Anti-desquamation virus MCP protein polyclonal antibody and application thereof

Abstract

The invention discloses an anti-desquamation virus MCP protein polyclonal antibody and application thereof, and relates to the technical field of biology. The preparation method of the anti-desquamation virus MCP protein polyclonal antibody comprises the following steps: immunizing an animal by using desquamation virus MCP protein, and collecting and separating to obtain serum; and extracting and purifying the serum to obtain the anti-desquamation virus MCP protein polyclonal antibody. The amino acid sequence of the desquamation virus MCP protein is as shown in SEQ ID NO. 2. The polyclonal antibody can accurately recognize the descaled disease virus MCP protein, is high in titer and good in specificity, and solves the problem that the descaled disease virus MCP protein lacks a specific antibody in the prior art, so that a certain theoretical basis is provided for an immune virus prevention and control strategy.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, in particular to a polyclonal antibody against MCP protein of desquamating disease virus and application thereof. Background Art

[0002] Scale desquamating disease virus (SDDV) is a cytoplasmic double-stranded DNA virus belonging to the genus Stomachiclovirus in the family Iridoviridae. Scale desquamating disease virus (SDS) was first discovered in 1992 and was identified as a new member of the family Iridoviridae in 2015, designated as scale desquamating disease virus (SDDV). Susceptibility to SDS is primarily limited to three species of bony fish: Asian seabass, mandarin fish, and yellowfin sea bream. Yellowfin sea bream is the third known host of SDDV. The symptoms of SDDV infection in yellowfin sea bream differ significantly from those in the first two hosts. Infected yellowfin sea bream exhibit ascites and proptosis, but do not exhibit the typical scale loss symptoms of SDDV infection. Therefore, it is also known as yellowfin sea bream ascites disease (YFSBAD). Notably, the pathogen exhibits no developmental stage specificity in its host, infecting both juvenile and sexually mature individuals. The mortality rate is 50-60% within one month of infection with SDDV. With the continued expansion of intensive aquaculture systems, its incidence in commercial fish farms is increasing significantly, posing a serious economic threat to the aquaculture industry. Currently, there is a lack of effective treatments and control measures for yellowfin sea bream descaling disease virus, making early detection and diagnosis crucial for disease prevention.

[0003] The major capsid protein (MCP) plays a key role in the assembly and maturation of viral particles, ensuring the efficient production and release of infectious virions from host bacterial cells. MCP expression can also be used to identify viral replication within the host. Therefore, the present invention proposes to prepare polyclonal antibodies against the MCP of the S. desquamative disease virus (SDDV) and utilize them to more efficiently and effectively detect SDDV, thereby advancing research on the function of the MCP protein. Summary of the Invention

[0004] The present invention aims to provide a polyclonal antibody against the MCP protein of the scaly virus and its application to solve the problems existing in the above-mentioned prior art. The polyclonal antibody can accurately recognize the MCP protein of the scaly virus and has high titer and good specificity, thus solving the problem of the lack of specific antibodies against the MCP protein of the scaly virus in the prior art, thereby providing a certain theoretical basis for the immune prevention and control of the virus strategy.

[0005] To achieve the above object, the present invention provides the following solutions:

[0006] The application provides a preparation method of an anti-peeling disease virus MCP protein polyclonal antibody, and comprises the following steps:

[0007] Animals are immunized with the peeling disease virus MCP protein, and serum is collected and separated;

[0008] The serum is extracted and purified to obtain the anti-peeling disease virus MCP protein polyclonal antibody.

[0009] The amino acid sequence of the peeling disease virus MCP protein is shown in SEQ ID NO. 2.

[0010] Further, the preparation method of the peeling disease virus MCP protein comprises the following steps:

[0011] A recombinant plasmid is constructed by using a peeling disease virus MCP gene; the nucleotide sequence of the peeling disease virus MCP gene is shown in SEQ ID NO. 1.

[0012] The recombinant plasmid is transformed into a host bacterium to obtain a recombinant strain.

[0013] The recombinant strain is subjected to fermentation culture, protein expression is induced, and then purification treatment is performed to obtain the peeling disease virus MCP protein.

[0014] Further, the initial plasmid of the recombinant plasmid is a pET-B2M plasmid.

[0015] Further, the host bacterium is an Escherichia coli.

[0016] Further, the animals are rabbits.

[0017] Further, the peeling disease virus MCP protein is mixed with an immunoadjuvant before the animals are immunized.

[0018] The application further provides an anti-peeling disease virus MCP protein polyclonal antibody prepared by the preparation method.

[0019] The application further provides application of the anti-peeling disease virus MCP protein polyclonal antibody in preparation of a product for detecting the peeling disease virus.

[0020] The application further provides a product for detecting the peeling disease virus, which comprises the anti-peeling disease virus MCP protein polyclonal antibody.

[0021] The application further provides application of the anti-peeling disease virus MCP protein polyclonal antibody in preparation of an anti-peeling disease virus drug.

[0022] The application discloses the following technical effects:

[0023] The application provides a polyclonal antibody against desquamating skin disease virus MCP protein, which can accurately recognize the desquamating skin disease virus MCP protein in yellow snapper, and has high titer and good specificity. The application extracts, clones and prokaryotically expresses the MCP gene of SDDV, effectively prepares a large amount of recombinant protein pET-SDDV-MCP, and then uses the recombinant protein pET-SDDV-MCP as an antigen to prepare the polyclonal antibody against the desquamating skin disease virus MCP protein, so that the polyclonal antibody has high specificity to the desquamating skin disease virus MCP protein, and can be used for effectively identifying and distinguishing SDDV on one hand, and reflecting the situation of the yellow snapper infected with SDDV from the molecular biology on the other hand. The application solves the problem of lacking specific antibodies for the desquamating skin disease virus MCP protein in the prior art, provides certain theoretical basis for the immunization prevention and control of viruses, and provides basic data for the development of a new detection technology. BRIEF DESCRIPTION OF DRAWINGS

[0024] In order to more clearly illustrate the technical solutions in the embodiments of the application or the prior art, the drawings needed in the embodiments will be briefly introduced below. Obviously, the drawings in the following description are only some embodiments of the application, and other drawings can be obtained by those skilled in the art without creative effort on the basis of these drawings.

[0025] Figure 1 It is a SDS-PAGE detection result chart in the process of inducing expression of the recombinant protein pET-SDDV-MCP, wherein lane 1 is whole bacteria, lane 2 is a control (ROSE), lane 3 is Marker (116.0, 66.2, 45.0, 35.0, 25.0, 18.4, 14.4 kDa), lane 4 is supernatant after bacteria are broken, and lane 5 is precipitate after bacteria are broken;

[0026] Figure 2 It is a SDS-PAGE detection result chart of the purified inclusion body, wherein lane 1 is Marker (116.0, 66.2, 45.0, 35.0, 25.0, 18.4, 14.4 kDa), and lane 2 is the purified inclusion body;

[0027] Figure 3 It is a SDS-PAGE result of the recombinant protein purified by affinity of the inclusion body, wherein lane 1 is the recombinant protein purified by affinity, and lane 2 is Marker (116.0, 66.2, 45.0, 35.0, 25.0, 18.4, 14.4 kDa);

[0028] Figure 4 It is an indirect ELISA detection result chart of the G3117 antibody titer;

[0029] Figure 5The figure shows the specific Western Blot test results of G3117 antibody. Lane M is Marker (180, 130, 100, 70, 55, 40, 35, 25, 15 kDa), lane 1 is pre-immune antibody, and lane 2 is G3117 antibody. DETAILED DESCRIPTION

[0030] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0031] It should be understood that the terms described herein are intended only to describe particular embodiments and are not intended to limit the present invention. In addition, for numerical ranges herein, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. The intermediate value within any stated value or stated range, and each smaller range between any other stated value or intermediate value within the stated range, is also encompassed within the present invention. The upper and lower limits of these smaller ranges may be independently included or excluded within the scope.

[0032] Unless otherwise indicated, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art. Although only preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein may also be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of any conflict with any incorporated document, the contents of this specification shall prevail.

[0033] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments described herein without departing from the scope or spirit of the invention. Other embodiments will be apparent to those skilled in the art from the description of the invention. The description and examples are intended to be exemplary only.

[0034] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0035] Example 1

[0036] This example provides a polyclonal antibody against the MCP protein of SDDV, the preparation process of which is as follows:

[0037] 1. Extraction of MCP gene from SDDV

[0038] The fin ray cells (ALF) of Sparus aurata are infected with SDDV virus, total RNA is extracted using an RNA extraction kit, and the RNA is separated and purified using a 1% agarose gel electrophoresis to obtain RNA that can be used to express the SDDV MCP protein (the amino acid sequence is shown as SEQ ID NO. 2); reverse transcription is performed on the obtained RNA to obtain a cDNA with the MCP gene of the desquamative disease virus, and the nucleotide sequence of the cDNA is shown as SEQ ID NO. 1.

[0039] SEQ ID NO. 1:

[0040]

[0041] SEQ ID NO. 2:

[0042] MSSIAGANVTSGFIDLAAYDAMETHLYGGDNSITYFLRETTRSSWFSKLPVQLSKQTGTANFGQEFSVVVARGGDYLMNVWLRVKVPALKNTKANSSIRWTDNFMHNLVQEVTISFNDLTAQTITSEFLDFWSTCNVPGGKSSGYANMIGYTHDLVGGTVQNATMPSKYLNLPIPFFFTRDTGLALPTAALPYNEIKIHFKLRDWKDLLISQSTNDNAISVPLTSDMENVTPALTEVSVMGTYAILTNEEREAMSLVSRDMIIEQCQMAPRIPIRPLENEMPHIDLRFSHPIKELFFAVKNVTHPNIHSNYTAASPIIASGTNKVTMPPKAQNPLSHVSLIYENTARLNNMGVDYFSYVDPYFFAPCIPKIDGVMAYCYTMNMGHVDPMGSTNFGRLSNITLSAKVTANSKTTSAASGNTDGHKVAQKFELVVIGVNHNVARISNGSFGFPIL*.

[0043] 2. Constructing a prokaryotic expression vector recombinant plasmid pET-B2M-SDDV-MCP

[0044] (1) Using the RT-PCR method, using the cDNA obtained above as a template, using primers as shown in SEQ ID NO. 3 and SEQ ID NO. 4 for cloning amplification, and using electrophoresis method to recover and purify the MCP gene fragment of SDDV obtained by amplification.

[0045] SEQ ID NO. 3:

[0046] TCCACTGGGTTCTCGGACTATGAGCAGCATTGCAGGTGCCAATGTTACCAGTGGTTTTATTGATCTGGCAGCCTA.

[0047] SEQ ID NO. 4:

[0048] GTGGTGCTCGAGTGCGGCCTTATTACAGAATCGGAAAGCCAAAGCTGCCATTACTAATGCGGGCAACATTATGAT.

[0049] (2) The cloned SDDV MCP gene fragment was double-digested with BamH I and SaI I, followed by electrophoresis, recovery, and purification of the target fragment.

[0050] (3) The blank pET-B2M plasmid (purchased from Wuhan Jinkairui Bioengineering Co., Ltd.) was double-digested with BamH I and SaI I, followed by electrophoresis, recovery, and purification of the target fragment.

[0051] (4) The fragment obtained in step (2) and the fragment obtained in step (3) were mixed in a volume ratio of 3:1, T4 ligase was added, and the mixture was reacted at 16°C for 12 hours overnight to obtain a ligation product; all the ligation products were used to transform E. coli DH5α competent cells (purchased from Beijing Qingke Biotechnology Co., Ltd.) and spread on LB plates containing 100 mg / mL ampicillin, and cultured inverted at 37°C overnight. Monoclonal colonies were selected and placed in LB liquid culture medium containing 100 mg / mL ampicillin for 3 hours. The plasmid was extracted using the Omega plasmid extraction kit to obtain the recombinant plasmid pET-B2M-SDDV-MCP.

[0052] 3. Construction of recombinant engineered bacteria

[0053] The recombinant plasmid pET-B2M-SDDV-MCP was transformed into E. coli BL21 competent cells (Beijing Qingke Biotechnology Co., Ltd.) to construct an engineered bacterium carrying the recombinant plasmid.

[0054] 4. Induced expression and purification of recombinant protein pET-B-SDDV-MCP

[0055] The engineered bacteria were cultured until their OD 600 When the value was 0.6, isopropyl-β-D-thiogalactopyranoside (IPTG) was added to the culture system to make the IPTG concentration in the culture system 0.5 mM. The bacteria were induced at 37°C for 4 hours, and the bacteria were collected and ultrasonically disrupted. The disrupted bacteria were centrifuged and the supernatant and precipitate of the recombinant protein pET-B-SDDV-MCP were collected respectively. A small amount of the supernatant and precipitate were taken for SDS-PAGE detection. The detection results were as follows: Figure 1 As shown. Figure 1 It can be seen that the recombinant plasmid was expressed in Escherichia coli and expressed a protein band with a molecular weight of approximately 67 kDa, which was consistent with the expected size and mainly existed in the form of inclusion bodies.

[0056] The precipitate was purified by column to obtain inclusion bodies. A portion of the inclusion bodies was tested by SDS-PAGE. The test results were as follows: Figure 2 As shown. Figure 2It can be seen that the inclusion body with high purity was obtained. The inclusion body was further renatured to obtain the recombinant protein pET-B-SDDV-MCP.

[0057] The inclusion body protein purification steps are as follows:

[0058] (1) The precipitate was resuspended with 50 mL STET buffer, and dithiothreitol (DTT) was added to a final concentration of 1 mM;

[0059] (2) Ultrasonic promotion of impurity protein dissolution, parameter setting is power 200 W, work 3 s, pause 3 s, time 10 min;

[0060] (3) 10000 rpm 4 ℃ centrifugation for 10 min, remove supernatant;

[0061] (4) Repeat the above three steps until the supernatant is transparent;

[0062] (5) The precipitate was resuspended with 1×PBS, and ultrasonic was performed with the parameters set as power 200 W, work 3 s, pause 3 s, and time 5 min;

[0063] (6) 16000 rpm 4 ℃ centrifugation for 10 min, remove supernatant;

[0064] (7) The inclusion body was resuspended with 4 mL aqueous solution containing 6M guanidine hydrochloride and 8M urea, and DTT was added to a final concentration of 5 mM;

[0065] (8) 220 rpm 37 ℃ shaking for 3 h until the inclusion body was completely dissolved;

[0066] (9) 10000 rpm 4 ℃ centrifugation for 10 min, take 10 μL supernatant for SDS-PAGE electrophoresis detection.

[0067] 5、Animal immunization for preparing polyclonal antibody

[0068] The recombinant protein pET-B-SDDV-MCP was subjected to protein concentration determination, and 2 New Zealand rabbits (No. G3117 and G3118) were subjected to subcutaneous immunization, 2 weeks of immunization once. At the first time of immunization, the recombinant protein pET-B-SDDV-MCP was mixed and emulsified with complete Freund's adjuvant at a ratio of 1:1 for immunization, and the immunization amount was 500 μg; at the subsequent immunization, the recombinant protein pET-B-SDDV-MCP was mixed and emulsified with incomplete Freund's adjuvant at a ratio of 1:1 for immunization, and the immunization amount was 300 μg; a total of 4 times of immunization. Rabbit blood was extracted to prepare antiserum, and desquamating disease virus MCP protein polyclonal antibody was obtained.

[0069] Example 2

[0070] In this example, the titer of the polyclonal antibody against the MCP protein of the desquamating disease virus prepared in Example 1 was tested, and the process was as follows:

[0071] 1. Antiserum titer detection

[0072] A 2 μg / mL solution of pET-SDDV-MCP recombinant protein was used as the coating antigen. 100 μL / well was added to a 96-well ELISA reaction plate and coated overnight at 4°C. The next day, the liquid was discarded and the wells were washed three times with washing buffer. Then, 200 μL / well of blocking buffer was added, the plates were incubated at 37°C for 2 h, and washed three times with washing buffer. Antiserum (blood was collected and centrifuged at 4000 rpm for 10 min at 4°C) was added, and the supernatant was collected. The serum was serially diluted with diluent at the following dilutions: 1:2000, 1:4000, 1:8000, 1:16000, 1:32000, 1:64000, 1:128000, etc. (Blank serum was diluted in the same manner as the negative control). 100 μL / well was incubated at 37°C for 1 h, and washed three times with washing buffer. Add HRP-labeled IgG secondary antibody, 100 μL / well, incubate at 37°C for 40 min, wash 5 times with washing solution and pat dry. Add 100 μL / well of freshly prepared substrate solution and place at 37°C in the dark for 20 min. Add 50 μL / well of stop solution and the color turns yellow. Use a microplate reader to measure the absorbance of each well at 450 nm and determine the titer of the anti-degenerative disease virus MCP protein polyclonal antibody by reading. The titer of the two rabbit sera is based on OD 抗血清 / OD 免前血 The judgment standard of ≥2.1 was used to determine the highest dilution factor. The results are shown in Tables 1 and 2.

[0073] Table 1 OD values ​​of antiserum at different dilution factors

[0074]

[0075] Table 2 Antiserum titer test results

[0076]

[0077] The results in Tables 1 and 2 show that the OD value of G3117 at a dilution of 1:1024K is still more than 2.1 times that of the negative control, and the OD value of G3118 at a dilution of 1:512K is still more than 2.1 times that of the negative control. This means that the titer of G3117 serum is 1024K, and the titer of G3118 serum is 512K. Since the titers of the sera from both rabbits exceeded 1:50K, the next step is to purify the G3117 antiserum with the higher titer.

[0078] 2. Antigen purification

[0079] The inclusion bodies obtained above were affinity purified: the inclusion body solution was filtered through a 0.22 μm filter for later use; a Ni-NTA column was prepared and the inclusion body solution was loaded at a flow rate of 1 mL / min; the column was washed with 6 M guanidine hydrochloride buffer (pH 8.0) until the effluent was protein-free (the G250 detection solution did not change color); elution was performed with eluents containing 20 mM, 60 mM, 200 mM, and 500 mM imidazole, respectively, and the eluents were collected in sections until the G250 detection solution did not change color; the column material was washed with 3 column volumes of deionized water, the column was washed with 20% ethanol, sealed at 4°C, and the effluent was collected. The product was concentrated by ultrafiltration at 4°C, and 10 μL was taken for SDS-PAGE electrophoresis. The test results were as follows: Figure 3 As shown. Figure 3 It can be seen that a single bright band was amplified, indicating that high-purity recombinant protein was obtained after purification.

[0080] 3. Antibody titer detection

[0081] The protein concentration of the purified G3117 antibody was determined. The antibody was diluted at different times to obtain antibody solutions with concentrations ranging from 0.6 ng / mL to 10 μg / mL. The antibody titer was detected by indirect ELISA. The detection process is shown in "1. Antiserum titer detection". The antibody titer is expressed as the absorbance reading at 450 nm. The test results are shown in Table 3 and Figure 4 As shown in the figure, it can be seen that when the antibody concentration is 0.6 ng / mL, it can still recognize and bind to the MCP protein of the desquamating disease virus, indicating that the antibody has a high titer.

[0082] Table 3 Antibody titer test results at different dilution ratios

[0083]

[0084] 4. Antibody specificity detection

[0085] Pre-immune rabbit serum was collected and purified using the method described in "2. Antibody Purification." Pre-immune antibody (lane 1) and antibody G3117 (lane 2) at a concentration of 2 μg / mL were used to test antibody specificity using Western blotting. The SDS-PAGE electrophoresis process was as follows:

[0086] Electrophoresis: The amount of sample loaded in each group was determined based on the protein quantification results. A 10% precast gel was used and the upper gel was run at a constant voltage of 70 V for 30 min. The lower gel was then run at a constant voltage of 110 V for 60 min.

[0087] Membrane transfer: Polyvinylidene fluoride (PVDF) membrane was cut into a suitable size of rectangle and activated in methanol solution for 5 min. The membrane transfer system was assembled in order, and the membrane transfer clamp was clamped and placed in the membrane transfer tank. Fast membrane transfer buffer was added, and the membrane transfer condition was 400 mA for 30 min.

[0088] Blocking and antibody incubation: The PVDF membrane was soaked in Tris buffered saline Tween (TBST) and placed in the fast blocking solution. Blocking was performed at room temperature for 30 min. The PVDF membrane was placed in a self-sealing bag, cut according to the size of the target protein, and placed in the diluted primary antibody solution. Incubation was performed at 4°C overnight. The primary antibody was recovered, and the PVDF membrane was washed with TBST solution for 3 times, each for 5 min. Secondary antibody was added and incubated at room temperature for 1 h. The PVDF membrane was washed with TBST solution. The band was incubated in the developing solution for 2 min, developed and photographed, and analyzed by Image J software.

[0089] The detection results are shown in Figure 5 It can be seen that the antibody G3117 can specifically recognize and bind to the desquamative dermatitis virus MCP protein, indicating that the antibody has high specificity and can be used to detect desquamative dermatitis virus infection and for subsequent research and development of related drugs for treating desquamative dermatitis virus.

[0090] The above-described embodiments are only descriptions of the preferred modes of the present application and do not limit the scope of the present application. Without departing from the design spirit of the present application, various modifications and improvements to the technical solutions of the present application made by those skilled in the art shall fall within the protection scope determined by the claims of the present application.

Claims

1. A method for preparing polyclonal antibodies against MCP protein of scaly disease virus, characterized in that: The following steps are involved: Animals were immunized with the MCP protein of the desquamating disease virus, and serum was collected and separated; Extracting and purifying the serum to obtain the anti-squamous disease virus MCP protein polyclonal antibody; The amino acid sequence of the MCP protein of the desquamating disease virus is shown in SEQ ID NO.

2.

2. The preparation method according to claim 1, characterized in that The preparation method of the desquamating disease virus MCP protein comprises the following steps: The recombinant plasmid is constructed using the MCP gene of the desquamating disease virus; the nucleotide sequence of the MCP gene of the desquamating disease virus is shown in SEQ ID NO.1; Transforming the recombinant plasmid into a host bacterium to obtain a recombinant strain; The recombinant strain is fermented and cultured to induce protein expression, and then the protein is purified to obtain the desquamation virus MCP protein.

3. The preparation method according to claim 2, characterized in that The initial plasmid of the recombinant plasmid is pET-B2M plasmid.

4. The preparation method according to claim 2, characterized in that The host bacteria is Escherichia coli.

5. The preparation method according to claim 1, characterized in that The animal is a rabbit.

6. The preparation method according to claim 1, characterized in that The MCP protein of the desquamating disease virus is mixed with an immune adjuvant and then the animal is immunized.

7. A polyclonal antibody against the MCP protein of the desquamating disease virus prepared according to the preparation method according to any one of claims 1 to 6.

8. Use of the anti-scaling virus MCP protein polyclonal antibody according to claim 7 in the preparation of a product for detecting the descaling virus.

9. A product for detecting desquamation virus, characterized in that: The invention comprises the anti-squamous disease virus MCP protein polyclonal antibody according to claim 7.

10. Use of the anti-scaling virus MCP protein polyclonal antibody according to claim 7 in the preparation of anti-scaling virus drugs.

Images