Method for identifying antigen-binding T cell receptors (TCRs)

Abstract

Provided herein are methods for identifying tumor neoantigens and T cell receptors (TCRs) that bind to tumor neoantigens (i.e., neoantigen-specific TCRs). In some embodiments, the disclosure relates to identified tumor neoantigens and tumor neoantigen-specific TCRs, and methods and uses related thereto. In some embodiments, provided embodiments relate to identifying tumor neoantigen-specific TCRs from an individual to facilitate personalized treatment, such as adoptive cell therapy.

Description

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS

[0002] This application claims the benefit of U.S. Provisional Patent Application No. 63 / 476,717, filed December 22, 2022, which is incorporated herein by reference.

[0003] Sequence Listing

[0004] The Sequence Listing prepared as file BSB-0005WO01_SeqListing_ST26.xml is 8.8 kilobytes in size, was created on December 22, 2022, and is hereby incorporated by reference. Technical Field

[0005] In some embodiments, the present disclosure relates to methods for identifying antigens and T cell receptors (TCRs) that bind to antigens, i.e., neoantigen-specific TCRs. In some embodiments, the present disclosure relates to identified tumor neoantigens and tumor neoantigen-specific TCRs, and related methods and uses thereof. In some embodiments, the provided embodiments relate to identifying tumor neoantigen-specific TCRs from individuals to facilitate personalized treatments, such as adoptive cell therapy. Background Art

[0006] The administration of T cells targeting specific antigens, also known as adoptive cell therapy (ACT), is a promising approach for treating diseases such as cancer. However, current ACT treatments face challenges, including identifying optimal T cell receptors for targeting antigens present in tumors. Therefore, new and improved methods are needed to overcome these challenges. The present disclosure addresses these and other needs. Summary of the Invention

[0007] Methods for identifying T cell receptors (TCRs) or their antigen-binding fragments that bind to antigens are described. Antigens can be, but are not limited to, tumor neoantigens, shared tumor antigens, pathogen antigens (e.g., viral or bacterial antigens), allergens, or autoimmune disease-associated antigens. These methods include: (a) forming a library of reporter T cells expressing TCRs, wherein each T cell in the library expresses a single TCR; (b) forming a library of antigen presenting cells (APCs), wherein each APC expresses one or more antigens (e.g., tumor neoantigens) and (c) contacting these reporter T cells with APCs, wherein the activation of the T cells indicates that the TCR expressed by the T cells is bound to the antigen expressed by the APCs. In some embodiments, before contacting these T cells with APCs, these T cells are incubated with immune effector cytokines. In some embodiments, TCRs are cloned from subjects, and APCs are matched with subject HLAs. In some embodiments, TCRs are cloned from subjects with one or more specific HLA alleles, and APCs express the one or more specific HLA alleles. In some embodiments, APCs are transfected or transduced with vectors encoding one or more tumor neoantigens present in a subject's tumor. In some embodiments, APCs are transfected or transduced with vectors encoding one or more pathogen proteins or fragments thereof. In some embodiments, APCs are transfected or transduced with vectors encoding one or more allergens or fragments thereof. In some embodiments, APCs are transfected or transduced with vectors encoding one or more proteins or fragments thereof associated with tissue cells that are targets of autoimmune diseases. In some embodiments, 1-100 TCRs can be rapidly screened against 1-20 candidate antigen expression vectors in a single sample.

[0008] In some embodiments, the method can be used to identify TCRs that recognize a shared tumor antigen, wherein the shared tumor antigen is presented in the context of a specific HLA allele. The identification of TCRs that recognize a shared tumor antigen in the context of a specific HLA allele can be used to treat subjects with a shared tumor antigen and a specific HLA allele.

[0009] The method can also be used to identify antigens presented to the immune system in the context of HLA. The identification of TCRs activated by APCs expressing the antigen indicates that the antigen is presented to T cells in the context of HLA. In some embodiments, the method can be used to identify antigens or neoantigens associated with cancer. In some embodiments, the method can be used to identify shared tumor antigens. In some embodiments, the method can be used to identify shared tumor antigens that bind to specific HLA alleles. In some embodiments, the method can be used to identify neoantigens that are specific to the subject. In some embodiments, the method is used to identify antigens expressed by pathogens, such as bacterial antigens or viral antigens. In some embodiments, the method is used to identify antigens associated with allergens or autoimmune diseases.

[0010] A method for forming a neoantigen expression library is described, comprising: (a) performing genomic DNA sequencing and RNA expression profiling on cells obtained from a tumor of a subject; (b) performing genomic DNA sequencing on non-cancerous cells obtained from the subject; (c) identifying expression mutations in the genome of tumor cells relative to non-cancerous cells; and (d) forming a library of neoantigen expression vectors containing neoantigen minigenes encoding the mutated neoantigens identified in step (c). The neoantigen expression vector can be, but is not limited to, a lentiviral vector. In some embodiments, the neoantigen expression vector contains a tandem minigene, wherein the tandem minigene comprises two or more neoantigen minigenes, wherein these neoantigen minigenes are expressed as fusion polypeptides. In some embodiments, the neoantigen expression library can be used to prepare a library of neoantigen-presenting APCs by introducing the neoantigen expression vector into APCs. In some embodiments, the APCs are HLA-matched to the subject. HLA matching indicates that the APCs express the same HLA-A, HLA-B, and HLA-C alleles as the subject. In some embodiments, the neoantigen expression vector is introduced into two antigen-presenting cells, wherein the two APCs together are HLA-matched to the subject. In some embodiments, the two APCs include a first APC expressing the subject's HLA-A, HLA-B, and HLA-C, and a second APC expressing the subject's HLA-A', HLA-B', and HLA-C', wherein HLA-A, HLA-B, HLA-C, HLA-A', HLA-B', and HLA-C' represent the HLA alleles expressed by the subject. In some embodiments, the new antigen expression vector is introduced into three antigen-presenting cells, wherein the three APCs are together HLA-matched to the subject. In some embodiments, the three APCs include a first APC expressing HLA-A alleles and HLA-A' alleles, a second APC expressing HLA-B alleles and HLA-B' alleles, and a third APC expressing HLA-C alleles and HLA-C' alleles, wherein HLA-A, HLA-B, HLA-C, HLA-A', HLA-B', and HLA-C' represent the HLA alleles expressed by the subject. HLA-A and HLA-A' may be the same or different. HLA-B and HLA-B' may be the same or different. HLA-C and HLA-C' may be the same or different.

[0011] Methods for identifying one or more T cell receptors (TCRs) or antigen-binding fragments thereof that bind to tumor neoantigens are described, the methods comprising: (a) generating a library of reporter T cells expressing functional TCRs by introducing a plurality of nucleic acid molecules from a plurality of T cells into a plurality of reporter T cells, the plurality of T cells being obtained from a biological sample of a subject having a tumor, the plurality of nucleic acid molecules each comprising a nucleic acid encoding a functional TCR or antigen-binding fragment thereof, wherein if the reporter T cells expressing the TCR contact an antigen-presenting cell expressing an antigen to which the TCR binds, the reporter T cells expressing the TCR are activated and provide a detectable signal; (b) identifying one or more candidate tumor neoantigens by comparing genomic DNA sequences and RNA expression profiles of tumor cells from the subject with corresponding genomic DNA sequences from non-tumor cells from the subject, and (c) identifying one or more candidate tumor neoantigens by comparing the genomic DNA sequences and RNA expression profiles of tumor cells from the subject with corresponding genomic DNA sequences from non-tumor cells from the subject, and (d) identifying one or more candidate tumor neoantigens by comparing the genomic DNA sequences and RNA expression profiles of tumor cells from the subject with corresponding genomic DNA sequences from non-tumor cells from the subject, and (e) identifying one or more candidate tumor neoantigens by comparing the genomic DNA sequences and RNA expression profiles of tumor cells from the subject with corresponding genomic DNA sequences from non-tumor cells from the subject, and (f ... or multiple candidate neoantigens or fragments thereof are cloned into one or more candidate neoantigen expression vectors to form a candidate neoantigen expression library, wherein each candidate neoantigen expression vector in the library encodes one or more candidate neoantigens or fragments thereof; (c) a library of antigen presenting cells (APCs) expressing neoantigens is generated by introducing the one or more candidate neoantigen expression vectors into multiple APCs, wherein the multiple APCs are capable of expressing the one or more candidate tumor neoantigens or fragments thereof complexed with major histocompatibility complex (MHC) molecules; (d) a library of reporter T cells expressing functional TCRs is contacted with one or more APCs of a library of APCs expressing neoantigens; (e) any activated reporter T cells expressing TCRs are detected based on the detection of a detectable signal; wherein the TCR expressed by the activated reporter T cells expressing TCRs binds to tumor neoantigens expressed by APCs. In some embodiments, these T cells are incubated with immune effector cytokines before contacting them with APCs. In some embodiments, nucleic acids encoding TCRs can be isolated from activated reporter T cells expressing TCRs. In some embodiments, nucleic acid sequences encoding a TCR or an antigen-binding fragment thereof can be isolated or identified from activated reporter T cells expressing the TCR. In some embodiments, nucleic acid sequences encoding a neoantigen can be isolated or identified from APCs that activate reporter T cells expressing the TCR.

[0012] Using this method, a TCR library can be screened for a complete or partial set of mutations. Using this method, 1-100 TCRs can be screened for 1-20 neoantigen expression vectors in a single sample. Steps (d) and (e) can be performed in as little as one day. In some embodiments, steps (d) and (e) are performed within 1, 2, or 3 days.

[0013] Using the methods described, libraries of TCRs can be screened against one or more proteins or fragments thereof associated with infection (eg, viral infection or bacterial infection), allergy, or autoimmune disease.

[0014] The reporter T cells (reporter T cells) expressing TCR include T cells and detectable markers expressing heterologous nucleic acid sequences, which encode functional TCRs in the T cells separated from the subject. The T cells separated from the subject can be, but are not limited to, tumor infiltrating T cells (TIL) or PBMC. The subject can be an autologous subject or an allogeneic subject. In the case of the TCR expressed in combination with the cognate antigens compounded by the MHC (HLA) molecules presented on APC, the reporter T cells expressing TCR are activated. Reporter T cell lines are reporter T cell colonies expressing identical functional TCRs and identical detectable markers.

[0015] Reporter T cells are T cells that provide detectable signals when T cells are activated by TCR, and the TCR is combined with the cognate antigen of major histocompatibility complex class 1 (MHC) molecules (e.g., HLA complex) presented on APC. In some embodiments, reporter T cells are T cells that express detectable markers when T cells are activated by TCR combined with cognate antigens under the background of major histocompatibility complex class 1 (MHC) molecules (e.g., HLA complex). In some embodiments, reporter T cells include T cells that express CD69 when activated. In some embodiments, reporter T cells contain reporter genes that express detectable markers when T cells are activated. Detectable markers can be, but are not limited to, fluorescent proteins, luciferases, or cell surface markers. Fluorescent proteins can be, but are not limited to, green fluorescent protein, blue fluorescent protein, cyan fluorescent protein, yellow fluorescent protein, orange fluorescent protein, or red fluorescent protein or derivatives thereof. Reporter T cells expressing TCRs include T cells and detectable markers expressing heterologous nucleic acid sequences that encode functional TCRs in T cells isolated from subjects. The T cells separated from the subject can be, but are not limited to, tumor infiltrating T cells (TIL) or PBMC. The subject can be an autologous subject or an allogeneic subject. In the case of the TCR expressed binding to the cognate antigen compounded with the MHC molecule presented on the APC, the reporter T cells are activated. In some embodiments, the reporter T cells expressing TCR have been modified to knock out the TCR of endogenous expression.

[0016] Any method known in the art for producing such libraries can be used to produce a library of reporter T cells expressing functional TCRs. In some embodiments, any method described in US20150203886 or WO2018102473 is used to produce a library of reporter T cells expressing functional TCRs, each of which is incorporated herein by reference. In some embodiments, the TCR is an αβ TCR.

[0017] Identifying one or more candidate tumor neoantigens includes identifying one or more neoantigens expressed by the subject's tumor cells but not by the subject's non-tumor cells. In some embodiments, an antigen is identified as a candidate tumor neoantigen if the following conditions are met: (i) there is a single nucleotide variant (SNV) or insertion-deletion (indel) in the genomic DNA sequence of the gene encoding the antigen from the subject's tumor cell compared to the corresponding genomic DNA sequence of the gene encoding the antigen from the subject's non-tumor cell; and / or (ii) there is SNV or indel in the mRNA sequence of the gene encoding the antigen from the same subject's tumor cell compared to the corresponding mRNA sequence of the gene encoding the antigen from the subject's non-tumor cell. In some embodiments, if there is SNV or indel in the genomic DNA sequence of the gene encoding the antigen from the subject's tumor cell compared to the corresponding genomic DNA sequence of the gene encoding the antigen from the subject's non-tumor cell, and it is expressed, the antigen is identified as a candidate tumor neoantigen. In some embodiments, SNVs result in non-synonymous mutations, missense mutations, or nonsense mutations in the gene encoding the antigen. In some embodiments, SNV or indel results in a non-synonymous mutation that is expressed as a peptide or protein. In some embodiments, indel results in a frameshift mutation in a gene encoding an antigen. In some embodiments, SNV or indel may be present in a coding region (such as an exon) of a gene encoding an antigen. In some embodiments, SNV or indel is present in a regulatory region or intron of a gene encoding an antigen and results in increased expression of the antigen in tumor cells compared to non-tumor cells.

[0018] In some embodiments, an antigen is identified as a candidate tumor neoantigen if: (i) a SNV or indel is present in a genomic DNA sequence of a tumor cell from the subject compared to a corresponding genomic DNA sequence of a non-tumor cell from the subject, wherein the SNV or indel results in increased expression of a non-coding RNA, a splice variant RNA, a silent retroviral element, an alternative ORF, an upstream ORF, a regulatory ORF, a small ORF, or a gene fusion; and / or (ii) a SNV or indel is present in an expressed RNA sequence of a tumor cell from the subject compared to a corresponding expressed RNA sequence of a non-tumor cell from the subject, wherein the SNV or indel results in increased expression of a non-coding RNA, a splice variant RNA, a silent retroviral element, an alternative ORF, an upstream ORF, a regulatory ORF, a small ORF, or a gene fusion. In some embodiments, the SNV or indel is present in an intergenic region, a non-coding region, a regulatory region, an intron, a silent retroviral element, or a heterochromatic region of the genome. In some embodiments, the antigen is encoded by a non-coding RNA or a splice variant RNA; and / or the antigen comprises an alternative ORF, an upstream ORF, a regulatory ORF, or a small ORF.

[0019] In some embodiments, the candidate antigen (e.g., candidate tumor neoantigen) is further analyzed for predicted complex formation with MHC molecules. Predicted complex formation with MHC molecules can be accomplished using predictive models available in the art.

[0020] In some embodiments, the predictive ability of candidate antigens (e.g., candidate tumor neoantigens) to generate an immune response is further analyzed. The predictive ability to generate an immune response can be accomplished using predictive models available in the art.

[0021] A neoantigen minigene comprising a nucleic acid sequence encoding an identified candidate neoantigen is described. The neoantigen minigene encodes a polypeptide fragment comprising all or a portion of a gene in which the candidate neoantigen is identified. In some embodiments, the neoantigen minigene encodes a polypeptide comprising an identified mutation (e.g., a mutated amino acid resulting from a tumor-specific non-synonymous variation) and its surrounding amino acids. In some embodiments, the neoantigen minigene encodes a peptide of about 8 to about 30 amino acids containing the mutated amino acid. In some embodiments, the neoantigen minigene encodes the identified mutated amino acid and about 4 to about 15 upstream amino acids and about 4 to about 15 downstream amino acids.

[0022] In some embodiments, the neoantigen minigene is cloned into an expression vector to form a neoantigen vector. The neoantigen minigene is cloned into an expression vector using methods known in the art. In some embodiments, the neoantigen minigene is cloned into an expression vector using seamless (e.g., Gibson) cloning. The neoantigen vector comprises a promoter operably linked to the neoantigen minigene, wherein the promoter is active in antigen presenting cells. The promoter can be, but is not limited to, a CMV promoter, an Igκ promoter, a PGK promoter, a SV40 promoter, a β-actin promoter, an α-actin promoter, a SRα promoter, a herpes thymidine kinase promoter, a herpes simplex virus (HSV) promoter, a mouse mammary tumor virus long terminal repeat (LTR) promoter, adenovirus major late promoter (Ad MLP), a Rous sarcoma virus (RSV) promoter, an immunoglobulin promoter, an EF1α promoter, an ubiquitin promoter, a MNDU3 promoter, a metallothionein promoter, an IFN gene promoter, or a GM-CSF gene promoter. In some embodiments, the expression vector further comprises one or more additional sequences that promote or enhance the expression of the neoantigen minigene in antigen-presenting cells. The one or more additional sequences include, but are not limited to, woodchuck hepatitis virus post-transcriptional regulatory elements (WPRE) elements and poly A tails. In some embodiments, the neoantigen vector further encodes a ubiquitin moiety. The ubiquitin moiety may be, but is not limited to, a modified ubiquitin moiety. The modified ubiquitin moiety may be, but is not limited to, a ubiquitin comprising a G76V amino acid substitution. In some embodiments, the encoded ubiquitin forms a fusion protein with a neoantigen or tandem neoepitope encoded by a neoantigen minigene or tandem minigene. Ubiquitin may be linked to the encoded neoantigen or tandem minigene via a spacer. In some embodiments, the neoantigen vector further encodes a selective marker or a cell surface reporter protein. The selective marker or cell surface reporter protein may be, but is not limited to, a truncated rat nerve growth factor receptor (tNGFR). The selective marker or cell surface reporter protein may be expressed from the same promoter as the neoantigen minigene or tandem minigene, or it may be expressed from a different promoter. If the selectable marker or cell surface reporter protein is expressed from the same promoter, the coding sequence of the selectable marker or cell surface reporter protein can be operably linked to the neoantigen minigene or tandem neoantigen minigene via a 2A or IRES element. The neoantigen vector or tandem minigene vector can be, but is not limited to, a viral vector or a vector for producing viral particles. The viral vector can be, but is not limited to, a lentiviral vector. The viral particle can be, but is not limited to, a lentivirus.

[0023] In some embodiments, two or more neoantigen minigenes are cloned in series to form a tandem minigene. The tandem minigene encodes a fusion polypeptide comprising two or more neoantigens or neoepitopes (i.e., tandem neoantigens). The tandem minigene can be cloned into an expression vector to form a tandem minigene vector. In some embodiments, the neoantigen minigenes in the tandem neoantigen minigene are separated by a spacer. In some embodiments, the spacer encodes a short amino acid that promotes effective epitope processing. In some embodiments, the spacer encodes the amino acid sequence AAY (alanine-alanine-tyrosine). In some embodiments, the spacer encodes the amino acid sequence GPGPG, EAAAK, or GGGSG. The tandem minigene vector can encode at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, or at least 10 candidate neoantigens or fragments thereof (including neoepitopes). In some embodiments, each tandem minigene vector encodes about 2 to about 10 candidate neoantigens or fragments thereof. In some embodiments, each tandem minigene vector encodes about 5 to about 10 candidate neoantigens or fragments thereof. For a tandem minigene comprising two or more neoantigen minigenes, each neoantigen minigene can be separated by a spacer region. The spacers can be the same or different.

[0024] In some embodiments, parallel cloning is used to assemble new antigen minigene vectors and / or tandem minigene vectors. In some embodiments, tandem minigene vectors are assembled without restriction endonuclease cleavage reactions. In some embodiments, seamless (e.g., Gibson) cloning is used to assemble tandem minigene vectors.

[0025] A candidate neoantigen expression library is described. The candidate neoantigen expression library comprises a variety of neoantigen minigene vectors and / or tandem minigene vectors. The neoantigen minigene vector library or tandem minigene vector library comprises a variety of neoantigen minigene vectors and / or a variety of tandem minigene vectors encoding a variety of candidate neoantigens and / or fragments thereof. The candidate neoantigen expression library may comprise all (complete mutation set), almost all, greater than 90%, greater than 75%, greater than 50% or a subset of the identified candidate neoantigens or fragments thereof or candidate neoepitopes from a subject.

[0026] The new antigen expression vectors and / or tandem minigene vectors in the library can be combined. The pool may include all new antigen expression vectors and / or tandem minigene vectors in the library or a subset of new antigen expression vectors and / or tandem minigene vectors in the library. Alternatively, each different new antigen expression vector and / or tandem minigene vector in the library can be maintained and / or stored separately. When each different new antigen expression vector and / or tandem minigene vector in the library is maintained and / or stored separately, information about the identity of the candidate new antigen and / or coding sequence or amino acid sequence can be recorded for each vector. For the tandem minigene expression library, each identified candidate new antigen can be presented once in the library. Alternatively, for the tandem minigene expression library, each identified candidate new antigen can be presented more than once in the library. When each identified candidate new antigen is presented more than once in the tandem minigene expression library, the new antigen minigene is arranged and grouped in separate tandem minigenes to facilitate the identification of new antigens bound by TCR in the tandem new antigen based on the APC group expressing the new antigen that activates TCR.

[0027] A method for generating a library of APCs expressing neoantigens is described, which express candidate neoantigens, the method comprising: introducing one or more of the neoantigen expression vectors into the APC individually or as a combined library. In some embodiments, the APC is transfected or transduced with the candidate neoantigen expression library. In some embodiments, the neoantigen minigene is introduced into the APC using the combined neoantigen expression library. After the combined neoantigen expression library is transfected or transduced into the APC, the APC is individually sorted into separate positions, such as separate wells in a multiwell plate, for subsequent incubation with reporter T cells expressing TCR. In some embodiments, each neoantigen expression vector in the neoantigen expression library is independently introduced into an APC in a separate position, such as a separate well in a multiwell plate, for subsequent incubation with reporter T cells expressing TCR.

[0028] In some embodiments, the new antigen carrier and / or the tandem minigene carrier are introduced into antigen presenting cells (APCs) expressing one or more HLA alleles. HLA alleles include, but are not limited to, HLA-A, HLA-B, and HLA-C. APCs may express one or two alleles of each of HLA-A, HLA-B, and / or HLA-C. If an APC expresses two alleles of HLA-A, HLA-B, and / or HLA-C, then for each of HLA-A, HLA-B, and HLA-C, the two alleles may be independently the same or different. In some embodiments, the HLA alleles expressed by the APC match the subject. In some embodiments, the new antigen carrier and / or the tandem minigene carrier are introduced into a first APC expressing a first group of HLA-A, HLA-B, and HLA-C alleles and a second APC expressing a second group of HLA-A, HLA-B, and HLA-C alleles. Each of the HLA-A, HLA-B, and HLA-C alleles in the first and second APCs may independently be the same or different. In some embodiments, the first and second sets of HLA-A, HLA-B, and HLA-C alleles expressed in combination by the first and second APCs match the HLA genotype of the subject, such that the first and second APCs together express the same set of HLA-A, HLA-B, and HLA-C alleles as the subject. The APCs may be, but are not limited to, B lymphoblastoid cells (B-LCLs) or artificial APCs. Artificial APCs (aAPCs) may be, but are not limited to, K562 cells expressing MHC molecules. In some embodiments, the APCs are transfected or transduced with one or more vectors (such as one or more lentiviral vectors) encoding the desired heterologous HLA-A, HLA-B, and / or HLA-C alleles. In some embodiments, the APCs do not express endogenous HLA. In some embodiments, the APCs are modified to knock out endogenous HLA prior to insertion of the one or more heterologous HLA alleles.

[0029] APCs expressing HLA genes that match the subject can be obtained from a library of APCs expressing a combination of HLA-A, HLA-B, and HLA-C alleles. APCs expressing HLA genes that match the subject can also be obtained by transducing APCs with one or more lentiviral vectors encoding HLA-A, HLA-B, and HLA-C alleles. APCs expressing HLA genes that match the subject can also be obtained by transducing APCs expressing one HLA allele (e.g., HLA-A allele) with one or more lentiviral vectors encoding other HLA alleles (e.g., HLA-B and HLA-C alleles). The lentiviral vector can be from a library of lentiviral vectors encoding HLA-A, HLA-B, and / or HLA-C alleles. Lentiviral vectors may each encode a single HLA-A, HLA-B, or HLA-C allele, a combination of two HLA alleles (e.g., two HLA-A alleles or HLA-B and HLA-C alleles), or a combination of three HLA alleles. In some embodiments, the lentiviral vector encodes two HLA alleles. The two HLA alleles may be, but are not limited to, an HLA-B allele and an HLA-C allele (i.e., an HLA-B / HLA-C combination). In some embodiments, APCs expressing HLA genes that match the subject are obtained by selecting APCs expressing HLA-A alleles that match the subject from a library of APCs each expressing one or two HLA-A alleles, and transducing the HLA-A-matched APCs with one or more lentiviral vectors encoding HLA-B and HLA-C alleles that match the subject. In some embodiments, APCs expressing HLA genes that match the subject are obtained by selecting APCs and transducing the APCs with one or more lentiviral vectors encoding HLA-A, HLA-B, and HLA-C alleles that match the subject.

[0030] The library of the reporter T cells expressing functional TCR is contacted with one or more APCs of the library of the APC expressing the neoantigen, including, under conditions suitable for activating T cells by binding TCR to cognate antigens, one or more reporter T cells expressing TCR from the library of the reporter T cells expressing functional TCR are combined with one or more APCs from the library of the APC expressing the neoantigen. In some embodiments, before the reporter T cells expressing TCR are contacted with APC, the reporter T cells expressing TCR are incubated with one or more immune effector cytokines. In some embodiments, the reporter T cells expressing TCR of each TCR are incubated in separate locations (e.g., separate holes of a multi-well plate) with APCs expressing each neoantigen minigene and / or series connection minigene, so that each TCR is tested with each neoantigen or series connection neoantigen combination. In some embodiments, a subset of the library of the reporter T cells expressing functional TCR is combined with a subset of the library of the APC expressing the neoantigen. In some embodiments, a library of reporter T cells expressing functional TCRs is combined with a subset of the library of APCs expressing neoantigens, such that each TCR is tested in combination with a subset of neoantigens or tandem neoantigens. In some embodiments, a subset of the library of reporter T cells expressing functional TCRs is combined with a library of APCs expressing neoantigens, such that a subset of TCRs is tested in combination with each neoantigen or tandem neoantigens. If each neoantigen expression vector or tandem minigene expression vector is introduced into a first APC expressing a first set of HLA-A, HLA-B, and HLA-C alleles and a second APC expressing a second set of HLA-A, HLA-B, and HLA-C alleles, the reporter T cells expressing the TCR can be combined with the first APC and the second APC together or separately.

[0031] The methods described herein can be multiplexed. Reporter T cells (or reporter T cell lines) expressing 1-5, 1-10, 1-20, 1-50 or 1-100 different or more TCRs can be combined to provide a pool of reporter T cells (or reporter T cell lines). APCs expressing neoantigens (or APC cell lines expressing neoantigens) expressing 1-20 or more different neoantigen expression vectors (including minigenes and / or tandem minigenes) can be combined to provide a pool of APCs expressing neoantigens (or APC cell lines expressing neoantigens). The pool of reporter T cells can contain multiple T cells expressing each TCR in different TCRs. The pool of APCs expressing neoantigens can contain multiple APCs expressing neoantigens expressing each different neoantigen expression vector. In any of the methods, the pool of reporter T cells can be contacted with APCs expressing neoantigens. In any of the methods, the pool of reporter T cells can be contacted with a pool of APCs expressing neoantigens. In any of the methods, the pool of reporter T cells can be contacted with a pool of APCs expressing neoantigens. In any of the methods, the pool of reporter T cells can be contacted with a pool of APCs expressing neoantigens. In some embodiments, one or more pools of reporter T cells, wherein each pool of reporter T cells expresses 1-100 different TCRs, are contacted with one or more pools of neo-antigen-expressing APCs, wherein each pool of neo-antigen-expressing APCs expresses 1-20 different neo-antigen-expressing vectors.

[0032] In some embodiments, after detecting a signal in a multiple sample (wherein at least one merged reporter T cell is activated by at least one APC), the multiple samples are deconvoluted. In some embodiments, the deconvolution of the multiple samples includes contacting each reporter T cell in the merged reporter T cells with each APC in the merged APC or the merged APC separately, and identifying the reporter T cells that are activated in the second round of detection. The deconvolution of the multiple samples may also include a second round of contact of the reporter T cells with the APC, wherein the pool of the reporter T cells is divided into two or more smaller pools of reporter T cells. Additional rounds of deconvolution may be performed until a single TCR is identified. Deconvolution may also be performed to identify the APCs that activate the T cells and / or the antigens expressed by the APCs that activate the T cells.

[0033] In some embodiments, the reporter T cells in the pool of reporter T cells contain a distinguishable detectable label so that the activation of reporter T cells expressing one TCR can be distinguished from the activation of reporter T cells expressing different TCRs. All reporter T cells in the pool of reporter T cells expressing the same TCR will contain the same detectable label. In some embodiments, each reporter T cell in the pool of reporter T cells contains a detectable label that is distinguishable from the detectable label contained by T cells in the pool of reporter T cells expressing different TCRs. By using a distinguishable detectable label, the identification of activated T cells in the pool of reporter T cells can be determined by identifying the distinguishable detectable label.

[0034] Detecting activated TCR-expressing reporter T cells after incubation with APCs expressing the neoantigen can be accomplished using methods available in the art for such detection. In some embodiments, identifying activated T cells comprises detecting cell surface markers, such as by flow cytometry. In some embodiments, identifying activated T cells comprises detecting a signal, such as fluorescence, from a fluorescent protein, the expression of which is induced by activation of the T cells.

[0035] In some embodiments, any of the methods further comprise determining whether the TCR binds to a wild-type form of the neoantigen.

[0036] Methods are described for identifying one or more T cell receptors (TCRs) or antigen-binding fragments thereof that bind to one or more antigens from pathogens, allergens, or proteins or epitopes associated with cells or tissues that are targets of an autoimmune disease, the methods comprising: (a) generating a library of reporter T cells expressing functional TCRs by introducing a plurality of nucleic acid molecules from a plurality of T cells into a plurality of reporter T cells, the plurality of T cells being obtained from a biological sample of a subject infected with a pathogen, the plurality of nucleic acid molecules each comprising a nucleic acid encoding a functional TCR or antigen-binding fragment thereof, wherein if the reporter T cells expressing the TCRs contact an antigen-presenting cell expressing an antigen to which the TCRs bind, the reporter T cells expressing the TCRs are activated and provide a detectable signal; (b) introducing a pathogen, allergen, or protein or epitope associated with cells or tissues that are targets of an autoimmune disease into a plurality of reporter T cells. One or more candidate antigens or fragments thereof of an allergen or protein or a fragment thereof are cloned into one or more antigen expression vectors to form a candidate antigen expression library, wherein each candidate antigen expression vector encodes one or more candidate antigens or fragments thereof; (c) a library of candidate antigen presenting cells (APCs) is produced by introducing the one or more candidate antigen expression vectors into multiple APCs, the multiple APCs being capable of expressing the one or more candidate antigens or fragments thereof complexed with major histocompatibility complex (MHC) molecules; (d) a library of reporter T cells expressing functional TCRs is contacted with one or more APCs of a library of APCs; (e) any activated reporter T cell expressing TCR is identified based on detection of a detectable signal; wherein the one or more TCRs or antigen-binding fragments thereof bound to the one or more candidate antigens are expressed by any activated reporter T cell expressing TCR. In some embodiments, the reporter T cell expressing TCR is incubated with one or more immune effector cytokines before contacting the reporter T cell expressing TCR with the APC. In some embodiments, nucleic acids encoding TCRs can be isolated from activated reporter T cells expressing TCRs. In some embodiments, a nucleic acid sequence encoding a TCR or antigen-binding fragment thereof can be isolated or identified from activated reporter T cells expressing the TCR.

[0037] In some embodiments, one iteration of the method can employ a library of reporter T cells expressing a TCR comprising at least 50, 100, 150, 200, 250, 300, 350, 400, 450, or 500 reporter T cells expressing a TCR. In some embodiments, one iteration of the method can employ at least 50, 100, 150, 200, 250, 300, 350, 400, 450, or 500 candidate tumor neoantigens or fragments thereof. In some embodiments, one iteration of the method can employ a plurality of tandem minigene vectors encoding at least 20, 50, 100, 200, 300, 400, 500, 600, 700, 800, 900, or 1000 neoantigen minigenes. In some embodiments, one iteration of the method can employ a library of APCs comprising at least 100, 200, 300, 400, 500, 600, 700, 800, 900, or 1000 APCs. In some embodiments, a TCR or antigen-binding fragment thereof that binds to a tumor neoantigen is identified within 6 months, 5 months, 4 months, 3 months, 2 months, 7 weeks, 6 weeks, 5 weeks, 4 weeks, 3 weeks, 2 weeks, or 1 week. In some embodiments, one iteration of the method is completed within 6 months, 5 months, 4 months, 3 months, 2 months, 7 weeks, 6 weeks, 5 weeks, 4 weeks, 3 weeks, 2 weeks, or 1 week.

[0038] In some embodiments, after detecting a signal in a multiplex assay, activated cells are detected and sorted using cell sorting. The identity of the TCR can then be determined by sequencing the TCR from a single activated cell.

[0039] In some embodiments, the APC contains a detectable label that provides a detectable signal when bound by the reporter T cell. When pooled APCs are used, the APC detectable label can be used to facilitate identification of the specific APC that activates the reporter T cell.

[0040] In some embodiments, an engineered cell is provided herein, comprising any TCR or antigen-binding fragment thereof provided herein, or any polynucleotide or any vector encoding a TCR provided herein. The engineered cell can be, but is not limited to, an engineered T cell. The engineered T cell can be expanded and used for T cell therapy.

[0041] In some embodiments, any TCR or nucleic acid encoding a TCR identified using the methods described herein can be used to generate engineered T cells that can be used to treat a condition in a subject that is treatable by T cell therapy. The condition can be, but is not limited to, cancer, infection, or autoimmune disease.

[0042] In some embodiments, a system for identifying a TCR or antigen-binding fragment thereof that binds to a tumor neoantigen is described. The system comprises: (a) a first device comprising a plurality of locations, each location comprising a reporter T cell expressing a TCR; (b) a computer or computer program for identifying candidate tumor neoantigens by comparing the genomic DNA sequence and RNA expression profile of a tumor cell from a subject with the corresponding genomic DNA sequence of a non-tumor cell from the subject; (c) a second device comprising a plurality of locations, each location comprising an APC, the APC comprising one of a plurality of neoantigen expression vectors, each of the plurality of neoantigen expression vectors encoding one or more candidate tumor neoantigens or fragments thereof, wherein the APC expresses one or more candidate tumor neoantigens or fragments thereof in complex with a major histocompatibility complex (MHC) molecule; (d) a third device or means for contacting one or more cells in a location of the first device with one or more cells in a location of the second device; and (e) a fourth device or means for detecting a signal generated by the reporter T cell expressing the TCR when the reporter T cell expressing the TCR is activated. BRIEF DESCRIPTION OF THE DRAWINGS

[0043] Figure 1 A schematic diagram illustrating an exemplary computational neoantigen discovery process is shown, generally as described in detail in Example 1. Sequencing data from tumor and non-tumor DNA and tumor RNA are used as input. The data are aligned to a reference genome and used to identify tumor-specific non-synonymous mutations, i.e., neoantigens. The identified neoantigens are used in silico to construct neoantigen minigenes. Candidate neoantigen minigenes are ranked based on multiple criteria, including MHC binding prediction and tumor expression level.

[0044] Figure 2 Shown are processed melanoma tumor samples and flow cytometry plots illustrating the parameters used to sort and isolate tumor infiltrating lymphocytes (TILs) from the sample. 192 individual TILs with a CD8+CD69hiPD1hi phenotype were isolated from the tumor sample.

[0045] Figure 3 A schematic diagram illustrating exemplary tandem minigene (TMG) polypeptides (with ubiquitin) for expression in antigen presenting cells is shown. The TMG polypeptide includes a modified N-terminal ubiquitin portion with the mutation G76V to prevent cleavage. The "uncleavable" ubiquitin portion promotes proteasomal degradation of the polypeptide to maximize the presentation of processed neoantigens on MHC I. The spacer sequence separating the ubiquitin portion and each neoantigen minigene is designed to promote efficient epitope processing. Each neoantigen in the polypeptide typically comprises a 25 amino acid (AA) sequence containing an identified single nucleotide variant (SNV) and 12 amino acids upstream and downstream of the SNV.

[0046] Figure 4 Schematic diagram showing seamless cloning of antigen expression vectors. The gene block encoding the antigen (eg, TMG) ​​was cloned into a lentiviral vector by Gibson assembly to express TMG.

[0047] Figure 5 Flow cytometry data shows the results of screening TCRs for candidate neoantigens using a reporter cell line expressing Jurkat TCRs cultured with candidate APCs expressing TMG as described in Example 6. EV represents an empty vector (not expressing TMG). Each column represents a reporter cell line with a different TCR. Based on the upregulation of CD69 and GFP expressed by the NFAT-GFP reporter transgene, TCR activation of the reporter cell line expressing the TCR was assessed by flow cytometry. Asterisks indicate the conditions for TCR activation.

[0048] Figure 6 : Flow cytometry data of TCR-A, TCR-C, and TCR-D showing reactivity in the presence of TMG-03-05 or the corresponding unmutated "wild-type" (WT) sequence 03 peptide (TMG-03WT-05) or 05 peptide (TMG-03-05WT). Percentages are CD69 + GFP + cell.

[0049] Figure 7 Flow cytometry data for (a) TCR-B that exhibited reactivity in the presence of TMG-01-10 or the corresponding unmutated "wild-type" (WT) sequence 01 peptide (TMG-01WT-10) or 10 peptide (TMG-01-10WT), (b) TCR-E that exhibited reactivity in the presence of TMG-07-09 or the corresponding unmutated "wild-type" (WT) sequence 07 peptide (TMG-07WT-09) or 09 peptide (TMG-07-09WT), and (c) TCR-H that exhibited reactivity in the presence of TMG-06-08 or the corresponding unmutated "wild-type" (WT) sequence 06 peptide (TMG-06WT-08) or 08 peptide (TMG-06-08WT). Percentages are CD69 + GFP + cell.

[0050] Figure 8 A schematic diagram illustrating exemplary methods and systems for personalized adoptive cell therapy (ACT) for treating cancer or tumors, including neoantigen discovery and neoantigen-specific TCR discovery, as described herein and outlined in Example 7, is shown.

[0051] Figure 9Graph representing the MFI of three different anti-RPL18 TCRs binding to various concentrations of the RPL18 KILTFDRL dextramer (darker colors represent lower dextramer concentrations).

[0052] Figure 10 : Graph representing flow cytometry data for binding of three different anti-RPL18 TCRs to two different amounts of the RPL18 KILTFDRL dextramer.

[0053] Figure 11 : Graph illustrating the expression of anti-RPL18 TCR relative to percent transduction and the affinity of anti-RPL18 TCR for RPL18KILTFDRL.

[0054] Figure 12 : Graph illustrating the relative expression of TCR MFI and RPL18-KILTFDRL dextramer binding compared to A09.

[0055] Figure 13A .Description of CD8 expressing RPL18-specific TCR A09, I20, I02, OVA-specific TCR OT1 and untransduced control + and CD4 + Stained cells (top), and CD8 + Figure 3. Representative TCR and RPL18-dex staining of cells (lower panel).

[0056] Figure 13B Graph illustrating the killing of MC38 tumor cells and RPL18 peptide-pulsed B6WT3 cells.

[0057] Figure 13C Graph illustrating the killing of MC38 tumor cells and RPL18 peptide-pulsed B6WT3 cells.

[0058] Figure 14 : Graph illustrating tumor regression in mice treated with RPL18-specific engineered T cells.

[0059] Figure 15 : Graph illustrating tumor regression in mice treated with RPL18-specific engineered T cells. DETAILED DESCRIPTION

[0060] Described herein is a method for identifying tumor-associated neoantigens and forming a neoantigen minigene library containing nucleic acids for expressing neoantigens in antigen presenting cells (APCs). The neoantigen minigene library can be used to identify T cell receptors (TCRs) bound to tumor neoantigens, i.e., to identify tumor neoantigen-specific TCRs. The method can be used to identify tumor neoantigens from individual tumors (such as tumors from specific subjects with tumors or cancer). Neoantigens from specific subjects (or APCs expressing neoantigens) can be used to identify TCRs specific for neoantigens from the same subject or donor subject. Nucleic acids (e.g., neoantigen minigenes, neoantigen tandem minigenes TMG, neoantigen minigene vectors, neoantigen TMG vectors, neoantigen minigene vector libraries, and neoantigen TMG vector libraries) and APCs expressing neoantigen minigenes are also described. Methods for forming minigenes, neoantigen TMG, neoantigen minigene vectors, neoantigen TMG vectors, neoantigen minigene vector libraries, neoantigen TMG vector libraries, and APCs expressing neoantigen minigenes are further described. The present disclosure also relates to systems for or performing these methods, nucleic acids encoding such TCRs and neoantigens, engineered cells comprising such TCRs, methods for isolating and identifying such TCRs and neoantigens, and uses thereof, e.g., therapeutic uses such as adoptive cell therapy.

[0061] Adoptive cell therapy (ACT; including those involving the administration of cells expressing recombinant TCRs specific for specific target antigens or epitopes associated with a disease or disorder, such as cancer or tumors) and other adoptive immune cells and adoptive T cell therapies can effectively treat diseases and disorders. In some cases, identifying functional TCRs that can recognize antigens that are expressed only in a particular subject's tumor and not on normal, non-tumor or non-cancerous cells can be time-consuming and expensive, and low-frequency TCRs can be difficult to identify. The provided methods, nucleic acids (neoantigen minigenes and TMGs), nucleic acid libraries, and APCs expressing nucleic acids can be used to reduce the time, cost, and complexity of identifying and / or cloning TCRs that recognize tumor antigens in a subject.

[0062] Methods and systems for generating libraries of APCs expressing candidate tumor neoantigens are described. Libraries of APCs expressing various candidate tumor neoantigens can be screened against libraries of T cells expressing TCRs to rapidly identify functional TCRs that can specifically bind and recognize patient-specific tumor neoantigens in a massively parallel manner. A schematic diagram of exemplary methods and systems described herein is shown in Figure 1In some embodiments, the invention relates to personalized adoptive cell therapy (ACT) for treating cancer or tumors, including neoantigen discovery (e.g., using a library of cells expressing tumor neoantigens) and neoantigen-specific TCR discovery (e.g., using a library of cells expressing functional TCRs). In some embodiments, one or more steps of these methods can be automated. In some embodiments, the identified and isolated TCRs targeting patient-specific tumor neoantigens can be used to engineer autologous or allogeneic cells for adoptive cell therapy (ACT) for treating tumors or cancer.

[0063] Using the methods and compositions, TCRs with specific desired functions (e.g., identifying and targeting one or more tumor neoantigens in a specific subject) can be identified in a relatively short period of time and in a cost-effective manner. In addition, the neoantigen minigene and TMP library can be used to identify low-frequency patient-specific TCRs for therapy. The provided embodiments can be used for personalized and customized therapies. In some embodiments, the method can be used to identify TCRs that recognize shared tumor antigens, wherein the shared tumor antigens are presented in the context of specific HLA alleles. The identification of TCRs that recognize shared tumor antigens in the context of specific HLA alleles can be used to treat subjects with shared tumor antigens and specific HLA alleles. Methods for identifying TCRs or antigen-binding fragments thereof that bind to antigens associated with infection, allergy, or autoimmune diseases are also described. These methods include identifying candidate antigens associated with infection, allergy, or autoimmune diseases, and forming a candidate antigen expression vector or a candidate antigen expression library containing nucleic acids for expressing candidate antigens in antigen-presenting cells (APCs). Candidate antigens can be, but are not limited to, pathogen proteins or fragments thereof (e.g., viral or bacterial proteins), allergen proteins or fragments thereof, or proteins or fragments thereof associated with cells or tissues that are targets of autoimmune diseases. Candidate antigen vectors or libraries can be used to identify T cell receptors (TCRs) that bind to candidate antigens. The method can be used to identify antigen TCRs that bind to antigens. In some embodiments, antigens from specific subjects (or APCs expressing antigens) can be used to identify TCRs specific for antigens from the same subject. Candidate antigen expression vectors and APCs expressing candidate antigens, or libraries thereof, can be prepared using methods similar to those described for preparing tumor neoantigen expression vectors and libraries.

[0064] The method can also be used to identify antigens that are presented to the immune system in the context of HLA. The identification of TCRs activated by APCs expressing the antigen indicates that the antigen is presented to T cells in the context of HLA.

[0065] All publications (including patent documents, scientific papers, and databases) mentioned in this application are incorporated by reference in their entirety for all purposes to the same extent as if each individual publication was individually incorporated by reference. If definitions set forth herein are contrary to or otherwise inconsistent with definitions set forth in patents, applications, published applications, and other publications incorporated herein by reference, the definitions set forth herein take precedence over those incorporated herein by reference.

[0066] The section headings used herein are for organizational purposes only and are not to be construed as limiting the subject matter described.

[0067] I. Tumor Neoantigens

[0068] In some embodiments, the embodiments provided relate to identifying tumor or cancer-associated antigens, such as tumor neoantigens. Tumor neoantigens can be, but are not limited to, antigens expressed in tumors from specific subjects, such as patient-specific tumor neoantigens. Tumor neoantigens may comprise full-length proteins or fragments thereof, which contain, for example, mutant amino acids, insertions or deletions. In some embodiments, tumor neoantigens comprise epitopes (e.g., neoepitopes or tumor neoepitopes). In some embodiments, peptide epitopes can be presented in combination with major histocompatibility complexes (MHC) on the surface of antigen-presenting cells (APCs) to be recognized by T cell receptors (TCRs) or cells expressing TCRs. In some embodiments, the neoantigens contain amino acid mutations (substitutions, deletions, and / or insertions) relative to corresponding peptides from normal, non-cancerous or non-tumor cells or tissues in the subject or from control subjects without cancer. In some embodiments, the neoantigens are expressed at higher levels in cancerous tissues relative to the expression of corresponding peptides from normal, non-cancerous or non-tumor cells or tissues in the subject or control subjects without cancer. In some embodiments, the expression of neoantigens promotes cancer growth.

[0069] In some embodiments, a computational method based on sequencing of a sample from a subject is used to identify tumor neoantigens (or candidate tumor neoantigens). In some embodiments, the computational method comprises comparing DNA and / or RNA sequences or expression levels identified in a tumor sample from a subject with DNA and / or RNA sequences or expression levels identified in a non-tumor sample obtained from the same subject or a control sample obtained from a subject who has never had a tumor or cancer.

[0070] In some embodiments, the neoantigen is an antigen involved in a tumor or cancer, or a disease associated with malignant growth or transformation of a cell. In some embodiments, the neoantigen is an intracellular protein antigen from a tumor or cancer cell. In some embodiments, the neoantigen is a tumor-associated antigen, and / or an antigen derived from a viral pathogen or bacterial pathogen associated with a tumor or cancer. In some embodiments, a tumor or cancer neoantigen is an antigen that can be found on a malignant cell, found within a malignant cell, or that serves as a mediator of tumor cell growth. In some embodiments, a tumor or cancer neoantigen is a neoantigen that is primarily expressed by tumor cells or cancer cells compared to normal, non-cancerous, or non-tumor cells or tissues in a subject or a control subject that does not have cancer. In some embodiments, a tumor or cancer neoantigen is overexpressed in a subject's tumor compared to normal, non-cancerous, or non-tumor cells or tissues in a subject or a control subject that does not have cancer. In some embodiments, the neoantigen is a virus-associated cancer antigen. The method is capable of identifying and screening viral or cancer antigens derived from intracellular proteins that can only be targeted to the cell surface through TCR in the context of MHC molecules. In some embodiments, tumor antigens include, but are not limited to, mutated peptides, differentiation antigens, and overexpressed antigens, all of which can be used as targets for immunotherapies such as, but not limited to, ACT.

[0071] In some embodiments, the neoantigen polypeptide binds or is predicted to bind to MHC with an IC50 or Kd value of less than 500 nM, less than 400 nM, less than 300 nM, less than 200 nM, less than 100 nM, less than 80 nM, less than 50 nM, less than 20 nM, or less than 10 nM.

[0072] In some embodiments, the neoantigen that binds to MHC class I is a polypeptide of about 8 to about 15 amino acids in length. In some embodiments, the neoantigen that binds to MHC class I is a polypeptide of about 8, 9, 10, 11, 12, 13, 14, or 15 amino acids in length. In some embodiments, the neoantigen that binds to MHC class I is a polypeptide of about 8 to about 11 amino acids in length. In some embodiments, the neoantigen that binds to MHC class I is a polypeptide of about 8 to about 25 amino acids in length. In some embodiments, the neoantigen that binds to MHC class I is a polypeptide of about 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 amino acids in length. In some embodiments, the neoantigen that binds to MHC class I is a polypeptide that contains a sequence motif that promotes proteasome cleavage or a sequence motif that promotes transport of a transporter (TAP) associated with antigen processing, or is located near these sequence motifs in its native protein context. In some embodiments, the neoantigens that bind to MHC class I are polypeptides that contain sequence motifs that promote cleavage by extracellular or lysosomal proteases (e.g., cathepsins) in their native protein context, or are located near these sequence motifs. In some embodiments, the neoantigens that bind to MHC class I are polypeptides that contain sequence motifs that promote HLA-DM-catalyzed HLA binding in their native protein context, or are located near these sequence motifs.

[0073] In some embodiments, a neoantigen or a peptide epitope thereof (e.g., a neoepitope) is presented on the surface of a tumor. The neoantigen can be immunogenic in a subject with a tumor, for example, capable of eliciting a T cell response or a B cell response in the subject. The length of the peptide epitope of a tumor neoantigen can be about 5 to about 30 amino acids or longer. In some embodiments, the length of the peptide epitope of a tumor neoantigen is 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 amino acids.

[0074] In some embodiments, the neoantigen or neoepitope thereof is presented on an HLA protein. In some embodiments, the neoantigen or neoepitope binds to an HLA molecule with a greater affinity than the corresponding peptide identified from normal, non-cancerous tissue or cells. In some embodiments, the neoantigen or neoepitope binds to an HLA molecule with an IC of less than 500 nM, less than 400 nM, less than 300 nM, less than 200 nM, less than 100 nM, less than 80 nM, less than 50 nM, less than 20 nM, or less than 10 nM. 50 Binds to HLA proteins.

[0075] In some embodiments, new antigens or new epitopes are identified using any of the methods described herein. In some embodiments, new antigens or new epitopes are identified using other known sources such as the Catalogue of Somatic Mutations in Cancer (COSMIC), which compiles comprehensive information on somatic mutations in human cancers.

[0076] Neoantigens (including any neoantigen identified herein or identified using the methods described herein) can be encoded by polynucleotides. Polynucleotides can be, but are not limited to, DNA, cDNA, PNA, CNA, or RNA (e.g., mRNA). Polynucleotides can be single-stranded or double-stranded.

[0077] In some embodiments, if genetic mutations in a tumor result in changes in the amino acid sequence of a protein that is only in the tumor, they can be considered for immune targeting of the tumor. Exemplary mutations that can generate tumor neoantigens include: (1) non-synonymous mutations that result in a different amino acid in the protein; (2) read-through mutations in which the stop codon is modified or deleted, resulting in the translation of a longer protein with a new tumor-specific sequence at the C-terminus; (3) splice site mutations that result in the inclusion of introns in the mature mRNA, thereby generating a unique tumor-specific protein sequence; (4) chromosomal rearrangements that result in a chimeric protein with a tumor-specific sequence at the junction of two proteins (i.e., a gene fusion); and (5) frameshift mutations or deletions that result in a new open reading frame with a new tumor-specific protein sequence. Mutations can also include one or more of non-frameshift indels, missense or nonsense substitutions, splice site changes, genomic rearrangements or gene fusions, or any genomic or expression changes that result in neoORFs.

[0078] In some embodiments, neoantigens or epitopes thereof (e.g., neoepitopes) are identified by sequencing DNA, RNA, or protein in tumor cells relative to normal cells, such as peptides or polypeptides with mutations resulting from, for example, splice site, frameshift, readthrough, or gene fusion mutations in tumor cells.

[0079] In some embodiments, a variety of methods can be used to detect the presence of specific mutations or alleles in the DNA or RNA of an individual. In some embodiments, a method for accurate, easy and cheap large-scale SNP genotyping can be used. For example, several technologies have been described, including dynamic allele-specific hybridization (DASH), microplate array diagonal gel electrophoresis (MADGE), pyrophosphate sequencing, oligonucleotide specific connection, TaqMan system and various DNA "chip" technologies, such as Affymetrix SNP chips. These methods utilize the amplification of the target genetic region, usually by PCR. In some embodiments, another method is based on the production of small signal molecules by invasive cleavage, followed by mass spectrometry or immobilized padlock probes and rolling circle amplification. In some embodiments, the type of high-throughput or massively parallel sequencing is used to sequence the DNA and RNA sequences of tumor samples and non-tumor samples from subjects to identify candidate tumor neoantigens or neoepitopes. Exemplary methods of high-throughput sequencing include pyrophosphate sequencing, sequencing by reversible terminator chemistry, sequencing by ligase-mediated connection, and fluorescent nucleotides or real-time sequencing of phosphate linkages. Templates for sequencing can be prepared by any available technique, including, for example, emulsion PCR, clonal bridge amplification, and mesh DNA nanoballs. In some techniques, a single template molecule is sequenced.

[0080] To identify peptide epitopes that can be complexed with and presented by MHC molecules, any of the methods described herein or any known methods, such as the pan-allele / pan-length algorithm, can be used. Neilsen et al., Genome Med. 2016, 8:33.

[0081] II. Identification of Neoantigens

[0082] Provided herein are methods involving the identification of candidate tumor neoantigens or epitopes of candidate tumor neoantigens (e.g., candidate tumor neoepitopes). In some embodiments, these methods relate to computational or bioinformatics analysis of sequences from biological samples of subjects (e.g., patients with tumors or cancer). The sequences analyzed can be RNA and / or DNA sequences. RNA and / or DNA sequences can be obtained using various high-throughput sequencing methods. The biological sample can be, but is not limited to, a tumor sample or non-tumor from a subject. For computational or bioinformatics analysis, the sequence from the tumor sample of the subject is compared with a sequence obtained from a normal non-tumor sample of the subject or a control subject who has never had cancer. In some aspects, these methods include obtaining DNA and / or RNA sequences from a tumor sample of the subject, and comparing these DNA and / or RNA sequences with corresponding DNA and / or RNA sequences from normal non-tumor samples of the same subject and / or from a control sample of a subject who has not had a tumor or cancer.

[0083] A. Biological samples

[0084] In some embodiments, one or more biological samples are analyzed to identify candidate tumor neoantigens or tumor neoepitopes. Biological samples can be, but are not limited to, tissues and / or cells or their products. The sample can include a tissue or cell sample obtained directly from a subject. In some embodiments, the sample comprises tissue or cells from a subject and processed, such as by purification, separation, centrifugation, genetic engineering (e.g., transduction with a viral vector), washing, and / or incubation. The tissue sample can be, but is not limited to, a tumor sample, a tumor biopsy sample, or a tissue sample. The cell can be, but is not limited to, a tumor cell, a tissue cell, a normal (non-cancerous) tissue cell, or a blood cell. The biological fluid can be, but is not limited to, blood.

[0085] Exemplary samples include, but are not limited to, whole blood, peripheral blood mononuclear cells (PBMC), white blood cells, bone marrow, thymus, tissue biopsy, tumor tissue or cells, leukemia cells, lymphoma cells, lymph node tissue or cells, intestinal associated lymphoid tissue or cells, mucosa associated lymphoid tissue or cells, spleen tissue or cells, other lymphoid tissues or cells, liver tissue or cells, lung tissue or cells, stomach tissue or cells, intestinal tissue or cells, colon tissue or cells, kidney tissue or cells, pancreatic tissue or cells, breast tissue or cells, bone tissue or cells, prostate tissue or cells, cervical tissue or cells, testicular tissue or cells, ovarian tissue or cells, tonsil tissue or cells, or other organ tissues or cells, and / or cells derived therefrom. Samples can be from cancerous tissue or cells and / or non-cancerous tissue or cells. In some embodiments, sample is or is obtained from a solid tumor. In some embodiments, sample is or is obtained from blood or a blood-derived sample. Blood or blood-derived samples can be or can be derived from apheresis or leukocyte removal products. In some embodiments, the non-tumor sample is or is derived from peripheral blood mononuclear cells (PBMCs).

[0086] In some embodiments, the first biological sample and the second biological sample are analyzed to identify candidate tumor neoantigens or tumor neoepitopes. The first biological sample comprises a tumor sample obtained from a subject. In some embodiments, the subject is a candidate for cell therapy (such as adoptive cell therapy or alloSCT). The second biological sample comprises a non-tumor (non-cancerous) sample. The second biological sample can be obtained from the subject or a control subject or a group of subjects without cancer.

[0087] In some embodiments, a sample comprises nucleic acid (eg, DNA and / or RNA) derived from one or more biological samples.

[0088] B. Computational Methods for Identifying Tumor Neoantigens

[0089] Methods for identifying neoantigens (e.g., tumor neoantigens or candidate tumor neoantigens) in subjects with a disease or condition (e.g., cancer) that can be treated by cell therapy, such as adoptive cell therapy or alloSCT, are described. These methods comprise comparing genomic DNA sequences and / or RNA sequences and / or expression profiles of tumor cells from the subject with corresponding genomic DNA sequences and / or RNA sequences and / or expression profiles of non-tumor cells from the same subject and / or from a control sample of a subject (or group of subjects) that does not have a tumor or cancer.

[0090] In some embodiments, these methods include computational analysis for identifying candidate mutations (e.g., variants or alleles present in tumor cells). The computational analysis described herein can be used to identify candidate mutations that generate tumor neoantigens or tumor neoepitopes. Neoantigens and neoepitopes are present in the genome, transcriptome, proteome, or exome of cancer cells from a subject, but not in normal tissue from the subject and / or from a control sample from a control subject that does not have a tumor or cancer.

[0091] The candidate mutation can be a somatic mutation. Somatic mutations that generate candidate neoantigens are identified by comparing tumor DNA with non-tumor DNA.

[0092] In some embodiments, sequence variations between tumor samples and non-tumor samples are further analyzed to identify non-synonymous mutations. Non-synonymous mutations result in changes in the amino acid sequence and are selected for further screening (e.g., to form new antigen minigenes and TMGs). In some embodiments, new antigens are selected based on cell structure, that is, mutations found in a high percentage of cells from a specific category or sample (e.g., tumor samples). For example, when more than 75% of cells have a specific mutation, the mutation can be selected as a new antigen.

[0093] In some embodiments, a computational neoantigen discovery process for identifying candidate tumor neoantigens is provided. The computational neoantigen discovery process is used to identify candidate tumor neoantigens. The process can be used as input nucleic acid sequencing data. The sequencing data can be obtained, for example, by whole genome DNA sequencing or exome sequencing of tumor and non-tumor tissues, and RNA sequencing of tumor tissues. In some embodiments, the computational neoantigen discovery process involves one or more steps, modules, programs, or scripts described herein. In some embodiments, multiple steps, modules, programs, or scripts described herein are executed sequentially and / or in parallel with respect to the process. Figure 1 An exemplary computational neoantigen discovery pipeline is depicted in A.

[0094] The process can include one or more of the following steps: (a) aligning the sequencing data to a reference genome (e.g., HG19 containing a decoy sequence); (b) aligning the RNA sequencing data using the Spliced ​​Transcripts Alignment to a Reference (STAR) module (Dobin et al., 2013, Bioinformatics, 29(1), 15-21); (c) aligning the DNA sequencing data using the Burrows-Wheeler Aligner (BWA) module (Li and Durbin, 2010, Bioinformatics, 26(5), 589-595); and (d) locally realigning and recalibrating the aligned tumor and non-tumor DNA sequences using standard GATK best practices (McKenna et al., 2010, Genome Research, 20(9), 1297-1303).

[0095] In some embodiments, neoantigens encoded by tumor-specific variants are identified. Tumor-specific variants are mutations that are present in tumor tissue but not in non-tumor tissue. Tumor-specific variants can be identified using one or more of the following: Mutect, Mutec2 (Benjamin et al., 2019, BioRxiv, 1–8. https: / / doi.org / 10.1101 / 861054), Somatic Sniper (Larson et al., 2012, Bioinformatics, 28(3), 311-317), VarScan2 (Koboldt et al., 2012, Genome Research, 22(3), 568-576) and Strelka2 (Kim et al., 2018, Nature Methods, 15, 591-594).

[0096] In some embodiments, neoantigens encoded by nonsynonymous variants are identified. Nonsynonymous variants are mutations that change the amino acid sequence encoded by a gene. In some embodiments, tumor-specific nonsynonymous variants are identified. Nonsynonymous variants can be identified using VEP (McLaren et al., 2016, Genome Biology, 17(1), 1–14) and / or SNPeff (Cingolani et al., 2012, Fly, 6(2), 80–92).

[0097] In some embodiments, the subject's HLA typing is predicted in the process. In some embodiments, the Seq2HLA (Boegel et al., 2012, Genome Medicine 4, Article No.: 102) and OptiType (Szolek et al., 2014, Bioinformatics, 30(23), 3310-3316) modules are used to predict HLA typing.

[0098] Using the described process, the computer constructs the sequence of one or more new antigen minigenes or tandem minigenes. In some embodiments, the new antigen minigene comprises a polypeptide fragment comprising an amino acid sequence encoding the identified mutation (e.g., tumor-specific non-synonymous variation) and its surrounding amino acids. Exemplary candidate new antigen minigenes include those described in Section III herein.

[0099] In some embodiments, the predicted new antigens are further analyzed for additional features. Further analysis can be, but is not limited to, predicted MHC binding, predicted binding to specific MHC alleles, expression levels, predicted ability to induce an immune response, processing, and self-similarity. MHC alleles can be, but are not limited to, MHC class 1 alleles. In some embodiments, the subject's MHC genotype is determined, and candidate new antigens or new epitopes predicted to bind to the MHC molecules expressed by the subject are selected. Human subjects carry two alleles of each of the three class I genes HLA-A, HLA-B, and HLA-C. Human subjects can express six different MHC-I alleles. HLA testing can be performed on a blood sample from the subject (e.g., on lymphocytes). HLA typing can be determined, for example, by testing HLA proteins on the surface of white blood cells using typical methods in the art or by testing DNA from the same cells. MHC binding predictions can be performed using NetMHCpan 4.0 and other methods known in the art for predicting MHC binding. (Jurtz et al., 2017, J Immunol 199(9), 3360-3368; Nielsen and Lund, 2009, BMC Bioinformatics, 10, 296; O'Donnell et al., 2018, Cell Systems 7(1), 129-132.E4).

[0100] In some embodiments, the binding affinity of the neo-epitope to the MHC molecule is analyzed, and a novel antigen binding protein with an IC of less than 500 nM, less than 400 nM, less than 300 nM, less than 200 nM, less than 100 nM, less than 80 nM, less than 50 nM, less than 20 nM, or less than 10 nM is selected. 50 or K dThe value is combined with the subject's MHC molecule or predicted new epitope. The expression level of the candidate neoantigen or neoepitope can be assessed using known methods for evaluating the expression level of protein or mRNA. For example, the method for measuring RNA expression level includes Northern blot, RT-qPCR, quantitative PCR on array, hybridization microarray, serial analysis of gene expression or high-throughput RNA sequencing (RNA-Seq). The predicted possibility that the candidate neoantigen will trigger an immune response can be completed using the predictive models available in the art. The method for measuring the expression level of the protein includes Western blot and enzyme-linked immunosorbent assay.

[0101] In some embodiments, a new antigen minigene is generated for all identified expressed candidate new antigens. In some embodiments, the identified new antigen minigenes are ranked. In some embodiments, the candidate new antigens are ranked based on MHC binding predictions. In some embodiments, the new antigens are ranked based on tumor expression levels. In some embodiments, the candidate new antigens are ranked based on the predicted likelihood of the new antigen eliciting an immune response (such as a T cell immune response) in the subject. In some embodiments, the new antigens are ranked based on multiple criteria (including MHC binding predictions and tumor expression levels). Sorting can be used to reduce the number of new antigens used in the method.

[0102] In some embodiments, the process generates one or more outputs, i.e., information or data generated by the process using the provided inputs. In some embodiments, the output includes the results of any pre-processing or processing steps of the process. For example, the output may include aligned sequencing data, one or more identified tumor-specific variants, predicted subject HLA typing, tumor-specific gene expression levels or summary statistics, graphical or non-graphical representations thereof. In some embodiments, the output comprises one or more neoantigen minigenes, which may be provided as amino acid sequences and / or nucleotide sequences. In some embodiments, the output includes a ranked list of neoantigen minigenes.

[0103] III. Evaluation of Candidate Tumor Neoantigens

[0104] Methods for expressing one or more candidate tumor neoantigens or neoepitopes in one or more antigen presenting cells (APCs) are described, for example, based on identification of the methods described in Section II. In some embodiments, these methods involve generating a library of (e.g., containing multiple) APCs, each APC expressing one or more candidate tumor neoantigens or neoepitopes. In some embodiments, a neoantigen minigene system or a tandem minigene system is used to express candidate tumor neoantigens or neoepitopes. In some embodiments, a library of APCs expressing one or more candidate tumor neoantigens or neoepitopes can be used to present antigens to cells expressing T cell receptors (TCRs). APCs expressing neoantigens can be used to identify TCRs that are specific for tumor neoantigens or neoepitopes from a subject. In some embodiments, a library of APCs can be used to screen a library of (e.g., containing multiple) cells expressing TCRs.

[0105] A. Neoantigen minigene

[0106] Neoantigen minigenes are described. Neoantigen minigenes encode polypeptide fragments comprising all or a portion of a gene, wherein a candidate neoantigen is identified, for example, according to the methods described herein, such as Section II. In some embodiments, the neoantigen minigene encodes all or a portion of a neoantigen or neoepitope. A neoantigen or neoepitope can be any neoantigen or neoepitope identified using any of the methods described for identifying neoantigens or neoepitopes. In some embodiments, the neoantigen minigene encodes a polypeptide comprising an identified mutation (e.g., a mutated amino acid resulting from a tumor-specific non-synonymous variation) and its surrounding amino acids. For example, the neoantigen minigene may encode a polypeptide containing a mutated amino acid and one or more amino acids upstream and / or downstream of the mutated amino acid. In some embodiments, the neoantigen minigene encodes a peptide of about 8 to about 30 amino acids containing a mutated amino acid. In some embodiments, the neoantigen minigene encodes a peptide of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acids containing the mutated amino acid. In some embodiments, the neoantigen minigene encodes the mutated amino acid and about 4 to about 15 upstream amino acids and about 4 to about 15 downstream amino acids. In some embodiments, the neoantigen minigene encodes the mutated amino acid and 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 upstream amino acids and 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 downstream amino acids. In some embodiments, the neoantigen minigene encodes 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 amino acids upstream and downstream of the mutated amino acid. In some embodiments, the neoantigen minigene comprises a 25-amino acid sequence comprising a mutated amino acid and 12 amino acids upstream and downstream of the mutated amino acid. In some embodiments, the neoantigen minigene is contained in a vector. The neoantigen minigene vector can be, but is not limited to, a plasmid or a viral vector. The viral vector can be, but is not limited to, a lentiviral vector. The vector can be used to transfect or transduce APCs. The vector can be used to express the neoantigen minigene in APCs.

[0107] In some embodiments, the neoantigen minigene vector further encodes one or more amino acid sequences in addition to the neoantigen minigene. When the neoantigen minigene is expressed in an antigen-presenting cell, one or more additional amino acid sequences can be used to enhance the processing and / or presentation of the neoantigen on MHC-I. For example, the neoantigen minigene vector can encode ubiquitin, which can be, but is not limited to, a modified N-terminal ubiquitin portion with a G76V mutation. In some embodiments, the modified ubiquitin portion promotes proteasomal degradation of the polypeptide to maximize the presentation of the neoantigen encoded by the neoantigen minigene on MHC-I. In some embodiments, the neoantigen minigene vector encodes a spacer sequence between the N-terminal ubiquitin portion and the neoantigen minigene. In some embodiments, the spacer has the amino acid sequence AAY.

[0108] In some embodiments, the neoantigen minigene vector further encodes a marker for identifying or selecting cells transfected / transduced with the vector. In some embodiments, the marker is truncated nerve growth factor (tNGFR) or a fluorophore (e.g., GFP, RFP, mCherry).

[0109] In some embodiments, a library of neoantigen minigene vectors is provided. The neoantigen minigene vector library comprises a variety of neoantigen minigene vectors encoding a variety of neoantigens. The neoantigen minigene library may comprise all (complete mutation group), almost all, greater than 95%, greater than 90%, greater than 85%, greater than 80%, greater than 75%, greater than 70%, greater than 60% or greater than 50% or a subset of the neoantigens identified from a tumor or subject. In some embodiments, the neoantigen minigene library may comprise all, almost all, greater than 95%, greater than 90%, greater than 85%, greater than 80%, greater than 75%, greater than 70%, greater than 60% or greater than 50% or a subset of the neoantigens identified using the computational method.

[0110] In some embodiments, a new antigen minigene is generated using a synthetic DNA sequence (e.g., a gene block (gblock)). The gene block can be inserted into a viral vector using seamless cloning (e.g., Gibson assembly or NEBuilder HiFi DNA assembly). The gene block is synthesized to encode the antigen of interest (e.g., minigene) and sufficient sequence (e.g., 20-40 nucleotides) that overlaps with the sequence of the vector into which the gene block is to be inserted.

[0111] B. Tandem minigenes

[0112] Tandem minigenes (TMGs) are also described. A TMG is a polynucleotide encoding two or more neoantigen minigenes. In some embodiments, a TMG encodes two or more neoantigen minigenes in tandem. The tandem minigene vectors may encode at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, or at least 10 candidate neoantigens or fragments thereof (including neoepitopes). In some embodiments, each tandem minigene vector encodes about 2 to about 10 candidate neoantigens or fragments thereof. In some embodiments, each tandem minigene vector encodes about 5 to about 10 candidate neoantigens or fragments thereof. The nucleic acid sequence encoding the neoantigen minigene in the TMG may be continuous or separated by a spacer. In some embodiments, two or more neoantigens are expressed as fusion polypeptides. In some embodiments, the expressed fusion polypeptide is processed and cleaved into peptide fragments, each of which may contain the identified candidate neoepitopes. The length of the TMG may be up to about 2000 to about 3000 nucleotides. In some embodiments, the TMG is contained in a vector (i.e., a TMG vector). The TMG vector can be, but is not limited to, a plasmid (non-viral vector) or a viral vector. The viral vector can be, but is not limited to, a lentiviral vector. The vector can be used to transfect or transduce APCs. The vector can be used to express TMG in APCs. A schematic diagram of an exemplary construct of TMG is depicted in Figures 3 and 4 middle.

[0113] In some embodiments, TMG further encodes one or more amino acid sequences in addition to the two or more neoantigen minigenes. In some embodiments, when TMG is expressed in antigen-presenting cells, one or more additional amino acid sequences can be used to enhance the processing and / or presentation of neoantigens on MHC-I. For example, TMG can encode ubiquitin. Ubiquitin can be, but is not limited to, a modified N-terminal ubiquitin portion having a G76V mutation. In some embodiments, the sequence encoding ubiquitin is located 5' of the neoantigen minigene. In some embodiments, the modified ubiquitin portion promotes proteasomal degradation of the polypeptide to maximize the presentation of the neoantigen encoded by TMG on MHC-I.

[0114] In some embodiments, TMG encodes one or more spacers (i.e., linkers). The spacers comprise intervening amino acid sequences between TMG elements (e.g., between neoantigen minigenes). In some embodiments, TMG encodes one or more spacer sequences between each neoantigen minigene. In some embodiments, TMG encodes one or more spacer sequences between the N-terminal ubiquitin portion and the neoantigen minigene. In some embodiments, the spacer is designed to promote efficient processing and presentation of the neoantigen minigene when TMG is expressed in APCs. The spacers between neoantigen minigenes and / or between the ubiquitin encoding sequence and the neoantigen minigene may be the same or different. The spacers between neoantigen minigenes or between the ubiquitin encoding sequence and the neoantigen minigene may encode the same amino acid sequence or different amino acid sequences. In some embodiments, at least one of these spacers encodes the amino acid sequence AAY. In some embodiments, each spacer in TMG encodes the amino acid sequence AAY.

[0115] In some embodiments, the TMG vector further encodes a marker for identifying or selecting cells transfected / transduced with the vector. In some embodiments, the marker is truncated nerve growth factor (tNGFR) or a fluorophore (e.g., GFP, RFP, mCherry).

[0116] In some embodiments, a library of TMG vectors is provided. The TMG vector library comprises a variety of TMG vectors encoding a variety of neoantigens. The TMG library may comprise all, almost all, greater than 95%, greater than 90%, greater than 85%, greater than 80%, greater than 75%, greater than 70%, greater than 60% or greater than 50% or a subset of the neoantigens identified from the subject. In some embodiments, the TMG library may comprise all, almost all, greater than 95%, greater than 90%, greater than 85%, greater than 80%, greater than 75%, greater than 70%, greater than 60% or greater than 50% or a subset of the neoantigens identified using the computational method. The TMG vector library may contain one or more neoantigen minigene vectors (e.g., vectors encoding a single neoantigen minigene).

[0117] In some embodiments, TMGs are generated using synthetic DNA sequences (e.g., gene blocks). Seamless cloning (e.g., Gibson assembly or NEBuilder HiFi DNA assembly) can be used to insert the gene blocks into the vector. The synthetic gene blocks encode about 1 to about 10 minigenes of interest with optional spacer sequences and sufficient sequence (e.g., 20-40 nucleotides) to overlap with the sequence of the vector into which the gene blocks are to be inserted.

[0118] C. Cloning of Antigen-Encoding Vectors

[0119] In some embodiments, a nucleic acid encoding an antigen (including but not limited to a protein, a protein fragment, an antigenic epitope, a neoantigen, a neoantigenic epitope, a minigene, or a tandem minigene) is synthesized (e.g., by chemical synthesis (e.g., gene block) or amplification (e.g., PCR)) as a linear nucleic acid containing sequences suitable for Gibson cloning into a vector at the 5' and 3' ends. Sequences suitable for Gibson cloning comprise sequences of about 20 to about 40 nucleotides in length that overlap (are complementary) with sequences in the vector into which the nucleic acid encoding the antigen is to be cloned (inserted). Overlapping sequences facilitate seamless (e.g., Gibson) cloning. In some embodiments, the vector into which the nucleic acid encoding the antigen is cloned contains, in sequence, a promoter, a sequence encoding ubiquitin (e.g., G67V ubiquitin), a first 2A element, and a first marker. The first marker may be, but is not limited to, a selective marker suitable for mammalian cells (e.g., APCs). The selective marker may be, but is not limited to, a resistance gene. The resistance gene may be, but is not limited to, an antibiotic resistance gene. The antibiotic resistance gene may be, but is not limited to, a puromycin resistance gene. The nucleic acid encoding the antigen (e.g., a gene block) is constructed so that it is inserted into the vector and is located between the sequence encoding ubiquitin and the 2A element, resulting in ubiquitin, antigen, 2A element, and the first marker being in frame with each other (i.e., each of ubiquitin, antigen, and the first marker is expressed from a promoter). In some embodiments, the vector further comprises a second 2A element and a second marker in frame with the first selective marker. The second marker can be, but is not limited to, a detectable marker detectable in mammalian cells. The detectable marker can be, but is not limited to, a cell surface protein (e.g., tNGFR) or a fluorescent protein. In some embodiments, the vector further comprises a post-transcriptional regulatory element downstream of the first marker and / or the second marker. The post-transcriptional regulatory element can be, but is not limited to, a Woodchuck hepatitis virus post-transcriptional regulatory element (WPRE). In some embodiments, the vector further comprises a bacterial selective marker (e.g., an ampicillin resistance gene). In some embodiments, the vector further comprises a ccdB gene located between the ubiquitin sequence and the 2A element. The ccdB gene can be operably linked to an inducible promoter (e.g., LacI).

[0120] In order to insert the nucleic acid encoding the antigen (e.g., minigene or TMG) ​​into the vector by seamless cloning, the vector is first linearized (by digesting the circular plasmid, or by synthesizing (e.g., by PCR) linear vectors) so that the vector contains a gap (e.g., double-strand break) between the sequence encoding ubiquitin and the first 2A element. If present, the ccdB gene is removed during vector linearization. The nucleic acid encoding the antigen is incubated with the linearized vector, enzymes (e.g., exonucleases, DNA polymerases, and DNA ligases) and other components suitable for seamless (e.g., Gibson) cloning. After seamless cloning, the vector expressing the antigen is transformed into bacteria. In some embodiments, plasmids are isolated from bacteria without the need for plating or separating bacterial colonies. In some embodiments, multiple nucleic acids encoding different antigens are cloned in parallel into the vector. In some embodiments, about 1 to about 500 antigen expression vectors are cloned in parallel. In some embodiments, about 1 to about 100 antigen expression vectors are cloned in parallel. In some embodiments, the cloning reaction is carried out in about 0.1 μL to about 500 μL. In some embodiments, the cloning reaction is performed in less than 1 μL. In some embodiments, the cloning reaction is performed in about 0.1 μL, about 0.15 μL, about 0.2 μL, about 0.25 μL, about 0.3 μL, about 0.35 μL, about 0.4 μL, about 0.45 μL, about 0.5 μL, about 0.55 μL, about 0.6 μL, about 0.65 μL, about 0.7 μL, about 0.75 μL, about 0.8 μL, about 0.85 μL, about 0.9 μL, or about 0.95 μL. In some embodiments, the cloning reaction is performed in about 1 μL to about 50 μL. In some embodiments, the cloning reaction is performed in about 1 μL, about 1.5 μL, about 2 μL, about 2.5 μL, about 3 μL, about 4 μL, about 5 μL, about 6 μL, about 7 μL, about 8 μL, about 9 μL, about 10 μL, about 15 μL, about 20 μL, about 25 μL, about 30 μL, about 40 μL, or about 50 μL.

[0121] If the ccdB gene is present in the original vector, the nucleic acid encoding the antigen is inserted into the vector to replace the ccdB gene during cloning. During the cloning of the nucleic acid encoding the antigen, the deletion of the ccdB gene in the vector can be used as a selection basis for assembled antigen expression vectors in bacteria. The nucleic acid encoding the antigen is correctly inserted into the vector, resulting in a vector expressing ubiquitin, the antigen, the first marker, and an optional second marker in mammalian cells (e.g., APCs).

[0122] Analysis of nucleic acid sequences from subject cells, identification of candidate neoantigens, and preparation of neoantigen expression vectors can be completed in about 2 weeks or less.

[0123] D. Expression of neoantigens in antigen-presenting cells

[0124] Antigen presenting cells (APCs) expressing neoantigens and methods for expressing neoantigens in APCs are described. These methods include inserting one or more of the neoantigen minigenes, neoantigen minigene vectors, TMG or TMG vectors, or a combination thereof, into one or more APCs to provide an APC library expressing neoantigens. The APC can be any cell line suitable for transfection or transduction, expressing neoantigen minigenes and / or TMG, and presenting processed neoantigens for TCR activation (via MHC / HLA). The APC can be, but is not limited to, a lymphoblastoid cell line (LCL). In some embodiments, the APC expresses one or more HLAs. The HLA can be, but is not limited to, HLA-A, HLA-B, and HLA-C. In some embodiments, the APC is HLA-matched to the subject.

[0125] Any suitable method for introducing the neoantigen minigene or TMG into APCs can be used, which results in expression of the neoantigen minigene and TMG in APCs. Various methods for introducing nucleic acids and nucleic acid vectors into cells are known in the art. These methods include non-viral and viral methods. Non-viral methods include, but are not limited to, electroporation (see, e.g., Chicaybam et al., (2013) PLoS ONE 8(3):e60298 and Van Tedeloo et al., (2000) Gene Therapy 7(16):1431-1437), transposition (see, e.g., Manuri et al., (2010) Hum Gene Ther 21(4):427-437; Sharma et al., (2013) Molec Ther Nucl Acids 2, e74; and Huang et al., (2009) Methods Mol Biol 506:115-126), calcium phosphate transfection (see, e.g., Current Protocols in Molecular Biology, John Wiley & Sons, New New York, NY), protoplast fusion, cationic lipid-mediated transfection (lipofection), tungsten particle-facilitated microprojectile bombardment (see, e.g., Johnston, Nature, 346:776-777 (1990)), and strontium phosphate DNA coprecipitation (see, e.g., Brash et al., Mol. Cell Biol., 7:2031-2034 (1987)). Viral vectors include, but are not limited to, retroviral vectors (e.g., Moloney murine leukemia virus (MoMLV), myeloproliferative sarcoma virus (MPSV), murine embryonic stem cell virus (MESV), murine stem cell virus (MSCV), or spleen focus forming virus (SFFV)) and lentiviruses (see, e.g., U.S. Patent Nos. 5,219,740, 6,207,453, and 5,219,740; Miller and Rosman (1989) BioTechniques 7:980-990; Miller, AD (1990) Human Gene Therapy 1:5-14; Scarpa et al., (1991) Virology 180:849-852; Burns et al., (1993) Proc. Natl. Acad. Sci. USA 90:8033-8037; and Boris-Lawrie and Temin (1993) Cur. Opin. Genet. Develop. 3:102-109).Lentiviral transduction is described, for example, in Wang et al. (2012) J. Immunother. 35(9):689-701; Cooper et al. (2003) Blood. 101:1637–1644; Verhoeyen et al. (2009) Methods Mol Biol. 506:97-114; and Cavalieri et al. (2003) Blood. 102(2):497-505.

[0126] In some embodiments, APCs are transfected or transduced with a vector encoding a neoantigen minigene or TMG. In some embodiments, multiple APCs are transfected or transduced with a library of neoantigen minigene vectors or a library of TMG vectors. In some embodiments, transfected / transduced APCs are selected or enriched based on the expression of a marker encoded by the neoantigen minigene or TMG vector. In some embodiments, enrichment of transfected / transduced APCs is performed by FACS.

[0127] The neoantigen minigene or TMG vector is introduced into the APC, resulting in the expression of one or more neoantigens in the APC. In some embodiments, the encoded neoantigen is processed by the APC. Processing may include, for example, cleavage by components of the proteasome and / or complexing with MHC molecules, and presentation on the cell surface of the APC. In some embodiments, the encoded TMG is processed by the APC. Processing may include, for example, cleavage of the encoded TMG polypeptide into two or more neoepitopes by components of the proteasome, which may then be complexed with or loaded onto MHC molecules for presentation on the cell surface of the APC.

[0128] In some embodiments, APCs are transfected or transduced with vectors encoding one or more proteins or protein fragments from pathogens, allergens, or immune-related proteins. In some embodiments, multiple APCs are transfected or transduced with one or more proteins or protein fragments. Introduction of the vector into the APC results in expression of the one or more proteins or protein fragments in the APC. In some embodiments, the encoding of the one or more proteins or protein fragments is processed by the APC. Processing may include, for example, cleavage by components of the proteasome and / or complexation with MHC molecules, and presentation on the cell surface of the APC.

[0129] The MHC molecule can be an MHC class I molecule or an MHC class II molecule. The MHC class I molecule is a heterodimer having a transmembrane α chain (in some cases having three α domains) and a non-covalently bound β2 microglobulin. The MHC class I molecule is a heterodimer consisting of a 46kDa heavy chain non-covalently bound to a 12kDa light chain β-2 microglobulin. In humans, there are several MHC alleles. MHC alleles include, but are not limited to, HLA-A2, HLA-A1, HLA-A3, HLA-A24, HLA-A28, HLA-A31, HLA-A33, HLA-A34, HLA-B7, HLA-B45, and HLA-Cw8. The sequences of the MHC alleles are known and can be found in, for example, the IMGT / HLA database available from EMBL-EBI (IPD-IMGT / HLA). In some embodiments, the MHC class I molecule is an HLA-A2 molecule. HLA-A2 molecules can be, but are not limited to, subtypes HLA-A*02:01, *02:02, *02:03, *02:06, or *02:07. The frequency of MHC subtypes can vary between different populations. For example, over 95% of HLA-A2-positive Caucasians are HLA-A*02:01. It has been reported that approximately 23% of the Chinese population are HLA-A*02:01, 45% are HLA-A*02:07, 8% are HLA-A*02:06, and 23% are HLA-A*02:03. In some embodiments, the MHC molecule is HLA-A*02:01. Typically, MHC class II molecules are composed of two transmembrane glycoproteins, α and β, both of which typically span the membrane. An MHC molecule can include an active portion of the MHC, which contains one or more antigen binding sites for binding to a peptide and the sequences necessary for recognition by an appropriate binding molecule, such as a TCR. In some embodiments, MHC class I molecules deliver peptides originating from the cytosol to the cell surface where the peptide:MHC complex is recognized by T cells, typically T cells such as CD8 + T cells, but in some cases CD4+ T cells. In some embodiments, MHC class II molecules deliver peptides derived from the vesicle system to the cell surface where they are typically expressed by CD4 + T cell recognition. Typically, MHC molecules are encoded by a set of connected loci, which are collectively referred to as H-2 in mice and human leukocyte antigens (HLA). In some embodiments, human MHC may also be referred to as human leukocyte antigens (HLA).

[0130] In some embodiments, MHC I class-peptide complexes are expressed in CD8+T cells (such as cytotoxic T cells) and are identified by expressing MHC I class-peptide complexes. In some embodiments, MHC I class-peptide complexes are expressed in CD4+T cells (such as cytotoxic T cells) and are identified by expressing MHC I class-peptide complexes. In some embodiments, MHC I class-peptide complexes are expressed in CD4+T cells (such as cytotoxic T cells) and are identified by expressing MHC I class-peptide complexes. In some embodiments, MHC I class-peptide complexes are expressed in CD4+T cells (such as cytotoxic T cells) and are identified by expressing MHC I class-peptide complexes. In some embodiments, MHC I class-peptide complexes are expressed in CD4+T cells (such as cytotoxic T cells) and are identified by expressing MHC I class-peptide complexes. In some embodiments, MHC I class-peptide complexes are expressed in CD4+T cells (such as cytotoxic T cells) and are identified by expressing MHC I class-peptide complexes.

[0131] MHC class II proteins are expressed in a subset of nucleated vertebrate cells, including antigen presenting cells (APCs). In humans, MHC class II alleles include, but are not limited to, DR1, DR3, DR4, DR7, DR52, DQ1, DQ2, DQ4, DQ8, and DP1. In some embodiments, the MHC class II allele is HLA-DRB1*01:01, HLA-DRB*03:01, HLA-DRB*07:01, HLA-DRB*04:01, or HLA-DQB1*02:01. The sequences of MHC alleles are known and can be found, for example, in the IMGT / HLA database available from EMBL-EBI (IPD-IMGT / HLA).

[0132] In some embodiments, the length of MHC II class restricted peptide is generally about 9 to 25 amino acids, such as 15 to 25 amino acids in length, or 13 to 18 amino acids in length. MHC II class restricted peptide can contain a binding core region of about 9 amino acids to about 12 amino acids in length. MHC II class molecules can bind peptides derived from exogenous antigens, and these peptides are internalized by phagocytosis or endocytosis and processed in the endosome / lysosome pathway. The MHC II class-peptide complex displayed on the cell surface is generally recognized by CD4+ cells (such as helper T cells). In some embodiments, the MHC II class-peptide complex displayed can be recognized by the TCR expressed on CD8+T cells.

[0133] In some embodiments, an antigen-encoding vector (a vector encoding a neoantigen, a tandem minigene, a protein, a protein fragment, and / or other antigen) is introduced into an antigen-presenting cell (APC) that expresses one or more HLA alleles. HLA alleles include, but are not limited to, HLA-A, HLA-B, and HLA-C. APCs may express one or two alleles of each of HLA-A, HLA-B, and / or HLA-C. If an APC expresses two alleles of HLA-A, HLA-B, and / or HLA-C, then for each of HLA-A, HLA-B, and HLA-C, the two alleles may independently be the same or different. In some embodiments, the HLA alleles expressed by the APC match the subject. HLA matching indicates that the APC expresses the same HLA-A, HLA-B, and HLA-C alleles as the subject. In some embodiments, a vector encoding an antigen is introduced into a first APC that expresses a first set of HLA-A, HLA-B, and HLA-C alleles and a second APC that expresses a second set of HLA-A, HLA-B, and HLA-C alleles. Each of the HLA-A, HLA-B, and HLA-C alleles in the first and second APCs can independently be the same or different. In some embodiments, the first and second sets of HLA-A, HLA-B, and HLA-C alleles expressed in combination by the first and second APCs match the HLA genotype of the subject, such that the first and second APCs together express the same set of HLA-A, HLA-B, and HLA-C alleles as the subject. In some embodiments, a vector encoding an antigen is introduced into a first APC that expresses one or two HLA-A alleles, a second APC that expresses one or two HLA-B alleles, and a third APC that expresses one or two HLA-C alleles. In some embodiments, the one or two HLA-A alleles, one or two HLA-B alleles, and one or two HLA-C alleles expressed in combination by the first, second, and third APCs match the HLA genotype of the subject, such that the first, second, and third APCs collectively express the same set of HLA-A, HLA-B, and HLA-C alleles as the subject. The APCs may be, but are not limited to, B lymphoblastoid cells (B-LCLs) or artificial APCs. The artificial APCs may be, but are not limited to, K562 cells expressing MHC molecules. In some embodiments, the APCs are transfected or transduced with one or more vectors (such as one or more lentiviral vectors) encoding the desired HLA-A, HLA-B, and / or HLA-C alleles.

[0134] In some embodiments, the APC cell line expressing the neoantigen is established by an APC expressing the neoantigen or a population thereof. The APC cell line expressing the neoantigen can be amplified, stored (e.g., frozen in aliquots) and thawed for use in one or more experiments. Each APC expressing the neoantigen (or APC line expressing the neoantigen) in the library is maintained and / or stored in a separate vessel or container. If a given neoantigen minigene or tandem minigene is introduced into two or three APCs that are HLA-matched with the subject, the two or three APCs can be combined and maintained and / or stored together. Information about the identity of the neoantigen minigene or tandem minigene expressed by each APC can be recorded for each APC, including but not limited to nucleic acid sequence, amino acid sequence, and neoantigen source.

[0135] Neoantigen-expressing APCs (or neoantigen-expressing APC lines) containing different neoantigen expression vectors can be combined. Neoantigen-expressing APCs containing 1-20 different neoantigen expression vectors (including minigenes and / or tandem minigenes) can be combined to provide a pool of APCs. The pool of neoantigen-expressing APCs can express 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 different neoantigen expression vectors. In some embodiments, the pool of neoantigen-expressing APCs expresses about 1 to about 3 different neoantigen minigenes and / or tandem minigenes. In some embodiments, the pool of neoantigen-expressing APCs expresses about 1 to about 5 different neoantigen minigenes and / or tandem minigenes. In some embodiments, the pool of neoantigen-expressing APCs expresses about 1 to about 10 different neoantigen minigenes and / or tandem minigenes. In some embodiments, the pool of APCs expressing the neoantigen expresses up to about 20 different neoantigen minigenes and / or tandem minigenes. In some embodiments, the pool of APCs expressing the neoantigen expresses about 20 different neoantigen minigenes and / or tandem minigenes. In some embodiments, each neoantigen minigene or tandem minigene expressed in the pool of APCs expressing the neoantigen is expressed by at least about 5% of the cells in the pool of APCs expressing the neoantigen. In some embodiments, each neoantigen minigene or tandem minigene expressed in the pool of APCs expressing the neoantigen is expressed by at least about 10%, at least about 20%, at least 25%, at least about 33%, or at least about 50% of the cells in the pool of APCs expressing the neoantigen.

[0136] The expression of neoantigens in APCs, including the binding of neoantigens to MHC molecules and the presentation of MHC-neoantigen complexes on the cell surface of APCs, can be used to identify TCRs that recognize neoantigens in the context of MHC molecules.

[0137] In some embodiments, antigens (e.g., neoantigens or neoepitopes) are capable of inducing an immune response. Antigens can induce an immune response by TCR recognition on T cells. After the T cell TCR binds to the MHC-neoantigen complex, the TCR (or other MHC-peptide binding molecules) produces or triggers an activation signal for the T cell, which induces a T cell response, such as T cell proliferation, cytokine production, cytotoxic T cell response, or other responses.

[0138] The methods described herein for expressing new antigens in APCs and forming new antigen APCs or APC libraries expressing new antigens can also be used to express other antigens in APCs. Such antigens include, but are not limited to, pathogen antigens (e.g., bacterial antigens or viral antigens), antigens associated with allergens, or antigens associated with autoimmune diseases. Antigens can be expressed in APCs as minigenes or tandem minigenes, or antigens can be expressed in APCs as all or part of one or more proteins. APCs can be any cell line suitable for transfection or transduction, expressing antigens, and presenting processed antigens for TCR activation (via MHC / HLA). APCs can be, but are not limited to, lymphoblastoid cell lines (LCLs). In some embodiments, APCs express one or more HLAs. HLAs can be, but are not limited to, HLA-A, HLA-B, and HLA-C. In some embodiments, APCs are HLA-matched to the subject.

[0139] E.HLA-matched antigen-presenting cells

[0140] In some embodiments, APCs expressing HLA genes that match the subject can be obtained from a library of APCs expressing a combination of HLA-A, HLA-B, and HLA-C alleles.

[0141] In some embodiments, the library of APCs comprises a plurality of APCs, wherein each APC in the library expresses an HLA-A allele, an HLA-B allele, and an HLA-C allele. In some embodiments, each APC in the library encodes a single HLA-A allele, a single HLA-B allele, and a single HLA-C allele. In some embodiments, each APC in the library encodes 1 or 2 HLA-A alleles, 1 or 2 HLA-B alleles, and / or 1 or 2 HLA-C alleles. In some embodiments, the HLA-A alleles, HLA-B alleles, and HLA-C alleles present in the library are selected to encompass greater than 50%, greater than 60%, greater than 70%, greater than 75%, greater than 80%, greater than 85%, greater than 90%, greater than 95%, greater than 98%, or greater than 99% of the HLA-A alleles, HLA-B alleles, and HLA-C alleles present in a given population. In some embodiments, the HLA-A alleles, HLA-B alleles, and HLA-C alleles present in the library are provided in Table 1. In some embodiments, the combinations of HLA-A, HLA-B, and / or HLA-C alleles present in the APCs in the library are selected to encompass combinations of HLA-A, HLA-B, and HLA-C alleles present in greater than 50%, greater than 60%, greater than 70%, greater than 75%, greater than 80%, greater than 85%, greater than 90%, greater than 95%, greater than 98%, or greater than 99% of individuals in a population. The population can be, but is not limited to, an American population, a European population, a Middle Eastern population, an Asian population, a North American population, a South American population, an African population, subpopulations thereof (e.g., China or sub-Saharan Africa), and combinations thereof (e.g., American and European).

[0142] In some embodiments, APCs expressing HLA genes that match the subject can be obtained by introducing expression vectors encoding HLA-A, HLA-B, and HLA-C alleles that match the subject into one or more APCs. Expression vectors encoding matching HLA-A, HLA-B, and HLA-C alleles can be obtained from a library of expression vectors encoding multiple HLA-A, HLA-B, and HLA-C alleles. Each expression vector in the library can express a single HLA allele or a combination of HLA alleles. In some embodiments, each expression vector encodes a single HLA allele. In some embodiments, each expression vector encodes a combination of HLA alleles. The combination of HLA alleles can be two different HLA-A alleles, two different HLA-B alleles, two different HLA-C alleles, an HLA-A allele and an HLA-B allele, an HLA-A allele and an HLA-C allele, an HLA-B and an HLA-C allele, or an HLA-A allele, an HLA-B allele, and an HLA-C allele. In some embodiments, the library of expression vectors encoding HLA-A, HLA-B, and HLA-C alleles comprises a plurality of expression vectors each encoding a single HLA allele and a plurality of expression vectors each encoding an HLA-B allele and an HLA-C allele. Expression vectors encoding two or more HLA alleles can express two or more HLA alleles from a single promoter that has one or more translational modification elements (e.g., 2A elements or internal ribosome entry sites (IRES)) to allow two or more HLA alleles to be expressed from a single mRNA (i.e., bicistronic or tricistronic vectors). Expression vectors encoding one or more HLA alleles can further encode a selective marker. The selective marker can be expressed from a separate mRNA (i.e., from a separate promoter), or the selective marker can be expressed from the same promoter as the HLA allele. In some embodiments, the HLA-A alleles, HLA-B alleles, and HLA-C alleles present in the library are selected to encompass greater than 50%, greater than 60%, greater than 70%, greater than 75%, greater than 80%, greater than 85%, greater than 90%, greater than 95%, greater than 98%, or greater than 99% of the HLA-A alleles, HLA-B alleles, and HLA-C alleles present in a given population. In some embodiments, the HLA-A alleles, HLA-B alleles, and HLA-C alleles present in the library are provided in Table 1.In some embodiments, the combinations of HLA-A, HLA-B, and HLA-C alleles present in the library are selected to encompass combinations of HLA-A, HLA-B, and / or HLA-C alleles present in greater than 50%, greater than 60%, greater than 70%, greater than 75%, greater than 80%, greater than 85%, greater than 90%, greater than 95%, greater than 98%, or greater than 99% of individuals in a population. The population can be, but is not limited to, an American population, a European population, a Middle Eastern population, an Asian population, a North American population, a South American population, an African population, subpopulations thereof (e.g., China or sub-Saharan Africa), and combinations thereof (e.g., American and European).

[0143] Exemplary expression vectors include, but are not limited to:

[0144] (a) P-HLA-A-2A-ZEO-PRE,

[0145] (b) P-HLA-B-2A-ZEO-PRE,

[0146] (c) P-HLA-C-2A-ZEO-PRE,

[0147] (d)P-HLA-A-2A-HLA-A'-2A'-ZEO-PRE,

[0148] (e)P-HLA-B-2A-HLA-B'-2A'-ZEO-PRE,

[0149] (f)P-HLA-C-2A-HLA-C'-2A'-ZEO-PRE,

[0150] (g)P-HLA-A-2A-HLA-B-2A'-ZEO-PRE,

[0151] (h)P-HLA-A-2A-HLA-C-2A'-ZEO-PRE,

[0152] (i)P-HLA-B-2A-HLA-C-2A'-ZEO-PRE, or

[0153] (j)P-HLA-A-2A-HLA-B-2A'-HLA-C-2A'-ZEO-PRE;

[0154] in:

[0155] P includes a promoter,

[0156] HLA-A, HLA-A', HLA-B, HLA-B', HLA-C and HLA-C' encode HLA alleles,

[0157] 2A, 2A' and 2A" each encode a 2A element,

[0158] ZEO encodes a selectable marker, and

[0159] PREs encode post-transcriptional regulatory elements.

[0160] The promoter can be any promoter active in APC or artificial APC. The promoter can be a constitutive or inducible promoter. The promoter can be, but is not limited to, a CMV promoter, an Igκ promoter, a PGK promoter, an SV40 promoter, a β-actin promoter, an α-actin promoter, an SRα promoter, a herpes thymidine kinase promoter, a herpes simplex virus (HSV) promoter, a mouse mammary tumor virus long terminal repeat (LTR) promoter, adenovirus major late promoter (AdMLP), a Rous sarcoma virus (RSV) promoter, an immunoglobulin promoter, an EF1α promoter, a ubiquitin promoter, a MNDU3 promoter, a metallothionein promoter, an IFN gene promoter, or a GM-CSF gene promoter. In some embodiments, the promoter includes a human 3-phosphoglycerate kinase (hPGK) promoter.

[0161] The 2A element can independently be a P2A element, a T2A element, an F2A element, or an E2A element. The P2A element comprises a nucleotide sequence encoding a peptide having the amino acid sequence ATNFSLLKQAGDVEENPGP (SEQ ID NO: 1). In some embodiments, the P2A element comprises the nucleotide sequence: gccacgaacttctctctgttaaagcaagcaggagacgtggaagaaaaccccggtccc (SEQ ID NO: 2) or gccaccaacttttcattgctcaagcaggcgggcgatgtggaggaaaaccctggcccc (SEQ ID NO: 3). The T2A element comprises a nucleotide sequence encoding a peptide having the amino acid sequence EGRGSLLTCGDVEENPGP (SEQ ID NO: 4). In some embodiments, the T2A element comprises the nucleotide sequence: gagggcagaggaagtctgctaacatgcggtgacgtcgaggagaatcct-ggccca (SEQ ID NO: 5). The E2A element comprises a nucleotide sequence encoding a peptide having the amino acid sequence QCTNYALLKLAGDVESNPGP (SEQ ID NO:6). In some embodiments, the E2A element comprises the nucleotide sequence: cagtgtactaattatgctc-tcttgaaattggctggagatgttgagagcaaccctggacct (SEQ ID NO:7). The F2A element comprises a nucleotide sequence encoding a peptide having the amino acid sequence VKQTLNFDLLKLAGDVESNPGP (SEQ ID NO:8). In some embodiments, the E2A element comprises the nucleotide sequence: gtgaagcagaccctgaacttcgacctgctgaagctggccggcgacgtggaga-gcaaccccggcccc (SEQ ID NO:9).

[0162] The selectable marker may be, but is not limited to, an antibiotic resistance gene. The antibiotic resistance gene may be, but is not limited to, a Zeocin resistance gene (e.g., Shble gene).

[0163] The post-transcriptional regulatory element may be, but is not limited to, a woodchuck hepatitis virus post-transcriptional regulatory element (WPRE).

[0164] In some embodiments, the nucleic acid encoding the HLA allele is codon-optimized for expression in a human subject.

[0165] In some embodiments, any of the expression vectors can be created using seamless cloning (eg, Gibson assembly or NEBuilder HiFi DNA assembly).

[0166] The expression vector may be, but is not limited to, a lentiviral vector.

[0167] In the United States, more than 99% of people have an HLA-A allele selected from the 22 HLA-A alleles shown in Table 1. In the United States, more than 94% of people have an HLA-B allele selected from the 46 HLA-B alleles shown in Table 1. In the United States, more than 99% of people have an HLA-C allele selected from the 30 HLA-C alleles shown in Table 1. Therefore, a library of 98 expression vectors encoding 22 HLA-A alleles, 46 HLA-B alleles, and 30 HLA-C alleles can be used to generate APCs that are HLA-matched to more than 94% of the U.S. population.

[0168] In some embodiments, the library of expression vectors encoding HLA-A, HLA-B, and HLA-C alleles comprises a plurality of expression vectors each encoding a single HLA allele and a plurality of expression vectors each encoding an HLA-B allele and an HLA-C allele (i.e., an HLA-B / HLA-C combination). In some embodiments, the library of expression vectors encoding HLA-A, HLA-B, and HLA-C alleles comprises a plurality of expression vectors each encoding one or two HLA-A alleles, a plurality of expression vectors each encoding one or two HLA-B alleles, and a plurality of expression vectors each encoding one or two HLA-C alleles. In some embodiments, the HLA-A alleles present in the library are selected to encompass greater than 50%, greater than 60%, greater than 70%, greater than 75%, greater than 80%, greater than 85%, greater than 90%, greater than 95%, greater than 98%, or greater than 99% of the HLA-A alleles present in a given population. In some embodiments, the plurality of expression vectors each encoding a single HLA-A allele comprises an expression vector encoding each of the HLA-A alleles in Table 1. In some embodiments, the plurality of expression vectors each encoding one or two HLA-A alleles comprises an expression vector encoding the HLA-A alleles (alone or in combination) in Table 1. In some embodiments, the HLA-B alleles present in the library are selected to encompass greater than 50%, greater than 60%, greater than 70%, greater than 75%, greater than 80%, greater than 85%, greater than 90%, greater than 95%, greater than 98%, or greater than 99% of the HLA-B alleles present in a given population. In some embodiments, the plurality of expression vectors each encoding one or two HLA-B alleles comprises an expression vector encoding the HLA-B alleles (alone or in combination) in Table 1. In some embodiments, the HLA-C alleles present in the library are selected to encompass greater than 50%, greater than 60%, greater than 70%, greater than 75%, greater than 80%, greater than 85%, greater than 90%, greater than 95%, greater than 98%, or greater than 99% of the HLA-C alleles present in a given population. In some embodiments, the plurality of expression vectors each encoding one or two HLA-C alleles comprises expression vectors encoding the HLA-C alleles (alone or in combination) in Table 1. In some embodiments, the HLA-B and HLA-C alleles present in the library are selected to encompass greater than 50%, greater than 60%, greater than 70%, greater than 75%, greater than 80%, greater than 85%, greater than 90%, greater than 95%, greater than 98%, or greater than 99% of the HLA-B and HLA-C alleles present in a given population. In some embodiments, the plurality of expression vectors each encoding an HLA-B allele and an HLA-C allele includes an expression vector encoding each of the HLA-B and HLA-C alleles in Table 1.In some embodiments, the combinations of HLA-B and HLA-C alleles present in the library are selected to encompass combinations of HLA-B and HLA-C alleles present in greater than 50%, greater than 60%, greater than 70%, greater than 75%, greater than 80%, greater than 85%, greater than 90%, greater than 95%, greater than 98%, or greater than 99% of individuals in a population. In some embodiments, the plurality of expression vectors each encoding an HLA-B allele and an HLA-C allele comprises an expression vector encoding a combination of the HLA-B and HLA-C alleles listed in Table 2. The population can be, but is not limited to, an American population, a European population, a Middle Eastern population, an Asian population, a North American population, a South American population, an African population, subpopulations thereof (e.g., China or sub-Saharan Africa), and combinations thereof (e.g., the United States and Europe).

[0169] In some embodiments, APCs expressing HLA genes matching the subject can be obtained by introducing one or more expression vectors encoding HLA-B and HLA-C alleles matching the subject into one or more APCs expressing HLA-A alleles matching the subject. The expression vectors encoding HLA-B and HLA-C alleles can encode HLA-B alleles or HLA-C alleles, or a combination of HLA-B alleles and HLA-C alleles.

[0170] APCs expressing HLA-A genes that match the subject can be obtained from a library of APCs, wherein each APC in the library expresses one or two HLA-A alleles. In some embodiments, each APC in the library encodes a single HLA-A allele. In some embodiments, the HLA-A alleles present in the library are selected to cover more than 50%, more than 60%, more than 70%, more than 75%, more than 80%, more than 85%, more than 90%, more than 95%, more than 98%, or more than 99% of the HLA-A alleles present in a given population. In some embodiments, the HLA-A alleles present in the library are provided in Table 1. The population can be, but is not limited to, an American population, a European population, a Middle Eastern population, an Asian population, a North American population, a South American population, an African population, subpopulations thereof (e.g., China or sub-Saharan Africa), and combinations thereof (e.g., the United States and Europe). In the United States, over 99% of people have an HLA-A allele selected from the 22 HLA-A alleles shown in Table 1. Therefore, a library of 22 APCs expressing the 22 HLA-A alleles in Table 1 can be used to generate APCs that are HLA-A matched to over 99% of the U.S. population. By selecting the most prevalent HLA-A allele in a given population, different libraries of APCs expressing HLA-A alleles can be generated and used for different populations.

[0171] Expression vectors encoding matched HLA-B and HLA-C alleles can be obtained from a library of expression vectors each encoding an HLA-B allele and an HLA-C allele. In some embodiments, the HLA-B and HLA-C alleles present in the library are selected to encompass greater than 50%, greater than 60%, greater than 70%, greater than 75%, greater than 80%, greater than 85%, greater than 90%, greater than 95%, greater than 98%, or greater than 99% of the HLA-B and HLA-C alleles present in a given population. In some embodiments, the plurality of expression vectors each encoding an HLA-B allele and an HLA-C allele includes an expression vector encoding each of the HLA-B and HLA-C alleles listed in Table 1. In some embodiments, the combinations of HLA-B and HLA-C alleles present in the library are selected to encompass combinations of HLA-B and HLA-C alleles present in greater than 50%, greater than 60%, greater than 70%, greater than 75%, greater than 80%, greater than 85%, greater than 90%, greater than 95%, greater than 98%, or greater than 99% of individuals in a population. In some embodiments, the plurality of expression vectors each encoding an HLA-B allele and an HLA-C allele comprises an expression vector encoding a combination of the HLA-B and HLA-C alleles listed in Table 2. The population can be, but is not limited to, an American population, a European population, a Middle Eastern population, an Asian population, a North American population, a South American population, an African population, subpopulations thereof (e.g., China or sub-Saharan Africa), and combinations thereof (e.g., the United States and Europe). By selecting the most prevalent HLA-B alleles, HLA-C alleles, and combinations thereof in a given population, different libraries of expression vectors encoding different HLA-B and HLA-C alleles and combinations thereof can be generated and used in different populations.

[0172] Table 2 shows the top 16 HLA-B / HLA-C haplotypes (combinations) in the European population. Approximately 50 HLA-B / HLA-C combinations cover approximately 95% of European haplotypes. Approximately 16 HLA-B / HLA-C combinations cover approximately 70% of European population haplotypes (including European descent populations). Therefore, a library of 16 expression vectors encoding the 16 HLA-B / HLA-C combinations in Table 2 can be used to generate APCs that match HLA-B / HLA-C in more than 70% of European populations (including European descent populations). Approximately 30 HLA-B / HLA-C combinations cover approximately 88% of European population haplotypes (including European descent populations). Approximately 240 HLA-A / HLA-B combinations cover approximately 95% of European population haplotypes (including European descent populations). Approximately 448 HLA-A / HLA-C combinations cover approximately 95% of European population haplotypes (including European descent populations). Libraries with a corresponding number of HLA allele combinations can be used to generate APCs that are HLA-matched to a corresponding percentage of the European population (including populations of European descent).

[0173] Using the described libraries and methods for generating HLA-matched APCs, HLA-matched APCs can be readily generated for a large percentage of a population. For example, a library of APCs expressing 22 HLA-A alleles (or a library of expression vectors encoding 22 HLA-A alleles) can be combined with a library of expression vectors encoding 50 HLA-B / HLA-C combinations to generate 1,100 HLA-A / HLA-B / HLA-C combinations.

[0174] The APCs in a library expressing APCs that each express an HLA allele or combination of HLA alleles are maintained in separate containers such that all APCs in each separate container express the same HLA allele (e.g., HLA-A allele) or HLA allele combination. Thus, a library of APCs expressing 22 different HLA-A alleles comprises 22 separate containers, each of which contains an APC expressing one of the 22 HLA-A alleles. Similarly, a library of expression vectors encoding HLA alleles or combinations of HLA alleles comprises multiple separate containers, each of which contains one or more expression vectors, wherein all expression vectors in each separate container encode the same HLA allele or combination of HLA alleles. Thus, a library of expression vectors encoding 50 different HLA-B / HLA-C combinations comprises 50 separate containers, each of which contains an expression vector expressing one of the 50 different HLA-B / HLA-C combinations. The expression vector can be provided as a nucleic acid, a plasmid, a viral vector, or a cell containing a nucleic acid, a plasmid, or a viral vector. In some embodiments, the expression vector comprises a lentiviral vector. In some embodiments, the expression vector comprises a nucleic acid for producing a lentiviral vector. In some embodiments, a cell containing a nucleic acid, a plasmid, or a viral vector (e.g., a lentiviral vector) is included.

[0175] In some embodiments, the HLA genotype of the subject is determined, and APCs expressing each of the HLA alleles determined for the subject are selected from a library of APCs expressing the HLA alleles. If the APCs in the library each express a single HLA-A allele, HLA-B allele, and HLA-C allele, then two APCs are selected such that the two APCs combined together express the same HLA allele as the subject.

[0176] In some embodiments, generating HLA-matched APCs comprises:

[0177] (a) determining or having determined the HLA genotype of the subject;

[0178] (b) selecting a first APC expressing a first HLA-A allele of the subject and a second APC expressing a second HLA-A allele of the subject from a library of APCs expressing HLA-A alleles;

[0179] (c) selecting a first expression vector encoding a first HLA-B allele and a first HLA-C allele of the subject, and a second expression vector encoding a second HLA-B allele and a second HLA-C allele of the subject from a library of expression vectors each encoding an HLA-B / HLA-C combination; and

[0180] (d) introducing the first expression vector into the first APC, and introducing the second expression vector into the second APC.

[0181] In some embodiments, generating HLA-matched APCs comprises:

[0182] (a) determining or having determined the HLA genotype of the subject; and

[0183] (b) introducing one or more expression vectors encoding the subject's HLA-A alleles into a first APC, introducing one or more expression vectors encoding the subject's HLA-B alleles into a second APC, and introducing one or more expression vectors encoding the subject's HLA-C alleles into a third APC.

[0184] In some embodiments, the expression vector library comprises a lentiviral vector library.

[0185] Libraries of APCs expressing HLA alleles and / or libraries of expression vectors encoding HLA alleles provide a repository of readily available resources that can be used to rapidly generate HLA-matched APCs for the majority of subjects in a population. The HLA-matched APCs can then be used to generate new antigen expression libraries, which can then be used to screen TCRs. Using the libraries, stable HLA-matched APCs can be generated in less than 7 days. In some embodiments, stable HLA-matched APCs can be generated within 5 days. In some embodiments, stable HLA-matched APCs can be generated within 6 days. In some embodiments, stable HLA-matched APCs can be generated within 7 days.

[0186] Table 1. HLA alleles and frequencies in the US population.

[0187]

[0188]

[0189] Table 2. HLA-B / HLA-C haplotypes in European populations.

[0190] HLA-B HLA-C European frequencies Cumulative frequency sum B*07:02 C*07:02 0.13782 0.13782 B*08:01 C*07:01 0.12397 0.26179 B*44:02 C*05:01 0.07715 0.33894 B*40:01 C*03:04 0.05538 0.39432 B*35:01 C*04:01 0.05487 0.44919 B*57:01 C*06:02 0.03701 0.48620 B*15:01 C*03:03 0.03482 0.52102 B*44:03 C*16:01 0.03314 0.55416 B*14:02 C*08:02 0.03038 0.58454 B*13:02 C*06:02 0.02599 0.61053 B*15:01 C*03:04 0.02436 0.63489 B*38:01 C*12:03 0.02122 0.65611 B*18:01 C*07:01 0.01795 0.67406 B*51:01 C*15:02 0.01677 0.69083 B*27:05 C*02:02 0.01611 0.70694 B*18:01 C*12:03 0.01525 0.72219

[0191] III. Methods for Identifying T Cell Receptors Targeting Neoantigens

[0192] Methods and systems for isolating or cloning nucleic acid molecules encoding one or more TCRs from a subject using the minigene vector library and tandem minigene vector library are described. These methods include using APCs expressing new antigens identified from a subject to screen the TCR library for TCRs that specifically bind to one or more of these new antigens. In some embodiments, the methods and compositions can be used to rapidly identify specific TCRs of interest for use in treating a tumor or cancer in a subject.

[0193] In some embodiments, the methods and systems are provided for rapidly cloning TCRs, functionally expressing, and testing TCRs of numerous T cells from subject T cells in a massively parallel manner, which is cost-effective and requires almost no hands-on time. In some embodiments, the embodiments provided allow for rapid and accurate identification of TCRs that are specific to antigens expressed in tumors from specific subjects (e.g., patient-specific variants or various types of patient-specific tumor neoantigens). In some embodiments, the embodiments provided also include methods and systems for producing a large number of library cells (such as reporter cells), each of which expresses one of a plurality of cloned or isolated TCRs (such as functional full-length TCRs) from a subject. For example, it was observed that the methods and systems for separating and cloning TCRs achieved 100% coverage of all human TCR V regions, with an amplification efficiency of >95% for each chain, and an amplification efficiency of >85% for TCR chain pairs (e.g., TCRα and TCRβ chains). It was observed that using a high-throughput automated system, at least 1,400 TCR chain pairs could be amplified in one day, and at least 700 pairs could be expressed and screened in the following two days, with the cost of each TCR being very low.

[0194] A. Reporter T cells, cell lines, and libraries

[0195] In some embodiments, provided herein are reporter T cells for identifying TCRs that are activated in the presence of antigens (such as tumor neoantigens). In some embodiments, the reporter T cells express an isolated TCR and, when the expressed TCR is activated or stimulated and / or signal transduction is induced by the TCR, a "report" is emitted (e.g., expression or upregulation of a reporter gene).

[0196] In some embodiments, a reporter T cell is transfected or transduced with a functional TCR isolated from a subject, and the reporter T cell comprises and / or expresses the functional TCR, e.g., as described herein. In some embodiments, TCRs are isolated from tumor infiltrating lymphocytes (TILs). In some embodiments, TILs are isolated from a biological sample (such as a tumor). In some embodiments, TILs are isolated by fluorescence activated cell sorting (FACS). In some embodiments, TILs are isolated (i.e., sorted) based on a phenotype assessed by FACS. In some embodiments, TILs are CD8+ T cells. In some embodiments, TILs have CD69 hi / PD1 hi Phenotype. In some embodiments, TCRs are isolated from PBMC T cells. The subject can be an autologous subject or an allogeneic subject. The reporter T cell line is a population of reporter T cells that express the same functional TCR and the same detectable marker.

[0197] In some embodiments, the library of reporter T cells expressing functional TCRs is obtained by a method comprising the following steps: (1) amplifying a plurality of first amplification products and a plurality of second amplification products from cDNA generated from RNA obtained from a plurality of T cells obtained from a subject, wherein each first amplification product comprises a nucleic acid encoding an alpha variable (Vα) or a gamma variable (Vγ) segment, and each second amplification product comprises a nucleic acid encoding a beta variable (Vβ) or a delta variable (Vδ) segment, and wherein the first amplification product and the second amplification product from each T cell in the plurality of T cells are sorted into separate locations on a device, and (2) assembling the first amplification product and the second amplification product from each of the plurality of separate locations to obtain an assembled nucleic acid encoding a functional T cell receptor for each of the plurality of separate locations, wherein the functional T cell receptor comprises (i) a full-length alpha variable region and a full-length beta variable region from the single T cell, or (ii) a full-length gamma variable region and a full-length delta variable region from the single T cell. In some embodiments, the single T cells are sorted into separate locations prior to step (1). In some embodiments, a reverse transcription reaction is performed before step (1) to obtain cDNA. In some embodiments, more than 50, more than 100, more than 500, more than 1000 or more than 5000 T cells are sorted into separate locations. These separate locations can be the holes of a multi-well plate. The device can be, but is not limited to, a multi-well plate. The multi-well plate can be, but is not limited to, a 96-well plate, a 384-well plate or a 1536-well plate. Using the method, an expression vector is produced that encodes a functional TCR for each T cell from a plurality of T cells of a subject.

[0198] In some embodiments, the first amplification product comprises a nucleic acid encoding the leader (L) sequence of a Vα or Vγ segment, an α joining (Jα) or γ joining (Jγ) segment, and / or the 5' portion of an α constant (Cα) or γ constant (Cγ) region.

[0199] In some embodiments, the second amplification product comprises a nucleic acid encoding a leader (L) sequence of a Vβ or Vδ segment, a β diversity (Dβ) or δ diversity (Dδ) segment, a β joining (Jβ) or δ joining (Jδ) segment, and / or a 5' portion of a β constant (Cβ) or δ constant (Cδ) region.

[0200] In some embodiments, the first amplification product further comprises a first adapter sequence added to the amplification template sequence of the cDNA via a second round of amplification, and / or the second amplification product further comprises a second adapter sequence added to the amplification template sequence of the cDNA via a second round of amplification. The first adapter sequence and the second adapter sequence can be the same or different. In some embodiments, the first adapter sequence and the second adapter sequence are different.

[0201] In some embodiments, a functional T cell receptor comprises a full-length alpha constant region and a full-length beta constant region; or a full-length gamma constant region and a full-length delta constant region.

[0202] In some embodiments, each of the assembled nucleic acids is obtained without nucleic acid sequencing. In some embodiments, each of the assembled nucleic acids is obtained without restriction endonuclease cleavage reaction. In some embodiments, seamless cloning is used for the assembly.

[0203] In some embodiments, the assembled nucleic acid encoding a functional T cell receptor comprises a single nucleic acid sequence encoding a first amplification product and a second amplification product. Expression of the first amplification product and the second amplification product on the assembled nucleic acid can be driven by a single promoter or by different promoters. In some embodiments, expression of the first amplification product and the second amplification product on the assembled nucleic acid is driven by a single promoter. In some embodiments, the first amplification product and the second amplification product on the assembled nucleic acid are separated by an IRES element or a self-cleaving peptide.

[0204] In some embodiments, the assembled nucleic acid encoding a functional TCR is assembled into a TCR vector. The TCR vector can be, but is not limited to, a lentiviral vector.

[0205] A "T cell receptor" or "TCR" is a molecule containing an alpha chain and a beta chain (also referred to as TCRα and TCRβ, respectively) or a gamma chain and a delta chain (also referred to as TCRγ and TCRδ, respectively), and is capable of specifically binding to an antigen (e.g., a peptide antigen or peptide epitope, including a neoantigen or a neoepitope) bound to an MHC molecule. In some embodiments, the TCR is in the form of an alpha beta. αβTCR and γδTCR are structurally similar. However, T cells expressing αβTCR and γδTCR may have different anatomical locations or functions. In some embodiments, the TCR is an alpha beta TCR. In some embodiments, the TCR is a gamma delta TCR. Typically, the TCR is present on the surface of a T cell (i.e., a T lymphocyte), where it recognizes an antigen (e.g., a neoantigen or a neoepitope) bound to a major histocompatibility complex (MHC) molecule.

[0206] "TCR" may encompass a full-length TCR or its antigen-binding portion or its antigen-binding fragment. In some embodiments, the TCR is a complete or full-length TCR, such as a TCR containing an α chain and a β chain or a γ chain and a δ chain. In some embodiments, the TCR is an antigen-binding portion that retains the ability to bind to specific peptides associated with MHC molecules (such as new antigens or new epitopes) that are smaller than the full-length TCR. In some embodiments, the antigen-binding portion or fragment of the TCR contains only a portion of the domain of the full-length or complete TCR, but still retains the ability to bind to specific peptides associated with MHC molecules (such as new antigens or new epitopes) that are the same as the full-length TCR. In some embodiments, the antigen-binding portion contains the variable domains of the TCR, such as variable α (Vα) and variable β (Vβ) chains or variable γ (Vγ) and variable δ (Vδ) chains.

[0207] Typically, the specific binding of a TCR to a peptide epitope is determined by one or more complementarity determining regions (CDRs). Specific binding of a TCR to a peptide epitope (in the context of an MHC molecule) means that the TCR binds to the peptide epitope with a higher affinity than it does to other peptides (in the context of an MHC molecule). Higher affinity can be at least about 2 times, at least about 10 times, at least about 20 times, at least about 50 times, or at least about 100 times higher affinity.

[0208] In some embodiments, the variable domain of TCR contains CDRs (CDR-1, CDR-2 and CDR-3), which generally contribute to the antigen recognition, binding ability and specificity of peptides, MHC molecules and / or MHC-peptide complexes. The CDRs of TCR or their combinations form all or substantially all of the antigen binding sites of a given TCR molecule. The various CDRs in the variable region of the TCR chain are usually separated by framework regions (FRs), which usually show less variability between TCRs compared to CDRs (see, for example, Jores et al., Proc. Nat'l Acad. Sci. USA 87:9138, 1990; Chothia et al., EMBO J. 7:3745, 1988; also see Lefranc et al., Dev. Comp. Immunol. 27:55, 2003). CDR-3 is usually primarily responsible for antigen binding or specificity and / or interaction with the processed peptide portion of the peptide-MHC complex. The CDR-1 of the α chain usually interacts with the N-terminal portion of certain antigenic peptides. The CDR-1 of the β chain often interacts with the C-terminal portion of the peptide. CDR-2 usually contributes the most to interacting with or recognizing the MHC portion of the MHC-peptide complex, or is the primary CDR responsible for these effects. The variable region of the β chain may contain additional hypervariable regions (e.g., CDR4 or HVR4), which are generally involved in superantigen binding and not in antigen recognition (Kotb (1995) Clinical Microbiology Reviews, 8: 411-426).

[0209] The α chain and / or β chain of the full-length TCR or the γ chain and / or δ chain of the full-length TCR also contains a constant domain, a transmembrane domain and / or a short cytoplasmic tail (see, for example, Janeway et al., Immunobiology: The Immune System in Health and Disease, 3rd edition, Current Biology Publications, p. 4: 33, 1997). Each chain of the TCR may have an N-terminal immunoglobulin variable domain, an immunoglobulin constant domain, a transmembrane region and a short cytoplasmic tail at the C-terminus. The TCR may associate with the constant protein of the CD3 complex involved in mediating signal transduction, or associate with other CD3-like molecules through its cytoplasmic tail.

[0210] In some embodiments, the reporter T cell library comprises a plurality of reporter T cells or reporter T cell lines, and these cells or cell lines comprise and / or express different functional TCRs. In some embodiments, each reporter T cell or reporter T cell line in the library comprises a TCR separated from different T cells or TILs, and each T cell or TIL is derived from the same patient and / or tumor sample. Any method known in the art for producing such libraries can be used to produce a library of reporter T cells expressing functional TCRs. In some embodiments, any method described in US20150203886 or WO2018102473 is used to produce a library of reporter T cells expressing functional TCRs, each of which is incorporated herein by reference. In some embodiments, TCR is αβTCR.

[0211] In some embodiments, the reporter T cells have been modified to knock out an endogenously expressed TCR. In some embodiments, the reporter T cells are derived from a cell line that does not express a TCR under normal conditions, or a cell line that has been engineered to not express an endogenous TCR. In some embodiments, the reporter T cells are derived from a Jurkat cell line.

[0212] The reporter T cell comprises a detectable marker (e.g., a reporter transgene encoding a detectable marker) that provides a detectable signal when the reporter T cell is activated. In some embodiments, the detectable marker is expressed and / or upregulated when the TCR is activated and / or the TCR recognizes an antigen presented by an MHC molecule. In some embodiments, the detectable marker comprises a fluorescent protein. The fluorescent protein can be, but is not limited to, green fluorescent protein (GFP), a GFP-like protein, a modified GFP, a GFP derivative, eGFP, eqFP611, Dronpa, TagRFPs, KFP, EosFP / IrisFP, Dendra, mVenus, mCherry, emerald GFP, superfolded GFP, Azami Green GFP, TagGFP, Turbo GFP, AcGFP, ZsGreen GFP, T-Sapphire GFP, blue fluorescent protein, EBFP, EGFP2, Azurite BFP, mTagBFP, Cyan fluorescent protein (CFP), SCFP, mECFP, Cerulean CFP, mTurquoise CFP, CyPET CFP, AmCyan1 CFP, Modori-Ishi Cyan CFP, TabCFP, mTFP (Teal), yellow fluorescent protein (YFP), Topax YFP, Venus YFP, mCitrine YFP, YPet YFP, TagYFP, PhiYFP, ZsYellow YFP, mBanana YFP, orange fluorescent protein (OFP), Kusabira Orange OFP, Kusabira Orange2 OFP, mOrange OFP, mOragne2 OFP, dTomato OFP, dTomato-Tandem OFP, TagRFP OFP, TagRFP-T OFP, DsRed OFP, DsRed2 OFP, DsRed-Express(T1)OFP, DsRed-Monomer OFP, mTangerine OFP, red fluorescent protein (RFP), mRubyRFP, mApple RFP, mStrawberry RFP, AsRed2 RFP, mRFP1 RFP, JRed RFP, mCherry RFP, HcRed1 RFP, mRaspberry RFP, dKeima-Tandem RFP, HcRed-Tandem RFP, mPlum RFP, and AQ143RFP.For example, in some embodiments, the reporter transgene is a NFAT-GFP reporter transgene, which is designed to express GFP upon activation or stimulation of signaling through the TCR.

[0213] In some embodiments, the reporter T cells contain an additional or second detectable label or tag to aid in the detection and / or enrichment of activated T cells. The second detectable label can be, but is not limited to, a protein that binds to the antibody.

[0214] In some embodiments, the detectable marker or second detectable marker or tag encodes a protein or gene that induces a change in the reporter T cell.

[0215] In some embodiments, the reporter T cell line is established by a reporter T cell or its colony. The reporter cell line can be amplified, stored (e.g., frozen in aliquots) and thawed for one or more experiments. Each reporter T cell (or reporter T cell line) in the library is maintained and / or stored in a separate vessel or container. Information about the identity of TCR can be recorded for each reporter T cell, including but not limited to nucleic acid sequence, amino acid sequence and TCR source.

[0216] The reporter T cells (or reporter T cell lines) of the library can be combined to form a pool of reporter T cells. Reporter T cells expressing about 100 or more different TCRs can be combined to provide a pool of reporter T cells. In some embodiments, the pool of reporter T cells can express about 1 to about 10, about 5 to about 10, about 8 to about 10, about 1 to about 20, about 1 to about 50, or about 1 to about 100 different TCRs. In some embodiments, the pool of reporter T cells expresses up to about 100 different TCRs. In some embodiments, the pool of reporter T cells expresses about 100 different TCRs. In some embodiments, each TCR expressed in the pool of reporter T cells is expressed by at least about 1% of the cells in the pool of reporter T cells. In some embodiments, each TCR expressed in the pool of reporter T cells is expressed by at least about 2%, at least about 4%, at least about 5%, at least about 10%, at least about 12.5%, at least about 20%, at least about 33% or at least about 50% of the cells in the pool of reporter T cells.

[0217] B. Screening of reporter T cells against tumor neoantigens

[0218] Methods for identifying neoantigen-specific TCRs using the neoantigen-expressing APCs are described herein. In some embodiments, these methods include screening multiple reporter T cells against multiple APCs expressing different neoantigen minigenes and / or TMGs, and assessing the activation of these reporter cells to identify neoantigen-specific TCRs and their target neoantigens.

[0219] Also described herein are methods for identifying antigen-specific TCRs using the antigen-expressing APCs. In some embodiments, these methods include screening multiple reporter T cells against multiple APCs expressing one or more proteins or protein fragments of pathogens, allergens, or autoimmune-related proteins, and assessing the activation of these reporter cells to identify antigen-specific TCRs and their target antigens.

[0220] The method can also be used to identify antigens presented to the immune system in the context of HLA. The identification of TCRs activated by APCs expressing antigens indicates that the antigens are presented to T cells in the context of HLA. In some embodiments, the method can be used to identify antigens or new antigens associated with cancer. In some embodiments, the method can be used to identify shared tumor antigens. In some embodiments, the method can be used to identify shared tumor antigens that are bound to specific HLA alleles. In some embodiments, the method can be used to identify new antigens specific to the subject. In some embodiments, peptides, protein fragments or proteins from pathogens, allergens or proteins associated with autoimmune diseases are expressed in APCs and one or more TCRs activated by APCs are identified, which can be used to identify antigens or epitopes processed by APCs and presented to the immune system, and / or identify TCRs specific for these antigens.

[0221] In some embodiments, one or more reporter T cell lines (e.g., from a reporter T cell library) are each co-cultured with one or more neoantigen-expressing APCs or neoantigen-expressing APC cell lines (e.g., from an APC library expressing neoantigens). Each reporter T cell in a library (or a subset thereof) can be co-cultured with each neoantigen-expressing APC in a library (or a subset thereof) under different conditions (or samples). In other words, reporter T cells expressing each TCR can be co-cultured with an APC containing each neoantigen expression vector, wherein each TCR / neoantigen expression vector combination includes different conditions (or samples). Different conditions or samples can be, but are not limited to, different wells in a multi-well plate. Each TMG contains a variety of neoantigen minigenes, allowing for improved high-throughput screening of potential neoantigen-specific TCRs. In some embodiments, a TMG library is screened, wherein each TMG contains different groups of neoantigen minigenes. The method described herein for identifying TCRs that recognize neoantigens can also be used to identify TCRs that recognize other antigens.

[0222] The methods described herein can be multiplexed. Reporter T cells (or reporter T cell lines) expressing 1-5, 1-10, 1-20, 1-50 or 1-100 different TCRs can be combined to provide a pool of reporter T cells. APCs expressing neoantigens (or APC lines expressing neoantigens) expressing 1-20 different neoantigen expression vectors (including minigenes and / or tandem minigenes) can be combined to provide a pool of APCs expressing neoantigens. In any of the methods, one or more reporter T cell pools can be contacted with each APC expressing a neoantigen in an APC library expressing a neoantigen. In any of the methods, each reporter T cell in a reporter T cell library can be contacted with one or more APC pools expressing a neoantigen. In any of the methods, one or more reporter T cell pools can be contacted with a pool of one or more APCs expressing a neoantigen. In some embodiments, one or more pools of reporter T cells (wherein each pool of reporter T cells expresses 1-100 different TCRs) are contacted with one or more pools of neoantigen-expressing APCs (wherein each pool of neoantigen-expressing APCs expresses 1-20 neoantigen-expressing vectors). In some embodiments, one or more pools of reporter T cells (wherein each pool of reporter T cells expresses up to 100 different TCRs) are contacted with one or more pools of neoantigen-expressing APCs (wherein each pool of neoantigen-expressing APCs expresses up to 20 different neoantigen-expressing vectors). The use of multiple samples or runs can enhance high-throughput screening of a large number of potential neoantigen-specific TCRs and neoantigens.

[0223] In some embodiments, the pool of each reporter T cell in the multiple samples or runs independently expresses about 1 to about 10, about 5 to about 10, about 8 to about 10, about 1 to about 20, about 1 to about 50, or about 1 to about 100 different TCRs. In some embodiments, the pool of each reporter T cell in the multiple samples or runs independently expresses up to about 100 different TCRs. In some embodiments, the pool of each reporter T cell in the multiple samples or runs independently expresses about 100 different TCRs. In some embodiments, each TCR expressed in the pool of each reporter T cell in the multiple samples or runs is expressed by at least about 1% of the cells in the pool of reporter T cells. In some embodiments, each TCR expressed in the pool of each reporter T cell is expressed by at least about 2%, at least about 4%, at least about 5%, at least about 10%, at least about 12.5%, at least about 20%, at least about 33%, or at least about 50% of the cells in the pool of reporter T cells.

[0224] In some embodiments, each pool of neoantigen-expressing APCs in a multiplex sample or run independently expresses 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 different neoantigen expression vectors. In some embodiments, each pool of neoantigen-expressing APCs in a multiplex sample or run independently expresses about 1 to about 3 different neoantigen expression vectors. In some embodiments, each pool of neoantigen-expressing APCs in a multiplex sample or run independently expresses about 1 to about 5 different neoantigen expression vectors. In some embodiments, each pool of neoantigen-expressing APCs in a multiplex sample or run independently expresses about 1 to about 10 different neoantigen expression vectors. In some embodiments, each pool of neoantigen-expressing APCs in a multiplex sample or run independently expresses up to about 20 different neoantigen expression vectors. In some embodiments, each pool of neoantigen-expressing APCs in a multiplex sample or run independently expresses about 20 different neoantigen expression vectors. In some embodiments, each neo-antigen expression vector expressed in the pool of neo-antigen-expressing APCs is expressed by at least about 5% of the cells in the pool of neo-antigen-expressing APCs. In some embodiments, each neo-antigen expression vector expressed in the pool of neo-antigen-expressing APCs is expressed by at least about 10%, at least about 20%, at least 25%, at least about 33%, or at least about 50% of the cells in the pool of neo-antigen-expressing APCs.

[0225] In some embodiments, up to about 5×10 5 Reporter T cells with up to approximately 5 × 10 5 In some embodiments, about 1×10 4 to about 1×10 6 Reporter T cells and 1×10 4 to about 1×10 6 In some embodiments, about 5×10 4 to about 5×10 5 reporter T cells and 5×10 4 to about 5×10 5 In some embodiments, reporter T cells are co-cultured with APCs expressing the neoantigen at a ratio of about 1:1 (e.g., 0.9:1 to 1.1:1).

[0226] In some embodiments, the T cells are incubated with immune effector cytokines prior to contacting the T cells with APCs. The immune effector can be, but is not limited to, IFNγ or type 1 interferon.

[0227] In some embodiments, after the reporter T cells are co-cultured with APCs expressing neoantigens, the TCR activation of the reporter T cells is assessed. In some embodiments, the reporter T cell activation is assessed based on the detection and / or quantification of detectable markers (e.g., expression of GFP, RFP, mCherry, luciferase, or expression of a protein (e.g., CD69) that can be detected using an antibody). After incubation with ABCs expressing neoantigens, the reporter T cells expressing activated TCR can be detected using methods in the art that can be used to detect detectable markers. In some embodiments, identifying activated T cells includes analyzing reporter T cells from a sample by flow cytometry. In some embodiments, identifying activated T cells includes detecting cell surface markers, such as by flow cytometry. In some embodiments, identifying activated T cells includes detecting signals such as fluorescence from fluorescent proteins, the expression of which is induced by the activation of T cells.

[0228] In some embodiments, detecting activated reporter T cells in a sample comprises analyzing the sample by flow cytometry (e.g., cell sorting) and determining the percentage of reporter T cells expressing a detectable marker. The percentage of reporter T cells expressing the detectable marker is at least about half of the percentage of reporter T cells in the sample expressing a given TCR, indicating that the reporter T cells are activated. If the sample contains a pool of reporter T cells expressing 100 different TCRs, a detectable marker is detected in about 0.5% of the cells in the sample during cytometry analysis, indicating that at least one reporter T cell line in the sample is activated.

[0229] In some embodiments, detecting activated reporter T cells in a sample comprises analyzing the sample by cell sorting, isolating one or more individual activated reporter T cells based on the presence of a detectable marker, and culturing or sequencing all or a portion of the TCRs of the isolated individual activated reporter T cells.

[0230] In some embodiments, detecting activated reporter T cells in the sample comprises detecting a signal from the reporter T cells, such as a fluorescent or luminescent signal, using a plate reader (e.g., a luminometer) configured to detect a signal from a detectable label.

[0231] In some embodiments, after detecting a signal in a multiple sample (wherein at least one merged reporter T cell is activated by at least one APC), the multiple samples are deconvoluted. The deconvolution of the multiple samples includes contacting each reporter T cell expressing a different TCR in the merged reporter T cells with each APC in the merged APC or the merged APC separately, and identifying the reporter T cells activated in the additional rounds of detection. Deconvolution can be performed in a single step or round, or in multiple steps or rounds. For single-step deconvolution, each different reporter T cell in the merged reporter T cells is co-cultured with the APC expressing the neoantigen in the separate sample, and if a second detection step is performed, which reporter T cell in the merged reporter T cells is in an activated state. Each different reporter T cell can be co-cultured with the merged APC expressing the neoantigen, or cultured separately with each different APC expressing the neoantigen from the merged APC expressing the neoantigen. For multiple-step deconvolution, the merged reporter T cells can be divided into two or more smaller reporter T cell pools for incubation with the APC expressing the neoantigen. After identifying the subdivided pool activated in the first round of deconvolution, additional rounds of deconvolution can be performed until a single TCR is identified. In a similar manner, deconvolution can also be performed to identify APCs that activate T cells and / or antigens expressed by APCs that activate T cells.

[0232] In some embodiments, reporter T cells are enriched prior to detection. In some embodiments, activated reporter T cells are enriched prior to detection. Enrichment of T cells or activated T cells can be performed using methods available in the art for such enrichment.

[0233] In some embodiments, the reporter T cells contain an additional or secondary marker or label to aid in the detection and / or enrichment of activated T cells. The added secondary marker or label can be, but is not limited to, a protein that binds to the antibody. Beads coated with the antibody can be used to enrich for activated reporter T cells.

[0234] The reporter T cells in the pool of reporter T cells may contain distinguishable detectable markers.All reporter T cells in the pool of reporter T cells expressing the same TCR will contain the same detectable marker.By using distinguishable detectable markers, the identification of activated T cells in the pool of reporter T cells can be determined by identifying distinguishable detectable markers.In some embodiments, the reporter T cells in the pool of reporter T cells contain distinguishable detectable markers so that the activation of the reporter T cells expressing a kind of TCR can be distinguished from the activation of at least a portion of reporter T cells expressing different TCRs.In some embodiments, in the pool of reporter T cells, the detectable markers contained in the reporter T cells expressing different TCRs are distinguishable.In some embodiments, in the pool of reporter T cells, the detectable markers contained in the reporter T cells expressing a kind of TCR can be distinguished from the detectable markers contained in the reporter T cells expressing different TCRs.In some embodiments, in the pool of reporter T cells, the detectable markers contained in the reporter T cells expressing at least one TCR can be distinguished from the detectable markers contained in the reporter T cells expressing at least one other (i.e., different) TCR. In some embodiments, each reporter T cell expressing the same TCR in the pool of reporter T cells contains the same detectable marker, wherein the detectable marker can be distinguished from the detectable marker contained in the reporter T cells in the pool or the reporter T cells expressing different TCRs. In some embodiments, each reporter T cell line in the pool of reporter T cells contains a different detectable marker, which can be distinguished from the detectable markers in other reporter T cell lines in the pool of reporter T cells. In some embodiments, two or more reporter T cell lines in the pool of reporter T cells containing distinguishable detectable markers contain the same detectable marker. For any given reporter T cell line pool, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more reporter T cell lines in the pool may contain the same detectable marker.

[0235] After detecting activated reporter T cells expressing TCRs, TCRs encoded by T cells and / or neoantigens expressed by APCs can be identified. In some embodiments, TCRs and / or neoantigens can be identified by amplifying, sequencing, and / or cloning TCRs from activated T cells and / or neoantigens from corresponding APCs. In some embodiments, TCRs and / or neoantigens can be identified by identifying reporter T cells or reporter T cell lines used in samples that produce activated reporter T cells and / or APCs expressing neoantigens or APC cell lines expressing neoantigens. In some embodiments, TCRs and / or neoantigens can be identified by amplifying, sequencing, and / or cloning TCRs from activated T cells and / or neoantigens from corresponding APCs expressing neoantigens.

[0236] In some embodiments, after detecting a signal in a multiplex assay, activated cells are detected and sorted using cell sorting. The identity of the TCR can then be determined by sequencing the TCR from a single activated reporter T cell.

[0237] In some embodiments, APCs expressing neoantigens are engineered to express a detectable marker upon binding to a T cell expressing a TCR or activated T cell that binds to the neoantigen expressed by the APC. By providing a detectable marker in both the reporter T cell and the APC, both the neoantigen and the TCR can be identified simultaneously. In some embodiments, when pooled APCs are used, the APC detectable marker can be used to facilitate identification of the specific APC that activated the reporter T cell.

[0238] Using the method, TCR libraries can be rapidly screened against a complete set of mutations. Using the method, 1-100 TCRs can be screened against 1-20 neoantigen expression vectors in a single sample. Screening a TCR library with a neoantigen library and identifying TCRs that bind to neoantigens can be completed in as little as one, two, or three days. In some embodiments, screening a TCR library with a neoantigen library and identifying TCRs that bind to neoantigens can be completed in as little as one, two, or three days.

[0239] In some embodiments, any of the methods further comprises contacting reporter T cells activated by APCs expressing the neoantigen (or T cells expressing the same TCR as the identified activated T cells) with APCs expressing the wild-type (non-mutated) form of the same peptide. The inability of APCs expressing the wild-type form of the peptide to activate the reporter T cells indicates that the TCR is specific for the neoantigen.

[0240] Methods for isolating and identifying T cell receptors (TCRs) or antigen binding fragments thereof that bind to or target tumor neoantigens or epitopes thereof, for example in the context of an MHC molecule, are described. The tumor neoantigen or neoepitope can be any neoantigen or neoepitope described herein, or a neoantigen or neoepitope identified using any of the methods described herein. In some embodiments, these methods provide for large-scale or high-throughput separation and identification of TCRs or antigen binding fragments thereof that bind to or target tumor neoantigens. Identification of TCRs includes identification of nucleic acids encoding TCRs.

[0241] The TCR or its antigen-binding fragment identified using the method can be isolated or purified. In some embodiments, the nucleic acid sequence encoding the TCR or its antigen-binding fragment identified using the method can be identified and isolated, synthesized, purified and used for cloning. In some embodiments, the TCR or its antigen-binding fragment or the nucleic acid encoding the TCR or its antigen-binding fragment is recombinant. In some embodiments, the TCR or its antigen-binding fragment is human. In some embodiments, the TCR contains two chains. In some embodiments, these two chains are encoded by two nucleic acid sequences. The two nucleic acid sequences encoding the two TCR chains can be present on two different expression vectors, i.e., on a single expression vector. If the two nucleic acid sequences encoding the two TCR chains are present in a single expression vector, the two nucleic acid sequences can be operably linked to two different promoters or a single promoter. If the two nucleic acids encoding the two TCR chains are operably linked to a single promoter, the two nucleic acids can be connected or operably linked via a T2 element (e.g., a P2A or T2A element) or an IRES element to encode a single-chain TCR. In some embodiments, the TCR is single-chain. In some embodiments, the TCR contains two chains.

[0242] The identified nucleic acids encoding TCRs can be used to generate engineered cells expressing heterologous TCRs. Compositions and treatment methods involving the administration of such TCRs and / or engineered cells are also described. In some embodiments, engineered cells expressing the identified TCRs or antigen-binding fragments thereof exhibit cytotoxic activity against target cells (such as cancer cells or tumor cells) expressing tumor neoantigens or epitopes thereof.

[0243] In some embodiments, TCRs identified by any of the embodiments described herein are provided, including TCRs that target tumor neoantigens. In some embodiments, such identified TCRs can be used in therapeutic methods or as therapeutic agents.

[0244] In some embodiments, nucleic acids, such as polynucleotides, encoding any identified TCR, such as a TCR targeting a tumor neoantigen, are also provided herein.

[0245] IV. Engineered Cells

[0246] The identified TCRs can be used to engineer cells (such as T cells) for use in therapies (such as, but not limited to, ACT). Compositions comprising the engineered cells described herein are also provided. The T cells can be, but are not limited to, CD4 + T cells, CD8 + T cells or CD4 + / CD8 + T cells, initial T (T N ) cells, effector T (T EFF) cells, memory T cells, stem cell memory T (T SCM ) cells, central memory T(T CM ) cells, effector memory T (T EM ) cells, terminally differentiated effector memory T cells, tumor infiltrating lymphocytes (TIL), immature T cells, mature T cells, helper T cells (including TH1, TH2, TH3, TH17, TH9 and TH22 cells), follicular helper T cells, cytotoxic T cells, mucosal-associated constant T (MAIT) cells, adaptive regulatory T (Treg) cells, α / β T cells or δ / γ T cells. In some embodiments, the cell is a NK cell.

[0247] A. Preparation of Cells for Genetic Engineering

[0248] In some embodiments, the preparation of engineered cells includes one or more culture and / or preparation steps. Cells for introducing TCR can be separated from samples (such as biological samples, for example, obtained from a subject or derived from a subject). In some embodiments, the subject from which cells are separated is a subject suffering from a disease or illness or needs a cell therapy or will be administered a cell therapy thereto. In some embodiments, the subject is a person who needs a specific therapeutic intervention (such as the adoptive cell therapy of separating, processing and / or engineering of cells).

[0249] Therefore, in some embodiments, the cell is a primary cell, such as a primary human cell. Samples include tissues, fluids, and other samples taken directly from a subject, as well as samples produced by one or more processing steps (such as separation, centrifugation, genetic engineering (e.g., transduction with a viral vector), washing, and / or incubation). Biological samples can be samples obtained directly from a biological source or processed samples. Biological samples include, but are not limited to, body fluids, such as blood, plasma, serum, cerebrospinal fluid, synovial fluid, urine, and sweat, tissue and organ samples, including processed samples derived therefrom.

[0250] In some embodiments, the sample derived from or from which cells are separated is a sample of blood or blood origin, or is or is derived from apheresis or leukocyte removal product. Exemplary samples include whole blood, PBMC, leukocytes, bone marrow, thymus, tissue biopsy, tumor, leukemia, lymphoma, lymph node, intestinal associated lymphoid tissue, mucosa associated lymphoid tissue, spleen, other lymphoid tissues, liver, lung, stomach, intestine, colon, kidney, pancreas, breast, bone, prostate, cervix, testis, ovary, tonsil or other organs and / or cells derived from them. In the context of cell therapy (e.g., adoptive cell therapy), sample includes samples from autologous and allogeneic sources.

[0251] B. Treatment Methods and Uses

[0252] Also provided herein are methods and uses of TCRs and antigen-binding fragments thereof and / or engineered cells expressing TCRs or antigen-binding fragments thereof identified or separated according to the provided embodiments, such as therapeutic uses and preventive uses. Such methods and uses include methods of treatment and uses, for example, involving administering molecules, cells, or compositions containing the molecules or cells to subjects suffering from tumors or cancers. In some embodiments, the molecules, cells, and / or compositions are administered in an effective amount to achieve treatment of tumors or cancers. Uses include the use of TCRs and cells in such methods and treatments, as well as in the preparation of drugs for the implementation of such methods of treatment. In some embodiments, the methods are implemented by administering TCRs or cells or compositions comprising the TCRs or cells to subjects suffering from, having suffered from, or suspected of having tumors or cancers. In some embodiments, these methods thus treat subjects' tumors, cancers, or disorders.

[0253] Diseases to be treated include cancer or tumors, or diseases associated with malignant cell growth or transformation.

[0254] V. Definitions

[0255] Unless otherwise defined, all technical terms, symbols, and other technical and scientific terms or proper nouns used herein are intended to have the same meaning as commonly understood by one of ordinary skill in the art to which the claimed subject matter belongs. In some cases, terms with commonly understood meanings are defined herein for clarity and / or for ease of reference, and the inclusion of such definitions herein is not necessarily to be construed as representing a substantial difference from what is generally understood in the art.

[0256] The terms "polypeptide" and "protein" are used interchangeably to refer to a polymer of amino acid residues and are not limited to a minimum length. Polypeptides (including the provided T cell receptors, antigen binding fragments thereof, and other peptides, such as linkers) may include amino acid residues, including natural and / or non-natural amino acid residues. The term also includes post-expression modifications of the polypeptide, such as glycosylation, sialylation, acetylation, phosphorylation, and the like. In some embodiments, the polypeptide may contain modifications relative to the native or natural sequence, as long as the protein retains the desired activity. These modifications may be intentional, such as by site-directed mutagenesis, or may be accidental, such as by mutations in the host producing the protein or errors due to PCR amplification.

[0257] An "isolated" nucleic acid refers to a nucleic acid molecule that has been separated from a component of its natural environment. An isolated nucleic acid includes a nucleic acid molecule contained in cells that ordinarily contain the nucleic acid molecule, but the nucleic acid molecule is present extrachromosomally or at a chromosomal location that is different from its natural chromosomal location.

[0258] An "isolated nucleic acid molecule encoding a TCR" refers to a single nucleic acid molecule (eg, a single vector) encoding a TCR, such as a functional α / β TCR or a functional γ / δ TCR.

[0259] An "isolated nucleic acid molecule encoding an antigen-binding fragment of a TCR" refers to a single nucleic acid molecule (eg, a single vector) encoding an antigen-binding fragment of a TCR.

[0260] "Isolated nucleic acid molecules encoding TCRs" refers to two or more separate nucleic acid molecules (e.g., two or more vectors) that together encode a TCR, such as a functional α / β TCR or a functional γ / δ TCR. Each of these two or more nucleic acid molecules can be present at different locations within the host cell.

[0261] "Isolated nucleic acid molecules encoding an antigen-binding fragment of a TCR" refers to two or more nucleic acid molecules (e.g., two or more vectors) that together encode an antigen-binding fragment of a TCR. Each of these two or more nucleic acid molecules can be present at different locations within the host cell.

[0262] The term "expression" means allowing or causing the information in a gene, RNA, or DNA sequence to become manifest; for example, by activating cellular functions involved in the transcription and translation of the corresponding gene to produce a protein. A DNA sequence is expressed in (or by) a cell to form an expression product, such as RNA (e.g., mRNA) or protein. The expression product itself may also be considered to be "expressed" by the cell.

[0263] "Operably linked" refers to the juxtaposition of two or more components (e.g., a promoter and another sequence element) so that the two components function normally and at least one of the components mediates a function imposed on at least one of the other components. For example, a promoter operably linked to a coding sequence will direct RNA polymerase-mediated transcription of the coding sequence into RNA (including mRNA), which can then be cleaved (if the RNA contains introns) and, optionally, translated into a protein encoded by the coding sequence. A coding sequence can be "operably linked" to one or more transcriptional or translational control sequences. A terminator / polyA signal operably linked to a gene can terminate the process of transcribing the gene into RNA and direct the addition of a polyA signal to the RNA.

[0264] A "promoter" is a DNA regulatory region that is capable of binding to RNA polymerase in a cell (e.g., directly or through other proteins or substances that bind to the promoter) and initiating transcription of a coding sequence. A promoter may include one or more additional regions or elements that affect the rate of transcription initiation, including but not limited to enhancers. A promoter may be, but is not limited to, a constitutively active promoter, a conditional promoter, an inducible promoter, or a cell type-specific promoter. Various promoters for T cells or APCs are known in the art. Examples of promoters can be found, for example, in WO 2013 / 176772. The promoter may be, but is not limited to, a CMV promoter, an Igκ promoter, a PGK promoter, an SV40 promoter, a β-actin promoter, an α-actin promoter, an SRα promoter, a herpes thymidine kinase promoter, a herpes simplex virus (HSV) promoter, a mouse mammary tumor virus long terminal repeat (LTR) promoter, an adenovirus major late promoter (Ad MLP), a Rous sarcoma virus (RSV) promoter, an immunoglobulin promoter, an EF1α promoter, an ubiquitin promoter, an MNDU3 promoter, a metallothionein promoter, an IFN gene promoter, or a GM-CSF gene promoter.

[0265] "Translation modifying elements" can translate two or more genes from a single transcript. Translation modifying elements include an internal ribosome entry site (IRES), which allows translation to be initiated from an internal region of the mRNA; and a 2A peptide that causes the ribosome to skip the peptide bond synthesis at the C-terminus of the element. Incorporation of translation regulatory elements results in the co-expression of two or more polypeptides from a single polycistronic mRNA. 2A regulators include, but are not limited to, P2A, T2A, E2A, or F2A.

[0266] The terms "host cell," "host cell line," and "host cell culture" are used interchangeably to refer to cells into which exogenous nucleic acid has been introduced, including the progeny of such cells. Host cells include "transformants" and "transformed cells," which include the primary transformed cell and progeny derived therefrom, regardless of the number of passages. Progeny may not be completely identical in nucleic acid content to the parent cell, but may contain mutations. Mutant progeny that have the same function or biological activity as screened or selected for in the originally transformed cell are included herein.

[0267] As used herein, "percentage (%) of amino acid sequence identity" and "percentage identity" when used with respect to an amino acid sequence (reference polypeptide sequence) are defined as the percentage of amino acid residues in a candidate sequence (e.g., a subject T cell receptor or fragment) that are identical to the amino acid residues in the reference polypeptide sequence, after aligning the sequences and, if necessary, introducing gaps to achieve maximum sequence identity and not considering any conservative substitutions as part of the sequence identity. Alignment for the purpose of determining percentage of amino acid sequence identity can be achieved in a variety of ways within the art, for example, using publicly available computer software such as BLAST, BLAST-2, ALIGN or Megalign (DNASTAR) software. Those skilled in the art can determine appropriate parameters for aligning sequences, including any algorithm required for achieving maximum alignment over the full length of the compared sequences.

[0268] Amino acid substitutions can include replacing one amino acid in a polypeptide with another amino acid. Amino acid substitutions can be introduced into a TCR or antigen-binding fragment thereof of interest, and the product can be screened for a desired activity, such as retained / improved antigen binding, reduced immunogenicity, or improved cytolytic activity.

[0269] Amino acids can generally be grouped according to the following common side chain properties:

[0270] (1) Hydrophobicity: norleucine, Met, Ala, Val, Leu, Ile;

[0271] (2) Neutral hydrophilicity: Cys, Ser, Thr, Asn, Gln;

[0272] (3) Acidic: Asp, Glu;

[0273] (4) Basic: His, Lys, Arg;

[0274] (5) Residues that affect chain orientation: Gly, Pro; and

[0275] (6) Aromatic: Trp, Tyr, Phe.

[0276] In some embodiments, conservative substitutions may involve exchanging a member of one of these classes for another member of the same class. In some embodiments, non-conservative amino acid substitutions may involve exchanging a member of one of these classes for another class.

[0277] As used herein, the term "vector" refers to a nucleic acid molecule capable of propagating another nucleic acid to which it is linked. The term includes vectors that are self-replicating nucleic acid structures as well as vectors that are incorporated into the genome of a host cell into which they are introduced. Certain vectors are capable of directing the expression of nucleic acids to which they are operatively linked. Such vectors are referred to herein as "expression vectors."

[0278] As used herein, the singular forms "a," "an," and "the" include plural referents unless the context clearly indicates otherwise. For example, "a" or "an" means "at least one" or "one or more." It should be understood that the aspects and variations described herein include "consisting of" and / or "consisting essentially of" aspects and variations.

[0279] Throughout this disclosure, various aspects of the claimed subject matter are presented in the form of ranges. It should be understood that the description in range form is merely for convenience and brevity and should not be interpreted as rigidly limiting the scope of the claimed subject matter. Therefore, the description of the range should be considered to have specifically disclosed all possible sub-ranges and each numerical value within the range. For example, where a range of values ​​is provided, it should be understood that each intermediate value between the upper and lower limits of the range and any other specified values ​​or intermediate values ​​within the specified range are encompassed within the claimed subject matter. The upper and lower limits of these smaller ranges may be independently included within the smaller range and are also encompassed within the claimed subject matter, subject to any specific exclusions in the stated range. Where the stated range includes one or both of the limitations, the range excluding one or both of these included limitations is also included in the claimed subject matter. This applies regardless of the width of the range.

[0280] As used herein, the term "about" refers to the typical error range for each value readily known to those skilled in the art. Reference herein to an "about" value or parameter includes (and describes) embodiments for that value or parameter itself. For example, a description referring to "about X" includes a description of "X."

[0281] As used herein, a composition refers to any mixture of two or more products, substances or compounds (including cells). It can be a solution, suspension, liquid, powder, paste, aqueous, non-aqueous or any combination thereof.

[0282] The "mutagenome" is the sum of somatic cancer mutations in an individual's tumor. The cancer mutagenome can be defined by comparing exome sequencing data obtained from next-generation sequencing of an individual's healthy tissue with sequences from tumor-derived nucleic acids.

[0283] "Treatment" (and grammatical variations such as "treat" or "treating") refers to the complete or partial improvement or reduction of a disease, condition, or disorder (such as a tumor or cancer), or the symptoms, side effects, outcomes, or phenotypes associated therewith. Desirable effects of treatment include, but are not limited to, preventing the occurrence or recurrence of the disease, alleviating symptoms, reducing any direct or indirect pathological consequences of the disease, preventing metastasis, reducing the rate of disease progression, ameliorating or palliating the disease state, and alleviating or improving prognosis. These terms do not imply a complete cure for the disease or the complete elimination of any symptom or effect on all symptoms or outcomes.

[0284] "Delaying the progression of a disease" means postponing, hindering, slowing, retarding, stabilizing, inhibiting, and / or slowing the progression of a disease or disorder (such as a tumor or cancer). The length of such a delay may vary, depending on the history of the disease and / or the individual being treated. As will be apparent to one skilled in the art, a sufficient or significant delay may actually encompass prevention, in that the individual will not develop the disease. For example, the progression of advanced cancers, such as metastases, may be delayed.

[0285] "Prevention" includes providing prevention of the occurrence or recurrence of a disease (such as a tumor or cancer) in a subject who may be susceptible to the disease but has not yet been diagnosed with the disease. In some embodiments, provided molecules and compositions are used to delay the development of a disease or slow the progression of a disease.

[0286] "Inhibiting" a function or activity means reducing that function or activity when compared to otherwise identical conditions (or alternatively, compared to another condition) except for the condition or parameter of interest. For example, a TCR, composition, or cell reduces the growth rate of a tumor compared to the growth rate of the tumor in the absence of the TCR, composition, or cell that inhibits tumor growth.

[0287] In the context of administration, an "effective amount" of an agent (e.g., pharmaceutical formulation, TCR, cell, or composition) refers to an amount effective, at dosages / amounts and for periods of time necessary, to achieve a desired result, such as a therapeutic or prophylactic result.

[0288] A "therapeutically effective amount" of an agent (e.g., a pharmaceutical formulation, TCR, or cell) is an amount that is effective to achieve a desired therapeutic outcome (such as treatment of a disease, condition, or disorder, such as a tumor or cancer) and / or a pharmacokinetic or pharmacodynamic effect of the treatment, at the dosage and time period necessary. A therapeutically effective amount may vary according to factors such as the disease state, age, sex, and weight of the subject, as well as the cell population being administered. In some embodiments, provided methods comprise administering a TCR, cell, and / or composition in an effective amount (e.g., a therapeutically effective amount).

[0289] A "prophylactically effective amount" refers to an amount effective, at dosages and for periods of time necessary, to achieve the desired prophylactic result. Typically, but not necessarily, a prophylactic effective amount will be less than a therapeutically effective amount because a prophylactic dose is used in subjects prior to disease or at an earlier stage of disease.

[0290] A "subject" is a mammal, such as a human or other animal, and typically a human.

[0291] VII. Exemplary Embodiments

[0292] The implementation schemes provided are:

[0293] 1. A method for identifying a T cell receptor (TCR) or an antigen-binding fragment thereof that binds to a tumor neoantigen, the method comprising:

[0294] (a) generating a library of reporter T cells expressing a functional TCR by introducing a plurality of nucleic acid molecules into a plurality of reporter T cells, wherein each of the plurality of nucleic acid molecules comprises a nucleic acid encoding a functional TCR from a T cell obtained from a biological sample of a subject having a tumor;

[0295] (b) identifying candidate tumor neoantigens by comparing the genomic DNA sequences and RNA expression profiles of tumor cells from the biological sample with corresponding genomic DNA sequences and RNA expression profiles of non-tumor cells from the same subject;

[0296] (c) generating a library of antigen presenting cells (APCs) by introducing a plurality of tandem candidate neoantigen vectors into a plurality of APCs, wherein each of the tandem candidate neoantigen vectors encodes one or more of the candidate tumor neoantigens or fragments thereof, wherein the plurality of APCs are capable of expressing the one or more candidate tumor neoantigens or fragments thereof in complex with major histocompatibility complex (MHC) molecules;

[0297] (d) identifying activated TCR-expressing reporter T cells after contacting the one or more cells of the library of reporter T cells expressing a functional TCR with the one or more cells of the library of APCs.

[0298] 2. The method according to embodiment 1 further includes (e) isolating the nucleic acid encoding the functional TCR from the activated reporter T cells expressing the TCR.

[0299] 3. The method of embodiment 1 or 2, wherein the reporter T cell expressing the TCR is activated when the expressed TCR binds to the candidate tumor neoantigen complexed with the MHC molecule presented on the APC.

[0300] 4. The method of any one of embodiments 1 to 3, wherein the plurality of APCs comprises a B-lymphoblastoid cell line (B-LCL).

[0301] 5. The method of any one of embodiments 1 to 3, wherein the plurality of APCs comprises artificial APCs.

[0302] 6. The method according to embodiment 5, wherein the artificial APCs comprise K562 cells expressing MHC molecules.

[0303] 7. A method according to any one of embodiments 1 to 6, wherein the tandem candidate neoantigen vectors each encode at least two candidate neoantigens or fragments thereof, optionally at least five candidate neoantigens or fragments thereof.

[0304] 8. The method of any one of embodiments 1 to 7, wherein the tandem candidate neoantigen vector encodes a modified ubiquitin, optionally wherein the modified ubiquitin comprises a G67V amino acid substitution.

[0305] 9. The method of any one of embodiments 1 to 8, wherein the tandem candidate neoantigen vectors are assembled using parallel cloning.

[0306] 10. The method of any one of embodiments 1 to 9, wherein the tandem candidate neoantigen vectors are assembled without performing a restriction endonuclease cleavage reaction.

[0307] 11. The method of any one of embodiments 1 to 10, wherein the tandem candidate neoantigen vectors are assembled using seamless cloning.

[0308] 12. The method of any one of embodiments 1 to 11, wherein the MHC molecules comprise human leukocyte antigen (HLA) alleles expressed in the subject.

[0309] 13. The method of embodiment 12, wherein the MHC molecule is a human leukocyte antigen (HLA)-A molecule.

[0310] 14. The method of embodiment 13, wherein the HLA-A molecule is serotype HLA-A*02:01.

[0311] 15. The method of embodiment 13, wherein the HLA-A molecule is serotype HLA-A*02:06.

[0312] 16. The method of embodiment 12, wherein the MHC molecule is an HLA-B or HLA-C molecule.

[0313] 17. The method of any one of embodiments 1 to 16, wherein an antigen is identified as a candidate tumor neoantigen if the following conditions are met:

[0314] (i) the presence of a single nucleotide variant (SNV) or insertion-deletion (indel) in the genomic DNA sequence of the gene encoding the antigen from the tumor cells of the biological sample compared to the corresponding genomic DNA sequence of the gene encoding the antigen from the non-tumor cells of the same subject; and / or

[0315] (ii) the presence of a SNV or indel in the mRNA sequence of the gene encoding the antigen from the tumor cells of the biological sample compared to the corresponding mRNA sequence of the gene encoding the antigen from the non-tumor cells of the same subject.

[0316] 18. A method according to embodiment 17, wherein the SNV results in a non-synonymous mutation, a missense mutation or a nonsense mutation in the gene encoding the antigen.

[0317] 19. The method of embodiment 17 or 18, wherein the indel results in a frameshift mutation in the gene encoding the antigen.

[0318] 20. The method of any one of embodiments 17 to 19, wherein the SNV or indel is present in a coding region or an exon of the gene encoding the antigen.

[0319] 21. The method of any one of embodiments 17 to 19, wherein the SNV or indel is present in a regulatory region or intron of the gene encoding the antigen.

[0320] 22. The method of any one of embodiments 17 to 21, wherein an antigen is identified as a candidate tumor neoantigen if:

[0321] (i) the presence of a SNV or indel in the genomic DNA sequence of the tumor cell from the biological sample compared to the corresponding genomic DNA sequence of the non-tumor cell from the same subject, wherein the SNV or indel results in increased expression of a non-coding RNA, a splice variant RNA, a silent retroviral element, an alternative ORF, an upstream ORF, a regulatory ORF, a small ORF, or a gene fusion; and / or

[0322] (ii) the presence of a SNV or indel in the expressed RNA sequence of the tumor cells from the biological sample compared to the corresponding expressed RNA sequence of the non-tumor cells from the same subject, wherein the SNV or indel results in increased expression of a non-coding RNA, a splice variant RNA, a silent retroviral element, an alternative ORF, an upstream ORF, a regulatory ORF, a small ORF, or a gene fusion.

[0323] 23. A method according to embodiment 22, wherein the SNV or indel is present in an intergenic region, a non-coding region, a regulatory region, an intron, a silent retroviral element or a heterochromatin region of the genome.

[0324] 24. The method according to embodiment 22 or 23, wherein:

[0325] The antigen is encoded by the non-coding RNA or the splice variant RNA; and / or

[0326] The antigen comprises the alternative ORF, the upstream ORF, the regulatory ORF or the small ORF.

[0327] 25. The method of any one of embodiments 1 to 24, wherein the antigen is identified as a candidate tumor neoantigen when the antigen or a fragment thereof is predicted to be complexed with an MHC molecule.

[0328] 26. The method according to any one of embodiments 1 to 25, wherein the plurality of nucleic acid molecules in (a) is obtained by a method comprising:

[0329] (1) amplifying a first amplification product and a second amplification product from cDNA generated from RNA obtained from a single T cell sorted into each of a plurality of separate locations on a device, wherein the first amplification product comprises a nucleic acid encoding an alpha variable (Vα) or gamma variable (Vγ) segment and the second amplification product comprises a nucleic acid encoding a beta variable (Vβ) or delta variable (Vδ) segment, and

[0330] (2) assembling the first amplification product and the second amplification product from each of the plurality of separate positions to obtain an assembled nucleic acid encoding a functional T cell receptor for each of the plurality of separate positions,

[0331] wherein the functional T cell receptor comprises (i) a full-length α variable region and a full-length β variable region from the single T cell, or (ii) a full-length γ variable region and a full-length δ variable region from the single T cell.

[0332] 27. A method according to embodiment 26, wherein the assembled nucleic acid encoding a functional TCR is assembled into a vector.

[0333] 28. The method according to embodiment 26 or 27, wherein:

[0334] The first amplification product comprises a nucleic acid encoding a leader (L) sequence of a Vα or Vγ segment;

[0335] The first amplification product comprises a nucleic acid encoding an alpha-joining (Jα) or gamma-joining (Jγ) segment;

[0336] The first amplification product comprises a nucleic acid encoding the 5' portion of the alpha constant (Cα) or gamma constant (Cγ) region; and / or

[0337] The first amplification product comprises a nucleic acid encoding the L sequence of the Va or Vy segment, the Jα or Jγ segment, and the 5' portion of the Ca or Cγ region.

[0338] 29. The method of any one of embodiments 26 to 28, wherein:

[0339] The second amplification product comprises a nucleic acid encoding a leader (L) sequence of a Vβ or Vδ segment;

[0340] The second amplification product comprises a nucleic acid encoding a beta diversity (Dβ) or a delta diversity (Dδ) segment, and / or wherein the second amplification product comprises a nucleic acid encoding a beta joining (Jβ) or a delta joining (Jδ) segment;

[0341] The second amplification product comprises a nucleic acid encoding the 5' portion of the beta constant (Cβ) or delta constant (Cδ) region; and / or

[0342] The second amplification product comprises a nucleic acid encoding the L sequence of the Vβ or Vδ segment, the Dβ or Dδ segment, the Jβ or Jδ segment, and the 5' portion of the Cβ or Cδ region.

[0343] 30. The method of any one of embodiments 26 to 29, wherein the first amplification product comprises an adapter sequence that is added to the amplified template sequence of the cDNA via a second round of amplification.

[0344] 31. A method according to any one of embodiments 26 to 30, wherein the second amplification product comprises an adapter sequence added to the amplified template sequence of the cDNA via the second round of amplification.

[0345] 32. The method of any one of embodiments 26 to 31, wherein the first amplification product comprises a first adapter sequence that is added to the amplified template sequence of the cDNA via a second round of amplification, and

[0346] wherein the second amplification product comprises a second adapter sequence added to the amplified template sequence of the cDNA via the second round of amplification, wherein the first adapter sequence and the second adapter sequence are different.

[0347] 33. A method according to any one of embodiments 26 to 32, wherein the functional T cell receptor comprises a full-length alpha constant region and a full-length beta constant region; or a full-length gamma constant region and a full-length delta constant region.

[0348] 34. The method of any one of embodiments 26 to 33, wherein:

[0349] Each of the assembled nucleic acids comprises a nucleic acid sequence encoding a self-cleaving peptide or an internal ribosome entry site (IRES);

[0350] The method further comprises sorting single T cells into the separate locations prior to step (1); and / or

[0351] The method further comprises performing a reverse transcription reaction before step (1) to obtain the cDNA.

[0352] 35. A method according to any one of embodiments 26 to 34, wherein each of the assembled nucleic acids is obtained without performing nucleic acid sequencing.

[0353] 36. A method according to any one of embodiments 26 to 35, wherein each of the assembled nucleic acids is obtained without performing a restriction endonuclease cleavage reaction.

[0354] 37. The method of any one of embodiments 26 to 36, wherein seamless cloning is used for the assembly.

[0355] 38. The method of any one of embodiments 1 to 37, wherein the vector is a high titer lentiviral vector.

[0356] 39. A method according to any one of embodiments 1 to 38, wherein each of the TCR-expressing reporter T cells is located at multiple separate locations of the device.

[0357] 40. The method of any one of embodiments 26 to 39, wherein the plurality of separate locations is greater than 50, optionally wherein the plurality is greater than 500, further optionally wherein the plurality is greater than 5000.

[0358] 41. The method of any one of embodiments 26 to 40, wherein the device comprises a multi-well plate, optionally wherein the multi-well plate is a 96-well plate, a 384-well plate, or a 1536-well plate.

[0359] 42. The method of any one of embodiments 1 to 41, wherein one iteration of the method is capable of employing a library of reporter T cells expressing the TCR, the library comprising at least 50, 100, 150, 200, 250, 300, 350, 400, 450, or 500 reporter T cells expressing the TCR.

[0360] 43. The method of any one of embodiments 1 to 42, wherein one iteration of the method is capable of employing at least 50, 100, 150, 200, 250, 300, 350, 400, 450, or 500 candidate tumor neoantigens or fragments thereof.

[0361] 44. A method according to any one of embodiments 1 to 43, wherein one iteration of the method is capable of using a plurality of tandem candidate neo-antigen carriers, wherein the plurality of tandem candidate neo-antigen carriers comprises at least 100, 200, 300, 400, 500, 600, 700, 800, 900 or 1000 tandem candidate neo-antigen carriers.

[0362] 45. The method of any one of embodiments 1 to 44, wherein one iteration of the method is capable of employing a library of APCs comprising at least 100, 200, 300, 400, 500, 600, 700, 800, 900, or 1000 APCs.

[0363] 46. ​​The method of any one of embodiments 1 to 45, wherein the TCR or its bound antigen that binds to a tumor neoantigen is identified within 6 months, 5 months, 4 months, 3 months, 2 months, 7 weeks, 6 weeks, 5 weeks, 4 weeks, 3 weeks, 2 weeks, or 1 week.

[0364] 47. The method of any one of embodiments 1 to 46, wherein one iteration of the method is completed within 6 months, 5 months, 4 months, 3 months, 2 months, 7 weeks, 6 weeks, 5 weeks, 4 weeks, 3 weeks, 2 weeks, or 1 week.

[0365] 48. A TCR or antigen-binding fragment thereof identified by the method of any one of embodiments 1 to 47.

[0366] 49. A polynucleotide encoding the TCR or antigen-binding fragment thereof according to embodiment 48, or its α chain, β chain, γ chain or δ chain.

[0367] 50. A vector comprising the polynucleotide according to embodiment 49.

[0368] 51. The vector of embodiment 50, wherein the vector is a viral vector.

[0369] 52. The vector of embodiment 51, wherein the viral vector is a lentiviral vector.

[0370] 53. An engineered cell comprising the TCR or antigen-binding fragment thereof according to any one of embodiments 1 to 47, the polynucleotide according to embodiment 49, or the vector according to any one of embodiments 50 to 52.

[0371] 54. A system comprising:

[0372] (a) a first device comprising a plurality of locations, each location comprising a T cell expressing a TCR, the T cell comprising one of a plurality of nucleic acid molecules, each nucleic acid molecule comprising a nucleic acid encoding a functional TCR from a T cell obtained from a biological sample of a subject having a tumor;

[0373] (b) a computer for identifying candidate tumor neoantigens by comparing genomic DNA sequences and RNA expression profiles of tumor cells from the biological sample with corresponding genomic DNA sequences and RNA expression profiles of non-tumor cells from the same subject;

[0374] (c) a second device comprising a plurality of locations, each location comprising an antigen presenting cell (APC), wherein the antigen presenting cell comprises one of a plurality of tandem candidate neoantigen vectors that enter the plurality of APCs, wherein the plurality of tandem candidate neoantigen vectors each encode one or more of the candidate tumor neoantigens or fragments thereof, wherein the plurality of APCs are capable of expressing the one or more candidate tumor neoantigens or fragments thereof in complex with a major histocompatibility complex (MHC) molecule;

[0375] (d) a third means for contacting one or more cells in the location of the first means with one or more cells in the location of the second means.

[0376] Example

[0377] The following examples are included for illustrative purposes only and are not intended to limit the scope of the present invention.

[0378] Example 1. Computational new antigen discovery process

[0379] A computational neoantigen discovery pipeline was developed, an illustrative schematic of which is available in Figure 1 A and described below.

[0380] As input, the process uses data from DNA sequencing (e.g., whole genome sequencing or exome sequencing) of tumor and non-tumor tissues from the subject, as well as RNA sequencing of tumor tissue. The sequencing information is then used to identify non-synonymous mutations that are present in tumor sequences but not in non-tumor sequences. Non-synonymous mutations are considered candidate neoantigens. As output, the process computer constructs candidate neoantigen minigenes, which are used to identify neoantigen-specific T cell receptors (TCRs). The following is an overview of the main processes of an exemplary computational neoantigen discovery process.

[0381] In this exemplary process, for the preprocessing step, RNA-seq data were aligned using the Spliced ​​Transcript Alignment to Reference Genome (STAR) module (Dobin et al., 2013, Bioinformatics, 29(1), 15-21), and the genome sequencing data were aligned to the reference genome HG19 containing the bait sequence using the Burrows-Wheeler Aligner (BWA) module (Li and Durbin, 2010, Bioinformatics, 26(5), 589-595). The aligned tumor and non-tumor DNA sequences were locally realigned and recalibrated using standard GATK best practices (McKenna et al., 2010, Genome Research, 20(9), 1297-1303).

[0382] Next, tumor-specific variants were identified using the Mutect, Mutec2 (Benjamin et al., 2019, BioRxiv, 1–8. https: / / doi.org / 10.1101 / 861054), Somatic Sniper (Larson et al., 2012, Bioinformatics, 28(3), 311–317), VarScan2 (Koboldt et al., 2012, Genome Research, 22(3), 568–576), and Strelka2 (Kim et al., 2018, Nature Methods, 15, 591–594) modules. Nonsynonymous variants (i.e., mutations that change the amino acid sequence encoded by a gene) were identified using the VEP (McLaren et al., 2016, Genome Biology, 17(1), 1–14) and SNPeff (Cingolani et al., 2012, Fly, 6(2), 80–92) modules. The identified mutations are used to design candidate neoantigen minigene constructs (e.g., encoding polypeptide fragments comprising the mutated amino acid and surrounding amino acids, e.g., as described in Example 4).

[0383] Subject HLA typing was predicted from sequencing data using Seq2HLA (Boegel et al., 2012, Genome Medicine 4, Article No. 102) and OptiType (Szolek et al., 2014, Bioinformatics, 30(23), 3310-3316) modules. Candidate neoantigen minigene constructs were ranked based on MHC binding predictions and predicted HLA typing using the NetMHCpan 4.0 module and other methods (Jurtz et al., 2017, J Immunol 199(9), 3360-3368; Nielsen and Lund, 2009, BMC Bioinformatics, 10, 296; O'Donnell et al., 2018, Cell Systems 7(1), 129-132.E4). RNA-seq data were used to determine tumor expression levels of genes encoding candidate neoantigens. Candidate neoantigen minigenes were ranked based on multiple criteria, including MHC binding prediction and tumor expression levels.

[0384] The identified and sequenced neoantigen minigenes are used to construct tandem minigenes for neoantigen screening libraries, e.g., as described in Example 4 below.

[0385] Example 2. Obtaining samples from subjects

[0386] Samples were obtained from a 68-year-old Caucasian woman with melanoma for the following exemplary studies. Melanoma tumor samples obtained from the subjects were minced and frozen in aliquots for subsequent isolation of tumor cells, tumor infiltrating lymphocytes (TILs), and nucleic acids (DNA and RNA). Non-tumor peripheral blood mononuclear cells (PBMCs) were obtained from the subjects for isolation of DNA.

[0387] Example 3. Generation and validation of recombinant TCR libraries

[0388] Tumor infiltrating lymphocytes (TILs) were isolated from aliquots of the tumor samples obtained in Example 2, and a library of reporter cells encoding T cell receptors (TCRs) was generated for screening of neoantigen-specific TCRs.

[0389] like Figure 2 As shown, fluorescence activated cell sorting (FACS) was used to isolate individual viable tumor-infiltrating CD8+ T cells with a CD69hi PD1hi phenotype. A total of 192 individual TILs were isolated from tumor sample aliquots.

[0390] For each isolated TIL, cDNA corresponding to the RNA encoding the TCR was obtained and used to generate a library of lentiviral TCR expression vectors from one TIL, each encoding a functional TCR α and β chain pair or a γ and δ chain pair, generally as described, for example, in WO 2018 / 102473. A total of 192 lentiviral expression vectors were generated.

[0391] Each of the 192 lentiviral expression vectors encoding TCRs was transduced with a TCR-negative Jurkat cell line that was designed to express GFP when transduced via TCR signaling. Flow cytometry using anti-TCR monoclonal Ab (IP26) was used to identify cells expressing functional TCRs that were successfully transduced. In total, 152 of the 192 TCRs were successfully expressed (79% efficiency). A separate Jurkat reporter cell line was established for each of the 152 TCRs. Aliquots of each cell line were frozen for future use.

[0392] Reporter cell lines expressing the Jurkat TCR were validated by screening directly against tumor cells isolated from subjects. Each cell line was cultured in the presence of tumor cells, and TCR activation was assessed by flow cytometry based on upregulation of CD69 (as an indicator of T cell activation) and GFP expressed by the NFAT-GFP reporter transgene. Seventeen cell lines showed upregulation of both CD69 and GFP.

[0393] The results demonstrate that the described approach represents an efficient platform for generating libraries of TCR reporter cell lines that can be screened to identify individual neoantigen-specific TCRs.

[0394] Example 4. Identification of candidate neoantigens using a computational neoantigen discovery pipeline

[0395] Based on high-throughput DNA and RNA sequencing of tumor samples, candidate neoantigens are identified by computational analysis to generate a candidate neoantigen minigene library. DNA is isolated from non-tumor (PBMC) and tumor samples obtained as described in Example 2, and whole genome sequencing (WGS) is performed. WGS produces approximately 1.3 billion reads and 90 times coverage for tumor DNA, and approximately 400 million reads and 30 times coverage for non-tumor DNA. RNA is isolated from tumor samples obtained as described in Example 2, and high-throughput RNA sequencing (RNAseq) is performed to obtain approximately 50 million reads. Sequencing data is then used to identify candidate neoantigens using the computational neoantigen discovery process as described in Example 1.

[0396] A total of approximately 47,000 tumor-specific variants were identified, including 250 coding mutations (amino acid changes). A tumor mutation burden (TMB) of 14 mutations per million base pairs was calculated. 60% of the total cellular mutations were C:G to T:A mutations, consistent with UV-induced mutation patterns.

[0397] Among the tumor-specific variants, 234 single nucleotide variants (SNVs) and 6 indels (including 5 frameshifts) were identified as non-synonymous mutations. Based on RNAseq data, 22 of the 234 SNVs were located in genes expressed in tumors. It was predicted that 14 of the 22 SNVs were computer-constructed neoantigen minigenes strongly bound to MHC. As described in Example 5, computer-constructed neoantigen minigenes with 14 SNVs that were tumor-expressed and predicted to bind to MHC were used to guide the construction of a tandem minigene neoantigen library.

[0398] Example 5. Generation of a Tandem Minigene Neoantigen Library

[0399] A tandem minigene (TMG) expression construct was designed to express a single polypeptide containing multiple neoantigen minigenes. An exemplary schematic diagram of the tandem minigene polypeptides encoded by the construct is depicted in Figure 3 Each neoantigen minigene typically comprises a 25 amino acid (AA) sequence containing the SNV and 12 amino acids upstream and downstream of the SNV. In the construct used for the study, the polypeptide has an N-terminal ubiquitin moiety and has the mutation G76V to prevent cleavage. The "uncleavable" ubiquitin moiety promotes proteasomal degradation of the polypeptide to maximize the presentation of the processed neoantigen minigene on MHC-I. A spacer sequence is included that separates the ubiquitin moiety and each neoantigen minigene to promote efficient epitope processing.

[0400] The 14 SNV candidate neoantigen minigenes were cloned into 7 TMG constructs, each containing 2 neoantigen minigenes. For each TMG, a gene block (gBlock; a double-stranded DNA fragment) encoding a TMG polypeptide sequence with an uncleavable ubiquitin moiety and two 25-mer SNV-containing neoantigen minigenes separated by an AAY amino acid spacer sequence was synthesized. The gBlock was cloned into an exemplary lentiviral vector (e.g., Figure 4 TMG was expressed in the cells (as shown), and truncated nerve growth factor receptor (tNGFR) or mCherry was used as a marker for transduction.

[0401] In this study, cloning was performed in parallel and automated using automated liquid handling instruments to reduce reagent usage and improve cloning efficiency. gBlocks containing sequences for assembly using Gibson cloning were incubated with linearized vectors at a molar ratio of 3:1 and incubated in a 96-well plate format at 50°C for 1 hour in the presence of Gibson reagent. 1 μL of the Gibson assembly reaction was used to transform 25 μL of competent bacteria, which were plated to obtain colonies. Colony PCR was used to verify the successful assembly of the TMG lentiviral construct. The TMG construct was successfully assembled with an efficiency of 95%. Plasmids were recovered from the colonies for transduction into antigen-presenting cells as described below.

[0402] Example 6. Identification of neoantigen-specific TCRs using a neoantigen-specific TCR discovery platform

[0403] Libraries of reporter cell lines expressing TCRs were screened against TMG-transduced antigen-presenting cells to identify neoantigen-specific TCRs in a high-throughput format.

[0404] The reporter cell line expressing the Jurkat TCR generated as described in Example 3 was successfully recovered from frozen aliquots with an efficiency of >85%. Lymphoblastoid cell line cells (LCL) were used for antigen presentation. LCL were transduced with each TMG encoding construct generated as described in Example 5 and purified by FACS sorting based on mCherry fluorescence. Each recovered TCR-expressing reporter cell line was co-cultured with each TMG-transduced LCL. After co-culture, TCR activation of the TCR-expressing reporter cell line was assessed by flow cytometry based on the upregulation of CD69 and GFP expressed by the NFAT-GFP reporter transgene.

[0405] like Figures 5 to 7 As shown, in this study, 6 unique TCRs were identified as activated in the presence of TMG-expressing LCLs, and each TCR was activated by a specific TMG. Four (4) different TMGs (4 of 7) resulted in activation of at least one TCR. Four (4) of the 6 activated TCRs were among the 17 TCRs activated in the presence of tumor cells described in Example 3.

[0406] In this exemplary study, because each TMG contained two candidate neoantigen minigenes, experiments were performed to identify the neoantigen minigenes for which each TCR was specific. Figure 5 As shown, exemplary TCRs TCR-A, TCR-C, and TCR-D were activated in the presence of TMG "TMG-03-05" containing candidate neoantigens "Neo-03" and "Neo-05." Figure 6As shown, TCR reactivity was tested in the presence of (a) original TMG (TMG-03-05) in the presence of two neoantigens, (b) TMG with an unmutated "wild-type" (WT) sequence corresponding to Neo-03 (TMG-03WT-05), or (c) TMG with a WT sequence corresponding to Neo-05 (TMG-03-05WT). TCR-A was specifically activated in the presence of the Neo-05 neoantigen, while TCR-C and TCR-D were specifically activated in the presence of the Neo-03 neoantigen.

[0407] As shown in Figure 65, TCR-B was activated in the presence of TMG-01-10, TCR-E was activated in the presence of TMG-07-09, and TCR-H was activated in the presence of TMG-06-08. Figure 7 The reactivity of these TCRs was also tested in the presence of TMG containing WT or mutant forms of the neoantigens as shown. TCR-B was activated in the presence of Neo-01, TCR-E was activated in the presence of Neo-09, and TCR-H was activated in the presence of Neo-06.

[0408] In summary, 6 unique TCRs were identified that were specific for 5 different predicted neoantigens. 5 of the 14 predicted neoantigens resulted in TCR activation, representing a hit rate of >35% for predicted neoantigens. This hit rate was shown to be significantly higher than that reported in previous studies (Wells et al., Cell 2020 Oct 29; 183(3): 818-834).

[0409] The results support the utility of the described computational neoantigen discovery pipeline and neoantigen-specific TCR discovery platform for rapid and cost-effective discovery of personalized neoantigen-specific TCRs. The described pipeline and platform can also provide biological insights into the properties and biological mechanisms of tumor neoantigens and neoantigen-specific TCRs.

[0410] Example 7. New Antigen-Specific TCR Discovery Platform for Personalized Therapy

[0411] The computational neoantigen discovery pipeline and neoantigen-specific TCR discovery platform described above are used for personalized adoptive cell therapy treatment of subjects with cancer.

[0412] Figure 8A schematic diagram of an exemplary platform combining the components described above is shown in FIG. As described above, tumor and non-tumor tissues are obtained from a subject. DNA and RNA sequencing data from the samples are used to predict candidate neoantigens and generate a TMG library, generally as described in Examples 1, 4, and 5. In parallel, individual TILs are isolated from the tumor sample and used to sequence TCRs and generate reporter cell lines expressing TCRs, generally as described in Example 3. The reporter T cell lines are screened against the TMG library to identify neoantigen-specific TCRs, generally as described in Example 6.

[0413] Prepare an engineered T cell population that expresses one of the identified neoantigen-specific TCRs. Alternatively, prepare multiple engineered T cell populations, each expressing a different neoantigen-specific TCR. Administer the one or more engineered T cell populations to a subject. The engineered T cells generate an immune response against tumor tissue expressing the neoantigen, thereby reducing or eliminating the cancer.

[0414] Example 8. Application of a new antigen-specific TCR discovery platform to multiple subjects with head and neck tumors Samples

[0415] To further demonstrate the utility of the neoantigen-specific TCR discovery platform, samples from three additional subjects with head and neck tumors were evaluated. Tumor and non-tumor samples were obtained from each subject as described above.

[0416] Subject 1 was a 69-year-old female with oral squamous cell carcinoma (inner mucosa of the lower lip). Subject 2 was a 74-year-old male with oral squamous cell carcinoma. Subject 3 was a 41-year-old Caucasian female with oral squamous cell carcinoma (left oral tongue).

[0417] For each subject, separate TILs were isolated and used to clone and sequence TCRs, and lentiviral TCR expression vectors were produced, generally as described in Example 3. A total of 1,673 TILs were processed. The clonality of TCRs was assessed in each of the three samples. Samples from subject 2 were selected for further analysis. 384 separate TILs with effector memory / resident memory phenotypes were separated by flow cytometry. As described in Example 3, TILs were used to generate a library of reporter cell lines expressing Jurkat TCRs using a high-throughput method. In parallel, tumor and non-tumor (blood) DNA and tumor RNA were separated and sequenced. Sequencing data were analyzed using a computational new antigen discovery process, generally as described in Examples 1 and 4. A total of approximately 40,000 tumor-specific variants (representing a tumor mutation load of approximately 13 mutations per million base pairs) were identified, including 301 non-synonymous missense mutations and 14 frameshift mutations. Based on RNA-seq data, 142 missense mutations and 1 frameshift mutation were located in genes expressed in tumors. A computer-constructed neoantigen minigene with 76 mutations was predicted to bind strongly to MHC.

[0418] Samples from subjects 1 and 3 were processed to generate reporter cell lines expressing Jurkat TCRs and identify in silico neoantigen minigenes. The neoantigen minigenes from each subject were used to guide the construction of a tandem minigene candidate neoantigen library, generally as described in Example 5. Libraries of reporter cell lines expressing Jurkat TCRs were screened against the candidate neoantigen library to identify neoantigen-specific TCRs.

[0419] Example 9. New Antigen-Specific TCR Discovery Platform

[0420] This example describes further details of an additional exemplary computational neoantigen discovery pipeline and a neoantigen-specific TCR discovery platform.

[0421] In order to improve capacity and efficiency, the construction and screening of the candidate tumor neoantigen TMG library were optimized. Tumor and non-tumor tissue samples were obtained from the subjects. The samples were analyzed to identify the candidate neoantigen minigenes constructed by the computer, which were used to guide the construction of the optimized tandem minigene library. A library of 20 kinds of TMGs was constructed, which contained a total of 50 neoantigen minigenes. Each TMG contained 5 neoantigen minigenes, and each neoantigen minigene was presented twice in the library (i.e., on two separate neoantigen minigenes or TMGs). Because each neoantigen minigene was expressed on a unique combination of 20 TMGs, the TCR response to a specific neoantigen minigene could be inferred based on the unique dual TMG activation signature. The TMG library was expressed by an optimized expression vector. For example, the expression vector may contain an optimized flexible linker sequence and a spacer sequence, and its optimal expression in transduced cells can be tested. 20 kinds of TMGs were transduced into antigen presenting cells (e.g., LCLs), and the transduced cells were enriched by FACS sorting.

[0422] In parallel, the reporter cell line expressing TCR is produced using the TIL separated. The reporter cell line of multiple expression TCR is tested to obtain the best reading of TCR activation. For example, different reporter genes (for example, GFP, RFP, luciferase) are expressed from cell lines compatible with high-throughput TCR activation assays.

[0423] Each TCR expressed in an optimized TCR-expressing reporter cell line is screened against each of 20 TMGs expressed by antigen-presenting cells. TCR activation is assessed by specific TMGs. 2-TMG activation signatures are used to identify TCRs specific for individual candidate neoantigens.

[0424] Example 10. Adoptive cell therapy for the treatment of solid tumors.

[0425] MC38 tumors were isolated from 5 mice. Tumor-infiltrating T cells (TILs) were then isolated from the tumors. TCRs were cloned from TILs using a high-throughput TCR cloning method (WO2018102473). These TCRs were then expressed in a reporter T cell line. As described herein, DNA sequencing of MC38 tumors was performed and compared with the B6 reference genome to identify tumor-specific non-synonymous mutations that were predicted to produce neoantigen peptides. After sorting according to predicted MHC binding and gene expression levels, the top 212 neoantigen coding sequences were cloned into 55 tandem minigenes (TMGs), and the TMG library was transduced into fibroblasts (APCs). As described herein, 294 TIL-associated TCRs from MC38 tumors of 5 different mice were tested against 55 TMG cells. Reactive TCRs were identified by upregulation of CD69 in reporter cells. 36 unique TCRs that responded to MC38 mutations were identified. 12 TCRs recognized a single amino acid difference in the gene RPL18. Characterize the new antigen affinity and expression level of multiple anti-RPL18 TCRs. Retroviral vectors and CRISPR / Cas9 were then used to knock out the endogenous TCR loci in T cells and insert heterologous anti-RPL18 TCRs to generate engineered T cells expressing high-affinity (A09) or low-affinity (I20) anti-RPL18 TCRs. The engineered T cells were then administered to tumor-bearing mice. Tumor growth or regression was monitored after administration of engineered T cells. Tumor regression was observed in 76% and 74% of tumors treated with engineered T cells expressing A09 (n=34) anti-RPL18 or I20 (n=35) anti-RPL18 TCRs. In contrast, regression was observed in only 37.5% (n=32) of mice treated with control T cells.

[0426] A. Overview: Generation of neoantigen-reactive T cells for adoptive cell therapy. MC38 tumors were resected and genomic DNA was isolated from the tumor. The genomic DNA was then subjected to whole genome sequencing (WGS) and mutation (neoantigen) identification. A library of tumor neoantigens was created and sequenced, and then TMGs were created for expressing the neoantigens in APCs. + TCRs are cloned from T cells and expressed in a reporter T cell line with a luciferase / eGFP / CD69 reporter gene. TCR-transduced reporter cells are then co-cultured with TMG-expressing APCs, and neoantigen-reactive T cells are identified and isolated. Reactive TCRs are characterized and expressed in primary T cells that have been modified to knock out the endogenous TCR. The engineered T cells are then used for adoptive T cell therapy for tumor treatment.

[0427] B. MC38 neoantigen identification and tandem minigene expression. As described above, MC38 tumor cells were isolated, the genome was sequenced and compared with the B6 reference genome. 320,000 variations between the MC38 genome and the B6 genome were identified. 360,000 variations were present in 4280 exons. The variations in the 4280 exons were then narrowed down to 807 non-synonymous mutations. After additional analysis, the 807 non-synonymous mutations were further narrowed down to approximately 100 best predicted neoantigen genes. The 7 identified neoantigens are shown in Table 3.

[0428] Table 3. Ranking of MC38 neoantigens.

[0429] protein IS Sorting REF ALT Predicted peptides <![CDATA[Net-HMC score 1 > <![CDATA[Expression level 2 > Rpl18 48 47 A G LTFDRLAL 358.55 16900 Map1a 52 29 G T SSFSHSAL 5.8 752 Hacd1 53 66 C A VSFDYYYFLLITI 17.31 179 Reps1 54 16 C T AAQLANDVVL 56.1 707 Med1 55 74 C A FQHPVNDSLV 431.21 1692 Adat1 56 50 T A ASFIPMLEF 433.09 235 Adpgk 89 36 G T ASMTNMELM 4.29 833

[0430] 1 Predicted binding to MHC (net-MHC score)

[0431] 2 Expression levels determined from publicly available RNA-seq data

[0432] TMG vectors. Of the 800+ genes identified, the top 100 neoantigens were assembled into a library of 26 TMG vectors. (That is, 26 TMG vectors encoding 100 neoantigens were generated; see Table 4, TMG 3.1-3.26). Each TMG vector encodes 6-10 minigenes (4-8 MC38 neoantigen minigenes). The first and last (e.g., the 1st and 10th) minigenes in each TMG encode the OVA epitope and the H60 epitope, respectively, as expression controls that do not exist in the tumor. Each minigene encodes 25 or fewer amino acids. Where possible, each minigene encodes 12 amino acids upstream and 12 amino acids downstream of the identified mutation. Each MC38 minigene is presented twice in the TMG library to help identify TCRs that match the neoantigen—once in TMG vectors 3.1-3.13 and once in TMG vectors 3.14-3.26. TMG 3.0 contains the previously disclosed MC38 neoantigen.

[0433] Table 4. Tandem minigene vectors.

[0434]

[0435] *Their published peptide sequence differs from our MC38 tumor cell line at multiple locations

[0436] C. TCR cloning. TILs from dissected MC38 cells were single-cell sorted into 384-well plates. TCR-α and TCR-β sequences were then amplified by single-cell PCR and assembled into retroviral vectors that also expressed a puromycin resistance gene. Retroviral vectors encoding 186 TCR vectors were individually transduced into TCR neg in Jurkat reporter cells.

[0437] Each retroviral vector encodes the TCRα gene and TCRβ gene of a single TCR. The TCRα and TCRβ genes are connected by a P2A sequence to enable expression from a single promoter. The retroviral vector further encodes mCherry and a puromycin resistance gene (PuroR). The coding sequence of the mCherry gene is operably connected to the coding sequence of the TCRβ gene via an IRES sequence, and the PuroR gene is operably connected to the mCherry gene via a T2A sequence. The enrichment of transduced Jurkat cells is completed by puromycin selection. The TCR cloning efficiency (mouse TCR-β in the transduced population) determined by flow cytometry was quantified. + The percentage of cells was 76%.

[0438] D. Screening for MC38 neoantigen-specific TCRs. 145 Jurkat cultures expressing individual candidate TCRs were grouped into 29 pools of five cell lines (TCRs) and plated in 96-well plates against TMG-transduced B6WT3 cells, MC38 cells, B6 bone marrow dendritic cells (BMDCs), or cells lacking H2-D. b or H2-D b / K b The untransduced B6WT3 were co-cultured. Activated T cells were determined by induction of CD69. A single TCR from each activation pool was then co-cultured against the same TMG that stimulated activation to determine which TCR recognized which new antigen. After screening 294 TCRs against a library of 212 new antigens, 36 unique TCRs that recognized 6 different new antigens were identified (see Table 5). RPL18 is a known new antigen expressed in MC38 tumors, indicating that this method effectively identifies new antigens that can be used for targeted anti-tumor therapies (such as adoptive cell therapy or engineered T cell therapy).

[0439] Table 5. Identified TCRs that recognize MC38 neoantigens

[0440]

[0441] E. In vitro characterization of anti-RPL18 TCRs. TCRs were transduced with retroviral vectors encoding A09, I20, and I02 anti-RPL18 TCRs at matching titers. neg4G4 cells. Transduction was performed to produce 20% transduction for each TCR (as determined by flow cytometry measuring TCRβ and mCherry expression). At the time of matched transduction, 4G4 cells were stained with serial dilutions of RPL18-KILTFDRL dextramer. The results show the diversity of RPL18-DEX mean fluorescence intensity (MFI) in TCRs ( Figure 9 ).like Figures 10 to 12 As shown, anti-RPL18 TCR I02 had the highest TCR expression, anti-RPL18 TCR A09 had the highest RPL18-dextramer affinity, and anti-RPL18 TCR I20 had the lowest TCR expression and the lowest RPL18-dextramer affinity.

[0442] CRISPR KO and RPL18-specific TCR transduction in FT cells. Engineered polyclonal T cells were prepared by transducing nucleic acids encoding anti-RPL18 TCRs (A09, I20, or I02) or control anti-OVA TCRs into primary T cells. Primary T cells were activated using plate-bound anti-CD3, soluble anti-41BB, anti-CD28, and IL-2. Endogenous TCRs were knocked out in T cells using TRAC and TRBC gRNAs via CRISPR-Cas9. Figure 13A (Upper row) Representative CD8 T cells expressing RPL18-specific TCRs A09, I20, I02, OVA-specific TCR OT1 and untransduced controls are shown. + and CD4 + Stain cells. Figure 13A (Lower row) shows CD8 + Representative TCR and RPL18-dex staining of cells. The engineered T cells were then tested for their ability to target and kill MC38 tumor cells and RPL18 peptide-pulsed B6WT3 cells. Figure 13B As shown, engineered T cells expressing heterologous anti-RPL18 TCRs killed MC38 tumor cells and RPL18 peptide-pulsed B6WT3 cells at a higher rate than control T cells expressing heterologous anti-OVA TCRs. The area under the curve analysis of each TCR against MC38 cells (top panel) and RPL18 peptide-pulsed B6WT3 cells was calculated and displayed in Figure 13C The groups were compared by one-way ANOVA followed by Tukey's post hoc test. ***p<0.01, ****p<0.001.

[0443] Example 11. Engineered T cell therapy of MC38 tumors in mice.

[0444] C57Bl / 6 mice received intradermal injections of 2 × 10 5MC38 cells. Nine days after injection, mice with tumors >2 mm in diameter were treated with engineered T cells expressing heterologous anti-RPL18 TCRs (A09, I20, or I02) or control anti-OVA TCRs ("Day 0"). Cell numbers were normalized so that all mice received 2 × 10 6 RPL18 dextramer binds CD8 + cells and "carried T cells". 18-24 hours after infusion, mice received 50 μg of anti-CD40 antibody. Tumor size was measured in two dimensions with high agreement by two anonymous judges. Data represent 1 of 3 independent experiments. The area under the curve of tumor growth was calculated and compared between groups by one-way analysis of variance with Tukey's post hoc test. Figure 14 As shown, mice treated with engineered T cells expressing heterologous A09 or I20 anti-RGP18 TCRs exhibited significant tumor regression compared to mice treated with engineered T cells expressing a control anti-OVA18 TCR.

[0445] The percentage change in tumor volume was calculated from day -1 of treatment to the last day of the experiment. Pooled data from three experiments are shown in Figure 15 The number of mice with regressed tumors in the A09 or I20 treated groups was compared with that in the control cell group by Fisher's exact test. The percentage of regression was significantly higher in mice treated with engineered T cells expressing heterologous A09 or I20 anti-RGP18 TCR. On the last day of the experiment, spleens were examined by flow cytometry and donor cells were identified by CD90.1 expression. The total number of donor CD8 cells per spleen did not differ significantly between the different treatment groups. The immune infiltration of the tumors was assessed by flow cytometry. The donor cells were CD90.1 + In the late stages of the experiment, many tumors were detectable only at dissection and were therefore not included in the tumor growth score. In mice treated with engineered T cells expressing heterologous I20 anti-RGP18 TCR, recovered donor CD8 + The number of cells was significantly increased. There was no difference in the number of endogenous T cells in the tumor. Data were compared by Kruskal-Wallis test and Dunn's multiple comparison test *p = 0.02. + The absolute RPL18-dextramer MFI in tumor-infiltrating lymphocytes was higher than that in spleen.

[0446] Using this method, new antigens are identified from mouse tumor models. The identified new antigens can then be used to capture TCRs specific for the identified antigens. The TCRs can then be used to generate engineered T cells that effectively target and treat tumors expressing the new antigens. Both low-affinity and high-affinity TCRs are effective in treating solid tumors.

[0447] Example 12. Identification of TCRs and neoantigens from solid tumors

[0448] Obtain lung tumor sample, be processed into quadrant, and carry out single cell sorting.Collect 1,500 kinds of tumor infiltrating lymphocytes (TIL).Subset of TIL is carried out surface staining for flow cytometry and single cell sorting.The plate of sorting is cryopreserved, and is returned later (for example, need to increase or other CDR3 diversity) when necessary.Process normal, edge and tumor tissue for genomic DNA and RNA sequencing.

[0449] The sorted plates were run through the TcXpress (WO pipeline, in which TRAV and TRBV fragments are cloned and assembled into approximately 1,000 expression vectors). The cloned TCRs were subjected to TRBV next-generation sequencing. 700 TCRs were run through the pipeline for assembly into lentiviral TCR expression vectors. The lentiviral TCR expression vectors were then used to generate a reporter T cell (Jurkat) cell library.

[0450] 300 kinds of non-synonymous protein coding mutations were identified by differential whole genome sequencing (i.e., normal tissue vs. tumor tissue). A subset of those candidate mutations was supported by tumor RNA expression (from RNAseq analysis) and other standards. 150 neoAgs were selected to be assembled into 5-antigen tandem minigene (5TMG) constructs, producing 30 kinds of tandem minigenes (TMG). The predicted TMGs were sorted for gene synthesis, high-throughput cloned into TMG expression vectors, and lentiviral constructs were produced, which were finally transduced into APC cell lines. Complete patient HLA haplotypes were reassembled using the methods described herein. Complete HLA patient haplotypes were expressed in two independent K562 cell lines, each of which carried HLA-A, HLA-B, and HLA-C. 30 TMG lentiviral constructs were each transduced into two K562 cell lines to produce 60 K562 clones. In general, each predicted TMG construct was screened for complete patient HLA haplotypes.

[0451] APC and reporter T cell libraries are mixed in high dimensionality to screen every possible HLA, TCR, and neoAg combination.

[0452] 32 unique TCRs per well were co-cultured with 6 unique APC clones (each unique APC clone carried 5 NeoAg minigenes). Under this co-culture dimension, 960 unique interactions were evaluated per well. For a single corresponding TCR in the pool of 32 TCRs, the maximum "hit response" on the flow cytometer reading (assuming 100% TCR transduction) was about 3%. Two new antigen-specific "hit" TCRs were identified.

[0453] The reactive TCR is deconvoluted from its corresponding screening pool.Then a single TCR is mapped to a specific HLA and TMG. Two reactive / hit TCR pools are deconvoluted (moved downward from 32 potential TCRs to a single unique TCR defined by the CDR3B sequence). After TCR deconvolution, the K562 of a single HLA expression engineered to identify and deconvolute the specific HLA restriction of the TCR. Next, a specific TMG (in the pool of 6 potential TMG constructs) is deconvoluted to produce a single TCR paired with a single HLA allele, which reacts to a single TMG construct (still comprising 5 independent minigenes).

[0454] The 5TMG construct was genetically broken down into individual minigenes to identify the mutation of interest. This mutation was then genetically reverted to the germline to confirm loss of TCR reactivity against the non-mutated antigen.

[0455] TCR#1 specifically reacts with TMG#1, which carries 5 unique neoantigen minigenes. After deconvolution of HLA restriction, NetMHCpan 4.1HLA loading and prediction software was used to predict a specific NeoAg (one of 5 possibilities) that was specifically processed and loaded onto the previously identified HLA. A separate NeoAg#1 (i.e., a single construct expressing neoAg) was synthesized, cloned into an expression vector, and transduced into matching HLA-expressing K562 (alternatively, HLA-restricted peptides predicted by NetMHCpan can be directly ordered for peptide synthesis). At the same time, a germline reversion construct of the same NeoAg (wherein the mutated SNP is reverted to the germline sequence) was generated. In the final confirmation, the reactivity of a single NeoAg and a single germline reversion of the NeoAg to the identified TCR was evaluated, thereby confirming the successful identification of a neoantigen TCR that does not react to normal antigens. A similar workflow was followed to deconvolve hits for TCR#2 and NeoAg#2.

[0456] Flow cytometric analysis was used to assess TCR signaling and responsiveness.

[0457] The present invention is not intended to be limited in scope to the specifically disclosed embodiments, which are provided, for example, to illustrate various aspects of the invention. Various modifications to the described compositions and methods will become apparent from the description and teachings herein. Such variations may be practiced without departing from the true scope and spirit of the present disclosure and are intended to fall within the scope of the present disclosure.

Claims

1. A method for identifying a T cell receptor (TCR) or antigen-binding fragment thereof that binds to an antigen associated with a disease or condition, the method comprising: (a) forming a library of reporter T cells expressing a TCR, wherein each T cell in the library expresses a single functional TCR; (b) forming a library of antigen presenting cells (APCs) expressing candidate antigens, wherein each APC in the library expresses one or more candidate antigens or fragments thereof associated with the disease or disorder; (c) contacting the reporter T cells with the APCs; as well as (d) identifying reporter T cells that are activated upon contacting the library of reporter T cells expressing the TCR with the library of APCs, thereby identifying the TCR or antigen-binding fragment thereof that binds to an antigen associated with the disease or disorder.

2. The method of claim 1, wherein the disease or condition is cancer, infection, viral infection, bacterial infection, allergy, or autoimmune disease.

3. The method of claim 1 or 2, wherein forming the library of reporter T cells expressing the TCR comprises introducing a plurality of nucleic acid molecules into a plurality of reporter T cells, each of the plurality of nucleic acid molecules comprising a nucleic acid encoding a functional TCR from a T cell obtained from a biological sample of a subject.

4. The method of claim 3, wherein the subject has a tumor.

5. The method according to any one of claims 1 to 4, wherein the disease is cancer, the candidate antigen or fragment thereof is a tumor neoantigen, and the library of APCs expressing the candidate antigen is a library of APCs expressing neoantigens.

6. The method of any one of claims 1 to 5, wherein forming the library of neoantigen-expressing APCs comprises: (i) performing genomic DNA sequencing and RNA expression profiling on cells obtained from a tumor of a subject; (ii) performing genomic DNA sequencing on non-cancerous cells obtained from the subject; (iii) identifying expression mutations in the genome of the tumor cell relative to the non-cancerous cell; (iv) forming a library of neoantigen expression vectors containing neoantigen minigenes encoding candidate tumor neoantigens or fragments thereof, wherein the candidate tumor neoantigens or fragments thereof contain the mutation identified in step (iii); and (v) introducing the library of neoantigen expression vectors into a plurality of APCs capable of expressing the one or more candidate tumor neoantigens complexed with major histocompatibility complex (MHC) molecules.

7. The method of claim 6, wherein the antigen is identified as a candidate tumor neoantigen if the following conditions are met: (i) the presence of a single nucleotide variant (SNV) or insertion-deletion (indel) in the genomic DNA sequence of the gene encoding the antigen from the tumor cells of the biological sample compared to the corresponding genomic DNA sequence of the gene encoding the antigen from the non-tumor cells of the same subject; and / or (ii) the presence of a SNV or indel in the mRNA sequence of the gene encoding the antigen from the tumor cells of the biological sample compared to the corresponding genomic sequence of the gene encoding the antigen from the non-tumor cells of the same subject.

8. The method of claim 7, wherein the SNV results in a non-synonymous mutation, a missense mutation, or a nonsense mutation in the gene encoding the antigen.

9. The method of claim 7, wherein the indel results in a frameshift mutation in the gene encoding the antigen.

10. The method according to any one of claims 7 to 9, wherein the SNV or indel is present in a coding region or an exon of the gene encoding the antigen.

11. The method according to any one of claims 7 to 9, wherein the SNV or indel is present in a regulatory region or an intron of the gene encoding the antigen.

12. The method according to any one of claims 6 to 12, wherein the minigene encodes 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, A peptide of 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acids, optionally wherein the minigene encodes about 4 to about 15 amino acids upstream of the mutation and about 4 to about 15 amino acids downstream of the mutation.

13. The method according to any one of claims 6 to 12, wherein each neoantigen expression vector in the library of neoantigen expression vectors encodes one or more of the candidate tumor neoantigens or fragments thereof.

14. The method of claim 13, wherein the neoantigen expression vector encodes a fusion polypeptide comprising a modified ubiquitin portion and at least one candidate tumor neoantigen or fragment thereof, optionally wherein the modified ubiquitin comprises a G76V amino acid substitution.

15. The method according to any one of claims 6 to 14, wherein at least one of the neoantigen expression vectors comprises a tandem minigene vector.

16. The method of claim 15, wherein the tandem minigene vector encodes a fusion polypeptide comprising at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9 or at least 10 candidate neoantigens or fragments thereof.

17. The method according to any one of claims 6 to 16, wherein the neoantigen expression vector is assembled using parallel cloning.

18. The method according to any one of claims 6 to 17, wherein the neoantigen expression vector is assembled using seamless cloning.

19. The method according to any one of claims 6 to 18, wherein the neoantigen expression vector comprises a lentiviral vector.

20. The method of any one of claims 6 to 19, wherein the library of neoantigen expression vectors comprises all, nearly all, greater than 95%, greater than 90%, greater than 85%, greater than 80%, greater than 75%, greater than 70%, greater than 60% or greater than 50% or a subset of the identified neoantigens from a subject.

21. The method according to any one of claims 6 to 20, wherein the method further comprises predicting binding to MHC molecules, predicting the ability to induce an immune response, predicting cellular processing of the identified expression mutation.

22. The method according to any one of claims 1 to 21, wherein the APC comprises a B lymphoblastoid cell line (B-LCL) or an artificial APC or a K562 cell expressing an MHC molecule.

23. The method of any one of claims 1 to 22, wherein the MHC molecule comprises at least one human leukocyte antigen (HLA) allele expressed in the subject.

24. The method of claim 23, wherein the MHC molecule is a human leukocyte antigen (HLA)-A molecule.

25. The method of claim 24, wherein the HLA-A molecule is serotype HLA-A2, HLA-A*02:01, HLA-A*02:06, HLA-A*02:02, HLA-A*02:03, HLA-A*02:

07.

26. The method of claim 23, wherein the MHC molecule is an HLA-B and / or HLA-C molecule.

27. The method of any one of claims 6 to 26, wherein introducing the library of neo-antigen expression vectors into the plurality of APCs comprises introducing each vector of the library of neo-antigen expression vectors into at least two APCs, wherein the at least two APCs together are HLA-matched to the subject.

28. The method of claim 27, wherein the at least two APCs comprise: (a) a first APC expressing a first HLA-A, a first HLA-B, and a first HLA-C of the subject and a second APC expressing a second HLA-A, a second HLA-B, and a second HLA-C of the subject; (b) a first APC expressing the subject's first HLA-A and second HLA-A, a second APC expressing the subject's first HLA-B and second HLA-B, and a third APC expressing the subject's first HLA-C and second HLA-C.

29. The method of any one of claims 6 to 28, wherein the plurality of APCs is obtained from a library of APCs expressing a combination of HLA-A, HLA-B, and HLA-C alleles.

30. The method of claim 29, wherein the library of APCs comprises a plurality of APCs, wherein each APC in the library expresses an HLA-A allele, an HLA-B allele, and an HLA-C allele.

31. The method of claim 30, wherein the HLA-A alleles, HLA-B alleles, and HLA-C alleles present in the library are selected to encompass greater than 50%, greater than 60%, greater than 70%, greater than 75%, greater than 80%, greater than 85%, greater than 90%, greater than 95%, greater than 98%, or greater than 99% of the HLA-A alleles, the HLA-B alleles, and the HLA-C alleles present in a population.

32. The method of claim 31 , wherein the combination of HLA-A, HLA-B, and / or HLA-C alleles present in the APCs in the library encompasses the combination of HLA-A, HLA-B, and HLA-C alleles present in greater than 50%, greater than 60%, greater than 70%, greater than 75%, greater than 80%, greater than 85%, greater than 90%, greater than 95%, greater than 98%, or greater than 99% of individuals in a population.

33. The method of any one of claims 29 to 32, wherein the HLA-A alleles, the HLA-B alleles, and the HLA-C alleles present in the library are provided in Table 1.

34. The method of any one of claims 6 to 33, wherein contacting the reporter T cell with the APC comprises combining one or more TCR-expressing reporter T cells from the library of reporter T cells expressing a functional TCR with one or more APCs from the library of neo-antigen-expressing APCs, and co-culturing the cells under conditions suitable for activation of the T cell by binding of the TCR to a cognate antigen.

35. The method of claim 34, wherein contacting the reporter T cells with the APC comprises contacting approximately 5×10 4 to about 5×10 5 Reporter T cells and about 5×10 4 to about 5×10 5 Co-culture of APCs expressing neoantigens.

36. The method of claim 34 or 35, wherein reporter T cells expressing each TCR are co-cultured separately with APCs containing each neo-antigen expression vector, wherein each TCR / neo-antigen expression vector combination is co-cultured in a separate sample.

37. The method of claim 34 or 35, wherein contacting the reporter T cells with the APCs comprises contacting a pool of reporter T cells expressing 1-100 different TCRs with a pool of APCs expressing 1-20 neoantigen expression vectors in a single sample.

38. The method of claim 37, wherein each neoantigen or fragment thereof is expressed in at least about 5% of the APCs in a pool of neoantigen-expressing APCs.

39. The method of claim 37 or 38, wherein each TCR is expressed by at least about 5% of the reporter T cells in the pool of reporter T cells.

40. The method of any one of claims 37 to 39, wherein the reporter T cells in the pool of reporter T cells express two or more different detectable markers.

41. The method of any one of claims 1 to 40, wherein the library of TCR-expressing reporter T cells contains a plurality of reporter T cells expressing at least 50, at least 100, at least 150, at least 200, at least 250, at least 300, at least 350, at least 400, at least 450, or at least 500 different TCRs.

42. The method of any one of claims 1 to 41, wherein the library of neoantigen-expressing APCs contains a plurality of APCs expressing at least 100, at least 200, at least 300, at least 400, at least 500, at least 600, at least 700, at least 800, at least 900, or at least 1000 different tumor neoantigens or fragments thereof.

43. The method of any one of claims 1 to 42, wherein the library of neo-antigen-expressing APCs contains a plurality of APCs expressing at least 100, at least 200, at least 300, at least 400, at least 500, at least 600, at least 700, at least 800, at least 900, or at least 1000 different neo-antigen expression vectors.

44. The method of any one of claims 1 to 43, wherein one iteration of the method is capable of screening at least 50, at least 100, at least 150, at least 200, at least 250, at least 300, at least 350, at least 400, at least 450, or at least 500 different TCRs and / or at least 100, at least 200, at least 300, at least 400, at least 500, at least 600, at least 700, at least 800, at least 900, or at least 1000 different neoantigen expression vectors or tumor neoantigens or fragments thereof.

45. The method of any one of claims 1 to 44, wherein the reporter T cells are contacted with the APCs in a plurality of separate locations of a device.

46. ​​The method of claim 45, wherein the plurality of separate locations is greater than 50, greater than 95, greater than 350, greater than 500, greater than 1500, greater than 3400, or greater than 5000.

47. The method of claim 45 or 46, wherein the device comprises a multi-well plate, optionally wherein the multi-well plate is a 96-well plate, a 384-well plate or a 1536-well plate.

48. The method of any one of claims 1 to 47, wherein identifying activated reporter T cells comprises detecting and / or quantifying a detectable marker.

49. The method of claim 48, wherein the detectable label comprises a fluorescent protein or a cell surface marker.

50. The method of claim 49, wherein expression of the detectable marker by activated reporter T cells is detected by flow cytometry.

51. The method of any one of claims 1 to 50, wherein identifying a sample containing activated reporter T cells comprises determining the percentage of reporter T cells in the sample that express the detectable marker, wherein detection of the detectable marker in at least about half of the percentage of reporter T cells in the sample that express a given TCR indicates activation of the reporter T cells in the sample.

52. An expression vector comprising a first nucleic acid sequence encoding a first HLA allele and a second nucleotide sequence encoding a second HLA allele, wherein the first nucleic acid sequence and the second nucleic acid sequence are expressed from a single promoter and are linked by a translation modification element.

53. The expression vector of claim 52, wherein the expression vector further comprises a third nucleic acid sequence encoding a selectable marker, optionally wherein the third nucleic acid sequence is expressed from the single promoter and is linked to the second nucleic acid sequence via a translation modification element.

54. The expression vector according to claim 52 or 53, wherein the expression vector encodes: (a) 2 different HLA-A alleles; (b) 2 different HLA-B alleles; (c) 2 different HLA-C alleles; (d) HLA-A alleles and HLA-B alleles; (e) HLA-A alleles and HLA-C alleles; (f) HLA-B and HLA-C alleles; or (g) HLA-A alleles, HLA-B alleles, and HLA-C alleles.

55. A library of HLA expression vectors, wherein the library encodes a plurality of HLA-A alleles and / or HLA-B alleles and / or HLA-C alleles, wherein the plurality of HLA-A alleles and / or HLA-B alleles and / or HLA-C alleles is selected to encompass greater than 50%, greater than 60%, greater than 70%, greater than 75%, greater than 80%, greater than 85%, greater than 90%, greater than 95%, greater than 98% or greater than 99% of the HLA-A alleles and / or HLA-B alleles and / or HLA-C alleles present in a population.

56. The library of HLA expression vectors, wherein the population is selected from the group consisting of an American population, a European population, a Middle Eastern population, an Asian population, a Chinese population, a Japanese population, a Korean population, an Indian population, a North American population, a South American population, an African population, subpopulations thereof, and combinations thereof.

57. The library of HLA expression vectors according to claim 55, wherein (a) the plurality of HLA-A alleles comprises the HLA-A alleles listed in Table 1; (b) the plurality of HLA-B alleles comprises the HLA-B alleles of Table 1; and / or (c) the plurality of HLA-C alleles comprises the HLA-C alleles listed in Table 1.

58. The library of HLA expression vectors of any one of claims 55 to 57, wherein the library comprises a plurality of expression vectors each encoding a single HLA-I allele and a plurality of expression vectors each encoding an HLA-B allele and an HLA-C allele.

59. The library of HLA expression vectors of claim 58, wherein the combinations of HLA-A, HLA-B, and HLA-C alleles present in the library are selected to encompass combinations of HLA-A, HLA-B, and / or HLA-C alleles present in greater than 50%, greater than 60%, greater than 70%, greater than 75%, greater than 80%, greater than 85%, greater than 90%, greater than 95%, greater than 98%, or greater than 99% of the individuals in a population.

60. The library of HLA expression vectors of claim 58 or 59, wherein the plurality of expression vectors each encoding an HLA-B allele and an HLA-C allele comprises expression vectors encoding the combination of HLA-B alleles and HLA-C alleles of Table 2.

61. The library of HLA expression vectors according to any one of claims 55 to 57, wherein the library comprises a plurality of expression vectors each encoding one or two HLA-A alleles, a plurality of expression vectors each encoding one or two HLA-B alleles, and / or a plurality of expression vectors each encoding one or two HLA-C alleles.

62. The library of HLA expression vectors of any one of claims 55 to 57, wherein the library comprises a plurality of expression vectors each encoding an HLA-B allele and an HLA-C allele, optionally wherein the HLA-B alleles and HLA-C alleles are selected to encompass greater than 50%, greater than 60%, greater than 70%, greater than 75%, greater than 80%, greater than 85%, greater than 90%, greater than 95%, greater than 98% or greater than 99% of the HLA-B and HLA-C alleles present in a population.

63. The library of HLA expression vectors of claim 62, wherein the plurality of expression vectors each encoding an HLA-B allele and an HLA-C allele comprises expression vectors encoding the combination of HLA-B alleles and HLA-C alleles of Table 2.

64. The library of HLA expression vectors according to any one of claims 55 to 63, wherein the expression vector is a lentiviral vector.

65. The library of HLA expression vectors of any one of claims 55 to 64, wherein the expression vectors are codon-optimized for human subjects.

66. A library of APCs comprising a plurality of APC cell lines each expressing a single HLA-A allele, wherein the HLA-A alleles are selected to encompass greater than 50%, greater than 60%, greater than 70%, greater than 75%, greater than 80%, greater than 85%, greater than 90%, greater than 95%, greater than 98% or greater than 99% of the HLA-A alleles present in a population, and wherein each cell line is maintained separately.

67. The library of APCs according to claim 62, wherein the library of APCs comprises 22 APC cell lines expressing the HLA-A alleles of Table 1.

68. A combination comprising a library of APCs according to claim 66 or 67 and a library of HLA expression vectors according to claim 62 or 63.

69. A method for generating APCs that are HLA-matched to a subject, the method comprising: (a) determining or having determined the HLA genotype of the subject; (b) selecting a first APC expressing the subject's first HLA-A allele and optionally a second APC expressing the subject's second HLA-A from the library of APCs according to claim 66 or 67; (c) selecting a first expression vector encoding a first HLA-B allele and a first HLA-C allele of the subject and optionally a second expression vector encoding a second HLA-B allele and a second HLA-C allele of the subject from the library of HLA expression vectors according to claim 62 or 63; and (d) introducing the first expression vector into the first APC, and optionally introducing the second expression vector into the second APC.

70. A method for cloning a TCR or antigen-binding fragment thereof that binds to a candidate antigen, the method comprising: Performing the method according to any one of claims 1 to 51, isolating the nucleic acid encoding the TCR from the activated reporter T cells identified in step (d), and inserting the isolated nucleic acid into a TCR expression vector.

71. The method of claim 70, wherein the TCR comprises a full-length alpha constant region and a full-length beta constant region.

72. The method of claim 70 or 71, wherein the TCR expression vector is a lentiviral vector.

73. A TCR or antigen-binding fragment thereof identified by the method of any one of claims 1 to 51 or 70 to 72.

74. A nucleic acid encoding a TCR cloned according to any one of claims 70 to 72.

75. A method of forming engineered T cells for treating cancer, the method comprising introducing the TCR expression vector of any one of claims 70 to 72 into donor T cells.

76. An engineered T cell formed by the method of claim 75.

77. An engineered cell comprising the identified TCR or antigen-binding fragment thereof according to any one of claims 1 to 51, the TCR expression vector according to any one of claims 60 to 72, or the nucleic acid according to claim 74.

78. A system comprising: (a) a first device comprising a plurality of locations, each location comprising 1-100 T cell lines expressing a TCR, wherein each T cell line expressing a TCR comprises a nucleic acid encoding a functional TCR from a T cell obtained from a first biological sample of a subject having a tumor; (b) a computer for identifying candidate tumor neoantigens by comparing genomic DNA sequences and RNA expression profiles of tumor cells from the subject with corresponding genomic DNA sequences of non-tumor cells from the same subject or a control subject; (c) a second device comprising a plurality of locations, each location comprising a pool of neo-antigen-expressing APC cell lines, wherein each pool of neo-antigen-expressing APC cell lines comprises 1-20 different neo-antigen expression vectors, wherein each neo-antigen expression vector expresses 1-10 candidate neo-antigens or fragments thereof, and wherein the APCs are capable of expressing the candidate neo-antigens or fragments thereof in complex with major histocompatibility complex (MHC) molecules; as well as (d) a third means for contacting one or more cells in the location of the first means with one or more cells in the location of the second means.

79. The system of claim 78, wherein the system further comprises a fourth device for analyzing activation of the T cells from the TCR-expressing T cell line after step (d).

80. The method of claim 2, wherein the disease is an infection and the candidate antigens or fragments thereof comprise one or more pathogen proteins or fragments thereof, optionally wherein the pathogen is a virus or a bacterium.

81. The method of claim 2, wherein the condition is allergy and the candidate antigen or fragment thereof comprises one or more allergen proteins or fragments thereof, optionally wherein the allergen is a food allergen or an environmental allergen.

82. The method of claim 2, wherein the condition is an autoimmune disease and the candidate antigens or fragments thereof comprise one or more proteins or fragments thereof associated with cells or tissues that are targets of the autoimmune disease.

83. The method of any one of claims 1 to 51, wherein the method further comprises identifying the APC that activates the reporter T cell and the antigen expressed by the APC.

84. A method of identifying an antigen presented to the immune system in the context of HLA, the method comprising: (a) forming a library of reporter T cells expressing a TCR, wherein each T cell in the library expresses a single functional TCR; (b) forming a library of antigen presenting cells (APCs) expressing candidate antigens, wherein each APC in the library expresses one or more candidate antigens or fragments thereof associated with the disease or disorder; (c) contacting the reporter T cells with the APCs; (d) identifying reporter T cells that are activated upon contacting the library of reporter T cells expressing the TCR with the library of APCs, and (e) identifying the APC that activates the reporter T cell and the antigen expressed by the APC.

85. A method of identifying an antigen presented to the immune system in the context of HLA, the method comprising: performing the method according to any one of claims 1 to 51, and identifying the APC that activates the reporter T cell and identifying the antigen expressed by the APC.

Images