A method for agrobacterium-mediated genetic transformation of 'bengdu No.1' hybrid pennisetum

Abstract

The application discloses a kind of agrobacterium-mediated'Bond No. 1'hybrid pennisetum genetic transformation method. The method comprises the following steps: using maltose solution containing glutamine to pretreat hybrid pennisetum embryonic callus;Agrobacterium resuspension solution containing the vector of target gene is used to infect pretreated callus;The callus after infection is inoculated into co-culture medium, recovery medium, screening medium, differentiation medium and rooting medium in sequence for culture, and regeneration transformation plant is obtained. The application successfully establishes agrobacterium-mediated'Bond No. 1'hybrid pennisetum genetic transformation system, and the positive rate can reach 62%, and'Bond No. 1'hybrid pennisetum efficient and stable genetic transformation is first effectively realized, and the analysis of hybrid pennisetum gene function research and the excavation of key candidate gene are laid the foundation for hybrid pennisetum molecular breeding.

Description

Technical Field

[0001] This invention belongs to the fields of plant tissue culture technology and biotechnology, specifically relating to an Agrobacterium-mediated genetic transformation method for 'Bande 1' hybrid Napier grass. Background Technology

[0002] Hybrid Napier grass thrives in warm, humid climates, exhibits strong resistance to adverse conditions, and is not particular about soil type, allowing it to be planted in various soil conditions. It is cultivated throughout my country, but primarily in Guangdong, Guangxi, Fujian, Jiangxi, Jiangsu, and Zhejiang provinces. Hybrid Napier grass inherits the high yield of its parent, elephant grass, and the palatability of American Napier grass. As a C4 plant, it possesses high light energy potential and high photosynthetic efficiency, exhibiting advantages such as rapid growth, high biomass, and rich nutrition.

[0003] 'Bangde No. 1' hybrid Napier grass is a triploid hybrid of American Napier grass and elephant grass. It is a perennial warm-season forage grass that can grow to over 3 meters tall. It does not flower and produce seeds, has many leaves, and is high in crude protein and water-soluble compounds, making it suitable for fresh fodder and silage. As a high-yield and high-quality forage grass that is currently being vigorously promoted, various research institutes and enterprises in my country have gradually carried out tissue culture technology research on hybrid Napier grass varieties in recent years. However, for 'Bangde No. 1' hybrid Napier grass, there are currently no reports on its genetic transformation methods. Summary of the Invention

[0004] The technical problem to be solved by this invention is how to achieve the genetic transformation of 'Bangde No. 1' hybrid Napier grass.

[0005] To address the aforementioned technical problems, this invention first provides a genetic transformation method for hybrid Napier grass.

[0006] The genetic transformation method for hybrid Napier grass provided by this invention includes the following steps:

[0007] 1) Hybrid Napier embryogenic callus was pretreated with a solution containing glutamine and maltose to obtain pretreated callus;

[0008] 2) Infect the pretreated callus with Agrobacterium resuspension containing the target gene to obtain infected callus;

[0009] 3) The infected callus tissue was inoculated into a co-culture medium for culture to obtain co-cultured callus tissue; the co-culture medium contained maltose, 2,4-D, 6-BA, proline, acetylsuccinone and glutamine;

[0010] 4) The co-cultured callus is inoculated into a recovery culture medium for further culture to obtain recovered callus; the recovery culture medium contains maltose, 2,4-D, 6-BA, proline and termethin;

[0011] 5) The recovered callus tissue was inoculated into a selection medium for culture to obtain resistant callus tissue; the selection medium contained maltose, 2,4-D, 6-BA, proline and termethin;

[0012] 6) The resistant callus tissue was inoculated into a differentiation medium for culture to obtain regenerated seedlings; the differentiation medium contained maltose, 6-BA, NAA and termethin;

[0013] 7) The regenerated seedlings are cultured in a rooting medium to obtain regenerated transformed plants; the rooting medium contains maltose and termethin.

[0014] In the above method, in step 1), the solution containing glutamine and maltose is a solution obtained by mixing glutamine, maltose and water.

[0015] The concentration of glutamine in the solution containing glutamine and maltose is 200-300 μmol·L. -1 ;

[0016] The maltose in the solution containing glutamine and maltose has a mass fraction (volume fraction) of 2-3%.

[0017] In the above method, in step 1), the pretreatment can be performed by immersing the sample in a room temperature (e.g., 20-25℃) or ice bath (0℃) for 20-25 minutes.

[0018] In some implementations, the pretreatment is performed by immersion at 25°C for 20 minutes.

[0019] In some implementations, the pretreatment is performed by immersion at 0°C for 20 minutes.

[0020] The above method for preparing hybrid Napier grass embryogenic callus includes the following steps: culturing hybrid Napier grass seeds in a callus induction medium; the callus induction medium contains maltose, 2,4-D and 6-BA.

[0021] Furthermore, the concentration of maltose in the callus induction medium can be 29-30 g / L, specifically 30 g / L.

[0022] The concentration of 2,4-D in the callus induction medium can be 3-5 mg / L, specifically 3 mg / L.

[0023] The concentration of 6-BA in the callus induction medium can be 0.5-2 mg / L, specifically 1 mg / L.

[0024] In some embodiments, the callus induction culture medium consists of a solute and a solvent, the solvent being double-distilled water, and the solute and its concentration being: MS inorganic salt and vitamin mixture 4.43 g / L, maltose 30 g / L, 2,4-D 3 mg / L, 6-BA 1 mg / L, and agar 8 g / L.

[0025] Furthermore, the culture conditions can be 25±2℃, cultured in the dark for 14-21 days.

[0026] Furthermore, the hybrid Napier grass seeds also include a sterilization process before inoculation.

[0027] In some implementations, the disinfection method includes the following steps: selecting seeds with a glossy appearance and relatively uniform size, placing them in centrifuge tubes, rinsing them with tap water for 30 minutes to remove dust and impurities from the seed surface; then disinfecting the centrifuge tubes with 75% ethanol and placing them in a clean bench, subsequently immersing the seeds in a 75% ethanol solution for 30 seconds, removing them and rinsing them five times with sterile water to remove residual ethanol; then immersing the rinsed seeds in a 7.5% sodium hypochlorite solution with two drops of Tween 20 for 20 minutes, removing them and rinsing them five times with sterile water to remove residual disinfectant; finally, placing the disinfected seeds on sterile filter paper to air dry.

[0028] The above method further includes the step of culturing the hybrid Napier embryogenic callus in a callus subculture medium; the callus subculture medium contains maltose, 2,4-D, 6-BA and proline.

[0029] Furthermore, the concentration of maltose in the callus subculture medium can be 29-30 g / L, specifically 30 g / L.

[0030] The concentration of 2,4-D in the callus subculture medium can be 3-5 mg / L, specifically 3 mg / L.

[0031] The concentration of 6-BA in the callus subculture medium can be 0.5-2 mg / L, specifically 1 mg / L.

[0032] The concentration of proline in the callus subculture medium can be 0.5-2 mg / L, specifically 2 g / L.

[0033] Furthermore, the callus subculture medium consists of a solute and a solvent, with double-distilled water as the solvent. The solute and its concentration are as follows: MS inorganic salt and vitamin mixture 4.43 g / L, maltose 30 g / L, 2,4-D 3 mg / L, 6-BA 1 mg / L, proline 2 g / L, and agar 8 g / L.

[0034] In the above method, in step 2), the Agrobacterium is Agrobacterium EHA105.

[0035] In the above method, step 2) involves the preparation of the Agrobacterium resuspension containing the vector of the target gene, which includes the following steps:

[0036] 2-1) Agrobacterium containing the target gene vector was inoculated into YEP liquid medium and cultured until OD... 600nm Centrifuge after the value is 0.8-1.0, discard the supernatant, and collect the bacterial cells;

[0037] 2-2) Resuspend the bacterial cells in the infection solution to OD. 600nm After the value was 0.8, acetosyringone was added, and the mixture was shaken and cultured. Then glutamine was added to obtain the Agrobacterium resuspension containing the vector of the target gene.

[0038] In step 2-1) above, the YEP liquid culture medium consists of a solvent and a solute. The solvent is double-distilled water, and the solute and its concentration are as follows: yeast extract 10g / L, trypsin 10g / L, sodium chloride 5g / L, rifampin 50mg / L, and kanamycin 100mg / L.

[0039] In step 2-2) above, the infection solution consists of a solute and a solvent. The solvent is double-distilled water, and the solute and its concentration are as follows: MS inorganic salt and vitamin mixture 4.43 g / L, maltose 30 g / L, 2,4-D 3 mg / L, 6-BA 1 mg / L, and proline 2 g / L.

[0040] In step 2-2) above, the concentration of acetylsuccinone in the Agrobacterium resuspension containing the vector of the target gene can be 50-150 μmol·L⁻¹. -1 Specifically, it can be 150 μmol·L -1 .

[0041] The concentration of glutamine in the Agrobacterium resuspension containing the vector of the target gene can be 200-300 μmol·L⁻¹. -1 Specifically, it can be 300 μmol·L -1 .

[0042] Before step 2-1), the above procedure also includes inoculating Agrobacterium containing the target gene vector onto YEP solid medium for cultivation. The cultivation conditions can be dark incubation at 28°C for 36-48 hours. The YEP solid medium consists of a solvent and a solute. The solvent is double-distilled water, and the solute and its concentration are as follows: yeast extract 10 g / L, trypsin 10 g / L, sodium chloride 5 g / L, rifampin 50 mg / L, kanamycin 100 mg / L, and agar 15 g / L.

[0043] In the above method, in step 2), the infection conditions can be (-1)-(-0.8) MPa vacuum for 10-20 min, followed by gentle shaking culture at 28℃ for 20-30 min, specifically (-0.8 MPa) vacuum for 10 min, followed by gentle shaking culture at 28℃ for 30 min.

[0044] In the above method, in step 3), the concentration of maltose in the co-culture medium can be 29-30 g / L, specifically 30 g / L.

[0045] The concentration of 2,4-D in the co-culture medium can be 3-5 mg / L, specifically 3 mg / L.

[0046] The concentration of 6-BA in the co-culture medium can be 0.5-2 mg / L, specifically 1 mg / L.

[0047] The concentration of proline in the co-culture medium can be 0.5-2 mg / L, specifically 2 g / L.

[0048] The concentration of acetylsuccione in the co-culture medium can be 50-150 μmol·L⁻¹ -1 Specifically, it can be 150 μmol·L -1 .

[0049] The concentration of glutamine in the co-culture medium can be 200-300 μmol·L⁻¹ -1 Specifically, it can be 300 μmol·L -1 .

[0050] In some embodiments, the co-culture medium consists of a solute and a solvent, the solvent being double-distilled water, and the solute and its concentration are as follows: MS inorganic salt and vitamin mixture 4.43 g / L, maltose 30 g / L, 2,4-D 3 mg / L, 6-BA 1 mg / L, proline 2 g / L, and acetylsylgenone 150 μmol·L. -1 Glutamine 300 μmol·L -1 .

[0051] In the above method, in step 4), the concentration of maltose in the recovery culture medium can be 29-30 g / L, specifically 30 g / L.

[0052] The concentration of 2,4-D in the recovery culture medium can be 3-5 mg / L, specifically 3 mg / L.

[0053] The concentration of 6-BA in the recovery medium can be 0.5-2 mg / L, specifically 1 mg / L.

[0054] The concentration of proline in the recovery medium can be 0.5-2 mg / L, specifically 2 g / L.

[0055] The concentration of termethin in the recovery culture medium can be 250-300 μmol·L⁻¹. -1 Specifically, it can be 250 μmol·L -1 .

[0056] In some embodiments, the recovery culture medium consists of a solute and a solvent, the solvent being double-distilled water, and the solute and its concentration being: MS inorganic salt and vitamin mixture 4.43 g / L, maltose 30 g / L, 2,4-D 3 mg / L, 6-BA 1 mg / L, proline 2 g / L, termethin 250 mg / L, and agar 8 g / L.

[0057] In the above method, in step 5), the concentration of maltose in the screening medium can be 29-30 g / L, specifically 30 g / L.

[0058] The concentration of 2,4-D in the screening medium can be 3-5 mg / L, specifically 3 mg / L.

[0059] The concentration of 6-BA in the screening medium can be 0.5-2 mg / L, specifically 1 mg / L.

[0060] The concentration of proline in the screening medium can be 0.5-2 mg / L, specifically 2 g / L.

[0061] The concentration of termethin in the screening medium can be 150-250 μmol·L⁻¹. -1 Specifically, it can be 150 μmol·L -1 .

[0062] In some embodiments, the screening medium consists of a solute and a solvent, the solvent being double-distilled water, and the solute and its concentration are as follows: MS inorganic salt and vitamin mixture 4.43 g / L, maltose 30 g / L, 2,4-D 3 mg / L, 6-BA 1 mg / L, proline 2 g / L, agar 8 g / L, termethin 150 mg / L, and screening agent (such as hygromycin) 10 mg / L.

[0063] In the above method, in step 6), the concentration of maltose in the differentiation medium can be 29-30 g / L, specifically 30 g / L.

[0064] The concentration of 6-BA in the differentiation medium can be 1-3 mg / L, specifically 3 mg / L.

[0065] The concentration of NAA in the differentiation medium can be 0.3-1 mg / L, specifically 1 mg / L.

[0066] The concentration of termethin in the differentiation medium can be 150-250 μmol·L⁻¹. -1 Specifically, it can be 150 μmol·L -1 .

[0067] In some embodiments, the differentiation medium consists of a solute and a solvent, the solvent being double-distilled water, and the solute and its concentration being: MS inorganic salt and vitamin mixture 4.43 g / L, maltose 30 g / L, 6-BA 3 mg / L, NAA 1 mg / L, agar 8 g / L, termethin 150 mg / L, and screening agent (such as hygromycin) 5 mg / L.

[0068] In the above method, in step 7), the concentration of maltose in the rooting medium can be 14-15 g / L, specifically 15 g / L.

[0069] The concentration of termethin in the rooting medium can be 150-250 μmol·L⁻¹. -1 Specifically, it can be 150 μmol·L -1 .

[0070] In some embodiments, the rooting medium consists of a solute and a solvent, the solvent being double-distilled water, and the solute and its concentration being: MS inorganic salt and vitamin mixture 2.215 g / L, maltose 15 g / L, agar 8 g / L, termethin 150 mg / L and screening agent (such as hygromycin) 5 mg / L.

[0071] In the above method, in step 3), the culture conditions can be dark culture at 25℃±2℃ for 2-3 days.

[0072] In the above method, in step 4), the culture conditions can be dark culture at 25℃±2℃ for 7-10 days.

[0073] In the above method, in step 5), the culture conditions can be dark culture at 25℃±2℃ for 14-28 days.

[0074] In the above method, in step 6), the culture conditions can be 25℃±2℃, and the light cycle is 16h white light / 8h darkness for 14-28 days.

[0075] In the above method, in step 7), the culture conditions can be 25℃±2℃, and the light cycle is 16h white light / 8h darkness for 14-28 days.

[0076] In the above method, the pH value of both the infection solution and the co-culture medium is 5.4.

[0077] The pH value of the callus induction medium, the callus subculture medium, the recovery medium, the screening medium, the differentiation medium, and the rooting medium is all 5.8.

[0078] The pH value of the YEP liquid culture medium is 7.0.

[0079] The target gene mentioned above can be an endogenous plant gene (such as the ZmRR1 gene or the Pal04G016300 gene) or an exogenous gene (such as the GUS gene).

[0080] The vectors mentioned above can be plasmids, bacteriophages (such as λ phage or M13 filamentous phage), granules (i.e., Cos plasmids), Ti plasmids, or viral vectors (such as retroviruses (including lentiviruses), adenoviruses, adeno-associated viruses, etc.).

[0081] In some embodiments, the vector containing the target gene is a GUS overexpression vector. The GUS overexpression vector is obtained by replacing the fragment between the AsciI and PmeI restriction sites in the pMDC162 vector with the pZmUBI promoter (sequence 1).

[0082] In some embodiments, the vector containing the target gene is a ZmRR1 overexpression vector. The ZmRR1 overexpression vector is a vector obtained by ligating the ZmRR1 gene (sequence 2) into the pCM1307 vector.

[0083] In some embodiments, the vector containing the target gene is a *Pal04G016300* overexpression vector. The *Pal04G016300* overexpression vector is obtained by ligating the *Pal04G016300* gene (sequence 3) into the pMDC32 vector between the attR1 and attR2 sites.

[0084] To address the aforementioned technical problems, this invention also provides a complete set of reagents for the genetic transformation of hybrid Napier grass.

[0085] The complete set of reagents for genetic transformation of hybrid Napier grass provided by the present invention includes the above-mentioned solution containing glutamine and maltose, the above-mentioned callus induction culture medium, the above-mentioned callus subculture culture medium, the above-mentioned infection solution, the above-mentioned co-culture culture medium, the above-mentioned recovery culture medium, the above-mentioned screening culture medium, the above-mentioned differentiation culture medium and the above-mentioned rooting culture medium.

[0086] Furthermore, the complete set of reagents also includes the aforementioned inoculum.

[0087] Furthermore, the complete reagent kit also includes the aforementioned YEP liquid culture medium and the aforementioned YEP solid culture medium.

[0088] To address the aforementioned technical problems, the present invention also provides new uses for the aforementioned complete set of reagents.

[0089] This invention provides the application of the above-described reagent kit in any one of the following X1)-X4):

[0090] X1) Genetic transformation of hybrid Napier grass;

[0091] X2) Prepare genetically transformed products of hybrid Napier grass;

[0092] X3) Hybrid Napier grass tissue culture;

[0093] X4) Prepare products from tissue culture of hybrid Napier grass.

[0094] The hybrid Napier grass mentioned above is 'Bande No. 1' hybrid Napier grass.

[0095] This invention successfully established an Agrobacterium-mediated genetic transformation system for 'Bande 1' hybrid Napier grass, obtaining positive plants with a positive rate of up to 62%. This is the first time that efficient and stable genetic transformation of 'Bande 1' hybrid Napier grass has been effectively achieved, laying the foundation for the analysis of hybrid Napier grass gene function, the discovery of key candidate genes, and molecular breeding of hybrid Napier grass. Attached Figure Description

[0096] Figure 1 The color development of the GUS gene in callus tissue after infection with different Agrobacterium strains.

[0097] Figure 2 The color development of callus tissue after infection with Agrobacterium tumefaciens at different concentrations for the GUS gene.

[0098] Figure 3 The effect of different concentrations of bacterial solution infection on the subsequent growth of callus tissue.

[0099] Figure 4 The color development of the GUS gene in callus tissue after infection with bacterial suspensions containing different amounts of AS.

[0100] Figure 5 The staining of callus tissue after infection with the GUS gene using different methods.

[0101] Figure 6 This describes the genetic transformation process of the Agrobacterium-mediated GUS overexpression vector.

[0102] Figure 7 To detect the DNA level in GUS-overexpressing plants.

[0103] Figure 8 This describes the genetic transformation process of the ZmRR1 overexpression vector mediated by Agrobacterium.

[0104] Figure 9 To detect the DNA level in plants overexpressing ZmRR1.

[0105] Figure 10 This describes the genetic transformation process of the Agrobacterium-mediated Pal04G016300 overexpression vector.

[0106] Figure 11 DNA level detection in plants overexpressing Pal04G016300. Detailed Implementation

[0107] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0108] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0109] The 'Bangde No. 1' hybrid Napier grass in the following examples is described in the literature "Zhang Huaishan, Qiao Guohua, Wang Chunmei, et al. Study on the main characteristics and ecological adaptability of new cultivated Napier grass varieties [J]. Herbivores, 2010(3):50-54."

[0110] The MS inorganic salt and vitamin mixture in the following examples is a PhytoTech product, catalog number M519.

[0111] The yeast extract used in the following examples is a product of Sangon Biotech, catalog number #A515245.

[0112] The trypsinized peptone in the following examples is a bioengineered product with catalog number #A505250.

[0113] The pCM1307 vector in the following examples is described in the literature “Zeng, R., et al. Natural variation in a type-Aresponse regulator confers maize chilling tolerance. NatCommun. 2021:12(1):4713.”.

[0114] The pMDC162 vector and pMDC162 vector in the following examples are described in the literature "Tvorogova, Varvara E., et al. The WUSCHEL-related homeobox transcription factor MtWOX9-1 stimulates somatic embryogenesis in Medicago truncatula."

[0115] Example 1: Culture medium used for genetic transformation of 'Bangde No. 1' hybrid Napier grass

[0116] I. Callus induction and subculture culture medium

[0117] The callus induction medium of this invention for inducing callus in 'Bangde No. 1' hybrid Napier grass consists of solute and solvent. The solvent is double-distilled water, and the solute and its concentration are as follows: MS inorganic salt and vitamin mixture 4.43 g / L, maltose 30 g / L, 2,4-D 3 mg / L, 6-BA 1 mg / L, and agar 8 g / L. The pH of the callus induction medium is 5.8.

[0118] The callus subculture medium of this invention for the subculturing of 'Bangde No. 1' hybrid Napier grass callus consists of solute and solvent. The solvent is double-distilled water, and the solute and its concentration are as follows: MS inorganic salt and vitamin mixture 4.43 g / L, maltose 30 g / L, 2,4-D 3 mg / L, 6-BA 1 mg / L, proline 2 g / L, and agar 8 g / L. The pH value of the callus subculturing medium is 5.8.

[0119] II. Agrobacterium activating culture medium

[0120] The culture media for Agrobacterium activation in this invention include YEP solid medium and YEP liquid medium.

[0121] The preparation method of YEP solid medium is as follows: Yeast extract, trypsin, sodium chloride, and agar are mixed with double-distilled water to achieve the following concentrations: yeast extract 10 g / L, trypsin 10 g / L, sodium chloride 5 g / L, and agar 15 g / L. The mixture is sterilized at 121°C for 15 minutes. When the medium cools to 50°C, rifampin and kanamycin are added to concentrations of 50 mg / L and 100 mg / L, respectively, to obtain YEP solid medium. The pH value of YEP solid medium is 7.0.

[0122] The preparation method of YEP liquid medium is as follows: Yeast extract, trypsin, sodium chloride, and double-distilled water are mixed to obtain the following concentrations: yeast extract 10 g / L, trypsin 10 g / L, and sodium chloride 5 g / L. The mixture is sterilized at 121℃ for 15 min. When the medium cools to 50℃, rifampin and kanamycin are added to concentrations of 50 mg / L and 100 mg / L, respectively, to obtain YEP liquid medium. The pH of YEP liquid medium is 7.0.

[0123] III. Infection, Co-culture, and Recovery Culture Media

[0124] The preparation method of the infection solution of this invention is as follows: The agar in the callus subculture medium from step one is removed, and the medium is autoclaved at 121°C for 15 minutes to obtain the infection solution. The pH value of the infection solution is 5.4.

[0125] The preparation method of the co-culture medium of this invention is as follows: Remove the agar from the callus subculture medium in step one, autoclave at 121℃ for 15 min, and set aside. Before use, add acetosyringone and glutamine to make the concentrations of acetosyringone and glutamine 150 μmol·L⁻¹, respectively. -1 300 μmol·L -1 The co-culture medium was obtained. The pH value of the co-culture medium was 5.4.

[0126] The preparation method of the recovery culture medium of the present invention is as follows: the callus subculture medium in step one is autoclaved at 121°C for 15 min, cooled to 50°C, and termethin is added to make its concentration 250 mg / L to obtain the recovery culture medium. The pH value of the recovery culture medium is 5.8.

[0127] IV. Screening Culture Media

[0128] The preparation method of the screening medium for screening callus of 'Bangde No. 1' hybrid Napier grass is as follows: The callus subculture medium in step one is autoclaved at 121°C for 15 minutes. When cooled to 50°C, hygromycin and termethin are added to make the concentrations of hygromycin and termethin 10 mg / L and 150 mg / L, respectively, to obtain the screening medium. The pH value of the screening medium is 5.8.

[0129] V. Differentiation Culture Medium

[0130] The preparation method of the differentiation medium for the differentiation of 'Bangde No. 1' hybrid Napier grass seedlings is as follows: MS inorganic salt and vitamin mixture, maltose, 6-BA, NAA, agar, and double-distilled water are mixed to achieve the following concentrations: MS inorganic salt and vitamin mixture 4.43 g / L, maltose 30 g / L, 6-BA 3 mg / L, NAA 1 mg / L, and agar 8 g / L, respectively. The mixture is then autoclaved at 121℃ for 15 min. After cooling to 50℃, hygromycin and termetin are added to achieve concentrations of 5 mg / L and 150 mg / L, respectively, to obtain the differentiation medium. The pH of the differentiation medium is 5.8.

[0131] VI. Rooting Culture Medium

[0132] The rooting medium for 'Bangde No. 1' hybrid Napier grass, as described in this invention, consists of a solute and a solvent. The solvent is double-distilled water. The solute and its concentration are as follows: MS inorganic salt and vitamin mixture 2.215 g / L, maltose 15 g / L, and agar 8 g / L. The medium is autoclaved at 121°C for 15 min, and then cooled to 50°C. Hygromycin and termetin are added to achieve concentrations of 5 mg / L and 150 mg / L, respectively, to obtain the rooting medium. The pH of the rooting medium is 5.8.

[0133] Example 2: Establishment and optimization of Agrobacterium-mediated genetic transformation system for 'Bande 1' hybrid Napier grass callus.

[0134] I. Induction and Subculture of Callus

[0135] 1. Seed disinfection

[0136] Select 'Bangde No. 1' hybrid Napier grass seeds with a glossy appearance and relatively uniform size. Place them in 50mL centrifuge tubes and rinse with tap water for 30 minutes to remove dust and impurities. Then, sterilize the centrifuge tubes with 75% ethanol and place them in a clean bench. Immerse the seeds in the 75% ethanol solution for 30 seconds, then rinse five times with sterile water to remove residual ethanol. Aliquot the rinsed seeds into 15mL centrifuge tubes and sterilize them with 7.5% sodium hypochlorite solution plus two drops of Tween 20 for 20 minutes, shaking continuously during the process. After sterilization, rinse five times with sterile water to thoroughly remove any residual disinfectant. Finally, place the sterilized seeds on sterile filter paper in an empty petri dish to air dry.

[0137] 2. Induction and subculture of callus tissue

[0138] Sterilized seeds were placed on callus induction medium in a clean bench and induced to form callus tissue at 25±2℃ in the dark. After approximately 14-21 days, buds and hairy roots were removed, and water-soaked callus tissue was peeled away, leaving only the internal yellow hardened callus. Bright yellow, dense, granular embryogenic callus tissue was selected and subcultured in a subculture medium at 25±2℃ in the dark, with subculture every 14-21 days. Well-formed embryogenic callus tissue was selected as transformation recipients for genetic transformation experiments.

[0139] II. Screening of the most suitable Agrobacterium strain

[0140] 1. Preparation of Agrobacterium

[0141] The GUS overexpression vector pUBI-GUS was introduced into three Agrobacterium strains: GV2260, GV3101, and EHA105 (Shanghai Weidi Biotechnology Co., Ltd., CAT#: AC1010). Recombinant strains GV2260 / pUBI-GUS, GV3101 / pUBI-GUS, and EHA105 / pUBI-GUS were obtained after identification. The bacterial suspensions of GV2260 / pUBI-GUS, GV3101 / pUBI-GUS, and EHA105 / pUBI-GUS were streaked onto YEP solid medium and incubated in the dark at 28°C for 36-48 hours. The GUS overexpression vector pUBI-GUS was obtained by replacing the fragment between the AsciI and PmeI restriction sites in the pMDC162 vector with the pZmUBI promoter (sequence 1).

[0142] 2. Preparation of Agrobacterium resuspension

[0143] Three types of Agrobacterium were inoculated from Agrobacterium plates into YEP liquid medium and incubated overnight at 28°C with shaking until OD reached. 600nmThe concentration was set to 0.8-1.0. Centrifuge at 6000 rpm for 15 min, discard the supernatant, and collect the bacterial cells. Resuspend the bacterial cells in the infection solution (the infection solution from step three of Example 1) to OD0.0. 600nm The value was 0.8, and Agrobacterium resuspensions of three strains were obtained respectively.

[0144] 3. Infection

[0145] Embryogenic callus of 'Bangde No. 1' hybrid Napier grass was used as material, and the embryogenic callus was infected with Agrobacterium resuspension of three strains prepared in step 2. The specific steps are as follows: the embryogenic callus was transferred to a sterile tube containing Agrobacterium resuspension, placed in a vacuum pump (-0.8 MPa) for 10 min, and then gently shaken at 28℃ for 30 min.

[0146] 4. Co-culture and GUS staining

[0147] After infection, the callus tissue was dried in a clean bench and then cultured in the dark in a co-culture medium. After 3 days, GUS staining was performed. The depth of staining of the callus tissue reflected the expression of GUS, and the Agrobacterium strain most suitable for the transformation of 'Bangde No. 1' hybrid Napier grass was screened out.

[0148] The results are as follows Figure 1 As shown, Figures A and B, from left to right, show the GUS staining results of callus tissue infected with strains GV2260, GV3101, and EHA105, respectively; Figures C, D, and E show the microscopic GUS staining results of callus tissue infected with GV2260, GV3101, and EHA105, respectively. The results show that different Agrobacterium strains exhibit significant differences in their transformation effects on callus tissue. Callus tissue infected with strain EHA105 showed the most pronounced GUS staining; while callus tissue infected with strains GV3101 and GV2260 showed lighter staining, especially GV2260, which showed the worst staining. Therefore, Agrobacterium EHA105 is the most suitable Agrobacterium strain for the transformation of 'Bangde 1' hybrid Napier grass.

[0149] III. Determination of the optimal concentration of Agrobacterium tumefaciens in bacterial solution

[0150] 1. Preparation of Agrobacterium

[0151] The expression vector pUBI-GUS was introduced into Agrobacterium tumefaciens EHA105 to obtain recombinant bacteria EHA105 / pUBI-GUS containing the vector pUBI-GUS. The recombinant bacteria EHA105 / pUBI-GUS culture was streaked onto YEP solid medium and incubated in the dark at 28°C for 36-48 hours.

[0152] 2. Preparation of Agrobacterium resuspension

[0153] The recombinant bacteria EHA105 / pUBI-GUS on Agrobacterium agar plates were inoculated into YEP liquid medium and cultured overnight at 28°C with shaking until OD... 600nm The concentration was 0.8-1.0. Centrifuge at 6000 rpm for 15 min, discard the supernatant, and collect the bacterial cells. Resuspend the bacterial cells in the infection solution to OD0.0. 600nm The values ​​were 0.5, 0.8, and 1.0, respectively, to obtain three different concentrations of Agrobacterium resuspension.

[0154] 3. Infection

[0155] Embryogenic callus of 'Bande No. 1' hybrid Napier grass was used as material, and the embryogenic callus was infected with three different concentrations of Agrobacterium resuspension prepared in step 2. The embryogenic callus was transferred to a sterile tube containing Agrobacterium resuspension, placed in a vacuum pump (-0.8 MPa) for 10 min, and then gently shaken at 28°C for 30 min.

[0156] 4. Co-culture and GUS staining

[0157] After infection, the callus tissue was dried in a clean bench and then cultured in the dark in a co-culture medium. After 3 days, GUS staining was performed. The staining depth of the callus tissue reflected the expression of GUS, and the working concentration of Agrobacterium tumefaciens most suitable for the transformation of 'Bande No. 1' hybrid Napier grass was screened.

[0158] The results are as follows Figure 2 As shown in Figures A and B, from left to right, represent the bacterial concentration OD. 600nm Figures show the GUS staining results of callus tissue infected with Agrobacterium resuspension at concentrations of 0.5, 0.8, and 1.0, respectively; Figures C, D, and E show the OD values ​​of the bacterial suspension. 600nm GUS staining results under a microscope on callus tissue infected with Agrobacterium resuspension at concentrations of 0.5, 0.8, and 1.0, respectively. The results showed that at OD... 600nm Within the range of 0.5-1.0, the higher the bacterial concentration, the better the infection effect. When the bacterial concentration OD... 600nm When the concentration of the bacterial culture is 0.5, the GUS staining color is relatively light; as the bacterial culture concentration increases, the OD value of the bacterial culture increases. 600nm When the concentration was 0.8, the infection effect was significantly enhanced; the bacterial concentration was further increased to OD0.8. 600nm At 1.0, although the infection effect was significantly higher than that of the bacterial culture concentration OD, 600nm =0.5, 0.8 is better, but observation of callus growth in the later stage revealed that for hybrid Napier grass callus, when the bacterial concentration OD 600nm When the concentration of the bacterial culture solution was 0.8, the callus tissue exhibited good growth, and the resistant callus was able to differentiate into buds normally in the later stages; when the concentration of the bacterial culture solution was OD... 600nmWhen the OD value was 1.0, the callus tissue showed a significant negative reaction during subsequent culture. After 3 days of co-culture, obvious mycelia were observed on the surface of the callus tissue. Even after multiple washes with sterile water, 7 days of recovery culture containing termethin failed to effectively inhibit the growth of Agrobacterium. The callus tissue died due to over-infection and could not differentiate normally. Therefore, the OD value of the bacterial culture was... 600nm =0.8 is the optimal bacterial concentration for the transformation of 'Bangde No. 1' hybrid Napier grass.

[0159] IV. Determination of the optimal working concentration of acetylsyringone (AS)

[0160] 1. Preparation of Agrobacterium

[0161] The expression vector pUBI-GUS was introduced into Agrobacterium tumefaciens EHA105 to obtain recombinant bacteria EHA105 / pUBI-GUS containing the vector pUBI-GUS. The recombinant bacteria EHA105 / pUBI-GUS culture was streaked onto YEP solid medium and incubated in the dark at 28°C for 36-48 hours.

[0162] 2. Preparation of Agrobacterium resuspension

[0163] The recombinant bacteria EHA105 / pUBI-GUS on Agrobacterium agar plates were inoculated into YEP liquid medium and cultured overnight at 28°C with shaking until OD... 600nm The concentration was set to 0.8-1.0. Centrifuge at 6000 rpm for 15 min, discard the supernatant, and collect the bacterial cells. Resuspend the bacterial cells in the infection solution (the infection solution from step three of Example 1) to OD0.0. 600nm The value was 0.8, and then acetylsuccine (AS) was added to make the final AS concentration 50 μmol·L⁻¹. -1 100 μmol·L -1 150 μmol·L -1 Three different AS-added Agrobacterium resuspensions were obtained.

[0164] 3. Infection

[0165] Embryogenic callus of 'Bangde No. 1' hybrid Napier grass was used as material, and the embryogenic callus was infected with Agrobacterium resuspension with different AS additions prepared in step 2. The embryogenic callus was transferred to a sterile tube containing Agrobacterium resuspension, placed in a vacuum pump (-0.8 MPa) for 10 min, and then gently shaken at 28℃ for 30 min.

[0166] 4. Co-culture and GUS staining

[0167] After infection, the callus tissue was dried in a clean bench and then cultured in the dark in a co-culture medium. After 3 days, GUS staining was performed. The depth of staining of the callus tissue reflected the expression of GUS, and the optimal working concentration of acetylsyleugenol (AS) for the transformation of 'Bangde No. 1' hybrid Napier grass was screened.

[0168] The results are as follows Figure 4 As shown in Figures A and B, from left to right, represent AS addition amounts of 50 μmol·L⁻¹. -1 100 μmol·L -1 150 μmol·L -1 GUS staining results of infected callus tissue; Figures C, D, and E show the results when AS was added at a concentration of 50 μmol·L⁻¹. -1 100 μmol·L -1 150 μmol·L -1 The results of GUS staining of infected callus tissue under a microscope. The results showed that the addition of AS significantly affected the transformation efficiency of hybrid Napier grass, with the AS concentration reaching 50 μmol·L⁻¹. -1 At that time, the staining rate of the callus tissue was low, and the GUS color development was poor, indicating that this concentration had a limited effect on improving the transformation efficiency; when the AS concentration was increased to 100 μmol·L... -1 At that concentration, the colorimetric intensity of GUS increased, indicating that this concentration could promote the conversion to some extent; while when the amount of AS added was 150 μmol·L⁻¹, the colorimetric intensity of GUS increased. -1 At that time, the GUS colorimetric intensity was between 50-150 μmol·L⁻¹. -1 It exhibits the strongest effect within the specified range, significantly improving the conversion efficiency. Based on these results, the optimal AS addition amount is 150 μmol·L⁻¹. -1 It is the most suitable AS working concentration for the transformation of 'Bande No. 1' hybrid Napier grass.

[0169] V. Determining the Most Suitable Method of Infection

[0170] 1. Preparation of Agrobacterium

[0171] The expression vector pUBI-GUS was introduced into Agrobacterium tumefaciens EHA105 to obtain recombinant bacteria EHA105 / pUBI-GUS containing the vector pUBI-GUS. The recombinant bacteria EHA105 / pUBI-GUS culture was streaked onto YEP solid medium and incubated in the dark at 28°C for 36-48 hours.

[0172] 2. Preparation of Agrobacterium resuspension

[0173] The recombinant bacteria EHA105 / pUBI-GUS on Agrobacterium agar plates were inoculated into YEP liquid medium and cultured overnight at 28°C with shaking until OD... 600nmThe concentration was 0.8-1.0. Centrifuge at 6000 rpm for 15 min, discard the supernatant, and collect the bacterial cells. Resuspend the bacterial cells in the infection solution to OD0.0. 600nm The value was 0.8, and Agrobacterium resuspension was obtained.

[0174] 3. Infection

[0175] Embryogenic callus from the 'Bande 1' hybrid Napier grass was used as material, and the Agrobacterium resuspension prepared in step 2 was used to infect the embryogenic callus. The embryogenic callus was transferred to a sterile tube containing the Agrobacterium resuspension, and the callus was infected using the following three different methods:

[0176] Method 1: Before infection, the callus tissue is not treated in any way. After immersion in the infection solution, it is placed in a vacuum pump (-0.8 MPa) and vacuumed for 10 minutes. Then, it is gently shaken and cultured at 28°C for 30 minutes.

[0177] Method 2: Before callus infection, place the callus in a solution containing 300 μmol·L⁻¹ -1 Treat with an aqueous solution of glutamine and 3% maltose at room temperature (25°C) for 20 min, and perform the remaining operations as in Method 1.

[0178] Method 3: Before callus infection, place the wound in a solution containing 300 μmol·L⁻¹ -1 Treat with an aqueous solution of glutamine and 3% maltose in an ice bath (0°C) for 20 min, and perform the remaining operations as in Method 1.

[0179] 4. Co-culture and GUS staining

[0180] After infection, the callus tissue was dried in a clean bench and then cultured in the dark in a co-culture medium. After 3 days, GUS staining was performed. The depth of staining of the callus tissue reflected the expression of GUS, and the most suitable infection method for the transformation of 'Bangde No. 1' hybrid Napier grass was screened.

[0181] The results are as follows Figure 5As shown, Figures A and B, from left to right, represent the GUS staining results of callus tissue infected using Method 1, Method 2, and Method 3, respectively; Figures C, D, and E represent the GUS staining results of callus tissue infected using Method 1, Method 2, and Method 3, respectively, under a microscope. The results show that pretreatment of callus tissue before infection significantly improves the infection effect. Specifically, callus tissue treated with vacuum alone showed lighter GUS staining and poorer infection effect; however, after adding a pretreatment step before infection, the GUS staining of callus tissue treated with vacuum was significantly deepened. This indicates that, compared with vacuum alone, pretreatment of callus tissue combined with vacuum can effectively promote genetic transformation efficiency. Furthermore, Method 3 shows better results when pretreatment of callus tissue under ice bath conditions. Therefore, the introduction of pretreatment steps has a positive promoting effect on the genetic transformation of hybrid Napier grass callus tissue, and Method 3 is the most suitable infection method for the transformation of 'Bangde 1' hybrid Napier grass.

[0182] Example 3: Application of Agrobacterium-mediated genetic transformation of 'Bande 1' hybrid Napier grass callus in GUS overexpression vector genetic transformation.

[0183] The flowchart of the genetic transformation of this invention is as follows: Figure 6 As shown.

[0184] I. Preparation of Agrobacterium

[0185] The GUS overexpression vector pUBI-GUS was introduced into Agrobacterium tumefaciens EHA105, and EHA105 Agrobacterium tumefaciens containing the pUBI-GUS vector was identified. The EHA105 Agrobacterium tumefaciens containing the pUBI-GUS1 vector was streaked onto YEP solid medium and incubated in the dark at 28°C for 36-48 hours.

[0186] II. Preparation of Agrobacterium resuspension

[0187] Inoculate the Agrobacterium on the Agrobacterium plate from step one into YEP liquid medium and incubate overnight at 28°C with shaking until OD... 600nm The concentration was 0.8-1.0. Centrifuge at 6000 rpm for 15 min and discard the supernatant. Resuspend the strain in the infection solution to OD value. 600nm When the value was 0.8, acetylsyleugenol was added to make the concentration of acetylsyleugenol 150 μmol·L⁻¹. -1 After incubating with gentle shaking at 28℃ for 30 min, glutamine was added to bring the glutamine concentration to 300 μmol·L⁻¹. -1 Agrobacterium resuspension was obtained.

[0188] III. Infection

[0189] The callus tissue of 'Bande No. 1' hybrid Napier grass was transferred to a solution containing 300 μmol·L⁻¹ -1 The callus was treated in an aqueous solution of glutamine and 3% maltose at room temperature or in an ice bath for 20 min. The treated callus was then transferred to a sterile tube containing Agrobacterium resuspension, placed in a vacuum pump (-0.8 MPa) and evacuated for 10 min. The tube was then incubated at 28°C with gentle shaking for 30 min.

[0190] IV. Co-cultivation and Resumption of Cultivation

[0191] Collect the callus tissue soaked in Agrobacterium resuspension in step three into a culture dish lined with sterile filter paper. Dry the callus tissue in a laminar flow hood until any residual Agrobacterium solution on the surface is removed. Then, use sterile forceps to spread the callus tissue evenly on the co-culture medium and incubate it in a dark room at 25±2℃ for 2-3 days. After co-culture, wash the callus tissue 3-5 times with sterile water until the water is clear. Collect the callus tissue into a culture dish lined with sterile filter paper, remove excess water, and air dry it in a laminar flow hood for 1-2 hours until the surface moisture is absorbed. Transfer the callus tissue to recovery medium and incubate it in a dark room at 25±2℃ for 7-10 days.

[0192] V. Screening and Cultivation

[0193] After recovery culture, the callus tissue was transferred to the screening medium and cultured in the dark at 25±2℃ for 14-28 days to obtain resistant callus.

[0194] VI. Induction of Regenerated Seedlings

[0195] The resistant callus obtained in step 5 was inoculated into differentiation medium and cultured in a light culture room at 25±2℃ with a light cycle of 16h white light / 8h dark for 14-28 days to obtain regenerated seedlings (resistant plants).

[0196] VII. Identification of Resistant Plants

[0197] Molecular testing was performed on the regenerated seedlings (resistant plants) obtained in step six. The specific steps of the molecular testing are as follows:

[0198] DNA was extracted from the regenerated seedlings (resistant plants), and PCR amplification was performed using primers GUS-F (ACCTCGCATTACCCTTACGCTGAA) and GUS-R (ACGCGGTGATACATATCCAGCCAT). Resistant plants that amplified a band of the same size as the target band amplified from the positive plasmid were considered positive plants. Partial PCR detection results are shown below. Figure 7 Calculate the transformation and regeneration induction rate and the transformation positivity rate.

[0199] Transformation and regeneration induction rate = (total number of resistant calluses that can induce seedlings / total number of calluses that initiate transformation) × 100%.

[0200] Transformation positivity rate = (total number of plants with positive molecular identification / total number of induced seedlings) × 100%.

[0201] The statistical results of transformation and regeneration induction rate and positive rate are shown in Table 1.

[0202] Table 1. Statistical results of transformation and regeneration induction rate and positive rate

[0203]

[0204] 8. Rooting Induction

[0205] The seedlings obtained in step seven were transferred to rooting jars containing rooting medium using tweezers and cultured for 28 days in a light-culture room at 25±2℃ with a light cycle of 16h white light / 8h darkness to obtain regenerated plants. The rooting induction rate was calculated using the following formula: (Total number of seedlings that can be induced to develop roots / Total number of seedlings inoculated for the rooting test) × 100%. The rooting induction rate is shown in Table 2.

[0206] Table 2. Statistical results of rooting induction rate

[0207]

[0208] Example 4: Application of Agrobacterium-mediated genetic transformation of 'Bande 1' hybrid Napier grass callus in genetic transformation of ZmRR1 overexpression vector.

[0209] The flowchart of the genetic transformation of this invention is as follows: Figure 8 As shown.

[0210] I. Preparation of Agrobacterium

[0211] The ZmRR1 overexpression vector was introduced into *Agrobacterium tumefaciens* EHA105, and EHA105 *Agrobacterium tumefaciens* containing the ZmRR1 overexpression vector were obtained. The *Agrobacterium tumefaciens* EHA105 containing the ZmRR1 overexpression vector was streaked onto YEP solid medium and incubated in the dark at 28°C for 36-48 hours. The ZmRR1 overexpression vector was obtained by ligating the ZmRR1 gene (sequence 2) into the pCM1307 vector.

[0212] II. Preparation of Agrobacterium resuspension

[0213] Inoculate the Agrobacterium on the Agrobacterium plate from step one into YEP liquid medium and incubate overnight at 28°C with shaking until OD... 600nm The concentration was 0.8-1.0. Centrifuge at 6000 rpm for 15 min, discard the supernatant, collect the bacterial cells, and resuspend the bacterial cells in the infection solution to OD.600nm When the value was 0.8, acetylsyleugenol was added to make the concentration of acetylsyleugenol 150 μmol·L⁻¹. -1 After incubating with gentle shaking at 28℃ for 30 min, glutamine was added to bring the glutamine concentration to 300 μmol·L⁻¹. -1 Agrobacterium resuspension was obtained.

[0214] III. Infection

[0215] The callus tissue of 'Bande No. 1' hybrid Napier grass was soaked in a solution containing 300 μmol·L⁻¹ -1 The callus was treated in an aqueous solution of glutamine and 3% maltose at room temperature or in an ice bath for 20 min. The treated callus was then transferred to a sterile tube containing Agrobacterium resuspension, placed in a vacuum pump (-0.8 MPa) and evacuated for 10 min. The tube was then incubated at 28°C with gentle shaking for 30 min.

[0216] IV. Co-cultivation and Resumption of Cultivation

[0217] Collect the callus tissue soaked in Agrobacterium resuspension in step three into a culture dish lined with sterile filter paper. Dry the callus tissue in a laminar flow hood until any residual Agrobacterium solution on the surface is removed. Then, use sterile forceps to spread the callus tissue evenly on the co-culture medium and incubate it in a dark room at 25±2℃ for 2-3 days. After co-culture, wash the callus tissue 3-5 times with sterile water until the water is clear. Collect the callus tissue into a culture dish lined with sterile filter paper, remove excess water, and air dry it in a laminar flow hood for 1-2 hours until the surface moisture is absorbed. Transfer the callus tissue to recovery medium and incubate it in a dark room at 25±2℃ for 7-10 days.

[0218] V. Screening and Cultivation

[0219] After recovery culture, the callus tissue was transferred to the screening medium and cultured in the dark at 25±2℃ for 14-28 days to obtain resistant callus.

[0220] VI. Induction of Regenerated Seedlings

[0221] The resistant callus obtained in step 5 was inoculated into differentiation medium and cultured in a light culture room at 25±2℃ with a light cycle of 16h white light / 8h dark for 14-28 days to obtain regenerated seedlings (resistant plants).

[0222] VII. Identification of Resistant Plants

[0223] Molecular testing was performed on the regenerated seedlings (resistant plants) obtained in step six. The specific steps of the molecular testing are as follows:

[0224] DNA was extracted from the regenerated seedlings (resistant plants), and PCR amplification was performed using primers Ubi-F (TGATGGCCCTGCCTTCATACGCT) and ZmRR1-R (TCACCGGATCCGGCTGCAGA). Resistant plants that amplified a band of the same size as the target band amplified by the positive plasmid were considered positive plants. Partial PCR detection results are shown below. Figure 9 Calculate the transformation and regeneration induction rate and the transformation positivity rate.

[0225] Transformation and regeneration induction rate = (total number of resistant calluses that can induce seedlings / total number of calluses that initiate transformation) × 100%.

[0226] Transformation positivity rate = (total number of plants with positive molecular identification / total number of induced seedlings) × 100%.

[0227] The statistical results of transformation and regeneration induction rate and positive rate are shown in Table 3.

[0228] Table 3. Statistical results of transformation and regeneration induction rate and positive rate

[0229]

[0230] 8. Rooting Induction

[0231] The seedlings obtained in step seven were transferred to rooting jars containing rooting medium using tweezers and cultured at 25±2℃ in a light-dark cycle of 16h light / 8h darkness for 28 days to obtain regenerated plants. The rooting induction rate was calculated using the following formula: (Total number of seedlings that can be induced to develop roots / Total number of seedlings inoculated for the rooting test) × 100%. The rooting induction rate is shown in Table 4.

[0232] Table 4. Statistical results of rooting induction rate

[0233]

[0234] Example 5: Application of Agrobacterium-mediated genetic transformation of 'Bande 1' hybrid Napier grass callus in genetic transformation using Pal04G016300 overexpression vector.

[0235] The flowchart of the genetic transformation of this invention is as follows: Figure 10 As shown.

[0236] I. Preparation of Agrobacterium

[0237] The overexpression vector of the Napier gene Pal04G016300 was introduced into Agrobacterium tumefaciens EHA105. After identification, Agrobacterium tumefaciens containing the overexpression vector Pal04G016300 was obtained. The Agrobacterium tumefaciens EHA105 culture containing the overexpression vector Pal04G016300 was streaked onto YEP solid medium and incubated in the dark at 28°C for 36-48 hours. The overexpression vector Pal04G016300 was obtained by ligating the Napier gene Pal04G016300 (sequence 3) into the attR1 and attR2 sites of the pMDC32 vector.

[0238] II. Preparation of Agrobacterium resuspension

[0239] Inoculate the Agrobacterium on the Agrobacterium plate from step one into YEP liquid medium and incubate overnight at 28°C with shaking until OD... 600nm The concentration was 0.8-1.0. Centrifuge at 6000 rpm for 15 min, discard the supernatant, and collect the bacterial cells. Resuspend the bacterial cells in the infection solution to OD0.0. 600nm When the value was 0.8, acetylsyleugenol was added to make the concentration of acetylsyleugenol 150 μmol·L⁻¹. -1 After incubating with gentle shaking at 28℃ for 30 min, glutamine was added to bring the glutamine concentration to 300 μmol·L⁻¹. -1 Agrobacterium resuspension was obtained.

[0240] III. Infection

[0241] The callus tissue of 'Bande No. 1' hybrid Napier grass was transferred to a solution containing 300 μmol·L⁻¹ -1 The callus was treated in an aqueous solution of glutamine and 3% maltose at room temperature or in an ice bath for 20 min. The treated callus was then transferred to a sterile tube containing Agrobacterium resuspension, placed in a vacuum pump (-0.8 MPa) and evacuated for 10 min. The tube was then incubated at 28°C with gentle shaking for 30 min.

[0242] IV. Co-cultivation and Resumption of Cultivation

[0243] Collect the callus tissue soaked in Agrobacterium resuspension in step three into a culture dish lined with sterile filter paper. Dry the callus tissue in a laminar flow hood until any residual Agrobacterium solution on the surface is removed. Then, use sterile forceps to spread the callus tissue evenly on the co-culture medium and incubate it in a dark room at 25±2℃ for 2-3 days. After co-culture, wash the callus tissue 3-5 times with sterile water until the water is clear. Collect the callus tissue into a culture dish lined with sterile filter paper, remove excess water, and air dry it in a laminar flow hood for 1-2 hours until the surface moisture is absorbed. Transfer the callus tissue to recovery medium and incubate it in a dark room at 25±2℃ for 7-10 days.

[0244] V. Screening and Cultivation

[0245] After recovery culture, the callus tissue was transferred to the screening medium and cultured in the dark at 25±2℃ for 14-28 days to obtain resistant callus.

[0246] VI. Induction of Regenerated Seedlings

[0247] The resistant callus obtained in step 5 was inoculated into differentiation medium and cultured in a light culture room at 25±2℃ with a light cycle of 16h white light / 8h dark for 14-28 days to obtain regenerated seedlings (resistant plants).

[0248] VII. Identification of Resistant Plants

[0249] Molecular testing was performed on the regenerated seedlings (resistant plants) obtained in step six. The specific steps of the molecular testing are as follows:

[0250] DNA was extracted from the regenerated seedlings (resistant plants), and PCR amplification was performed using primers Ubi-F (TGATGGCCCTGCCTTCATACGCT) and 16300-R (CTAGGCGCCCCAAACGGTGATCC). Resistant plants that amplified a target band of the same size as the band amplified by the positive plasmid were identified as positive plants.

[0251] Transformation and regeneration induction rate = (total number of resistant calluses that can induce seedlings / total number of calluses that initiate transformation) × 100%.

[0252] Transformation positivity rate = (total number of plants with positive molecular identification / total number of induced seedlings) × 100%.

[0253] The statistical results of transformation and regeneration induction rate and positive rate are shown in Table 5.

[0254] Table 5. Statistical results of transformation and regeneration induction rate and positive rate

[0255]

[0256] 8. Rooting Induction

[0257] The seedlings obtained in step seven were transferred to rooting jars containing rooting medium using tweezers and cultured at 25±2℃ in a light-dark cycle of 16h light / 8h darkness for 28 days to obtain regenerated plants. The rooting induction rate was calculated using the following formula: (Total number of seedlings that can be induced to develop roots / Total number of seedlings inoculated for the rooting test) × 100%. The rooting induction rate is shown in Table 6.

[0258] Table 6. Statistical results of rooting induction rate

[0259]

[0260] The present invention has been described in detail above. For those skilled in the art, the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. Although specific embodiments have been given, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein. Some of the essential features can be applied within the scope of the following appended claims.

Claims

1. A method for genetic transformation of hybrid Napier grass, comprising the following steps: 1) Hybrid Napier embryogenic callus was pretreated with an aqueous solution containing glutamine and maltose to obtain pretreated callus; The concentration of the glutamine in the aqueous solution containing glutamine and maltose is 300 pmol L -1 ; The maltose in the aqueous solution containing glutamine and maltose has a mass fraction of 3%. The pretreatment method is to soak the sample at room temperature or in an ice bath for 20-25 minutes. The method for preparing hybrid Napier grass embryogenic callus includes the following steps: culturing hybrid Napier grass seeds in a callus induction medium; the callus induction medium consists of solute and solvent, the solvent being double-distilled water, and the solute and its concentration being: MS inorganic salt and vitamin mixture 4.43 g / L, maltose 30 g / L, 2,4-D 3 mg / L, 6-BA 1 mg / L, and agar 8 g / L; The method for preparing hybrid Napier embryogenic callus further includes the step of culturing the hybrid Napier embryogenic callus in a callus subculture medium; the callus subculture medium consists of solute and solvent, the solvent being double-distilled water, and the solute and its concentration being: MS inorganic salt and vitamin mixture 4.43 g / L, maltose 30 g / L, 2,4-D 3 mg / L, 6-BA 1 mg / L, proline 2 g / L, and agar 8 g / L; 2) Infect the pretreated callus with Agrobacterium resuspension containing the target gene to obtain infected callus; The method for preparing the Agrobacterium resuspension containing the vector of the target gene includes the following steps: 2-1) Agrobacterium containing the target gene vector was inoculated into YEP liquid medium and cultured until OD... 600nm Centrifuge after the value is 0.8-1.0 and collect the bacterial cells; 2-2) Resuspend the bacterial cells in the infection solution to OD. 600nm After the value was 0.8, acetylsuccinone was added, and the mixture was shaken and cultured. Then glutamine was added to obtain the Agrobacterium resuspension containing the vector of the target gene. The Agrobacterium species mentioned is Agrobacterium EHA105. The infection solution consists of a solute and a solvent, with double-distilled water as the solvent. The solute and its concentration are as follows: MS inorganic salt and vitamin mixture 4.43 g / L, maltose 30 g / L, 2,4-D 3 mg / L, 6-BA 1 mg / L, and proline 2 g / L. The concentration of acetylsuccinone in the Agrobacterium resuspension containing the vector of the target gene was 150 μmol·L⁻¹. -1 ; The concentration of glutamine in the Agrobacterium resuspension containing the vector of the target gene was 300 μmol·L⁻¹. -1 ; 3) The infected callus tissue was inoculated into a co-culture medium for culture to obtain co-cultured callus tissue; the co-culture medium consisted of solute and solvent, the solvent being double-distilled water, and the solute and its concentration were as follows: MS inorganic salt and vitamin mixture 4.43 g / L, maltose 30 g / L, 2,4-D 3 mg / L, 6-BA 1 mg / L, proline 2 g / L, acetylsyleugenone 150 μmol·L. -1 Glutamine 300 μmol·L -1 ; 4) The co-cultured callus was inoculated into recovery culture medium for further culture to obtain recovered callus; the recovery culture medium consisted of solute and solvent, the solvent being double-distilled water, and the solute and its concentration were as follows: MS inorganic salt and vitamin mixture 4.43 g / L, maltose 30 g / L, 2,4-D 3 mg / L, 6-BA 1 mg / L, proline 2 g / L, termethin 250 mg / L, and agar 8 g / L; 5) The recovered callus tissue was inoculated into a selection medium for culture to obtain resistant callus tissue; the selection medium consisted of solute and solvent, the solvent being double-distilled water, and the solute and its concentration were as follows: MS inorganic salt and vitamin mixture 4.43 g / L, maltose 30 g / L, 2,4-D 3 mg / L, 6-BA 1 mg / L, proline 2 g / L, agar 8 g / L, termethin 150 mg / L, and selection agent 10 mg / L; 6) The resistant callus tissue was inoculated into a differentiation medium for culture to obtain regenerated seedlings; the differentiation medium contained maltose, 6-BA, NAA and termethin; The differentiation medium consists of solute and solvent, with double-distilled water as the solvent. The solute and its concentration are as follows: MS inorganic salt and vitamin mixture 4.43 g / L, maltose 30 g / L, 6-BA 3 mg / L, NAA 1 mg / L, agar 8 g / L, termethin 150 mg / L, and screening agent 5 mg / L. 7) The regenerated seedlings are cultured in a rooting medium to obtain regenerated transformed plants; the rooting medium consists of solutes and solvents, the solvent being double-distilled water, and the solutes and their concentrations being: MS inorganic salt and vitamin mixture 2.215 g / L, maltose 15 g / L, agar 8 g / L, termethin 150 mg / L and screening agent 5 mg / L; The hybrid Napier grass mentioned is 'Bande No. 1' hybrid Napier grass.

2. A complete set of reagents for the genetic transformation of hybrid Napier grass, the complete set of reagents comprising the aqueous solution containing glutamine and maltose as described in claim 1, the callus induction medium as described in claim 1, the callus subculture medium as described in claim 1, the infection solution as described in claim 1, the co-culture medium as described in claim 1, the recovery medium as described in claim 1, the screening medium as described in claim 1, the differentiation medium as described in claim 1, and the rooting medium as described in claim 1; The hybrid Napier grass mentioned is 'Bande No. 1' hybrid Napier grass.

3. The use of the reagent kit according to claim 2 in any one of the following X1)-X2): X1) Genetic transformation of hybrid Napier grass; X2) Prepare genetically transformed products of hybrid Napier grass; The hybrid Napier grass mentioned is 'Bande No. 1' hybrid Napier grass.

Images