0.6:1 and 1.2:1.

[0498] 59. The method of any one of embodiments 49 to 57, wherein the initial ratio of activated serotype 10A, 22F or 33F polysaccharide to carrier protein is between 0.6:1 and 1.2:1.

[0499] 60. The method of any one of embodiments 49 to 59, wherein in step (b), the activated polysaccharide is reacted with between 0.5 and 2.5 molar equivalents of a reducing agent.

[0500] 61. The method of any one of embodiments 49 to 60, wherein the reducing agent is sodium cyanoborohydride.

[0501] 62. The method of any one of embodiments 49 to 61, wherein the duration of step (d) is between 20 and 30 hours.

[0502] 63. The method of any one of embodiments 49 to 62, wherein the reaction temperature in step d is maintained between 20°C and 26°C.

[0503] 64. The method of embodiment 53, wherein the unreacted aldehyde is capped by adding about 2 molar equivalents of NaBH4.

[0504] 65. The method of any one of embodiments 49 to 64, further comprising the step of purifying the polysaccharide:carrier protein conjugate.

[0505] 66. The method of any one of embodiments 49 to 65, further comprising the step of purifying the polysaccharide:carrier protein conjugate by tangential flow filtration and diafiltration.

[0506] 67. An immunogenic conjugate comprising a Streptococcus pneumoniae serotype 10A polysaccharide covalently linked to a carrier protein, obtainable by the method of any one of embodiments 49 to 66.

[0507] 68. An immunogenic conjugate comprising a polysaccharide of Streptococcus pneumoniae serotype 10A covalently linked to a carrier protein, obtainable by the method of any one of embodiments 49 to 66.

[0508] 69. The immunogenic conjugate of embodiment 67 or 68, wherein the conjugate has a molecular weight of between 500 kDa and 15000 kDa, between 500 kDa and 10000 kDa, between 2000 kDa and 10000 kDa, or between 3000 kDa and 8000 kDa.

[0509] 70. The immunogenic conjugate of embodiment 67 or 68, wherein the conjugate has a molecular weight of between 3000 kDa and 8000 kDa.

[0510] 71. The immunogenic conjugate of any one of embodiments 67 to 70, wherein the conjugate comprises less than about 50%, 45%, 40%, 35%, 30%, 25%, 20% or 15% free serotype 10A polysaccharide compared to the total amount of serotype 10A polysaccharide.

[0511] 72. The immunogenic conjugate of any one of embodiments 67 to 70, wherein the conjugate comprises less than about 20% free serotype 10A polysaccharide compared to the total amount of serotype 10A polysaccharide.

[0512] 73. The immunogenic conjugate of any one of embodiments 67 to 72, wherein the ratio of serotype 10A polysaccharide to carrier protein in the conjugate is between 0.5 and 3.

[0513] 74. The immunogenic conjugate of any one of embodiments 67 to 72, wherein the ratio of serotype 10A polysaccharide to carrier protein in the conjugate is between 0.8 and 1.4.

[0514] 75. The immunogenic conjugate of any one of embodiments 67 to 74, wherein at least 40% of said immunogenic conjugates have a Kd lower than or equal to 0.3 in a CL-4B column.

[0515] 76. The immunogenic conjugate of any one of embodiments 67 to 74, wherein between 50% and 80% of said serotype 10A immunogenic conjugates have a Kd less than or equal to 0.3 in a CL-4B column.

[0516] 77. The immunogenic conjugate of any one of embodiments 67 to 76, wherein the degree of conjugation of the immunogenic conjugate is between 2 and 15, between 2 and 13, between 2 and 10, between 2 and 8, between 2 and 6, between 2 and 5, between 2 and 4, between 3 and 15, between 3 and 13, between 3 and 10, between 3 and 8, between 3 and 6, between 3 and 5, between 3 and 4, between 5 and 15, between 5 and 10, between 8 and 15, between 8 and 12, between 10 and 15, or between 10 and 12.

[0517] 78. The immunogenic conjugate of any one of embodiments 67 to 76, wherein the degree of conjugation of the immunogenic conjugate is between 6 and 8.

[0518] 79. An immunogenic conjugate comprising a polysaccharide of Streptococcus pneumoniae serotype 22F covalently linked to a carrier protein, obtainable by the method of any one of embodiments 49 to 66.

[0519] 80. An immunogenic conjugate comprising a polysaccharide of Streptococcus pneumoniae serotype 22F covalently linked to a carrier protein, obtainable by the method of any one of embodiments 49 to 66.

[0520] 81. The immunogenic conjugate of embodiment 79 or 80, wherein the conjugate comprises at least 0.5, 0.6 or 0.7 mM acetate per mM serotype 22F polysaccharide.

[0521] 82. The immunogenic conjugate of embodiment 79 or 80, wherein the ratio of mM acetate per mM serotype 22F polysaccharide in the immunogenic conjugate to mM acetate per mM serotype 22F polysaccharide in the isolated polysaccharide is at least 0.7.

[0522] 83. The immunogenic conjugate of any one of embodiments 79 to 82, wherein the ratio of mM acetate per mM serotype 22F polysaccharide in the immunogenic conjugate to mM acetate per mM serotype 22F polysaccharide in the activated polysaccharide is at least 0.7.

[0523] 84. The immunogenic conjugate of any one of embodiments 79 to 83, wherein the conjugate has a molecular weight of between 400 kDa and 15000 kDa, between 500 kDa and 10000 kDa, between 2000 kDa and 10000 kDa, between 3000 kDa and 8000 kDa, or between 3000 kDa and 5000 kDa.

[0524] 85. The immunogenic conjugate of any one of embodiments 79 to 83, wherein the conjugate has a molecular weight of between 3000 kDa and 5000 kDa.

[0525] 86. The immunogenic conjugate of any one of embodiments 79 to 85, wherein the conjugate comprises less than about 50%, 45%, 40%, 35%, 30%, 25%, 20% or 15% free serotype 22F polysaccharide compared to the total amount of serotype 22F polysaccharide.

[0526] 87. The immunogenic conjugate of any one of embodiments 79 to 83, wherein the conjugate comprises less than about 20% of free serotype 22F polysaccharide compared to the total amount of serotype 22F polysaccharide.

[0527] 88. The immunogenic conjugate of any one of embodiments 79 to 87, wherein the ratio of serotype 22F polysaccharide to carrier protein in the conjugate is between 0.5 and 2.

[0528] 89. The immunogenic conjugate of any one of embodiments 79 to 87, wherein the ratio of serotype 22F polysaccharide to carrier protein in the conjugate is between 0.8 and 1.2.

[0529] 90. The immunogenic conjugate of any one of embodiments 79 to 89, wherein at least 40% of said immunogenic conjugates have a Kd lower than or equal to 0.3 in a CL-4B column.

[0530] 91. The immunogenic conjugate of any one of embodiments 79 to 89, wherein between 50% and 80% of said serotype 22F immunogenic conjugates have a Kd less than or equal to 0.3 in a CL-4B column.

[0531] 92. The immunogenic conjugate of any one of embodiments 79 to 91, wherein the degree of conjugation of the immunogenic conjugate is between 2 and 15, between 2 and 13, between 2 and 10, between 2 and 8, between 2 and 6, between 2 and 5, between 2 and 4, between 3 and 15, between 3 and 13, between 3 and 10, between 3 and 8, between 3 and 6, between 3 and 5, between 3 and 4, between 4 and 7, between 5 and 15, between 5 and 10, between 8 and 15, between 8 and 12, between 10 and 15, or between 10 and 12.

[0532] 93. The immunogenic conjugate of any one of embodiments 79 to 91, wherein the degree of conjugation of the immunogenic conjugate is between 4 and 7.

[0533] 94. An immunogenic conjugate comprising a Streptococcus pneumoniae serotype 33F polysaccharide covalently linked to a carrier protein, obtainable by the method of any one of embodiments 49 to 66.

[0534] 95. An immunogenic conjugate comprising a polysaccharide of Streptococcus pneumoniae serotype 33F covalently linked to a carrier protein, obtainable by the method of any one of embodiments 49 to 66.

[0535] 96. The immunogenic conjugate of embodiment 94 or 95, wherein the conjugate comprises at least 0.5 mM, 0.6 mM or 0.7 mM acetate per mM serotype 33F polysaccharide.

[0536] 97. The immunogenic conjugate of embodiment 94 or 95, wherein the ratio of mM acetate per mM serotype 33F polysaccharide in the immunogenic conjugate to mM acetate per mM serotype 33F polysaccharide in the isolated polysaccharide is at least 0.7.

[0537] 98. The immunogenic conjugate of any one of embodiments 94 to 97, wherein the ratio of mM acetate per mM serotype 33F polysaccharide in the immunogenic conjugate to mM acetate per mM serotype 33F polysaccharide in the activated polysaccharide is at least 0.7.

[0538] 99. The immunogenic conjugate of any one of embodiments 94 to 98, wherein the conjugate has a molecular weight of between 500 kDa and 30,000 kDa, between 500 kDa and 25,000 kDa, between 500 kDa and 20,000 kDa, between 500 kDa and 15,000 kDa, between 500 kDa and 10,000 kDa, between 1,000 kDa and 10,000 kDa, between 1,000 kDa and 8,000 kDa, between 1,000 kDa and 5,000 kDa, between 2,000 kDa and 10,000 kDa, between 2,000 kDa and 8,000 kDa, or between 2,000 kDa and 5,000 kDa.

[0539] 100. The immunogenic conjugate of any one of embodiments 94 to 98, wherein the conjugate has a molecular weight of between 1000 kDa and 5000 kDa.

[0540] 101. The immunogenic conjugate of any one of embodiments 94 to 100, wherein the conjugate contains less than about 50%, 45%, 40%, 35%, 30%, 25%, 20% or 15% free serotype 33F polysaccharide compared to the total amount of serotype 33F polysaccharide.

[0541] 102. The immunogenic conjugate of any one of embodiments 94 to 100, wherein the conjugate comprises less than about 20% of free serotype 22F polysaccharide compared to the total amount of serotype 22F polysaccharide.

[0542] 103. The immunogenic conjugate of any one of embodiments 94 to 102, wherein the ratio of serotype 33F polysaccharide to carrier protein in the conjugate is between 0.5 and 2.

[0543] 104. The immunogenic conjugate of any one of embodiments 94 to 102, wherein the ratio of serotype 22F polysaccharide to carrier protein in the conjugate is between 0.5 and 1.5.

[0544] 105. The immunogenic conjugate of any one of embodiments 94 to 104, wherein at least 40% of said immunogenic conjugates have a Kd lower than or equal to 0.3 in a CL-4B column.

[0545] 106. The immunogenic conjugate of any one of embodiments 94 to 104, wherein between 40% and 80% of said serotype 33F immunogenic conjugates have a Kd less than or equal to 0.3 in a CL-4B column.

[0546] 107. The immunogenic conjugate of any one of embodiments 94 to 106, wherein the degree of conjugation of the immunogenic conjugate is between 2 and 15, between 2 and 13, between 2 and 10, between 2 and 8, between 2 and 6, between 2 and 5, between 2 and 4, between 3 and 15, between 3 and 13, between 3 and 10, between 3 and 8, between 3 and 6, between 3 and 5, between 3 and 4, between 5 and 15, between 5 and 10, between 8 and 15, between 8 and 12, between 10 and 15, or between 10 and 12.

[0547] 108. The immunogenic conjugate of any one of embodiments 94 to 106, wherein the degree of conjugation of the immunogenic conjugate is between 4 and 6.

[0548] 109. The immunogenic conjugate of any one of embodiments 67 to 108, wherein the carrier protein is CRM 197 .

[0549] 110. The method of any one of embodiments 49 to 66, wherein the carrier protein is CRM 197 .

[0550] 111. The method of any one of embodiments 49 to 66, wherein the activated polysaccharide is serotype 10A.

[0551] 112. The method of any one of embodiments 49 to 66, wherein the activated polysaccharide is serotype 22F.

[0552] 113. The method of any one of embodiments 49 to 66, wherein the activated polysaccharide is serotype 33F.

[0553] 114. The method of any one of embodiments 49 to 66 and 110 to 113, wherein the method further comprises the step of formulating the conjugate in a multivalent vaccine.

[0554] 115. An immunogenic composition comprising the immunogenic conjugate of any one of embodiments 67 to 109 and a physiologically acceptable vehicle.

[0555] 116. The immunogenic composition of embodiment 115, further comprising at least one additional antigen.

[0556] 117. The immunogenic composition of embodiment 115 or 116, further comprising an adjuvant.

[0557] 118. The immunogenic composition of embodiment 117, wherein the adjuvant is aluminum phosphate.

[0558] 119. A vaccine comprising the immunogenic composition of any one of embodiments 115 to 118.

[0559] 120. A method of treating or preventing a S. pneumoniae infection, disease, or condition associated with serotype 10A, 22F, or 33F S. pneumoniae in a subject, the method comprising the step of administering a therapeutically or prophylactically effective amount of the immunogenic composition of any one of embodiments 115 to 118 or the vaccine of embodiment 119.

Claims

1. A method for preparing activated Streptococcus pneumoniae serotype 10A, 22F or 33F capsular polysaccharide, the method comprising the following steps: (a) reacting an isolated serotype 10A, 22F or 33F capsular polysaccharide with an oxidizing agent; and (b) quenching the oxidation reaction by adding a quencher, thereby producing activated Streptococcus pneumoniae serotype 10A, 22F or 33F capsular polysaccharide.

2. The method according to claim 1, wherein the concentration of serotype 10A, 22F or 33F capsular polysaccharide in step (a) is between 0.5 and 5 mg / mL.

3. The method of claim 1 or 2, wherein in step (a), the capsular polysaccharide is reacted with 0.01-10, 0.05-5, 0.1-1, 0.5-1, 0.7-0.8, 0.01-0.2, 0.05-0.5, 0.05-0.2, 0.1-0.3 molar equivalents of an oxidant.

4. The method according to any one of claims 1 to 3, wherein the oxidizing agent is periodate.

5. The method according to any one of claims 1 to 4, wherein the reaction temperature in step (a) is maintained between 1 and 10°C.

6. The method according to any one of claims 1 to 5, wherein the quencher is selected from the group consisting of glycerol, ethylene glycol, propylene-1,2-diol, butane-1,2-diol, and butane-2,3-diol.

7. The method according to any one of claims 1 to 6, wherein the oxidation reaction is quenched by adding 0.1 to 10, 0.5 to 5, 0.5 to 3 or 0.5 to 2 molar equivalents of a quencher.

8. The method according to any one of claims 1 to 7, wherein the reaction temperature in step (b) is maintained between 1 and 10°C.

9. The method according to any one of claims 1 to 8, wherein the activated capsular polysaccharide is purified after step (b).

10. Activated Streptococcus pneumoniae serotype 10A capsular polysaccharide obtained by the method according to any one of claims 1 to 9.

11. A method for preparing an immunogenic conjugate comprising a capsular polysaccharide of Streptococcus pneumoniae serotype 10A, 22F or 33F covalently linked to a carrier protein, the method comprising the steps of: (a) mixing an activated serotype 10A, 22F or 33F capsular polysaccharide obtained or obtainable by the method of any one of claims 1 to 9 with a carrier protein; and, (b) reacting the mixed, activated serotype 10A, 22F or 33F capsular polysaccharide and carrier protein with a reducing agent to form a serotype 10A, 22F or 33F capsular polysaccharide:carrier protein conjugate.

12. The method of claim 11, wherein steps (a) and (b) are performed in DMSO.

13. The method of claim 11, wherein steps (a) and (b) are performed in an aqueous solution.

14. The method according to any one of claims 11 to 13, wherein the concentration of the activated capsular polysaccharide in step (b) is between 0.1 and 10 mg / mL, 0.5 and 5 mg / mL, or 0.5 and 2 mg / mL.

15. The method according to any one of claims 11 to 14, wherein the initial ratio of activated serotype 10A, 22F or 33F capsular polysaccharide to carrier protein is 5:1 to 0.1:1, 2:1 to 0.1:1, 2:1 to 1:1, 1.5:1 to 1:1, 0.1:1 to 1:1, 0.3:1 to 1:1 or 0.6:1 to 1.2:

1.

16. The method according to any one of claims 11 to 15, wherein the reducing agent is sodium cyanoborohydride.

17. The method according to any one of claims 11 to 16, further comprising the step of purifying the capsular polysaccharide:carrier protein conjugate.

18. An immunogenic conjugate comprising a capsular polysaccharide of Streptococcus pneumoniae serotype 10A, 22F or 33F obtained by the method of any one of claims 11 to 17 covalently linked to a carrier protein.

19. An immunogenic composition comprising the immunogenic conjugate according to claim 18 and a physiologically acceptable carrier.

Images