A lipid nanoparticle for liver-targeted co-delivery of crisper-cas9 system and single-stranded dna repair template

Abstract

The application provides a kind of lipid nanoparticle for liver targeting combined delivery CRISPR-Cas9 system and single-stranded DNA repair template, which is prepared using ionizable lipid ALC-0315, PC lipid DOPC, cholesterol and DMG-PEG (2000) according to the molar ratio of 50:10:38.5:1.5. The lipid nanoparticle can simultaneously package Cas9 mRNA, sgRNA and single-stranded DNA repair template required for homology-directed repair (HDR) gene editing in a certain proportion to prepare All-in-one LNP. The All-in-one LNP successfully realizes liver targeting combined delivery of the above three nucleic acids, and successfully edits the liver of young mice, providing a precise and efficient tool for in vivo editing.

Description

Technical Field

[0001] This invention relates to the field of biomedicine, specifically to a lipid nanoparticle for targeted liver delivery of a CRISPR-Cas9 system and a single-stranded DNA repair template. Background Technology

[0002] Gene editing technology, a revolutionary breakthrough in life sciences, has brought new research directions to many fields such as disease treatment and bio-breeding. Among them, CRISPR / Cas9 technology stands out in the field of gene editing due to its ability to precisely edit and modify any location in the genome, becoming one of the most popular and widely used technologies today. Although CRISPR / Cas9 technology can precisely edit and modify any location in the genome and has achieved efficient gene editing in various cell lines, its in vivo delivery for clinical application still faces challenges in terms of safety and efficacy.

[0003] In current gene delivery strategies, viral vectors are a common in vivo CRISPR delivery method in preclinical disease models. Adeno-associated virus (AAV), as a commonly used viral vector, has certain advantages but also significant drawbacks. Its limited loading capacity makes it difficult to meet the delivery requirements of complex gene editing systems; furthermore, the continuous expression of the Cas9 protein in AAV greatly increases the risk of off-target effects, potentially leading to accidental editing of non-target genes and triggering a series of unpredictable safety issues, such as gene mutations, abnormal cell function, and even tumorigenesis, severely limiting its widespread application in clinical treatment.

[0004] LNPs, as non-viral vectors, possess numerous advantages such as high delivery efficiency, non-integrative expression, low immunogenicity, and large loading capacity, making them highly promising for in vivo delivery of CRISPR systems. Current technologies have only achieved in vivo delivery of Cas9 mRNA and sgRNA via LNPs, but still suffer from limitations such as the inability to deliver DNA repair templates and poor template stability, hindering subsequent gene editing. Therefore, a method capable of simultaneously delivering Cas9 mRNA, sgRNA, and DNA repair templates while stably and efficiently achieving HDR repair is urgently needed. Summary of the Invention

[0005] To address the above problems, this invention provides a lipid nanoparticle (LNP) capable of performing HDR (homology-directed repair) gene editing in mouse liver.

[0006] To achieve the above objectives, the specific technical solution provided by the present invention is as follows:

[0007] The first aspect of the present invention provides a lipid nanoparticle for targeted delivery of a CRISPR-Cas9 system and a single-stranded DNA repair template to the liver, wherein the lipid nanoparticle comprises ionizable lipids, PC-like lipids, PEG lipids, structural lipids and active ingredients.

[0008] The ionizable lipid is ALC-0315.

[0009] The PC-like lipid is DOPC.

[0010] Furthermore, the PEG lipid is DMG-PEG(2000); the structural lipid is cholesterol.

[0011] In this invention, ionizable lipids are a class of amphiphilic small molecules that can undergo charge changes under specific pH conditions. They are core components of lipid nanoparticles (LNPs) and are widely used in gene delivery, mRNA vaccine development, and RNA interference therapy. In some embodiments, ionizable lipids include DLin-MC3-DMA (MC3), ALC-0315, and SM-102. In a specific embodiment of this invention, the ionizable lipid is ALC-0315, an ionizable amino lipid responsible for mRNA compression, facilitating mRNA delivery to cells and cytoplasmic release.

[0012] In this invention, PC-like lipids refer to phosphatidylcholine, which is used to encapsulate and protect the core formed by the interaction between ionizable lipids and drugs within lipid nanoparticles, and bind to the phospholipid bilayer of target cells to promote cell membrane penetration and endosome escape during intracellular drug delivery. In some embodiments, the PC-type phospholipids include distearylphosphatidylcholine (DSPC), palmitoyloleylphosphatidylcholine (POPC), egg phosphatidylcholine (EPC), dioleoylphosphatidylcholine (DOPC), dipalmitoylphosphatidylcholine (DPPC), 1,2-dilinoleoyl-sn-glycerol-3-phosphate choline (DLPC), 1,2-dimyristoyl-sn-glycerol-3-phosphate choline (DMPC), 1,2-docosanoyl-sn-glycerol-3-phosphate choline (DUPC), 1,2-di-O-octadecenyl-sn-glycerol-3-phosphate choline (18:O diether PC), 1-oleoyl-2-cholestyloyl-succinoyl-sn-glycerol-3-phosphate choline (OChemsPC), and 1-hexadecyl-sn-glycerol-3-phosphate choline (C16 LysoPC). In a specific embodiment of the present invention, the PC-type phospholipid is dioleoylphosphatidylcholine (DOPC).

[0013] In this invention, structural lipids are used to morphologically impart lipid loading rigidity within lipid nanoparticles and to enhance nanoparticle stability by dispersing them in the core and surface of the nanoparticles. In some embodiments, the structural lipids include cholesterol, cholesterol, spinachosterol, coccosterol, sitosterol, ergosterol, ergosterol, campesterol, stigmasterol, brassicosterol, tomatine, ursolic acid, and α-tocopherol. In a specific embodiment of this invention, the structural lipid is cholesterol.

[0014] In this invention, PEG lipids refer to polyethylene glycol (PEG) modified lipids, which contribute to the particle stability of lipid nanoparticles in serum and act as a barrier to nanoparticle aggregation. In some embodiments, the PEG lipids include ALC-0159, PEG-ceramide, PEG-DMG, PEG-c-DOMG, PEG-DLPE, PEG-DMPE, PEG-DPPC, DMG-PEG(2000), and PEG-DSPE. In a specific embodiment of this invention, the PEG lipid is DMG-PEG(2000).

[0015] Furthermore, the molar ratio of ionizable lipids, PC-like lipids, structural lipids, and PEG lipids in the lipid nanoparticles is 50:10:38.5:1.5.

[0016] In a specific embodiment of the present invention, the lipid nanoparticles are composed of ALC-0315, DOPC, cholesterol and DMG-PEG(2000) in a molar ratio of 50:10:38.5:1.5.

[0017] Furthermore, the active ingredient is a nucleic acid molecule, which includes at least one of mRNA, sgRNA, DNA, miRNA, siRNA, shRNA, rRNA, aptamer, tRNA, antisense oligonucleotide, tracrRNA, gRNA, ribozyme, PNA, and DNase.

[0018] Furthermore, the nucleic acid molecule is a combination of Cas9 mRNA, sgRNA, and DNA, and the DNA is a DNA repair template.

[0019] The second aspect of the present invention provides a method for preparing the lipid nanoparticles described in the first aspect of the present invention, the method comprising the steps of: dissolving ionizable lipids, PC-like lipids, structural lipids, and PEG lipids in anhydrous ethanol at a molar ratio of 50:10:38.5:1.5 to obtain an organic phase;

[0020] Acidified and diluted Cas9 mRNA, sgRNA, and DNA repair template were mixed in an aqueous phase at a mass ratio of 2:1:2.

[0021] The organic phase and the aqueous phase were packaged into LNPs at a volume ratio of 3:1 and a flow rate of 12 mL / min, wherein the mass ratio of lipids to nucleic acids was 13.79:1 and the N / P ratio was 5.94.

[0022] In this invention, the N / P ratio refers to the molar ratio of ionizable ammonium (N) in cationic lipids to phosphate (P) in nucleic acid molecules. This ratio affects the stability, potential, and nucleic acid encapsulation efficiency of LNPs through electrostatic adsorption and is a key parameter in LNP preparation. Its calculation is based on the ratio of the amount of nitrogen (N) in cationic lipids to the amount of phosphate (P) in nucleic acids.

[0023] A third aspect of the present invention provides a pharmaceutical composition comprising the lipid nanoparticles described in the first aspect of the present invention and a pharmaceutically acceptable carrier.

[0024] In this invention, a pharmaceutical composition refers to a composition containing at least one bioactive substance (such as lipid nanoparticles as described in the first aspect of this invention). The pharmaceutical compositions of this invention can be administered orally, non-gastrointestinally, via inhalation spray, topically, rectally, nasally, buccally, vaginally, or via an implanted storage device. In some embodiments, non-gastrointestinal administration, such as injection, is preferred. The pharmaceutical compositions of this invention may contain any commonly used non-toxic pharmaceutically acceptable carrier, excipient, or excipient. In some cases, pharmaceutical acids, bases, or buffers may be used to adjust the pH of the formulation to improve the stability of the formulated compound or its dosage form. The pharmaceutical compositions of this invention can be in the form of granules, tablets, lyophilized powders, suppositories, capsules, sublingual tablets, liquid solutions, nasal drops, sprays, or metered-dose sprays. The term "non-gastrointestinal" as used in this invention includes subcutaneous, intradermal, intravenous, intramuscular, intra-articular, intra-arterial, intrasynovial, intrasternal, intrathecal, intralesional, and intracranial injection or infusion techniques. The pharmaceutical compositions of this invention can be administered to the receptor via any route, provided the target tissue can be reached.

[0025] In this invention, a pharmaceutically acceptable carrier refers to any pharmaceutical carrier that does not induce the production of antibodies harmful to the individual receiving the composition and can be administered without excessive toxicity. Suitable carriers can be large, slowly metabolized macromolecules, such as proteins, polysaccharides, polylactic acid, polyglycolic acid, polymeric amino acids, and amino acid copolymers. Such carriers are well known to those skilled in the art. Pharmaceutically acceptable carriers in pharmaceutical compositions may comprise fluids such as water, saline, glycerol, and ethanol. Such carriers may also contain auxiliary substances such as wetting agents or emulsifiers, pH buffers, etc.

[0026] Furthermore, the pharmaceutically acceptable carrier includes at least one of diluents, fillers, excipients, binders, humectants, disintegrants, absorption enhancers, surfactants, adsorbents, lubricants, and flavorings.

[0027] The fourth aspect of the present invention provides the use of the lipid nanoparticles described in the first aspect of the present invention and / or the pharmaceutical composition described in the third aspect of the present invention, the use including any one of the following: 1) use in the preparation of gene therapy drugs for liver diseases, wherein the gene therapy is homologous targeted repair of the liver; 2) use in the preparation of personalized liver cancer vaccines, wherein the lipid nanoparticles are loaded with mRNA encoding patient-specific tumor neoantigens, wherein the patient-specific tumor neoantigens are selected from highly expressed mutant genes in patient tumor tissues.

[0028] In this invention, homologous targeted repair of the liver refers to a technique that utilizes the homologous targeted repair (HDR) mechanism to achieve precise correction or knock-in of gene sequences in liver cells. HDR is a key mechanism for repairing DNA double-strand breaks (DSBs) in organisms through homologous recombination.

[0029] Furthermore, the liver disease refers to hereditary liver diseases caused by gene mutations that impair liver function and / or liver cancer carrying gene mutations related to homologous directed repair.

[0030] In this invention, the hereditary liver disease caused by gene mutation leading to impaired liver function refers to a disease caused by liver metabolic disorders or structural abnormalities resulting from specific gene mutations, leading to impaired hepatocyte function. Its core mechanism is that gene mutations cause abnormal function of liver-related enzymes or proteins, thereby leading to metabolic disorders or tissue damage. In some embodiments, the hereditary liver disease caused by gene mutation leading to impaired liver function includes Wilson's disease (ATP7B mutation), non-alcoholic fatty liver disease (FTO mutation), hereditary hemochromatosis (HFE mutation, such as C282Y or H63D missense mutation), α1-antitrypsin deficiency (SERPINA1 mutation), glycogen storage disease (G6PC mutation or AGL mutation), and congenital liver fibrosis (PKHD1 mutation).

[0031] Furthermore, the hereditary liver diseases caused by gene mutations that impair liver function include Wilson's disease and non-alcoholic fatty liver disease.

[0032] Hepatolenticular degeneration (HLD) was first described by Wilson in 1912, hence it is also known as Wilson's disease (WD). Its causative gene is ATP7B. ATP7B encodes a type P ATPase, which, under physiological conditions, participates in the synthesis of ceruloplasmin in the liver and promotes the excretion of copper in bile. Mutations in ATP7B can lead to reduced or lost function of its encoded protein, resulting in decreased ability of hepatocytes to excrete copper via the bile pathway. Ultimately, this leads to excessive copper deposition in the liver, brain, and other organs, resulting in a series of corresponding clinical manifestations.

[0033] Nonalcoholic fatty liver disease (NAFLD) is a clinicopathological syndrome characterized by excessive fat deposition in hepatocytes, independent of alcohol intake. The expression level of the FTO gene is significantly elevated in NAFLD patients, and its mutations are associated with an increased risk of NAFLD. Polymorphisms in the FTO gene may increase the risk of NAFLD by affecting the liver's regulation of lipid metabolism. The FTO gene (fat mass and obesity-related gene) is a novel candidate gene that has been clearly identified in recent years as being closely related to obesity. Its single nucleotide polymorphisms (SNPs) can affect body mass index (BMI) in adults and children, increasing body weight, body fat mass, and altering eating behaviors, and are associated with various metabolic diseases such as metabolic syndrome, type 2 diabetes, and coronary heart disease.

[0034] The advantages and beneficial effects of this invention are as follows: 1) This invention is the first to achieve an all-in-one LNP that simultaneously packages three nucleic acids, namely Cas9 mRNA, sgRNA and single-stranded DNA repair template, using the ALC-0315+DOPC formulation; 2) The LNP provided by this invention can accurately and efficiently achieve homologous targeted repair (HDR) editing in mouse liver. Attached Figure Description

[0035] Figure 1 The images show the in vivo optical imaging results of small animals after injection of four types of LNPs (LNP-1 to LNP-4 in Example 1) into the temporal vein of suckling mice. A is a representative optical imaging image of the four types of LNPs, and B is a statistical graph of the results.

[0036] Figure 2 A statistical graph showing the efficiency of two LNPs (ALC-0315+DOPC and SM-102+DSPC) in delivering mRNA into HeLa cells.

[0037] Figure 3 The image shows the Western blot results of the efficiency of Cas9 protein expression by LNP-delivered Cas9 mRNA in the liver of young mice.

[0038] Figure 4Statistical graph showing the efficiency of homologous targeted repair of FTO sites in the livers of young mice by delivering Cas9 mRNA, sgRNA targeting mouse FTO sites, and single-stranded DNA templates mediating homologous targeted repair to the livers of two LNPs (ALC-0315+DOPC, SM-102+DSPC).

[0039] Figure 5 This is a statistical graph showing the homologous targeted repair efficiency of ALC-0315+DOPC all-in-one LNP on the ATP7B site in mouse liver.

[0040] Figure 6 A schematic diagram of an LNP for the combined delivery of a CRISPR-Cas9 system and a DNA repair template. Detailed Implementation

[0041] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0042] Example 1: Detection of Liver-Targeted Delivery Efficiency of Different LNPs

[0043] I. Experimental Materials

[0044] 1. LNP: The formulation is shown in Table 1.

[0045] Table 1. Formulations for LNP-1 to LNP-4

[0046]

[0047] 2. Nucleic acid: The Luciferase mRNA packaged using the above LNP is EZ Cap™ Firefly Luciferase mRNA (APExBIO, R1018).

[0048] 3. Mouse information: The mice used in the experiment were wild-type C57 / BL6J mice. The mice that were about to give birth were purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd. and housed in an SPF (Special Pathogen Free) animal laboratory.

[0049] II. Experimental Methods

[0050] 1. LNP Packaging:

[0051] 1. Dissolve the following components in anhydrous ethanol according to the indicated proportions (molar ratio) to prepare a lipid ethanol solution (organic phase):

[0052] LNP-1: ALC-0315:cholesterol:DSPC:DMG-PEG-2K=50:38.5:10:1.5;

[0053] LNP-2: ALC-0315:cholesterol:DOPC:DMG-PEG-2K=50:38.5:10:1.5;

[0054] LNP-3:DLin-MC3-DMA:cholesterol:DSPC:DMG-PEG-2K=50:38.5:10:1.5;

[0055] LNP-4:DLin-MC3-DMA:cholesterol:DOPC:DMG-PEG-2K=50:38.5:10:1.5.

[0056] 2. The nucleic acid was acidified and diluted with 25 mM sodium acetate buffer (pH 4.0) to a concentration of 0.44 mg / mL to prepare a nucleic acid solution (aqueous phase).

[0057] 3. The lipid ethanol solution (organic phase) and nucleic acid solution (aqueous phase) were mixed in the following proportions for LNP packaging to prepare four formulations of LNP.

[0058] Lipid:Nucleic acid (mass ratio) = 40:1, N / P ratio is 3.

[0059] The ratio of aqueous phase volume to organic phase volume is 3:1.

[0060] Add the organic phase (lipid ethanol solution) to the aqueous phase (nucleic acid solution) and rapidly pipette 30-40 times to make the solution a turbid mixture. Incubate at room temperature for 15 min.

[0061] 4. Add PBS to the LNP solution to a final volume of 500 μL, transfer to an ultrafiltration tube (10- or 30-kD MWCO, Merck), centrifuge at 6000×g for 15 min, and repeat once. The resulting LNP will dissolve in PBS at a concentration of 600.00 μg / mL.

[0062] 2. Administration: After the newborn mice were delivered, four LNPs containing 2 μg of Luciferase mRNA (LNP-1, LNP-2, LNP-3, and LNP-4) were injected into the temporal vein of 1-2 day old suckling mice. Six hours after the LNP injection, D-Luciferin (150 mg / kg) was injected intraperitoneally, followed by luminescence imaging using the PerkinElmer IVIS Lumina small animal in vivo optical imaging system.

[0063] III. Experimental Results

[0064] The results are as follows Figure 1 As shown, bioluminescence was detected in the head (LNP injection site) and liver of mice in groups LNP-1, LNP-2, and LNP-4, indicating that LNP successfully delivered Luciferase mRNA to the liver and expressed it as firefly luciferase. Among them, group LNP-2 showed the highest average luminescence intensity (Avg radiance) in the liver, significantly higher than the other three groups, indicating that LNP-2 (ALC-0315+DOPC LNP) was significantly more efficient than the other three LNPs in delivering Luciferase mRNA to the liver of young mice and expressing it as firefly luciferase. The results were statistically significant using one-way ANOVA, and then Dunnett's multiple comparison test was used to compare groups LNP-1, LNP-3, and LNP-4 with LNP-2.

[0065] Example 2: Detection of Intracellular Targeted Delivery Efficiency of Different LNPs

[0066] I. Experimental Materials

[0067] 1. LNP: LNP was synthesized by Nanjing Genscript Biotech Co., Ltd., and the formula is shown in Table 2.

[0068] Table 2. Formulations of ALC-0315+DOPC and SM-102+DSPC

[0069]

[0070] 2. Nucleic Acids: All nucleic acids in the LNP package were synthesized by Nanjing Genscript Biotech Co., Ltd., and the specific sequences are shown below.

[0071] 1) The Cas9 mRNA is eSpCas9 mRNA (Cap1, m1Ψ), catalog number RP-A00018.

[0072] 2) SgATP7B sequence: 5'-GUGUUCCAGCCACCGUCCCA-3' (SEQ ID NO:1). Note: Except for the seed sequence that is complementary to the genome, the other sequences of the guide RNA are fixed and consistent.

[0073] 3) Single-stranded DNA repair template sequence: 5'-AACTCCCCCTCCATCATTCACTGTGAACGAAAGAACCCTTGAAGCTGTAGCTACCTTGGCCACGTGTTCCAGCCACCGTGCCAGGGCGATGAACACAAAGAGCATGGGGGGCGTGTCAAAGAAGGTCACG-3' (SEQ ID NO: 2).

[0074] 4) Cas9 qPCR primers were synthesized at Sangon Biotech (Shanghai) Co., Ltd., and the sequences are as follows:

[0075] F: CTGCGCTGGAAAGCGAGTTC (SEQ ID NO:3);

[0076] R: AGTACTTGGCGGTAGCCTTG (SEQ ID NO: 4).

[0077] 5) GAPDH qPCR primers were synthesized at Sangon Biotech (Shanghai) Co., Ltd., and the sequences are as follows:

[0078] F: AAGGGTCATCATCTCTGCCC (SEQ ID NO:5);

[0079] R: CATGAGTCCTTCCACGATACC (SEQ ID NO: 6).

[0080] 3. Cells: The HeLa cells used in the experiment were obtained from the Cell Resource Center of the Institute of Basic Medical Sciences, Chinese Academy of Medical Sciences. The culture medium used was DMEM + 10% FBS + 1% P / S, and the culture conditions were 37℃ and 5% carbon dioxide.

[0081] II. Experimental Methods

[0082] 1. LNP Packaging

[0083] 1. Dissolve the following components in anhydrous ethanol according to the indicated proportions (molar ratio) to form a lipid ethanol solution (organic phase):

[0084] SM-102+DSPC all-in-one LNP: SM-102:cholesterol:DSPC:DMG-PEG-2K=50:38.5:10:1.5;

[0085] ALC-0315+DOPC all-in-one LNP: ALC-0315:cholesterol:DOPC:DMG-PEG-2K=50:38.5:10:1.5.

[0086] 2. The nucleic acids were acidified and diluted with 25 mM sodium acetate buffer (pH 4.0) to a concentration of 0.138 mg / mL. The three nucleic acids were mixed in the aqueous phase in the following ratio: Cas9:sgRNA:ssDNA (mass ratio) = 2:1:2.

[0087] 3. The organic phase and aqueous phase were packaged into LNPs in the following proportions to prepare ALC-0315+DOPC all-in-one LNP and SM-102+DSPC all-in-one LNP.

[0088] The lipid:nucleic acid ratio is as follows:

[0089] ALC-0315: nucleic acid (mass ratio) = 13.79:1, N / P ratio is 5.94;

[0090] SM-102: nucleic acid (mass ratio) = 13:1, N / P ratio is 6.

[0091] Aqueous phase volume: organic phase volume = 3:1, flow rate: 12 mL / min.

[0092] 4. The obtained LNP was finally dissolved in 10% sucrose in PBS (pH 7.4, 10 mM) at a concentration of 200.00 μg / mL.

[0093] 2. Cells:

[0094] 1. HeLa cells were seeded in 12-well plates, 1×10⁶ cells / well. 5 Cells / wells. After overnight adhesion, two all-in-one LNPs containing 10 ng, 50 ng, and 150 ng of Cas9 mRNA were added directly to the cell culture medium, mixed well, and cultured at 37°C with 5% carbon dioxide.

[0095] 2. After LNP treatment for 4 h, cells were washed three times with PBS, and then 200 μl of TRIzol was added to each well to lyse the cells and extract RNA.

[0096] 3. Take 1 μg of RNA and reverse transcribe it using the vazyme HiScript III 1st Strand cDNA Synthesis Kit (+gDNA wiper) (catalog number R312-01). After the transcription is complete, add 380 μl of double-distilled water to dilute the resulting cDNA solution to a total volume of 400 μl.

[0097] 4. Using 2 μl cDNA as a template and GAPDH as an internal control, primers for Cas9 mRNA-specific amplification were designed, and qPCR was used to detect the efficiency of LNP delivery of Cas9 mRNA.

[0098] III. Experimental Results

[0099] The ct value of Ca9 mRNA-specific amplification is subtracted from the ct value of the corresponding sample GAPDH-specific amplification to obtain Δct. 2 is then calculated. -Δct This was used to detect the relative abundance of Cas9 mRNA delivered into cells by the two LNPs. The results are as follows: Figure 2 As shown, the efficiency of ALC-0315+DOPC LNP in delivering mRNA into HeLa cells was significantly higher than that of SM-102+DSPC LNP. The results were statistically significant using two-way ANOVA, followed by Sidak multiple comparison test to analyze differences between groups.

[0100] Example 3: Determination of protein expression efficiency after targeted delivery of LNP to mouse liver

[0101] I. Experimental Materials

[0102] 1. LNP: LNP was synthesized by Nanjing Genscript Biotech Co., Ltd., with the same formulation as in Example 2, as shown in Table 2.

[0103] 2. Nucleic Acids: All nucleic acids in the LNP package were synthesized by Nanjing Genscript Biotech Co., Ltd.

[0104] 1) The Cas9 mRNA is eSpCas9 mRNA (Cap1, m1Ψ), catalog number RP-A00018.

[0105] 2) SgFTO sequence: 5'-caugaagcgcguccagaccg-3' (SEQ ID NO:7). Note: Except for the seed sequence that is complementary to the genome, the other sequences of the guide RNA are fixed and consistent.

[0106] 3. Antibodies: GAPDH antibody was purchased from Cell Signaling Technology (catalog number 2118S); Cas9 antibody was purchased from Abcam (catalog number ab189380).

[0107] 4. Mice: The mice used in the experiment were wild-type C57 / BL6J mice. The mice that were about to give birth were purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd. and were housed in an SPF (Special Pathogen Free) animal laboratory.

[0108] II. Experimental Methods

[0109] 1. LNP packaging: The method is the same as in Example 2.

[0110] 2. Administration:

[0111] 1. After the pregnant mice gave birth and newborn mice were obtained, two types of LNPs, ALC-0315+DOPC and SM-102+DSPC, which contained 2 μg of nucleic acid, were injected into the temporal vein of one-day-old suckling mice.

[0112] 2. Seven hours after injection, liver tissue was collected from the suckling mice to extract total protein.

[0113] 3. Western blot analysis was performed to determine the efficiency of LNP-delivered Cas9 mRNA expression as Cas9 protein in the liver of young mice.

[0114] III. Experimental Results

[0115] Figure 3 Western blot analysis of the efficiency of Cas9 protein expression via LNP-delivered Cas9 mRNA in the liver of young mice. Results are as follows: Figure 3 As shown, with essentially identical GAPDH bands, a specific protein band of Cas9 was detected in the livers of two mice injected with ALC-0315+DOPC LNP, but no Cas9 protein expression was detected in the livers of two mice injected with SM-102+DSPC LNP. This indicates that ALC-0315+DOPC LNP is significantly more efficient than SM-102+DSPC LNP in delivering Cas9 mRNA and expressing Cas9 protein in mouse livers.

[0116] Example 4: Efficiency Testing of Individual Delivery and Combined Delivery

[0117] I. Experimental Materials

[0118] 1. LNP: LNP was synthesized by Nanjing Genscript Biotech Co., Ltd., with the same formulation as in Example 2, as shown in Table 2.

[0119] 2. Nucleic Acids: All nucleic acids in the LNP package were synthesized by Nanjing Genscript Biotech Co., Ltd.

[0120] 1) The Cas9 mRNA is eSpCas9 mRNA (Cap1, m1Ψ), catalog number RP-A00018.

[0121] 2) SgFTO sequence: 5'-caugaagcgcguccagaccg-3' (SEQ ID NO:7). Note: Except for the seed sequence that is complementary to the genome, the other sequences of the guide RNA are fixed and consistent.

[0122] 3) Single-stranded DNA repair template sequence: 5'-cgcccggagccccacataccttagcttcccgctctcgttcctccgACTtctggacgcgcttcatgctgctactaaagccgccttcgccac-3' (SEQ ID NO:8).

[0123] 3. Mice: The mice used in the experiment were wild-type C57 / BL6J mice. The mice that were about to give birth were purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd. and were housed in an SPF (Special Pathogen Free) animal laboratory.

[0124] II. Experimental Methods

[0125] 1. LNP Packaging:

[0126] 1) Packaging method: Except for the addition of nucleic acid, the packaging method is the same as in Example 2.

[0127] 2) Packaging contents: 4 types of LNP, the specific packaging contents are as follows.

[0128] 1. ALC-0315+DOPC LNP-1: Only Cas9 mRNA and sgRNA are added, with a mass ratio of Cas9:sgRNA = 1:1.

[0129] 2. ALC-0315+DOPC LNP-2: Only single-stranded DNA repair template is introduced.

[0130] 3. SM-102+DSPC LNP-1: Only Cas9 mRNA and sgRNA are added, with a mass ratio of Cas9:sgRNA = 1:1.

[0131] 4. SM-102+DSPC LNP-2: Only single-stranded DNA repair templates are delivered.

[0132] 3) Mix LNP-1 and LNP-2 of ALC-0315+DOPC at a ratio of 1:1 (nucleic acid mass ratio) to prepare the final injected ALC-0315+DOPC LNP; mix LNP-1 and LNP-2 of SM-102+DSPC at a ratio of 1:1 (nucleic acid mass ratio) to prepare the final injected SM-102+DSPC LNP.

[0133] 2. Administration:

[0134] 1) After the pregnant mice gave birth and newborn mice were obtained, two types of LNPs with a nucleic acid content of 10 μg were injected into the temporal vein of three-day-old suckling mice.

[0135] 2) Liver tissue was collected from suckling mice 72 hours after injection.

[0136] 3) The liver genome was extracted using the phenol-chloroform extraction method, and the editing sites were amplified by PCR (polymerase chain reaction) and next-generation sequencing adapters were added.

[0137] 4) The gene sequence after gene editing is obtained by next-generation sequencing, and the proportion of the gene is calculated using CRISPResso2, a target analysis software based on high-throughput sequencing, to obtain the efficiency of completing precise gene editing.

[0138] III. Experimental Results

[0139] The results are as follows Figure 4 The results show the efficiency of two LNPs, ALC-0315+DOPC and SM-102+DSPC, in delivering Cas9 mRNA, sgRNA targeting the mouse FTO site, and a single-stranded DNA template mediating homology-directed repair to the FTO site in the liver of three-day-old suckling mice. When delivering the same amount of nucleic acid, the ALC-0315+DOPC LNP showed significantly higher editing efficiency at the FTO site in the liver of suckling mice than the SM-102+DSPC LNP.

[0140] Example 5: Detection of Homologous Directed Repair Gene Editing Efficiency at the ATP7B Site in Mouse Liver

[0141] I. Experimental Materials

[0142] 1. LNP: The formulation and preparation method are the same as those of ALC-0315+DOPC all-in-one LNP in Example 2.

[0143] 2. Mice: The mice used in the experiment were wild-type C57 / BL6J mice. The mice that were about to give birth were purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd. and were housed in an SPF (Special Pathogen Free) animal laboratory.

[0144] II. Experimental Methods

[0145] 1. Administration

[0146] 1) After the pregnant mice gave birth and newborn mice were obtained, ALC-0315+DOPC all-in-one LNP containing 8 μg of nucleic acid was injected into the temporal vein of one-day-old suckling mice, and ALC-0315+DOPC all-in-one LNP containing 10 μg of nucleic acid was injected into the temporal vein of three-day-old suckling mice.

[0147] 2) Liver tissue was taken from suckling mice 3-7 days after injection.

[0148] 3) The liver genome was extracted using the phenol-chloroform extraction method, and the editing sites were amplified by PCR (polymerase chain reaction) and next-generation sequencing adapters were added.

[0149] 4) The gene sequence after gene editing is obtained by next-generation sequencing, and the proportion of the gene is calculated using CRISPResso2, a target analysis software based on high-throughput sequencing, to obtain the efficiency of completing precise gene editing.

[0150] III. Experimental Results

[0151] The results are as follows Figure 5 The results show the homology-directed repair efficiency of the ALC-0315+DOPC all-in-one LNP (obtained by simultaneously packaging Cas9 mRNA, sgATP7B, and ATP7B site single-stranded DNA repair templates into the ATP7B site in mouse liver using the LNP. The results demonstrate that the simultaneous packaging of three nucleic acids into LNPs successfully performed homology-directed repair gene editing at the ATP7B site in mouse liver.

[0152] In summary, this invention provides a lipid nanoparticle (LNP) capable of performing HDR (homology-directed repair) gene editing in mouse liver. This lipid nanoparticle uses ionizable lipid ALC-0315, neutral phospholipid DOPC, cholesterol, and DMG-PEG(2000) in a ratio of 50:10:38.5:1.5. These components can be packaged separately or simultaneously in a certain ratio with Cas9 mRNA, sgRNA, and single-stranded DNA repair template required for HDR gene editing, as prepared as follows: Figure 6 The all-in-one LNP shown is an example. This all-in-one LNP successfully achieved targeted delivery of the three nucleic acids mentioned above to the liver and successfully performed HDR editing on the livers of young mice. The lipid nanoparticles provided by this invention lay the foundation for in vivo gene editing.

[0153] The above description of the embodiments is only for understanding the method and core ideas of the present invention. It should be noted that those skilled in the art can make various improvements and modifications to the present invention without departing from the principles of the invention, and these improvements and modifications will also fall within the protection scope of the claims of the present invention.

Claims

1. The application of lipid nanoparticles for targeted liver delivery of a CRISPR-Cas9 system and a single-stranded DNA repair template in the preparation of gene therapy drugs for liver diseases, characterized in that, The lipid nanoparticles are composed of ALC-0315, DOPC, cholesterol, and DMG-PEG (2000) in a molar ratio of 50:10:38.5:1.

5. The active ingredient encapsulated in the lipid nanoparticles is a nucleic acid molecule, which is a combination of Cas9 mRNA, sgRNA, and DNA repair template. The gene therapy described is a homologous targeted repair of the liver.

2. The application according to claim 1, characterized in that, The liver diseases mentioned are hereditary liver diseases caused by gene mutations that impair liver function and / or liver cancer carrying gene mutations related to homologous directed repair.

3. The application according to claim 2, characterized in that, The hereditary liver diseases caused by gene mutations that impair liver function include Wilson's disease and non-alcoholic fatty liver disease.

Images